Compositions, kits and related methods for the detection and/or monitoring of salmonella
10711295 ยท 2020-07-14
Assignee
Inventors
Cpc classification
C12Q2304/00
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
Provided are compositions, kits, and methods for the identification of Salmonella. In certain aspects and embodiments, the compositions, kits, and methods may provide improvements in relation to specificity, sensitivity, and speed of detection.
Claims
1. A detection oligonucleotide comprising a nucleotide sequence consisting essentially of the sequence of SEQ ID NO: 66, 67, 68, 69, or 70.
2. The detection oligonucleotide of claim 1, wherein the oligonucleotide is fluorescently labeled.
3. The detection oligonucleotide of claim 2, wherein the oligonucleotide comprises a quencher.
4. The detection oligonucleotide of claim 1, wherein the oligonucleotide is a molecular torch oligonucleotide.
5. A kit comprising a plurality of reagents for detecting a Salmonella target nucleic acid, wherein the plurality of reagents comprises the detection oligonucleotide of claim 1.
6. The kit of claim 5, wherein the detection oligonucleotide is fluorescently labeled.
7. The kit of claim 5, wherein the plurality of reagents further comprises one or more amplification oligonucleotides for amplifying the Salmonella target nucleic acid.
8. The kit of claim 7, wherein the Salmonella target nucleic acid is an amplicon that comprises a sequence corresponding to bases from about 164 to about 209 of SEQ ID NO: 150.
9. The kit of claim 7, wherein the one or more amplification oligonucleotides for amplifying the Salmonella target nucleic acid comprises a promoter oligonucleotide for isothermally amplifying the Salmonella target nucleic acid.
10. A nucleic acid complex comprising the detection oligonucleotide of claim 1 hybridized to a Salmonella target nucleic acid.
11. The nucleic acid complex of claim 10, wherein the detection oligonucleotide is fluorescently labeled.
12. A composition comprising the detection oligonucleotide of claim 1 and one or more amplification and/or capture oligonucleotides for amplifying and/or capturing a Salmonella target nucleic acid.
13. The composition of claim 12, wherein the detection oligonucleotide is fluorescently labeled.
14. The composition of claim 12, further comprising one or more amplification oligonucleotides for amplifying a Salmonella target nucleic acid.
15. The composition of claim 12, further comprising an RNA polymerase.
16. A method for detecting Salmonella in a sample, said method comprising a detecting step of detecting the presence or absence of a Salmonella target nucleic acid using the detection oligonucleotide of claim 1.
17. The method of claim 16, wherein the detection oligonucleotide is fluorescently labeled.
18. The method of claim 17, wherein the detection oligonucleotide further comprises a quencher.
19. The method of claim 16, wherein the method further comprises amplifying the Salmonella target nucleic acid using one or more amplification oligonucleotides.
20. The method of claim 16, wherein the Salmonella target nucleic acid is an amplicon that comprises a sequence corresponding to bases from about 164 to about 209 of SEQ ID NO: 150.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
DETAILED DESCRIPTION OF THE INVENTION
(3) In certain aspects and embodiments, the invention relates to compositions, methods and kits for the identification, detection, and/or quantitation of Salmonella, which may be present either alone or as a component, large or small, of a homogeneous or heterogeneous mixture of nucleic acids in a sample taken for testing, e.g., for diagnostic testing, for screening of blood products, for microbiological detection in bioprocesses, food, water, industrial or environmental samples, and for other purposes. Specific methods, compositions, and kits as disclosed herein provide improved sensitivity, specificity, or speed of detection in the amplification-based detection of Salmonella. Salmonella ribosomal RNA is very closely related to E. coli, Shigella sp., Citrobacter sp., Enterobacter sp and other potential enteric bacteria. Accordingly, in certain embodiments of the invention, the Salmonella assay identifies rRNA sequences common to nearly all species, subspecies and serovars of the Salmonella genus, and differentiates Salmonella from other enteric bacteria. A useful region for such differentiation is the 350 region of the 23S rRNA.
(4) As a result of extensive analyses of amplification oligonucleotides specific for Salmonella, the particular region of Salmonella, corresponding to the region of E. coli 23s rRNA reference sequence (accession no. AJ278710) from about 150-425 nucleotide bases (hereinafter referred to as the 350 region), has been identified as a preferred target for amplification-based detection of Salmonella. Accordingly, the invention relates to methods of detection of Salmonella in a sample of interest, amplification oligonucleotides, compositions, reactions mixtures, kits, and the like.
(5) The Salmonella genus assay detects ribosomal RNA sequences specific for known Salmonella species. It utilizes real-time TMA technology, where the target-specific sequence is amplified using reverse TMA and a fluorescent molecular torch is used to detect the amplified products as they are produced. Target detection is performed simultaneously with the amplification and detection of an internal control in order to confirm reliability of the result. The result of the assay consists of the classification of the sample as positive or negative for the presence or absence of Salmonella.
(6) In one embodiment, the sample is a biopharmaceutical process (bioprocess) stream where Salmonella is a known or suspected contaminant. A bioprocess, as used herein, refers generally to any process in which living cells or organisms, or components thereof, are present, either intended or unintended. For example, essentially any manufacturing or other process that employs one or more samples or sample streams, at least one of which contains living cells, organisms, or components thereof, or contains such cells, organisms or components as a result of unintended contamination, is considered a bioprocess. In many such processes it is desirable to have the ability to detect, identify and/or control the presence and/or sources of living cells, organisms or components thereof within a process. Using the methods disclosed herein, for example, the presence and/or sources of Salmonella in one or more bioprocess samples and/or streams may be monitored in a rapid and sensitive fashion.
Target Nucleic Acid/Target Sequence
(7) Target nucleic acids may be isolated from any number of sources based on the purpose of the amplification assay being carried out. Sources of target nucleic acids include, but are not limited to, clinical specimens, e.g., blood, urine, saliva, feces, semen, or spinal fluid, from criminal evidence, from environmental samples, e.g., water or soil samples, from food, from industrial samples, from cDNA libraries, or from total cellular RNA. If necessary, target nucleic acids are made available for interaction with various oligonucleotides. This may include, for example, cell lysis or cell permeabilization to release the target nucleic acid from cells, which then may be followed by one or more purification steps, such as a series of isolation and wash steps. See, e.g., Clark et al., Method for Extracting Nucleic Acids from a Wide Range of Organisms, U.S. Pat. No. 5,786,208, the contents of which are hereby incorporated by reference herein. This is particularly important where the sample may contain components that can interfere with the amplification reaction, such as, for example, heme present in a blood sample. See Ryder et al., Amplification of Nucleic Acids from Mononuclear Cells Using Iron Complexing and Other Agents, U.S. Pat. No. 5,639,599, the contents of which are hereby incorporated by reference herein. Methods to prepare target nucleic acids from various sources for amplification are well known to those of ordinary skill in the art. Target nucleic acids may be purified to some degree prior to the amplification reactions described herein, but in other cases, the sample is added to the amplification reaction without any further manipulations.
(8) As will be understood by those of ordinary skill in the art, unique sequences are judged from the testing environment. At least the sequences recognized by the detection probe should be unique in the environment being tested, but need not be unique within the universe of all possible sequences. Furthermore, even though the target sequence should contain a unique sequence for recognition by a detection probe, it is not always the case that the priming oligonucleotide and/or promoter oligonucleotide are recognizing unique sequences. In some embodiments, it may be desirable to choose a target sequence which is common to a family of related organisms. In other situations, a very highly specific target sequence, or a target sequence having at least a highly specific region recognized by the detection probe and amplification oligonucleotides, would be chosen so as to distinguish between closely related organisms, for example, between pathogenic and non-pathogenic E. coli. A target sequence may be of any practical length. A minimal target sequence includes the region which hybridizes to the priming oligonucleotide (or the complement thereof), the region which hybridizes to the hybridizing region of the promoter oligonucleotide (or the complement thereof), and a region used for detection, e.g., a region which hybridizes to a detection probe. The region which hybridizes with the detection probe may overlap with or be contained within the region which hybridizes with the priming oligonucleotide (or its complement) or the hybridizing region of the promoter oligonucleotide (or its complement). In addition to the minimal requirements, the optimal length of a target sequence depends on a number of considerations, for example, the amount of secondary structure, or self-hybridizing regions in the sequence. Typically, target sequences range from about 30 nucleotides in length to about 300 nucleotides in length. The optimal or preferred length may vary under different conditions which can be determined according to the methods described herein.
Nucleic Acid Identity
(9) In certain embodiments, a nucleic acid comprises a contiguous base region that is at least 70%; or 75%; or 80%, or 85% or 90%, or 95%; or 100% identical to a contiguous base region of a reference nucleic acid. For short nucleic acids, the degree of identity between a base region of a query nucleic acid and a base region of a reference nucleic acid can be determined by manual alignment. Identity is determined by comparing just the sequence of nitrogenous bases, irrespective of the sugar and backbone regions of the nucleic acids being compared. Thus, the query:reference base sequence alignment may be DNA:DNA, RNA:RNA, DNA:RNA, RNA:DNA, or any combinations or analogs thereof. Equivalent RNA and DNA base sequences can be compared by converting U's (in RNA) to T's (in DNA).
Oligonucleotides & Primers
(10) An oligonucleotide can be virtually any length, limited only by its specific function in the amplification reaction or in detecting an amplification product of the amplification reaction. However, in certain embodiments, preferred oligonucleotides will contain at least about 10; or 12; or 14; or 16; or 18; or 20; or 22; or 24; or 26; or 28; or 30; or 32; or 34; or 36; or 38; or 40; or 42; or 44; or 46; or 48; or 50; or 52; or 54; or 56 contiguous bases that are complementary to a region of the target nucleic acid sequence or its complementary strand. The contiguous bases are preferably at least about 80%, more preferably at least about 90%, and most preferably completely complementary to the target sequence to which the oligonucleotide binds. Certain preferred oligonucleotides are of lengths generally between about 10-100; or 12-75; or 14-50; or 15-40 bases long and optionally can include modified nucleotides.
(11) Oligonucleotides of a defined sequence and chemical structure may be produced by techniques known to those of ordinary skill in the art, such as by chemical or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules, e.g., bacterial or viral vectors. As intended by this disclosure, an oligonucleotide does not consist solely of wild-type chromosomal DNA or the in vivo transcription products thereof.
(12) Oligonucleotides may be modified in any way, as long as a given modification is compatible with the desired function of a given oligonucleotide. One of ordinary skill in the art can easily determine whether a given modification is suitable or desired for any given oligonucleotide. Modifications include base modifications, sugar modifications or backbone modifications. Base modifications include, but are not limited to the use of the following bases in addition to adenine, cytidine, guanosine, thymine and uracil: C-5 propyne, 2-amino adenine, 5-methyl cytidine, inosine, and dP and dK bases. The sugar groups of the nucleoside subunits may be ribose, deoxyribose and analogs thereof, including, for example, ribonucleosides having a 2-O-methyl substitution to the ribofuranosyl moiety. See Becker et al., U.S. Pat. No. 6,130,038. Other sugar modifications include, but are not limited to 2-amino, 2-fluoro, (L)-alpha-threofuranosyl, and pentopyranosyl modifications. The nucleoside subunits may by joined by linkages such as phosphodiester linkages, modified linkages or by non-nucleotide moieties which do not prevent hybridization of the oligonucleotide to its complementary target nucleic acid sequence. Modified linkages include those linkages in which a standard phosphodiester linkage is replaced with a different linkage, such as a phosphorothioate linkage or a methylphosphonate linkage. The nucleobase subunits may be joined, for example, by replacing the natural deoxyribose phosphate backbone of DNA with a pseudo peptide backbone, such as a 2-aminoethylglycine backbone which couples the nucleobase subunits by means of a carboxymethyl linker to the central secondary amine. DNA analogs having a pseudo peptide backbone are commonly referred to as peptide nucleic acids or PNA and are disclosed by Nielsen et al., Peptide Nucleic Acids, U.S. Pat. No. 5,539,082. Other linkage modifications include, but are not limited to, morpholino bonds.
(13) Non-limiting examples of oligonucleotides or oligos contemplated herein include nucleic acid analogs containing bicyclic and tricyclic nucleoside and nucleotide analogs (LNAs). See Imanishi et al., U.S. Pat. No. 6,268,490; and Wengel et al., U.S. Pat. No. 6,670,461.) Any nucleic acid analog is contemplated by the present invention provided the modified oligonucleotide can perform its intended function, e.g., hybridize to a target nucleic acid under stringent hybridization conditions or amplification conditions, or interact with a DNA or RNA polymerase, thereby initiating extension or transcription. In the case of detection probes, the modified oligonucleotides must also be capable of preferentially hybridizing to the target nucleic acid under stringent hybridization conditions.
(14) The design and sequence of oligonucleotides depend on their function as described below. Several variables to take into account include: length, melting temperature (Tm), specificity, complementarity with other oligonucleotides in the system, G/C content, polypyrimidine (T, C) or polypurine (A, G) stretches, and the 3-end sequence. Controlling for these and other variables is a standard and well known aspect of oligonucleotide design, and various computer programs are readily available to initially screen large numbers of potential oligonucleotides.
(15) The 3-terminus of an oligonucleotide (or other nucleic acid) can be blocked in a variety of ways using a blocking moiety, as described below. A blocked oligonucleotide is not efficiently extended by the addition of nucleotides to its 3-terminus, by a DNA- or RNA-dependent DNA polymerase, to produce a complementary strand of DNA. As such, a blocked oligonucleotide cannot be a primer.
Blocking Moiety
(16) A blocking moiety may be a small molecule, e.g., a phosphate or ammonium group, or it may be a modified nucleotide, e.g., a 32 dideoxynucleotide or 3 deoxyadenosine 5-triphosphate (cordycepin), or other modified nucleotide. Additional blocking moieties include, for example, the use of a nucleotide or a short nucleotide sequence having a 3-to-5 orientation, so that there is no free hydroxyl group at the 3-terminus, the use of a 3 alkyl group, a 3 non-nucleotide moiety (see, e.g., Arnold et al., Non-Nucleotide Linking Reagents for Nucleotide Probes, U.S. Pat. No. 6,031,091, the contents of which are hereby incorporated by reference herein), phosphorothioate, alkane-diol residues, peptide nucleic acid (PNA), nucleotide residues lacking a 3 hydroxyl group at the 3-terminus, or a nucleic acid binding protein. Preferably, the 3-blocking moiety comprises a nucleotide or a nucleotide sequence having a 3-to-5 orientation or a 3 non-nucleotide moiety, and not a 32-dideoxynucleotide or a 3 terminus having a free hydroxyl group. Additional methods to prepare 3-blocking oligonucleotides are well known to those of ordinary skill in the art.
Priming Oligonucleotide or Primer
(17) A priming oligonucleotide is extended by the addition of covalently bonded nucleotide bases to its 3-terminus, which bases are complementary to the template. The result is a primer extension product. Suitable and preferred priming oligonucleotides are described herein. Virtually all DNA polymerases (including reverse transcriptases) that are known require complexing of an oligonucleotide to a single-stranded template (priming) to initiate DNA synthesis, whereas RNA replication and transcription (copying of RNA from DNA) generally do not require a primer. By its very nature of being extended by a DNA polymerase, a priming oligonucleotide does not comprise a 3-blocking moiety.
Promoter Oligonucleotide/Promoter Sequence
(18) For binding, it was generally thought that such transcriptases required DNA which had been rendered double-stranded in the region comprising the promoter sequence via an extension reaction, however, it has been determined that efficient transcription of RNA can take place even under conditions where a double-stranded promoter is not formed through an extension reaction with the template nucleic acid. The template nucleic acid (the sequence to be transcribed) need not be double-stranded. Individual DNA-dependent RNA polymerases recognize a variety of different promoter sequences, which can vary markedly in their efficiency in promoting transcription. When an RNA polymerase binds to a promoter sequence to initiate transcription, that promoter sequence is not part of the sequence transcribed. Thus, the RNA transcripts produced thereby will not include that sequence.
Terminating Oligonucleotide
(19) A terminating oligonucleotide or blocker is designed to hybridize to the target nucleic acid at a position sufficient to achieve the desired 3-end for the nascent nucleic acid strand. The positioning of the terminating oligonucleotide is flexible depending upon its design. A terminating oligonucleotide may be modified or unmodified. In certain embodiments, terminating oligonucleotides are synthesized with at least one or more 2-O-methyl ribonucleotides. These modified nucleotides have demonstrated higher thermal stability of complementary duplexes. The 2-O-methyl ribonucleotides also function to increase the resistance of oligonucleotides to exonucleases, thereby increasing the half-life of the modified oligonucleotides. See, e.g., Majlessi et al. (1988) Nucleic Acids Res. 26, 2224-9, the contents of which are hereby incorporated by reference herein. Other modifications as described elsewhere herein may be utilized in addition to or in place of 2-O-methyl ribonucleotides. For example, a terminating oligonucleotide may comprise PNA or an LNA. See, e.g., Petersen et al. (2000) J. Mol. Recognit. 13, 44-53, the contents of which are hereby incorporated by reference herein. A terminating oligonucleotide typically includes a blocking moiety at its 3-terminus to prevent extension. A terminating oligonucleotide may also comprise a protein or peptide joined to the oligonucleotide so as to terminate further extension of a nascent nucleic acid chain by a polymerase. Suitable and preferred terminating oligonucleotides are described herein. It is noted that while a terminating oligonucleotide typically or necessarily includes a 3-blocking moiety, 3-blocked oligonucleotides are not necessarily terminating oligonucleotides. Other oligonucleotides as disclosed herein, e.g., promoter oligonucleotides and capping oligonucleotides are typically or necessarily 3-blocked as well.
Extender Oligonucleotide
(20) An extender oligonucleotide hybridizes to a DNA template adjacent to or near the 3-end of the first region of a promoter oligonucleotide. An extender oligonucleotide preferably hybridizes to a DNA template such that the 5-terminal base of the extender oligonucleotide is within 3, 2 or 1 bases of the 3-terminal base of a promoter oligonucleotide. Most preferably, the 5-terminal base of an extender oligonucleotide is adjacent to the 3-terminal base of a promoter oligonucleotide when the extender oligonucleotide and the promoter oligonucleotide are hybridized to a DNA template. To prevent extension of an extender oligonucleotide, a 3-terminal blocking moiety is typically included.
Probe
(21) As would be understood by someone having ordinary skill in the art, a probe comprises an isolated nucleic acid molecule, or an analog thereof, in a form not found in nature without human intervention (e.g., recombined with foreign nucleic acid, isolated, or purified to some extent). Probes may have additional nucleosides or nucleobases outside of the targeted region so long as such nucleosides or nucleobases do not substantially affect hybridization under stringent hybridization conditions and, in the case of detection probes, do not prevent preferential hybridization to the target nucleic acid. A non-complementary sequence may also be included, such as a target capture sequence (generally a homopolymer tract, such as a poly-A, poly-T or poly-U tail), promoter sequence, a binding site for RNA transcription, a restriction endonuclease recognition site, or may contain sequences which will confer a desired secondary or tertiary structure, such as a catalytic active site or a hairpin structure on the probe, on the target nucleic acid, or both.
(22) The probes preferably include at least one detectable label. The label may be any suitable labeling substance, including but not limited to a radioisotope, an enzyme, an enzyme cofactor, an enzyme substrate, a dye, a hapten, a chemiluminescent molecule, a fluorescent molecule, a phosphorescent molecule, an electrochemiluminescent molecule, a chromophore, a base sequence region that is unable to stably hybridize to the target nucleic acid under the stated conditions, and mixtures of these. In one particularly preferred embodiment, the label is an acridinium ester. Certain probes as disclosed herein do not include a label. For example, non-labeled capture probes may be used to enrich for target sequences or replicates thereof, which may then be detected by a second detection probe. See, e.g., Weisburg et al., Two-Step Hybridization and Capture of a Polynucleotide, U.S. Pat. No. 6,534,273, which is hereby incorporated by reference herein. While detection probes are typically labeled, certain detection technologies do not require that the probe be labeled. See, e.g., Nygren et al., Devices and Methods for Optical Detection of Nucleic Acid Hybridization, U.S. Pat. No. 6,060,237.
(23) Probes of a defined sequence may be produced by techniques known to those of ordinary skill in the art, such as by chemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules. Preferably probes are 10 to 100 nucleotides in length, more preferably 12 to 50 bases in length, and even more preferably 18 to 35 bases in length.
Hybridize/Hybridization
(24) Nucleic acid hybridization is the process by which two nucleic acid strands having completely or partially complementary nucleotide sequences come together under predetermined reaction conditions to form a stable, double-stranded hybrid. Either nucleic acid strand may be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA) or analogs thereof. Thus, hybridization can involve RNA:RNA hybrids, DNA:DNA hybrids, RNA:DNA hybrids, or analogs thereof The two constituent strands of this double-stranded structure, sometimes called a hybrid, are held together by hydrogen bonds. Although these hydrogen bonds most commonly form between nucleotides containing the bases adenine and thymine or uracil (A and T or U) or cytosine and guanine (C and G) on single nucleic acid strands, base pairing can also form between bases which are not members of these canonical pairs. Non-canonical base pairing is well-known in the art. (See, e.g., Roger L. P. Adams et al., The Biochemistry Of The Nucleic Acids (11.sup.th ed. 1992).)
(25) Stringent hybridization assay conditions refer to conditions wherein a specific detection probe is able to hybridize with target nucleic acids over other nucleic acids present in the test sample. It will be appreciated that these conditions may vary depending upon factors including the GC content and length of the probe, the hybridization temperature, the composition of the hybridization reagent or solution, and the degree of hybridization specificity sought. Specific stringent hybridization conditions are provided in the disclosure below.
Nucleic Acid Amplification
(26) Many well-known methods of nucleic acid amplification require thermocycling to alternately denature double-stranded nucleic acids and hybridize primers; however, other well-known methods of nucleic acid amplification are isothermal. The polymerase chain reaction (U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; 4,965,188), commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of the target sequence. In a variation called RT-PCR, reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from mRNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA. The ligase chain reaction (Weiss, R. 1991, Science 254: 1292), commonly referred to as LCR, uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid. The DNA oligonucleotides are covalently linked by a DNA ligase in repeated cycles of thermal denaturation, hybridization and ligation to produce a detectable double-stranded ligated oligonucleotide product. Another method is strand displacement amplification (Walker, G. et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; U.S. Pat. Nos. 5,270,184 and 5,455,166), commonly referred to as SDA, which uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTPaS to produce a duplex hemiphosphorothioated primer extension product, endonuclease-mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3 end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product. Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (European Pat. No. 0 684 315). Other amplification methods include: nucleic acid sequence based amplification (U.S. Pat. No. 5,130,238), commonly referred to as NASBA; one that uses an RNA replicase to amplify the probe molecule itself (Lizardi, P. et al., 1988, BioTechnol. 6: 1197-1202), commonly referred to as Q- replicase; a transcription-based amplification method (Kwoh, D. et al., 1989, Proc. Natl. Acad. Sci. USA 86:1173-1177); self-sustained sequence replication (Guatelli, J. et al., 1990, Proc. Natl. Acad. Sci. USA 87: 1874-1878); and, transcription-mediated amplification (U.S. Pat. Nos. 5,480,784 and 5,399,491), commonly referred to as TMA. For further discussion of known amplification methods see Persing, David H., 1993, In Vitro Nucleic Acid Amplification Techniques in Diagnostic Medical Microbiology: Principles and Applications (Persing et al., Eds.), pp. 51-87 (American Society for Microbiology, Washington, D.C.).
(27) In a preferred embodiment, Salmonella is detected by a transcription-based amplification technique. One preferred transcription-based amplification system is transcription-mediated amplification (TMA), which employs an RNA polymerase to produce multiple RNA transcripts of a target region. Exemplary TMA amplification methods are described in U.S. Pat. Nos. 5,480,784, 5,399,491, 7,374,885, and references cited therein, the contents of which are incorporated herein by reference in their entireties. TMA uses a promoter-primer that hybridizes to a target nucleic acid in the presence of a reverse transcriptase and an RNA polymerase to form a double-stranded promoter from which the RNA polymerase produces RNA transcripts. These transcripts can become templates for further rounds of TMA in the presence of a second primer capable of hybridizing to the RNA transcripts. Unlike PCR, LCR or other methods that require heat denaturation, TMA is an isothermal method that uses an RNase H activity to digest the RNA strand of an RNA:DNA hybrid, thereby making the DNA strand available for hybridization with a primer or promoter-primer. Generally, the RNase H activity associated with the reverse transcriptase provided for amplification is used.
(28) In one version of the TMA method, one amplification primer is an oligonucleotide promoter-primer that comprises a promoter sequence which becomes functional when double-stranded, located 5 of a target-binding sequence, which is capable of hybridizing to a binding site of a target RNA at a location 3 to the sequence to be amplified. A promoter-primer may be referred to as a T7-primer when it is specific for T7 RNA polymerase recognition. Under certain circumstances, the 3 end of a promoter-primer, or a subpopulation of such promoter-primers, may be modified to block or reduce promoter-primer extension. From an unmodified promoter-primer, reverse transcriptase creates a cDNA copy of the target RNA, while RNase H activity degrades the target RNA. A second amplification primer then binds to the cDNA. This primer may be referred to as a non-T7 primer to distinguish it from a T7-primer. From this second amplification primer, reverse transcriptase creates another DNA strand, resulting in a double-stranded DNA with a functional promoter at one end. When double-stranded, the promoter sequence is capable of binding an RNA polymerase to begin transcription of the target sequence to which the promoter-primer is hybridized. An RNA polymerase uses this promoter sequence to produce multiple RNA transcripts (i.e., amplicons), generally about 100 to 1,000 copies. Each newly-synthesized amplicon can anneal with the second amplification primer. Reverse transcriptase can then create a DNA copy, while the RNase H activity degrades the RNA of this RNA:DNA duplex. The promoter-primer can then bind to the newly synthesized DNA, allowing the reverse transcriptase to create a double-stranded DNA, from which the RNA polymerase produces multiple amplicons. Thus, a billion-fold isothermic amplification can be achieved using two amplification primers.
(29) Another version of TMA uses one primer and one or more additional amplification oligomers to amplify nucleic acids in vitro, making transcripts (amplicons) that indicate the presence of the target sequence in a sample (described in Becker et al., U.S. Pat. No. 7,374,885, the details of which are hereby incorporated by reference herein). Briefly, the single-primer TMA method uses a primer (or priming oligomer), a modified promoter oligomer (or promoter-provider) that is modified to prevent the initiation of DNA synthesis from its 3 end (e.g., by including a 3-blocking moiety) and, optionally, a binding molecule (e.g., a 3-blocked extender oligomer) to terminate elongation of a cDNA from the target strand. As referred to herein, a T7 provider is a blocked promoter-provider oligonucleotide that provides an oligonucleotide sequence that is recognized by T7 RNA polymerase. This method synthesizes multiple copies of a target sequence and includes the steps of treating a target RNA that contains a target sequence with a priming oligomer and a binding molecule, where the primer hybridizes to the 3 end of the target strand. RT initiates primer extension from the 3 end of the primer to produce a cDNA which is in a duplex with the target strand (e.g., RNA:cDNA). When a binding molecule, such as a 3 blocked extender oligomer, is used in the reaction, it binds to the target nucleic acid adjacent near the 5 end of the target sequence. That is, the binding molecule binds to the target strand next to the 5 end of the target sequence to be amplified. When the primer is extended by DNA polymerase activity of RT to produce cDNA, the 3 end of the cDNA is determined by the position of the binding molecule because polymerization stops when the primer extension product reaches the binding molecule bound to the target strand. Thus, the 3 end of the cDNA is complementary to the 5 end of the target sequence. The RNA:cDNA duplex is separated when RNase (e.g., RNase H of RT) degrades the RNA strand, although those skilled in the art will appreciate that any form of strand separation may be used. Then, the promoter-provider oligomer hybridizes to the cDNA near the 3 end of the cDNA strand. The promoter-provider oligomer includes a 5 promoter sequence for an RNA polymerase and a 3 region complementary to a sequence in the 3 region of the cDNA. The promoter-provider oligomer also has a modified 3 end that includes a blocking moiety that prevents initiation of DNA synthesis from the 3 end of the promoter-provider oligomer. In the promoter-provider: cDNA duplex, the 3-end of the cDNA is extended by DNA polymerase activity of RT using the promoter oligomer as a template to add a promoter sequence to the cDNA and create a functional double-stranded promoter. An RNA polymerase specific for the promoter sequence then binds to the functional promoter and transcribes multiple RNA transcripts complementary to the cDNA and substantially identical to the target region sequence that was amplified from the initial target strand. The resulting amplified RNA can then cycle through the process again by binding the primer and serving as a template for further cDNA production, ultimately producing many amplicons from the initial target nucleic acid present in the sample. Some embodiments of the single-primer transcription-associated amplification method do not include the binding molecule and, therefore, the cDNA product made from the primer has an indeterminate 3 end, but the amplification steps proceed substantially as described above for all other steps.
(30) Suitable amplification conditions can be readily determined by a skilled artisan in view of the present disclosure. Amplification conditions as disclosed herein refer to conditions which permit nucleic acid amplification. Amplification conditions may, in some embodiments, be less stringent than stringent hybridization conditions as described herein. Oligonucleotides used in the amplification reactions as disclosed herein may be specific for and hybridize to their intended targets under amplification conditions, but in certain embodiments may or may not hybridize under more stringent hybridization conditions. On the other hand, detection probes generally hybridize under stringent hybridization conditions. While the Examples section infra provides preferred amplification conditions for amplifying target nucleic acid sequences, other acceptable conditions to carry out nucleic acid amplifications could be easily ascertained by someone having ordinary skill in the art depending on the particular method of amplification employed.
(31) The amplification methods as disclosed herein, in certain embodiments, also preferably employ the use of one or more other types of oligonucleotides that are effective for improving the sensitivity, selectivity, efficiency, etc., of the amplification reaction. These may include, for example, terminating oligonucleotides, extender or helper oligonucleotides, and the like.
Target Capture
(32) In certain embodiments, it may be preferred to purify or enrich a target nucleic acid from a sample prior to amplification, for example using a target capture approach. Target capture (TC) refers generally to capturing a target polynucleotide onto a solid support, such as magnetically attractable particles, wherein the solid support retains the target polynucleotide during one or more washing steps of the target polynucleotide purification procedure. In this way, the target polynucleotide is substantially purified prior to a subsequent nucleic acid amplification step. Numerous target capture methods are known and suitable for use in conjunction with the methods described herein.
(33) Any support may be used, e.g., matrices or particles free in solution, which may be made of any of a variety of materials, e.g., nylon, nitrocellulose, glass, polyacrylate, mixed polymers, polystyrene, silane polypropylene, or metal. Illustrative examples use a support that is magnetically attractable particles, e.g., monodisperse paramagnetic beads (uniform size.+0.5%) to which an immobilized probe is joined directly (e.g., via covalent linkage, chelation, or ionic interaction) or indirectly (e.g., via a linker), where the joining is stable during nucleic acid hybridization conditions.
(34) For example, one illustrative approach, as described in U.S. Patent Application Publication No 20060068417, uses at least one capture probe oligonucleotide that contains a target-complementary region and a member of a specific binding pair that attaches the target nucleic acid to an immobilized probe on a capture support, thus forming a capture hybrid that is separated from other sample components before the target nucleic acid is released from the capture support.
(35) In another illustrative method, Weisburg et al., in U.S. Pat. No. 6,110,678, describe a method for capturing a target polynucleotide in a sample onto a solid support, such as magnetically attractable particles, with an attached immobilized probe by using a capture probe and two different hybridization conditions, which preferably differ in temperature only. The two hybridization conditions control the order of hybridization, where the first hybridization conditions allow hybridization of the capture probe to the target polynucleotide, and the second hybridization conditions allow hybridization of the capture probe to the immobilized probe. The method may be used to detect the presence of a target polynucleotide in a sample by detecting the captured target polynucleotide or amplified target polynucleotide.
(36) Another illustrative target capture technique (U.S. Pat. No. 4,486,539) involves a hybridization sandwich technique for capturing and for detecting the presence of a target polynucleotide. The technique involves the capture of the target polynucleotide by a probe bound to a solid support and hybridization of a detection probe to the captured target polynucleotide. Detection probes not hybridized to the target polynucleotide are readily washed away from the solid support. Thus, remaining label is associated with the target polynucleotide initially present in the sample.
(37) Another illustrative target capture technique (U.S. Pat. No. 4,751,177) involves a method that uses a mediator polynucleotide that hybridizes to both a target polynucleotide and to a polynucleotide fixed on a solid support. The mediator polynucleotide joins the target polynucleotide to the solid support to produce a bound target. A labeled probe can be hybridized to the bound target and unbound labeled pro can be washed away from the solid support.
(38) Yet another illustrative target capture technique is described in U.S. Pat. Nos. 4,894,324 and 5,288,609, which describe a method for detecting a target polynucleotide. The method utilizes two single-stranded polynucleotide segments complementary to the same or opposite strands of the target and results in the formation of a double hybrid with the target polynucleotide. In one embodiment, the hybrid is captured onto a support.
(39) In another illustrative target capture technique, EP Pat. Pub. No. 0 370 694, methods and kits for detecting nucleic acids use oligonucleotide primers labeled with specific binding partners to immobilize primers and primer extension products. The label specifically complexes with its receptor which is bound to a solid support.
(40) The above capture techniques are illustrative only, and not limiting. Indeed, essentially any technique available to the skilled artisan may be used provided it is effective for purifying a target nucleic acid sequence of interest prior to amplification.
Nucleic Acid Detection
(41) Essentially any labeling and/or detection system that can be used for monitoring specific nucleic acid hybridization can be used in conjunction to detect Salmonella amplicons. Many such systems are known and available to the skilled artisan, illustrative examples of which are briefly discussed below.
(42) Detection systems typically employ a detection oligonucleotide of one type or another in order to facilitate detection of the target nucleic acid of interest. Detection may either be direct (i.e., probe hybridized directly to the target) or indirect (i.e., a probe hybridized to an intermediate structure that links the probe to the target). A probe's target sequence generally refers to the specific sequence within a larger sequence which the probe hybridizes specifically. A detection probe may include target-specific sequences and other sequences or structures that contribute to the probe's three-dimensional structure, depending on whether the target sequence is present (e.g., U.S. Pat. Nos. 5,118,801, 5,312,728, 6,835,542, and 6,849,412).
(43) Any of a number of well known labeling systems may be used to facilitate detection. Direct joining may use covalent bonds or non-covalent interactions (e.g., hydrogen bonding, hydrophobic or ionic interactions, and chelate or coordination complex formation) whereas indirect joining may use a bridging moiety or linker (e.g., via an antibody or additional oligonucleotide(s), which amplify a detectable signal. Any detectable moiety may be used, e.g., radionuclide, ligand such as biotin or avidin, enzyme, enzyme substrate, reactive group, chromophore such as a dye or particle (e.g., latex or metal bead) that imparts a detectable color, luminescent compound (e.g. bioluminescent, phosphorescent or chemiluminescent compound), and fluorescent compound. Preferred embodiments include a homogeneous detectable label that is detectable in a homogeneous system in which bound labeled probe in a mixture exhibits a detectable change compared to unbound labeled probe, which allows the label to be detected without physically removing hybridized from unhybridized labeled probe (e.g., U.S. Pat. Nos. 6,004,745, 5,656,207 and 5,658,737). Preferred homogeneous detectable labels include chemiluminescent compounds, more preferably acridinium ester (AE) compounds, such as standard AE or AE derivatives which are well known (U.S. Pat. Nos. 5,656,207, 5,658,737, and 5,948,899). Methods of synthesizing labels, attaching labels to nucleic acid, and detecting signals from labels are well known (e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) at Chapter. 10, and U.S. Pat. Nos. 6,414,152, 5,185,439, 5,658,737, 5,656,207, 5,547,842, 5,639,604, 4,581,333, and 5,731,148). Preferred methods of linking an AE compound to a nucleic acid are known (e.g., U.S. Pat. No. 5,585,481 and U.S. Pat. No. 5,639,604, see column 10, line 6 to column 11, line 3, and Example 8). Preferred AE labeling positions are a probe's central region and near a region of A/T base pairs, at a probe's 3 or 5 terminus, or at or near a mismatch site with a known sequence that is the probe should not detect compared to the desired target sequence.
(44) In a preferred embodiment, oligonucleotides exhibiting at least some degree of self-complementarity are desirable to facilitate detection of probe:target duplexes in a test sample without first requiring the removal of unhybridized probe prior to detection. By way of example, when exposed to denaturing conditions, the two complementary regions of a molecular torch, which may be fully or partially complementary, melt, leaving the target binding domain available for hybridization to a target sequence when the predetermined hybridization assay conditions are restored. Molecular torches are designed so that the target binding domain favors hybridization to the target sequence over the target closing domain. The target binding domain and the target closing domain of a molecular torch include interacting labels (e.g., a fluorescent/quencher pair) positioned so that a different signal is produced when the molecular torch is self-hybridized as opposed to when the molecular torch is hybridized to a target nucleic acid, thereby permitting detection of probe:target duplexes in a test sample in the presence of unhybridized probe having a viable label associated therewith. Molecular torches are fully described in U.S. Pat. No. 6,361,945, the disclosure of which is hereby incorporated by reference herein.
(45) Another example of a self-complementary hybridization assay probe that may be used is a structure commonly referred to as a molecular beacon. Molecular beacons comprise nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) that holds the probe in a closed conformation in the absence of a target nucleic acid sequence, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the molecular beacon target complementary sequence to the target nucleic acid separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are fully described in U.S. Pat. No. 5,925,517, the disclosure of which is hereby incorporated by reference herein. Molecular beacons useful for detecting specific nucleic acid sequences may be created by appending to either end of one of the probe sequences disclosed herein, a first nucleic acid arm comprising a fluorophore and a second nucleic acid arm comprising a quencher moiety. In this configuration, Salmonella-specific probe sequences may serve as the target-complementary loop portion of the resulting molecular beacon.
(46) Molecular beacons are preferably labeled with an interactive pair of detectable labels. Preferred detectable labels interact with each other by FRET or non-FRET energy transfer mechanisms. Fluorescence resonance energy transfer (FRET) involves the radiationless transmission of energy quanta from the site of absorption to the site of its utilization in the molecule or system of molecules by resonance interaction between chromophores, over distances considerably greater than interatomic distances, without conversion to thermal energy, and without the donor and acceptor coming into kinetic collision. The donor is the moiety that initially absorbs the energy, and the acceptor is the moiety to which the energy is subsequently transferred. In addition to FRET, there are at least three other non-FRET energy transfer processes by which excitation energy can be transferred from a donor to an acceptor molecule.
(47) When two labels are held sufficiently close such that energy emitted by one label can be received or absorbed by the second label, whether by a FRET or non-FRET mechanism, the two labels are said to be in an energy transfer relationship. This is the case, for example, when a molecular beacon is maintained in the closed state by formation of a stem duplex and fluorescent emission from a fluorophore attached to one arm of the molecular beacon is quenched by a quencher moiety on the other arm.
(48) Illustrative label moieties for the molecular beacons include a fluorophore and a second moiety having fluorescence quenching properties (i.e., a quencher). In this embodiment, the characteristic signal is likely fluorescence of a particular wavelength, but alternatively could be a visible light signal. When fluorescence is involved, changes in emission are preferably due to FRET, or to radiative energy transfer or non-FRET modes. When a molecular beacon having a pair of interactive labels in the closed state is stimulated by an appropriate frequency of light, a fluorescent signal is generated at a first level, which may be very low. When this same molecular beacon is in the open state and is stimulated by an appropriate frequency of light, the fluorophore and the quencher moieties are sufficiently separated from each other such that energy transfer between them is substantially precluded. Under that condition, the quencher moiety is unable to quench the fluorescence from the fluorophore moiety. If the fluorophore is stimulated by light energy of an appropriate wavelength, a fluorescent signal of a second level, higher than the first level, will be generated. The difference between the two levels of fluorescence is detectable and measurable. Using fluorophore and quencher moieties in this manner, the molecular beacon is only on in the open conformation and indicates that the probe is bound to the target by emanating an easily detectable signal. The conformational state of the probe alters the signal generated from the probe by regulating the interaction between the label moieties.
(49) Examples of donor/acceptor label pairs that may be used, making no attempt to distinguish FRET from non-FRET pairs, include fluorescein/tetramethylrhodamine, IAEDANS/fluorescein, EDANS/DABCYL, coumarin/DABCYL, fluorescein/fluorescein, BODIPY FL/BODIPY FL, fluorescein/DABCYL, lucifer yellow/DABCYL, BODIPY/DABCYL, eosine/DABCYL, erythrosine/DABCYL, tetramethylrhodamine/DABCYL, Texas Red/DABCYL, CY5/BH1, CY5/BH2, CY3/BH1, CY3/BH2, and fluorescein/QSY7 dye. Those having an ordinary level of skill in the art will understand that when donor and acceptor dyes are different, energy transfer can be detected by the appearance of sensitized fluorescence of the acceptor or by quenching of donor fluorescence. When the donor and acceptor species are the same, energy can be detected by the resulting fluorescence depolarization. Non-fluorescent acceptors such as DABCYL and the QSY 7 dyes advantageously eliminate the potential problem of background fluorescence resulting from direct (i.e., non-sensitized) acceptor excitation. Preferred fluorophore moieties that can be used as one member of a donor-acceptor pair include fluorescein, ROX, and the CY dyes (such as CY5). Highly preferred quencher moieties that can be used as another member of a donor-acceptor pair include DABCYL and the Black Hole Quencher moieties, which are available from Biosearch Technologies, Inc. (Novato, Calif.).
(50) Synthetic techniques and methods of attaching labels to nucleic acids and detecting labels are well known in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), Chapter 10; Nelson et al., U.S. Pat. No. 5,658,737; Woodhead et al., U.S. Pat. No. 5,656,207; Hogan et al., U.S. Pat. No. 5,547,842; Arnold et al., U.S. Pat. No. 5,185,439 and 6,004,745; Kourilsky et al., U.S. Pat. No. 4,581,333; and, Becker et al., U.S. Pat. No. 5,731,148).
Preferred Salmonella Oligonucleotides and Oligonucleotide Sets
(51) As described herein, preferred sites for amplifying and detecting Salmonella nucleic acids as disclosed herein have been found to reside in the 350 region of Salmonella 23S rRNA. Moreover, particularly preferred oligonucleotides and oligonucleotide sets within this region have been identified for amplifying Salmonella 23S with improved sensitivity, selectivity and specificity. It will be understood that the oligonucleotides disclosed herein are capable of hybridizing to a Salmonella target sequence with high specificity and, as a result, are capable of participating in a nucleic acid amplification reaction that can be used to detect the presence and/or levels of Salmonella in a sample and distinguish it from the presence of other enteric bacteria.
(52) For example, in one embodiment, the amplification oligonucleotides comprise a first oligonucleotide and a second oligonucleotide, wherein the first and second oligonucleotides target the 350 region of the Salmonella 23s rRNA with a high degree of specificity. Of course, it will be understood, when discussing the amplification oligonucleotides disclosed herein that the first and second oligonucleotides used in an amplification reaction have specificity for opposite strands of the target nucleic acid sequence to be amplified.
(53) The amplification oligonucleotides disclosed herein are particularly effective for amplifying a target nucleic acid sequence of Salmonella in a transcription-based amplification reaction, preferably a real-time transcription-mediated amplification (TMA) reaction.
(54) It will be understood that in addition to the particular T7 provider oligonucleotides and primer oligonucleotides used in the amplification reaction, additional oligonucleotides will also generally be employed in conjunction with the amplification reaction. For example, in certain embodiments, the amplification reactions will also employ the use of one or more of a detection oligonucleotide (e.g., a torch oligonucleotide), and a blocker oligonucleotide.
(55) Table 1 presents specific examples of T7 Provider oligonucleotides, Primer oligonucleotides, and other ancillary oligonucleotides (e.g., Blocker, Torch, and Target Capture oligonucleotides) that have been identified by the invention.
(56) TABLE-US-00001 TABLE1 ExamplesofPreferredOligonucleotides SEQID Use NO: Sequence(5-3) T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:1 ATCAGCTTGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:2 AGTGGAAGCGTCTGGAAAGGCGCG-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:3 GTTAGTGGAAGCGTCTGGAAAGGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:4 TAGTGGAAGCGTCTGGAAAGGCGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:5 GGAAGCGTCTGGAAAGGCGCGCGA-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:6 CCAGAGCCTGAATCAGCTTGTGTG-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:7 CGTGTGTGTTAGTGGAAGCGTCTGGAA-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:8 CGTGTGTGTTAGTGGAAGCGTCTGGA-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:9 CGTGTGTGTTAGTGGAAGCGTCTGG-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:10 CCACAAATCAGCTTGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:11 CCACAACGGTTTATCAGCTTGTGTGTTAGTGG AAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:12 ATCAGCATGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:13 CCACAACGGTTTATCAGCATGTGTGTTAGTGG AAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:14 ATCAGCGTGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:15 ATCAGCTGGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:16 CCACAACGGTTTATCAGCTGGTGTGTTAGTGG AAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:17 ATCAGCAGGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:18 CCACAACGGTTTATCAGCAGGTGTGTTAGTGG AAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:19 ATCAGCTTGTGTGTTAGTGGAAGCG-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:20 ATCAGCTTGTGTGTTAGTGGAAGCGT-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:21 ATCAGCTTGTGTGTTAGTGGAAGCGTC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:22 ATCAGCTTGTGTGTTAGTGGAAGCGTCTG-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:23 ATCAGCTTGTGTGTTAGTGGAAGCGTCTG G-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:24 ATCAGCTTGTGTGTTAGTGGAAGCGTCTG GA-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:25 ATCAGCTTGTGTGTTAGTGGAAGCGTCTGG AA-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:26 ATCAGCTTGTGTGTTAGTGGAAGCGTCT-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:27 ATCAGCACGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:28 ATCAGCATGCGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:29 ATCAGCATGTGCGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:30 ATCAGCATGTGTGCTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:31 ATCAGCATGTGTGTTAGCGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:32 ATCAGCAAGTGTGTTAGTGGAAGC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:33 CCACAAATCAGCTTGTGTGTTAGTGGAAGC GTCT-X T7 SEQID AATTTAATACGACTCACTATAGGGAGA- Provider NO:34 CCACAACGGTTTATCAGCTTGTGTGTTAGT GGAAGCGTCT-X Primer SEQID TCACAGCACATGCGC NO:35 Primer SEQID CTCACAGCACATGCGC NO:36 Primer SEQID GCTCACAGCACATGCGC NO:37 Primer SEQID AGCTCACAGCACATGCGC NO:38 Primer SEQID AGCTCACAGCACATcCGC NO:39 Primer SEQID CGAGCTCACAGCACATGCGC NO:40 Primer SEQID cgagCTCACAGCACATGCGC NO:41 Primer SEQID cgagCTCACAGCACATCCGC NO:42 Primer SEQID ATCGAGCTCACAGCACATGCGC NO:43 Primer SEQID aucgAGCTCACAGCACATGCGC NO:44 Primer SEQID aucgAGCTCACAGCACATCCGC NO:45 Primer SEQID acucATCGAGCTCACAGCACATGCGCT NO:46 Primer SEQID CGAGCTCACAGCACATCCGC NO:47 Primer SEQID ATCGAGCTCACAGCACATCCGC NO:48 Primer SEQID AGCTCACAGCAGATCCGC NO:49 Primer SEQID AGCTCACAGCACCTCCGC NO:50 Primer SEQID AGCTCACAGCAGCTCCGC NO:51 Primer SEQID GCTCACAGCACATGCGCTTTTGTGTACG NO:52 Primer SEQID CTCATCGAGCTCACAGCACATGCGCTTTTGTG NO:53 Primer SEQID CCCTACTCATCGAGCTCACAGCAC NO:54 Primer SEQID GGATACCACGTGTCCCGCCCTACTC NO:55 Primer SEQID CGAGCTCACAGCACATGCGCTTTTGTGTACG NO:56 Primer SEQID AGCTCACAGCACATGCCC NO:57 Primer SEQID CGAGCTCACAGCACACGCGCTTTTGTGTACG NO:58 Blocker SEQID cugauucaggcucugggcucc-X NO:59 Blocker SEQID ccacuaacacacacgcugau-X NO:60 Blocker SEQID cuaacacacacgcugauucagg-X NO:61 Blocker SEQID cacuaacacacacgcugauucagg-X NO:62 Blocker SEQID cuuccacuaacacacacgcu NO:63 Blocker SEQID ucugggcuccuccccguucg NO:64 Blocker SEQID acacgcugauucaggcucugg-X NO:65 Torch SEQID ggcugucacccuguau9cagcc NO:66 Torch SEQID cgcgc9ugucacccuguaucgcgcg NO:67 Torch SEQID cacccuguaucgcgc9gggug NO:68 Torch SEQID cacccuguaucgcgcgccuuuc9gggug NO:69 Torch SEQID cccc9gcuuuuguguacgggg NO:70 Target SEQID ccgguucgccucauuaacc- Capture NO:71 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target SEQID ccucgggguacuuagauguuuc- Capture NO:72 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target SEQID ggaaucucgguugauuucuuuucc- Capture NO:73 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target SEQID ccguucgcucgccgcuacug- Capture NO:74 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target SEQID cugauucaggcucugggcucc- Capture NO:75 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target SEQID cagacaggataccacgtgtcc- Capture NO:76 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target SEQID cccatattcagacaggatacc- Capture NO:77 TTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Lower case 2-O--methyl RNA X is a blocking moiety (e.g., reverse(3-5) C blocked) 9 is a non-nucleotide (e.g.,triethylene glycol) linker joining region, and 5-fluorescein (F) fluorophore and 3-dabsyl (D) quencher moieties were attached to the torch oligonucleotides
(57) In addition, Table 2 identifies two particularly preferred oligonucleotide sets for use in the compositions, kits and methods as disclosed herein.
(58) TABLE-US-00002 TABLE 2 Example of Two Preferred Oligonucleotide Sets Oligonucleotide Set Description Oligonucleotide Set #1 T7 Provider SEQ ID NO: 17 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 50 Torch SEQ ID NO: 66 Set #2 T7 Provider SEQ ID NO: 26 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 49 Torch SEQ ID NO: 66
(59) While specifically preferred amplification oligonucleotides derived from the 350 region have been identified, which result in superior assay performance, it will be recognized that other oligonucleotides derived from the 350 region and having insubstantial modifications from those specifically described herein may also be used, provided the same or similar performance objectives are achieved. For example, oligonucleotides derived from the 350 region and useful in the amplification reactions as disclosed herein can have different lengths from those identified herein, provided it does not substantially affect amplification and/or detection procedures. These and other routine and insubstantial modifications to the preferred oligonucleotides can be carried out using conventional techniques, and to the extent such modifications maintain one or more advantages provided herein they are considered within the spirit and scope of the invention.
(60) The general principles as disclosed herein may be more fully appreciated by reference to the following non-limiting Examples.
EXAMPLES
(61) Examples are provided below illustrating certain aspects and embodiments. The examples below are believed to accurately reflect the details of experiments actually performed, however, it is possible that some minor discrepancies may exist between the work actually performed and the experimental details set forth below which do not affect the conclusions of these experiments or the ability of skilled artisans to practice them. Skilled artisans will appreciate that these examples are not intended to limit the invention to the specific embodiments described therein. Additionally, those skilled in the art, using the techniques, materials and methods described herein, could easily devise and optimize alternative amplification systems for carrying out these and related methods while still being within the spirit and scope of the present invention.
(62) Unless otherwise indicated, oligonucleotides and modified oligonucleotides in the following examples were synthesized using standard phosphoramidite chemistry, various methods of which are well known in the art. See e.g., Carruthers, et al., 154 Methods in Enzymology, 287 (1987), the contents of which are hereby incorporated by reference herein. Unless otherwise stated herein, modified nucleotides were 2-O-methyl ribonucleotides, which were used in the synthesis as their phosphoramidite analogs. For blocked oligonucleotides used in single-primer amplification (Becker et al., U.S. Pat. No. 7,374,885, hereby incorporated by reference herein), the 3-terminal blocking moiety consisted of a reversed C 3-to-3 linkage prepared using 3-dimethyltrityl-N-benzoyl-2-deoxycytidine, 5-succinoyl-long chain alkylamino-CPG (Glen Research Corporation, Cat. No. 20-0102-01). Molecular torches (see Becker et al., U.S. Pat. No. 6,849,412, hereby incorporated by reference herein) were prepared using a C9 non-nucleotide (triethylene glycol) linker joining region (Spacer Phosphoramidite 9, Glen Research Corporation, Cat. No. 10-1909-xx), 5-fluorescein (F) fluorophore and 3-dabsyl (D) quencher moieties attached to the oligonucleotide by standard methods.
(63) As set forth in the examples below, analyses of a wide variety of amplification reagents and conditions has led to the development of a highly sensitive and selective amplification process for the detection of Salmonella. The raw real-time amplification assay charts of multiple replicates of analyte at different target concentrations (see, e.g.,
Example 1
Description of Illustrative Assay Reagents and Protocols
(64) The following example describes typical assay reagents, protocols, conditions and the like used in the real-time TMA experiments described herein. Unless
(65) A. Reagents and Samples
(66) 1. Amplification Reagent. The Amplification Reagent or Amp Reagent comprised approximate concentrations of the following components: 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.5 mM dTTP, 10 mM ATP, 2 mM CTP, 2 mM GTP, 12.7 mM UTP, 30 mM MgCl.sub.2, and 33 mM KCl in 50 mM HEPES buffer at pH 7.7. Primers and other oligonucleotides were added to the Amp Reagent.
(67) 2. Enzyme Reagent. The Enzyme Reagent comprised approximate concentrations of the following components: 1180 RTU/L Moloney murine leukemia virus (MMLV) reverse transcriptase (RT) and 260 PU/L T7 RNA polymerase in 75 mM HEPES buffer containing 120 mM KCl, 10% TRITON X-100, 160 mM N-acetyl-L-cysteine, and 1 mM EDTA at pH 7.0, where one RTU of RT activity incorporates 1 nmol of dT into a substrate in 20 minutes at 37 C. and one PU of T7 RNA polymerase activity produces 5 fmol of RNA transcript in 20 minutes at 37 C.
(68) 3. Wash Solution. The Wash Solution comprised 0.1% (w/v) sodium dodecyl sulfate, 150 mM NaCl and 1 mM EDTA in 10 mM HEPES buffer at pH to 7.5.
(69) 4. Target Capture Reagent. The Target Capture Reagent (TCR) comprised approximate concentrations of the following components: 60 pmol/mL each of one or more capture probes having a dT.sub.3dA.sub.30 tail and an optional capture helper probe, 250 to 300 ug/mL paramagnetic oligo-(dT).sub.14 microparticles (Seradyn), 250 mM HEPES, 100 mM EDTA and 1.88 M LiCl at pH 6.5.
(70) 5. Lysis Reagent. The Lysis Buffer comprised 1% lithium lauryl sulfate in a buffer containing 100 mM tris, 2.5 mM succinic acid, 10 mM EDTA and 500 mM LiCl at pH 6.5.
(71) 6. Target rRNA Samples. rRNA samples were stored in water, 0.1% LiLS or Lysis Reagent prior to use in the experiments described herein.
(72) B. Equipment and Material
(73) KingFisher 96 (Thermo Electron, Waltham, Mass.) FLUOstar (BMG LABTECH, Germany) eppendorf Thermomixer R 022670565 (Eppendorf Corporation, Westbury, N.Y.) Hard-Shell Thin-Wall 96-Well Skirted PCR Plates, colored shell/white well, Catalog numbers: HSP-9615, HSP-9625, HSP-9635) (BioRad Hercules, Calif.) KingFisher 96 tip comb for DW magnets (Catalog number: 97002534) Thermo Electron, Waltham, Mass.) DW 96 plate, V bottom, Polypropylene, sterile 25 pcs/case (Axygen Catalog number: P-2ML-SQ-C-S; VWR catalog number 47749-874) KingFisher 96 KF plate (200 microlitres) (Catalog number: 97002540) PTI plate reader Chromo4 plate reader
C. Target Capture
(74) Samples were mixed with Lysis Reagent to release target and stabilize rRNA. Target Capture Reagent was added. Ribosomal RNA target was captured and purified on magnetic particles using the KingFisher 96 purification system. Particles were resuspended in Amplification Reagent containing FAM-labeled Torch for analyte and TAMRA-labeled Torch for the internal control. A typical target capture procedure to purify and prepare nucleic acid samples for subsequent amplification was performed essentially as described below. 100 L of test sample, 50 L of the TCR containing target capture oligonucleotides, and 1 mL Lysis Reagent were combined and incubated at 60 C. for 15 minutes. The TCR magnetic particles from the treated reaction mixture were captured and washed using the Wash Solution and a suitable magnetic particle washing and separation device (e.g., a magnetic separation rack, a GEN-PROBE Target Capture System, Gen-Probe Cat. No. 5207, or a KingFisher magnetic particle processor system available from Thermo Labsystems). After washing, the magnetic particles were resuspended in 100 L of the Amplification Reagent.
(75) D. Amplification and Detection of Target
(76) The real-time TMA amplification reactions were performed essentially as follows. 30 L of sample, amplification and detection oligonucleotides in the Amp Reagent or 30 L of the resuspended particles in the Amp Reagent from the target capture procedure was incubated at 60 C. for 10 minutes. The temperature was then reduced and the reaction mixture was equilibrated to 42 C. on an Eppendorf Thermomixer incubator for 15 minutes. 10 L of Enzyme Reagent was added. The reaction mixture was mixed and incubated for 75 minutes at 42 C. in a real-time detection system (e.g., Opticon or Chromo4 detection systems available from Bio-Rad Laboratories, or a PTI FluoDia T70 instrument) for simultaneous amplification and detection of analyte and the internal control.
Example 2
Design and Initial Testing of Salmonella Oligonucleotide Sets
(77) Using a region corresponding to the 350 region of the E. coli rRNA sequence, several T7 Providers, Blockers, Primers, and Torches were designed. This region was selected because it contains mismatches that are unique to other non-Salmonella enteric bacteria.
(78) A total of 426 sets of T7, Blocker, Primer and Torch oligonucleotides were screened using a plate screening protocol. The SEQ ID NOs: of preferred oligonucleotides are given in Table 3. The number of oligonucleotides and concentrations used were: 8 different T7s (5 pmol/rxn); 7 different Blockers (0.5 pmol/rxn); 12 different Primers (5 pmol/rxn) and 5 different Torches (8 pmol/rxn). The target used was Salmonella enterica ssp. enterica sv. Enteritidis (ATCC 13076/GP60) rRNA at 1E+4 copies per rxn. The raw data collected were analyzed to calculate TTime values and RFU range. The data derived were grouped into sets giving TTime below 30 min, between 30 to 35 min, and those that were 35 to 39 min (Table 4).
(79) TABLE-US-00003 TABLE 3 Oligonucleotides Used for Screening 23S 350 Region Use SEQ ID NOs: T7 Providers SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 Primers SEQ ID NOs: 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 Torches SEQ ID NOs: 66, 67, 68, 69, 70 Blockers SEQ ID NOs: 59, 60, 61, 62, 63, 64, 65
(80) TABLE-US-00004 TABLE 4 RFU and TTime Values Oligonucletide Combination SEQ ID Nos: of Provider:Blocker:Primer:Torch RFU Range TTime SEQ ID NOs: 6:64:46:66 33768 22.86 SEQ ID NOs: 6:64:46:68 14696 26.43 SEQ ID NOs: 6:64:43:66 26036 26.62 SEQ ID NOs: 3:61:38:70 19878 27.22 SEQ ID NOs: 3:61:46:70 25349 29.58 SEQ ID NOs: 3:61:42:66 27285 29.64 SEQ ID NOs: 6:64:46:69 10330 29.85 SEQ ID NOs: 6:64:42:66 29060 29.92 SEQ ID NOs: 6:64:42:67 26651 29.92 SEQ ID NOs: 3:61:39:68 19129 30.13 SEQ ID NOs: 6:64:42:68 18237 30.18 SEQ ID NOs: 1:59:46:68 8391 30.52 SEQ ID NOs: 6:64:43:68 18629 30.53 SEQ ID NOs: 3:61:39:66 27392 30.81 SEQ ID NOs: 1:59:39:66 26912 30.94 SEQ ID NOs: 1:59:46:66 25411 31.00 SEQ ID NOs: 6:64:42:70 33095 31.29 SEQ ID NOs: 1:59:46:67 25661 31.37 SEQ ID NOs: 1:59:42:67 34611 31.41 SEQ ID NOs: 1:59:46:70 16521 31.74 SEQ ID NOs: 3:61:46:68 22371 31.94 SEQ ID NOs: 3:61:42:70 24300 31.94 SEQ ID NOs: 1:59:39:68 13141 32.03 SEQ ID NOs: 3:61:39:70 19397 32.88 SEQ ID NOs: 1:59:42:68 12664 33.15 SEQ ID NOs: 1:59:45:70 16806 33.47 SEQ ID NOs: 6:64:38:66 18289 34.17 SEQ ID NOs: 1:59:39:70 18714 34.21 SEQ ID NOs: 6:64:42:69 9186 34.59 SEQ ID NOs: 6:64:38:68 18537 34.80 SEQ ID NOs: 1:59:38:68 17840 34.83 SEQ ID NOs: 1:59:39:67 18239 34.83 SEQ ID NOs: 1:59:45:67 30804 34.92 SEQ ID NOs: 6:64:45:68 18529 35.01 SEQ ID NOs: 3:61:39:67 21912 35.33 SEQ ID NOs: 1:59:45:68 9103 35.92 SEQ ID NOs: 1:59:38:70 18450 36.41 SEQ ID NOs: 1:59:45:66 13572 37.68 SEQ ID NOs: 1:59:37:69 13248 38.14 SEQ ID NOs: 3:61:35:68 20426 38.21 SEQ ID NOs: 1:59:38:67 15171 38.29 SEQ ID NOs: 6:64:40:68 18404 38.31 SEQ ID NOs: 1:59:40:70 11004 38.54 SEQ ID NOs: 5:63:42:66 26120 38.72 SEQ ID NOs: 3:61:35:67 17633 38.84 SEQ ID NOs: 6:64:45:70 27222 38.94 SEQ ID NOs: 1:59:43:67 16832 39.07 SEQ ID NOs: 6:64:38:67 18945 39.32 SEQ ID NOs: 6:64:38:70 15589 39.35
(81) A secondary screening was performed on 42 potential oligonucleotide sets based on the initial screening. The oligonucleotides used are shown in Table 5.
(82) TABLE-US-00005 TABLE 5 Oligonucleotides Used for Secondary Screening Use SEQ ID NOs: T7 Providers SEQ ID NOs: 1, 3, 5, 6 Primers SEQ ID NOs: 35, 37, 38, 39, 40, 42, 43, 45, 46 Torches SEQ ID NOs: 66, 67, 68, 69, 70 Blockers SEQ ID NOs: 59, 61, 63, 64
(83) In addition to repeating the reactivity to S. Enteritidis (GP60) rRNA, a preliminary cross-reactivity test against E. coli (GP88/ATCC10798) rRNA was also performed. From these results, 4 sets were identified that either did not cross-react with E. coli or did cross-react with E. coli but with a lag in the emergence time. These 4 oligonucleotide sets are shown in Table 6.
(84) TABLE-US-00006 TABLE 6 Oligonucleotides Used for Additional Screening Oligonucleotide Set Description Oligonucleotide Set #3 T7 Provider SEQ ID NO: 1 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 39 Torch SEQ ID NO: 66 Set #4 T7 Provider SEQ ID NO: 1 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 43 Torch SEQ ID NO: 66 Set #5 T7 Provider SEQ ID NO: 6 Blocker SEQ ID NO: 64 Primer SEQ ID NO: 45 Torch SEQ ID NO: 66 Set #6 T7 Provider SEQ ID NO: 6 Blocker SEQ ID NO: 64 Primer SEQ ID NO: 42 Torch SEQ ID NO: 67
(85) Initial specificity testing against other enteric bacteria (namely, Enterobacter cloacae and Citrobacter freundii) was performed for all 4 oligonucleotide sets. From these 4 oligonucleotide sets, the best oligonucleotide set was identified as Set #3 because it did not cross-react with E. coli (GP88), E. cloacae and C. freundii. It also did detect Salmonella bongori, the other species under the genus Salmonella. Repeat testing of Salmonella 23S oligonucleotide Set #3 was done with more replicates of S. Enteritidis, S. bongori, C. freundii, E. cloacae and 3 E. coli strains (GP3/ATCC25922, GP88/ATCC10798, and GP831/ATCC29214). S. Enteritidis and S. bongori rRNAs were again detected to a level similar to what was obtained previously. However, one E. coli strain (GP831) was also detected by this set of oligonucleotides.
(86) Alternative Regions
(87) Designs for the Salmonella genus project were started in the 450 region of the 16S rRNA (Table 7). Sequences were screened in that same manner as those in the 23S rRNA discussed above. Designs for the assay focused on the mismatches shown between bases 450-490. It was shown that the Citrobacter and Enterobacter strains were very close if not identical to the Salmonella in this region. It was also determined that S. bongori and S. arizonae were more similar to E. coli than other Salmonella and posed the risk of false negative generation. Initial screening results showed the inability of the 16S oligonucleotide system to discriminate the Citrobacter and Enterobacter strains tested. The data showed a very high false positivity rate that was inherent to the system. Based on initial screening results, it was decided to move forward with alternate designs (23S-350 region) since Enterobacter and Citrobacter could not be discriminated.
(88) TABLE-US-00007 TABLE7 OligonucleotidesUsedforScreening16S 450Region SEQID Use NO: Sequence Blocker SEQID gcggcauggcugcauccgga NO:78 Blocker SEQID cauacacgcggcauggcugc-X NO:79 Blocker SEQID uucauacacgcggcauggcu-X NO:80 Blocker SEQID ccuucuucauacacgcggca-X NO:81 Blocker SEQID cuucuucauacacgcg-X NO:82 Blocker SEQID gccuucuucauacacgcg-X NO:83 Blocker SEQID aggccuucuucauacacgcg-X NO:84 Blocker SEQID gaaggccuucuucauacacg NO:85 Blocker SEQID gaaggccuucuucauacacg-X NO:86 Blocker SEQID caacccgaaggccuucuuc-X NO:87 Blocker SEQID aguacuuuacaacccgaagg NO:88 Blocker SEQID cgcugaaaguacuuuacaac NO:89 T7 SEQID ATTTAATACGACTCACTATAGGGAGAGCCG Provider NO:90 CGTGTATGAAGAAGGCCTTC-X T7 SEQID AATTTAATACGACTCACTATAGGGAGAGTG Provider NO:91 TATGAAGAAGGCCTTCGGGTTGTAAAG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAATGA Provider NO:92 AGAAGGCCTTCGGGTTGTAAAG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGAAG Provider NO:93 GCCTTCGGGTTGTAAAG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGACCAC Provider NO:94 AAGAAGGCCTTCGGGTTGTAAAG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGAAG Provider NO:95 GCCTTCGGGTTGTAAAGTA-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGAAG Provider NO:96 GCCTTCGGGTTGTAAAGTACTT-X T7 SEQID AATTTAATACGACTCACTATAGGGAGAGGC Provider NO:97 CTTCGGGTTGTAAAGTACTTTCAGCGG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGACCTT Provider NO:98 CGGGTTGTAAAGTACTTTC-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGGGT Provider NO:99 TGTAAAGTACTTTCAGCGG-X T7 SEQID AATTTAATACGACTCACTATAGGGAGAGTT Provider NO:100 GTAAAGTACTTTCAGCGGGGAGGAAGG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGTAC Provider NO:101 TTTCAGCGGGGAGGAAGG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGTAC Provider NO:102 TTTCAGCGGGGAGGAAGG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGAGTAC Provider NO:103 TTTCAGCGGGGAGGAAGGGAGTAAAG-X T7 SEQID ATTTAATACGACTCACTATAGGGAGACAGC Provider NO:104 GGGGAGGAAGGGAGTAAAG-X Extender SEQID TACTTTCAGCGGGGAGGAAGG NO:105 Extender SEQID TACTTTCAGCGGGGAGGAAGGGAG NO:106 Primer SEQID CGGGTTGTAAAGTACTTTCAGCGG NO:107 Primer SEQID GAACCTAGTTGGGCGAGTTACGGA NO:108 GTAACGTCAATTGCTGCGGT Primer SEQID GTAACGTCAATTGCTGCGGT NO:109 Primer SEQID GGTAACGTCAATTGCTGCGG NO:110 Primer SEQID GAACCTAGTTGGGCGAGTTACGGA NO:111 GGTAACGTCAATTGCTGCGG Primer SEQID CTGCGGGTAACGTCAATTGCTG NO:112 Primer SEQID GAACCTAGTTGGGCGAGTTACGGA NO:113 CTGCGGGTAACGTCAATTGCTG Primer SEQID GTTTGTATGTCTGTTGCTATTATGTCTACC NO:114 TTCTTCTGCGGGTAACGTCAATG Primer SEQID cacgGAGTTAGCCGGTGCTTC NO:115 Primer SEQID cugcTGGCACGGAGTTAGCCGGTGCTTC NO:116 Primer SEQID GTTTGTATGTCTGTTGCTATTATGTCTACC NO:117 TGCTGGCACGGAGTTAGCCGGTGCTTC Primer SEQID GTCTACGCGGCTGCTGGCACGGAGTTAGCC NO:118 GGTGCTTC Primer SEQID GAACCTAGTTGGGCGAGTTACGGA NO:119 GTCTACGCGGCTGCTGGCACGGAGTTAGCC GGTGCTTC Primer SEQID cugcTGGCACGGAGTTAGC NO:120 Primer SEQID cgcuTGCACCCTCCGTATTACCGCGGC NO:121 Primer SEQID cgcuTGCACCCTCCGTATTACC NO:122 Primer SEQID GTTTGTATGTCTGTTGCTATTATGTCTACG NO:123 GAUTTCACATCTGACTTAACAAAC Torch SEQID ggggcuuuacucccuuccucccc NO:124 Torch SEQID ggagg9accacaacaccuuccucc NO:125 Torch SEQID ggagg9uuauuaaccacaacaccuuccucc NO:126 Torch SEQID cgagg9accacaacaccuuccucg NO:127 Torch SEQID ccaacuuuacucccuuccucguugg NO:128 Torch SEQID gcaaagguauuaacuuuacucccuuccuuu NO:129 gc Torch SEQID ggaagg9uuauuaaccacaacaccuucc NO:130 Torch SEQID gcaaagguauuaacuuuacucccuuugc NO:131 Torch SEQID gggaggguauuaacuuuacuccc NO:132 Torch SEQID cggug9uuauuaaccacaacaccg NO:133 Torch SEQID gguguu9auuaaccacaacacc NO:134 Torch SEQID cggug9gcugcgguuauuaaccacaacacc NO:135 g Torch SEQID cgcugcgguuauuaaccacaa9cagcg NO:136 Torch SEQID gcugcgguuauuaaccacaaca9gcagc NO:137 Torch SEQID ccugcugcgguuauuaaccacaaca9gcag NO:138 g Torch SEQID cgaggagcaaagguauuaacuuuacucgg NO:139 Torch SEQID cgagcaaagguauuaacuuuacucgcucg NO:140 Torch SEQID cgagcaaagguauuaacuuuacugcucg NO:141 Torch SEQID cgagcaaagguauuaacuuuacgcucg NO:142 Torch SEQID cgagcaaagguauuaacuuuagcucg NO:143 Torch SEQID cgagcaaagguauuaacuuugcucg NO:144 Torch SEQID cgagcaaagguauuaacgcucg NO:145 Torch SEQID ccgucaaugagcaaaggacgg NO:146 Torch SEQID cggguaacgucaaugagcaaaggacccg NO:147 Torch SEQID cugcggguaacgucaaugagcaaacgcag NO:148 Torch SEQID ccugcggguaacgucaaugagcagg NO:149 Lower case 2-O--methyl RNA Xis a blocking moiety (e.g., reverse(3-5) C blocked) 9 is a non-nucleotide (triethylene glycol) linker joining region, and 5-fluorescein (F) fluorophore and 3-dabsyl (D) quencher moieties were attached to the torch oligonucleotides
(89) Accordingly, the 350 region of the 23S rRNA was selected as the preferred region for further optimization based upon the finding that T7 providers and primer oligonucleotides for this region displayed the highest signals and lowest background in a single primer TMA assay, relative to the large number of other oligonucleotide sets tested. Screening of oligonucleotides in a TMA assay was performed, and different Torches and Blockers were also analyzed. The criteria for selecting the best oligonucleotide sets included having the lowest background and the highest signal at 1E+5 copies of Salmonella rRNA.
Example 3
Further Identification of Salmonella Oligonucleotide Sets
(90) To further reduce background signals and improve specificity and sensitivity, a number of additional oligonucleotide sets were designed and tested.
(91) Based on oligonucleotide set #3 several redesigned T7 providers and primer oligonucleotides were identified that took advantage of mismatches found in E. coli. Real-time TMA was run on the redesigned 23S T7 providers and primer oligonucleotides. The number of oligonucleotides and concentrations used were: 10 different T7 Providers (5 pmol/reaction); 1 Blocker (0.5 pmol/reaction); 6 Primer oligonucleotides (5 pmol/reaction) and 1 Torch oligonucleotide (8 pmol/reaction). The identities of the oligonucleotides are shown in Table 8.
(92) TABLE-US-00008 TABLE 8 Redesigned Oligonucleotides Use SEQ ID NO: T7 Providers SEQ ID NOs: 1, 10, 11, 12, 13, 14, 15, 16, 17, 18 Primers SEQ ID NOs: 39, 40, 43, 47, 48, 49 Blocker SEQ ID NO: 59 Torch SEQ ID NO: 66
(93) The targets used were S. Enteritidis GP60 rRNA at 1E+4 copies per reaction, S. bongori at 1E+4 copies per reaction, E. coli GP88 rRNA at 1E+6 copies/rxn and E. coli GP831 rRNA at 1E+6 copies/rxn. A total of 60 sets were tested and 10 potential oligonucleotide sets from this redesigned set were identified to give respectable TTimes and RFU ranges for S. Enteritidis, but some did not react with S. bongori or did cross-react with E. coli GP88 and/or E. coli GP831 (Table 9).
(94) TABLE-US-00009 TABLE 9 TTime and RFU range of 10 Potential Oligonucleotide Sets OLIGO COMBINATION Provider:Blocker:Primer:Torch (SEQ ID NOs:) Target> SE at 10{circumflex over ()}4 SB at 10{circumflex over ()}4 EC0088 at 10{circumflex over ()}6 EC0831 at 10{circumflex over ()}6 SEQ ID NOs: 1:59:39:66 TTIME 29.49 30.16 0 37.44 RFU 34,713 1,113 0 22,417 SEQ ID NOs: 12:59:47:66 TIME 34.11 40.06 0 40.19 RFU 30,963 3.357 0 14,759 SEQ ID NOs: 12:59:49:66 TTIME 28.67 30.53 30.91* 34.19 RFU 32,554 15.103 1145* 26,336 SEQ ID NOs: 13:59:47:66 TTIME 32.17 44.14 0 40.37 RFU 29.643 3.037 0 2,541 SEQ ID NOs: 13:59:48:66 TTIME 28.42 38.55 44.91 36.4 RFU 28,184 11,519 1,534 4,687 SEQ ID NOs: 14:59:49:66 TTIME 27.5 33.24 0 39.29 RFU 27,505 14,480 0 18,138 SEQ ID NOs: 15:59:49:66 TTIME 30.83 32.22 43.11 46.27 RFU 35.564 1,766 1,014 19,568 SEQ ID NOs: 17:59:48:66 TTIME 33.96 34.24 46.01** 44.58 RFU 22.283 1,854 2018** 19.210 SEQ ID NOs: 17:59:49:66 TTIME 30.46 30.7 46.12 42.08 RFU 27,194 25,054 21,684 14,927 SEQ ID NOs: 10:59:48:66 TTIME 35.56 43.06 52.25 45.31 RFU 29,914 20,081 1,327 10,999 *0 target had lower TTime and same RFU; **0 target had higher Ttime and lower RFU Lower TTime and higher TTime refer to earlier and later emergence of signal, respectively.
(95) Real-time TMA was used to screen a subset of the above 10 sets using the following concentrations: T7 Providers at 5 pmol/reaction; Blocker oligonucleotide at 0.5 pmol/rxn; Primer oligonucleotides at 5 pmol/reaction and Torch oligonucleotide at 8 pmol/rxn. The targets used were S. Enteritidus rRNA at 1E+4 cps/rxn, S. bongori at 1E+4 cps/rxn; 13 strains of E. coli at 1E+7 cps/rxn; C. freundii at 1E+6 cps/rxn; E. cloacae at 1E+6 cps/rxn; 2 strains of Shigella flexneri at 1E+6 cps/rxn, and Shigella sonnei at 1E+6 cps/rxn.
(96) The T7 Provider and primer oligonucleotides were mixed and matched to provide 4 possible sets to test that are shown in Table 10.
(97) TABLE-US-00010 TABLE 10 Oligonucleotide Sets Oligonucleotide Set Description Oligonucleotide Set 3 T7 Provider SEQ ID NO: 1 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 39 Torch SEQ ID NO: 66 Set 7 T7 Provider SEQ ID NO: 1 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 49 Torch SEQ ID NO: 66 Set 8 T7 Provider SEQ ID NO: 17 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 39 Torch SEQ ID NO: 66 Set 9 T7 Provider SEQ ID NO: 17 Blocker SEQ ID NO: 59 Primer SEQ ID NO: 49 Torch SEQ ID NO: 66
(98) These sets were tested against all 13 strains of E. coli (ATCC#'s 25922, 11775, 10798, 35150, 33780, 23722, 25404, 29214, 29194, 35359, 23499, 12792, and 23503), then against other enteric bacteria. The TTime and RFU results were compared to each other. Using the best 3 oligonucleotide sets obtained from the E. coli results, real-time TMA was run on several other enteric bacteria using sets #3, #7, and #9. All 3 oligonucleotide sets picked up S. enterica with TTimes of 28 min, 25 and 23 min, respectively. S. bongori was also picked up by these 3 oligonucleotide sets with TTimes of 32 min, 30 min and 26 min, respectively. Some other enteric bacteria showed some cross-reactivity, but had very late emergence times and low RFU levels.
(99) Based on the results obtained, further assay testing and optimization focused on 2 oligonucleotide sets: #7 and #9 (Table 10). Sensitivity of detecting various copy levels of S. Enteritidis GP60 rRNAs in a pure system (no target capture step) using oligonucleotide sets #7 and #9 was tested. At 1E+5 copies, TTime was in the low 20 min range for both sets of oligonucleotides. Oligonucleotide set #7 detected 83% of replicates at the 100-copy level. Oligonucleotide set #9 detected 100% of replicates at the 50-copy level.
Example 4
Further Characterization and Optimization of Salmonella Oligonucleotide Sets
(100) Based on the results of set #7 showing better specificity than set #9 and of set #9 showing better sensitivity than set #7, new oligonucleotide redesigns of both T7 provider and primer oligonucleotides were prepared.
(101) Oligonucleotide Set #7
(102) Newly redesigned T7 oligonucleotide providers were tested and compared to the original T7 Provider sequence of SEQ ID NO: 1, which, in combination with the Blocker sequence of SEQ ID NO: 59, the primer sequence of SEQ ID NO: 49, and the Torch sequence of SEQ ID NO: 66, provided the least cross-reactivity to E. coli. Amplification performance was evaluated for each set of oligonucleotides compared to set #7. The targets all went through Target Capture step using the sequence of SEQ ID NO: 74. From the data and shape of the curves, T7 provider sequences of SEQ ID NOs: 24 and 26 were selected to be further evaluated.
(103) Oligonucleotide Set #9
(104) Primer oligonucleotides of SEQ ID NOs: 50 and 51 were redesigned from the sequence of SEQ ID NO: 49 to take advantage of other possible mismatches to E. coli and in order to reduce cross-reactivity of the sequence of SEQ ID NO: 49 to E. coli. Testing was done without target capture to establish baseline performance measurement.
(105) Table 11 presents redesigned oligonucleotides. The redesigned oligonucleotides had the lowest relative fluorescence unit (RFU) and the longest TTime at the zero rRNA copy level. High RFU values at the zero rRNA copy level indicated possible contamination within the reagents.
(106) TABLE-US-00011 TABLE 11 Redesigned Oligonucleotides Use SEQ ID NO: T7 Provider SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26 Primer SEQ ID NOs: 50, 51
(107) Based on the results obtained, it was determined that the oligonucleotide set #1 had a better specificity than set #9. This oligonucleotide set had less cross-reactivity to E. coli and was used as one of the oligonucleotide systems for further study.
(108) The other oligonucleotide set used for further study was set #2. The structural basis for choosing these two oligonucleotide sets was based on the combination of enough mismatches to discriminate Salmonella from other enteric bacteria and enough matches to detect all Salmonella subspecies. This would allow the amplification system to achieve the required specificity and sensitivity. The two preferred oligonucleotide sets are shown in Table 2.
(109) Confirmatory testing was performed on both oligonucleotide sets. For set #1, using the new concentrations of T7 (15 pmol), primer (15 pmol) and Blocker (5 pmol) for analyte, and T7 (2 pmol) and primer (2 pmol) for IC, there was a significant improvement in both TTimes (at least 10-15 min earlier at 1E+5 -1E+4 S. Enteritidis target copies) and curve shape (standing up and tight). For set #2, using the new concentrations of T7 (15 pmol) and primer (15 pmol) for analyte, and T7 (2 pmol) and primer (2 pmol) for IC, there was a significant improvement in both TTimes (at least 10-17 min earlier at 1E+5-1E+4 S. Enteritidis target copies) and curve shape (standing up and tight).
Example 5
Evaluation of Target Capture Integration and Internal Control (IC) Integration
(110) Seven Salmonella 23S target capture oligonucleotides (SEQ ID NOs: 71-77 were tested using two sets of amplification oligonucleotides: set #7 and set #9. The target capture procedure was performed on varying amounts of S. Enteritidis GP60 rRNAs and against 1E+7 copies of E. coli GP88 rRNAs. Two potential useful target capture oligonucleotide (TCO) sequences were identified (SEQ ID NOs: 71 and 74). Overall, the TTime observed was about 8 to 10 min later than in a pure system. Target capture oligonucleotide of SEQ ID NO: 74 was chosen for use in all subsequent experiments.
(111) The method of Target Capture with Kingfisher 96 is summarized in Table 12. Amplification and Enzyme reagents were reconstituted. A wash plate was prepared by filling a KF200 plate with 200 L/well of wash solution. An amp plate was prepared by filling another KF200 plate with 100 L/well of amplification reagent. Both the amp and wash plates were covered until used. A sample plate was prepared by adding 50 L TCR/well into a 2-mL, deep-well 96 plate (Axygen). The target was diluted to the required concentrations in 10 L lysis solution. One ml of lysis solution was added to each well of the sample plate. With a repeat pipettor, 10 L of target solution was added to the appropriate deep wells. A deep-well tip-comb was placed in the sample plate. The covers for the wash and amp plates were removed. The KF96 protocol was started and all three plates were placed on the KF96 instrument. The amp plate was placed in position 4, the wash plate in position 3, and the sample (deep-well plate) in position 1. Position 2 in the KF96 instrument was left empty. Once the plates were loaded, the KF96 instrument began the target capture step. When the KF96 run was completed, the plates were removed. From the amp plate, 30 L from each well were removed using a multi-channel pipettor and transferred to an MJ 96-well PCR plate.
(112) TABLE-US-00012 TABLE 12 Kingfisher 96 Program Step Step Position Description Action Beginning Mix End 1 1 Capture Heat 5 min-85 C. Very slow No action 2 1 Capture Heat 15 min-65 C. Very slow No action 3 2 Cool Heat 30 min-25 C. (table No action No action rotated to empty position) 4 1 Mix prior to Mix No action 1 min-Very slow Collect beads- collect/collect count 20 Sample 1 5 3 Release to Wash Wash Release 30 s Slow 30 s Slow No action 6 1 Capture Wash Release 30 s Very 30 s Very Slow Collect beads- Sample 2 Slow (mix only) count 20 7 3 Release to Wash Release 30 s Slow 30 s Slow Collect beads- Wash 2 count 20 8 4 Capture and Wash Release 30 s Slow 30 s Slow No action release into Amp Soln
(113) An Internal Control (IC) was integrated into the Salmonella prototype assay with target capture. This set of IC oligonucleotides performed well for the Salmonella system with average TTimes in the 19-20 min range and curves that were tight, sharp and standing up. With the IC integration, the sensitivity of the Salmonella assay dropped by about 10-fold, although it did not seem to affect specificity to other enteric bacteria.
(114) TABLE-US-00013 TABLE 13 Oligonucleotide Components used for the Complete System using Oligonucleotide Set #2 with IC system Component Salmonella T7 Provider SEQ ID NO: 26 at 5 pmol Blocker SEQ ID NO: 59 at 0.5 pmol Primer SEQ ID NO: 49 at 10 pmol Torch SEQ ID NO: 66 at 8 pmol Target Capture SEQ ID NO: 74 at 5 pmol Target reference S. Enteritidis GP60 rRNA
Example 6
Sensitivity, Specificity, Interference, Limit of Detection, Cross-Reactivity, and Time to Results
(115) Stage I
(116) Sensitivity
(117) Salmonella Enteritidis, ATCC 13076, was assayed at 1E+5 copies/reaction. Lysis buffer was used as the negative control. Twenty positives (10.sup.5 copies of rRNA/assay) were tested using the KingFisher 96 instrument for target capture and the PTI reader for detection. Twenty negatives (lysis buffer) were used as control. The input for target capture was 1 mL, the output for target capture was 100 L of which 30 L was used in the amplification. The positive criterion was 1,000 RFU. Nineteen of 20 replicates were to be detected with >95% positivity rate. If less than 19 replicates were positive after an initial round of testing, 40 additional replicates were to be tested. Testing for Stage I-Sensitivity yielded a 100% rate of positivity for Salmonella Enteritidis at 1E+5 copies/reaction and 0% false positivity at 0 copies.
(118) Specificity
(119) Organisms that were closely related to the target organism but were genotypically distinct by rRNA analysis were chosen as negatives. Eight challenge organisms were tested at 1E+7 copies/rxn using the Kingfisher96 instrument for target capture, the Eppendorf thermomixer for annealing of primers and enzyme addition, and the PTI reader for detection. Twenty reactions of all challenge organisms (8) were tested with one replicate of each reaction amplified (10.sup.5 copies of rRNA, 100 CFU/assay). S. Enteritidis, ATCC 13076, was used as a positive control at 1E+5 copies/rxn and lysis solution used as a negative control. The positive criterion was 1,000 RFU. Less than or equal to 8 of 160 reactions were to meet the goal (to discriminate and not detect 10.sup.5 copies of non-target rRNA) of 5% combined false positivity rate. The dispersion of any false positives across the 8 organisms was to be considered. Organisms with clustered false positivity 4 were to be retested and investigated further. Stage I-Specificity testing showed 0% positivity against any of the challenge organisms tested and 100% positivity with the positive control.
(120) Interference
(121) The goal was repeatable detection of rRNA approximately equivalent to 10-100 CFUs rRNA spiked into a volume of lysis buffer expected to be obtained from the sample concentration device. Testing was to include low copy numbers of desired rRNA and 10.sup.7 copies rRNA (10,000 CFU) nearest neighbor organisms. S. Enteritidis, ATCC 13076, was used as the baseline target and was tested at 1E+5 copies rRNA/reaction (approximately 100 CFUs). Eight challenge organisms were spiked into the samples at a concentration of 0 (lysis solution only) or 1E+7 copies (approximately 10,000 CFU). Assays were performed using the Kingfisher 96 and the PTI reader. All conditions were tested in replicates of 12 with a positive criterion of 1,000 RFU. Results were to report the reproducibility of positivity in the presence of the nearest neighbor organisms. The dispersion of interference across the organisms tested was to be considered. Organisms exhibiting interference were to be retested and investigated further. Stage I-Interference testing showed 100% positivity in all challenge samples and positive controls.
(122) Microbial Flora Determination
(123) Twenty poultry rinses were analyzed at Gen-Probe to provide an estimate of the normal flora associated with poultry rinse. Eighteen of 20 rinses were part of one batch that was received from a source outside of Gen-Probe. The other two samples were derived at Gen-Probe from chickens purchased at 2 local grocery stores. Dilution plating for total aerobic count on TSA plates was conducted. Dilutions of 1E+1 through 1E+4 of each poultry rinsate sample were prepared in 1phosphate buffered saline. 100 L of undiluted, 1E+1 through 1E+4 rinsate dilutions were plated on tryptic soy agar (TSA) plates.
(124) Colony counts were performed after the plates had been incubated at 30 C. and 35-37 C. for 24-48 hours. Colonies representing different morphologies were sent to PACE Analytical Life Sciences (Minneapolis, Minn.) for identification by RiboPrinter microbial characterization system. In addition to TSA counts and riboprinting, samples were enriched in buffered peptone water (BPW) followed by selective enrichment with either TT broth or mRSV broth (semi-solid). Samples from the selective enrichment were plated on both BGS and XLT4 agar plates for further selectivity. BIOLOG identification and Gram stain/oxidase testing were performed on representative colonies. Results showed normal flora in the poultry rinse.
(125) For Salmonella selection, 90 ml buffered-peptone water (BPW) was inoculated with 10 ml of poultry rinsate and enriched at 35 C. for 24 hours. Ten ml of mRSV (modified Rappaport-Vassiliadis-Bouillion) broth was inoculated with 100 L of enriched sample and incubated at 42 C., shaking, for 24 hours. Ten ml of TT broth (Hajna) was inoculated with 500 L of enriched sample and incubated aat 42 C., shaking, for 24 hours. Ten L samples from both selective media (mRSV and TT) were plated on both XLT4 (xylose lysine tetrathionate) and BGS (brilliant green selenite) agar plates. The inoculated plates were incubated at 35 C. and examined at 24 and 48 hours. Selected colonies from the XLT4 and BGS plates were plated on opposite media. For example, if a colony was chosen from the XLT4 plate, it was plated on BGS media, and visa versa. Selected colonies were plated on TSA, from which BIOLOG identification and Gram stain/oxidase testing were performed to confirm the identification of the microorganism.
(126) Glycerol stocks of selected colonies were made and sent to PACE Analytical for riboprinting for confirmation of microorganism identity.
(127) Stage II
(128) Stage II performance testing evaluated the preliminary amplification assay in Buffered-Peptone Water (BPW). The evaluation used pure culture lysates. Sample preparation device was not included. All positive controls (at 1E+5 copies/assay) used the purified RNA isolated from S. enterica ssp. enterica sv. Enteritidis ATCC 13076 and negative control was lysis solution:BPW (7:3). Three hundred L BPW and 700 L lysis buffer (with or without sample) were used to make a 1 mL input for target capture. The input for target capture was 1 mL, the output for target capture was 100 L of which 30 L was used in the amplification.
(129) Sensitivity
(130) S. enterica ssp. enterica sv. Choleraesuis (ATCC 10708), S. enterica ssp. enterica sv. Typhi (ATCC 19430) and S. enterica ssp. enterica sv. Typhimurium (ATCC 13311) were tested at a level of 1E4-5E4 copies RNA/assay (approximately 10-50 CFU). All three species and negative control (unspiked BPW) were tested in replicates of 20. Target capture was performed on the Kingfisher 96 instrument, with enzyme addition on the Eppendorf thermomixer, followed by detection on the PTI reader. The positive criterion parameter for the sensitivity was 1,000 RFU. Nineteen of the 20 replicates were to be positive. If less than 19 of 20 were positive, further testing of an additional 40 replicates was required. All organisms tested for sensitivity passed the Stage II requirement.
(131) Limit of Detection
(132) The goal was repeatable detection of 10.sup.3-10.sup.4 equivalent copies rRNA (1-10 CFU) per assay input volume. Repeatable detection was defined as 95% positivity. S. enterica ssp. enterica sv. Choleraesuis (ATCC 10708), S. enterica ssp. enterica sv. Typhi (ATCC 19430), S. enterica ssp. enterica sv. Typhimurium (ATCC 13311), S. enterica ssp. enterica sv. Enteritidis (ATCC 13076), S. enterica ssp. enterica sv. Gallinarum (ATCC 9184) and S. enterica ssp. arizonae (ATCC 29933) were tested at a level of 1E3-1E4 copies RNA/assay (approximately 1-10 CFU). Target capture was performed on the Kingfisher 96, enzyme addition on the Eppendorf thermomixer, and the detection on the PTI reader. Each species was tested in replicates of 20. The lysates were prepared from pure culture target organisms quantitated in CFUs and lysed to provide nucleic acid target at a level equivalent to 1-10 CFU. The positive criterion was 1,000 RFU. S. Enteritidis, ATCC 13076, was considered both the positive control as well as a strain required for testing. For LOD testing, the Positive Control RNA was used at 1E+4 copies/assay. The criteria was 95% positivity for all of the species tested. If less than 19 of 20 were positive, further testing of an additional 40 replicates was required. All organisms passed the Stage II requirement.
(133) Analytical Testing of Inclusive and Exclusive Species
(134) Twenty-two Inclusive organisms and twenty-two Exclusive organisms were tested at 1E+5 copies/assay (approximately 100 CFU). Testing was performed on the Kingfisher 96 instrument for target capture, enzyme addition on the Eppendorf thermomixer, and the PTI reader for detection. All were tested in replicates of 4 for the Inclusives and replicates of 8 for the Exclusives.
(135) For the Inclusives, 3 of 4 replicates were to be positive and, for the Exclusives, no more than 1 of 8 replicates were to be positive. If these criteria were not met for any organism, testing for that species/strain was repeated in replicates of 12, where 11 of 12 replicates of Inclusives were to be reactive. The identity of organisms that failed the inclusivity criterion after retest were to be further investigated. For Exclusives that did not meet retesting criterion [<3/12 positive], cross-reacting organisms were further investigated.
(136) TABLE-US-00014 TABLE 14 Positivity Rate for Inclusives Testing ATCC Copies per No. of No. of Organism Serovar # Reaction Reactions Replicates Positives Positivity S. enterica Typhimurium 33062 1E5 4 1 4 100% ssp. enterica S. bongori 43975 1E5 4 1 0 0% S. enterica Harmelen 15783 1E5 4 1 4 100% ssp. houtenae S. enterica Heidelberg 8326 1E5 4 1 4 100% ssp. enterica S. enterica Newport 6962 1E5 4 1 4 100% ssp. enterica S. enterica Muenchen 8388 1E5 4 1 4 100% ssp. enterica S. enterica Typhi 6539 1E5 4 1 4 100% ssp. enterica S. enterica Saint Paul 9712 1E5 4 1 4 100% ssp. enterica S. enterica Montevideo 8387 1E5 4 1 4 100% ssp. enterica S. enterica Paratyphi A 9150 1E5 4 1 4 100% ssp. enterica S. enterica Paratyphi B 10719 1E5 4 1 4 100% ssp. enterica S. enterica Paratyphi C 13428 1E5 4 1 4 100% ssp. enterica S. enterica 33952 1E5 4 1 4 100% ssp. arizonae S. enterica 29934 1E5 4 1 4 100% ssp. diarizonae S. enterica Typhimurium 14028 1E5 4 1 4 100% ssp. enterica S. enterica Illinois 11646 1E5 4 1 4 100% ssp. enterica S. enterica Hooggraven 15786 1E5 4 1 4 100% ssp salamae S. enterica Cubana 12007 1E5 4 1 0 0% ssp. enterica S. enterica Rubislaw 10717 1E5 4 1 4 100% ssp. enterica S. enterica Panama 7378 1E5 4 1 4 100% ssp. enterica S. enterica Gallinarum 9184 1E5 4 1 4 100% ssp. enterica S. enterica Ferlac 43976 1E5 4 1 4 100% ssp. indica Positive* 13076 1E5 12 1 12 100% Negative* NA 0 12 1 0 0% Repeat Testing S. bongori 43975 1E5 12 1 0 0% S. enterica Cubana 12007 1E5 12 1 12 100% ssp. enterica *Total for all runs
(137) TABLE-US-00015 TABLE 15 Positivity Rate for Exclusives Testing Copies Number Number ATCC#/ per of of Organism other Reaction Reactions Replicates Positives Positivity E. coli 25922 1E5 8 1 0 0% E. vulneris 33833 1E5 8 1 0 0% E. hermannii 55236 1E5 8 1 0 0% E. cloacae 700644 1E5 8 1 0 0% E. aerogenes 13048 1E5 8 1 0 0% E. hoshinae 33379 1E5 8 1 0 0% P. mirabilis 29906 1E5 8 1 0 0% C. brakii 29063 1E5 8 1 0 0% P. fluorescens 13525 1E5 8 1 0 0% S. flexneri 12022 1E5 8 1 0 0% C. freundii 33128 1E5 8 1 0 0% C. koseri/diversus CI495 1E5 8 1 0 0% K. pneumoniae 23357 1E5 8 1 0 0% S. marcescens 13880 1E5 8 1 0 0% L. innocua 33090 1E5 8 1 0 0% E. faecalis 33186 1E5 8 1 0 0% C. jejuni 33560 1E5 8 1 0 0% C. coli 43478 1E5 8 1 0 0% S. pneumoniae 6303 1E5 8 1 0 0% Positive* 13076 1E5 8 1 8 100% Negative* NA 0 8 1 0 0% *Total for all runs
(138) Testing for the Stage IIAnalytical Testing of Inclusives (Table 14) and Exclusives (Table 15) was considered complete except for the single minor exception of Salmonella bongori inclusivity. S. bongori was not detected upon initial testing of 4 replicates (0 pos/4 reps) and retesting of 12 replicates (0 pos/12 reps) (Table 14). For S. bongori, retesting was done on a new lysate tube from the current lot of S. bongori ATCC 43975 after determination of RNA concentration using Gen-Probe's MTC-NI (cat. no. 4573). Testing was also performed on other strains of S. bongori, but none was amplified by the current Salmonella assay. Due to the rare isolation of this organism, detection of S. bongori was not considered a requirement for the assay as S. bongori has only been isolated twice out of 36,184 isolates and is not in the top 30 isolates per the CDC 2005 Salmonella Annual Summary. For S. Cubana retesting, a new lysate tube was used from the same lot used in the initial testing. Upon retesting, S. Cubana (12 pos/12 reps) passed Stage 2 acceptable criteria for retesting.
(139) Time-To-Result
(140) The time of each assay run for Stage II was tracked from the time samples were added to the deep-well plate through the end of the PTI reader protocol. The average time from sample loading to the start of the PTI reader was 2 hours, 18 minutes for 96 samples. The PTI reader time was static at 75 minutes. Therefore, the whole assay from start to finish was 3 hours, 33 minutes on average for 96 samples.
(141) These results indicate that the species-specific detection of Salmonella can be achieved by the compositions and methods even in the presence of closely related organisms, based upon the characteristics of the real-time TMA data (e.g., the size and shape of RFU curves generated from the real-time TMA reactions).
Example 7
Food Testing of Spiked Ground Beef and Ice Cream
(142) To test the functionality of the prototype Salmonella assay with real life samples, ground beef and ice cream were purchased from a local supermarket, spiked with a known quantity of S. Enteritidis GP60 and grown in buffered peptone water in a Stomacher sampling bag. At various time points, samples were removed and processed for colony count using XLD agar selective medium and for real-time TMA using the prototype Salmonella assay. The various steps followed in this study are described below. A McFarland 1 of S. Enteritidis GP60 was made. CFU count confirmation in TSA plates (made dilution to 1E+6 in sterile PBS) was performed. Twenty-five grams of food was weighed and aseptically placed into a Stomacher bag. Twenty CFU were inoculated directly to 225 mL of Buffered Peptone Water. The spiked media was poured into the food-containing Stomacher bag and processed for 2 minutes at 200 rpm. The sample was incubated at 35 C. A 1-mL aliquot was removed (1 aliquot for use in plate count) at times 0, 4, 6, 8, and 24 hours. The sample was plated for CFU counts on selective agar, XLD plates at 3 dilutions, 1 plate/dilution and incubated at 35 C. The remaining five aliquots sampled during a 24-hour period were spun at 12,000g for 30 seconds. The supernatant was removed and 500 L of a 50 mM succinate buffer (0.6 M LiCl, 1% LiLS, pH 4.8) was added to the pellet which was then vortexed vigorously for 20 seconds. The sample was heated at >95 C. at least 15 minutes. It was then spun at 12,000g for 1 minute. The supernatant was transferred to a new labeled tube. Samples were frozen at 70 C. Food controls included: 2 positive and 2 negative for ground beef, 2 positive and 2 negative for plain vanilla icecream, and 2 positive and 1 negative for the media only pure system.
(143) Salmonella CFU Timing and Plate Counts
(144) Using an inoculum of around 12 CFU per 225 ml of media, the spiked Salmonella in ground beef grew to around 280 CFU/ml after 4 h of incubation in buffered peptone water (BPW). In spiked ice cream, 20 CFU/ml were observed after 6 h of incubation in BPW. The ground beef was substantially more contaminated than ice cream with other enteric bacteria and had over 1,000 CFU/ml after 4 h of incubation. The spiked media without any food sample had around 20 CFU/ml after 4 h of incubation. By 24 h, all spiked and unspiked food samples in BPW had >1.5E+7 CFU/ml. All negative unspiked media controls did not show any growth. These results corroborate the data obtained from real-time TMA with regards to CFU timing and early emergence of a positive detectable signal using real-time TMA.
(145) For food samples that were spiked with 12 CFU of Salmonella per 225 ml BPW, a positive RFU signal for Salmonella was observed after 4 h of incubation in either ground beef or ice cream. The unspiked ground beef control run produced positive signals (due to indigenous microbial contamination) after 8 h of incubation and unspiked ice cream control run showed positive signal after 24 h incubation. In both unspiked food samples, the positive signals emerged very late (>40 min). In the unspiked ground beef sample, these false-positive signals may have be caused by cross-reacting organisms (most probably other enteric bacteria) at a very high nucleic acid load (e.g. >6E+8 copies rRNA/reaction in this sample). In the unspiked ice cream sample, the apparent positive signals were derived from indigenous or contaminating organisms that did not grow in the XLD selective medium, but grew in BPW. The positive control (positive spiked media) was positive at 4-h to 24-h points. The negative control (negative unspiked media) remained negative throughout the whole run. These data indicate that real-time TMA can be used to detect a very low level of Salmonella contamination with a minimum of 4 h pre-enrichment in BPW and that the whole process did not require complex sample processing steps, except for two brief (<1 minute) centrifugation steps.
(146) Assay Summary
(147) Amplification and detection oligonucleotides targeting two regions of Salmonella nucleic acid, a 450 region corresponding to from about 380 to about 630 nucleotide base positions of E. coli 16S rRNA and a 350 region corresponding to from about 150 to about 425 nucleotide base positions of E. coli 23s rRNA, were designed and synthesized for evaluation. Designs in the 16S-450 region did not yield good oligonucleotide candidates for a Salmonella genus assay. The oligonucleotides cross-reacted with Citrobacter and Enterobacter.
(148) Assay specificity and sensitivity were evaluated using lysed bacterial pellets. CFU and rRNA target levels of the bacterial pellets were estimated by plating and by a direct DNA probe assay.
(149) The Salmonella assay was 100% sensitive to 22 strains of Salmonella including 6 different subspecies and 16 serotypes of S. enterica ssp. One exception was the S. bongori, which is genotypically more similar to E. coli in the target region than other Salmonella species. The Salmonella assay was 100% specific against 22 non-Salmonella organisms at 1E+5 copies/assay.
(150) Two food matrices, ice cream and ground beef (25 g), were inoculated with S. Enteritidis (20 CFU) and processed through a Stomacher device in broth. Plating and the real-time TMA were monitored over a 24-hour time course. The real-time TMA system utilized two fluorescent probes, one specific for the analyte, one specific for an internal control. The results were analyzed based on fluorescence emergence curves. The real-time TMA assay was run in less than four hours, reducing the time needed for testing in food facilities from days to hours. Results indicated that low level Salmonella contamination could be detected within 8 hours, which included 4 hours of pre-enrichment in a non-selective medium follow 8000 copies (8 CFU/gram food). Interference from high nucleic acid load started at 1.8E+10 copies (1.8E+7 CFU)/gram food after 8 h growth.
(151) In summary, real-time TMA technology was suitable for rapid, highly sensitive detection of food-borne pathogens. The assay had a sensitivity of 1E+4 rRNA copies/assay (approximately 10 CFU) for the desired species, Salmonella enterica ssp. enterica sv. Enteritidis GP60/ATCC13076, while excluding various nearest neighbors and potentially co-contaminating flora at 1E+7 rRNA copies/assay (approximately 10,000 CFU). Utilizing magnetic particle target capture technology, interference from ground beef and ice cream samples was not observed. The data demonstrated a rapid test format that allowed screening of food samples within a single 8-hour workshift for Salmonella with an improved enrichment protocol.
(152) The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.
(153) The methods illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof. It is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the invention embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
(154) The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the methods. This includes the generic description of the methods with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
(155) Other embodiments are within the following claims. In addition, where features or aspects of the methods are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.