GLYCOSYLATION METHOD
20200215178 ยท 2020-07-09
Assignee
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
A61K39/105
HUMAN NECESSITIES
C12N15/70
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
A61K39/09
HUMAN NECESSITIES
C12N15/70
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
Abstract
The invention relates to microbial host cells engineered to produce glycoconjugate vaccines by stable integration of an acceptor protein and an oligosaccharyltransferase into the host's genome, wherein expression of the oligosaccharyltransferase is regulated.
Claims
1. A transposon, comprising: a transcription cassette adapted for expression in a bacterial host cell, wherein the transcription cassette comprises: i) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1; ii) a nucleic acid molecule comprising at least 90% sequence identity to SEQ ID NO: 1 and encodes an oligosaccharyltransferase that recognizes the amino acid motif: D/E-X-N-X-S/T, wherein X is any amino acid except proline; or iii) a nucleic acid molecule with a sequence that is degenerate with respect to the nucleotide sequence of SEQ ID NO: 1 and encodes an oligosaccharyltransferase enzyme comprising the amino acid sequence of SEQ ID NO: 2; and a nucleic acid molecule encoding a bacterial resistance marker gene.
2. The transposon according to claim 1, wherein the transcription cassette comprises a regulatable promoter functionally linked to at least the nucleotide molecule encoding said oligosaccharyltransferase enzyme.
3. The transposon according to claim 1, wherein the transcription cassette comprises an acceptor polypeptide that includes an amino acid sequence motif which is a substrate for the oligosaccharyltransferase enzyme.
4. The transposon according to claim 3 wherein said acceptor polypeptide includes the amino acid motif: D/E-X-N-X-S/T, wherein X is any amino acid except proline.
5. The transposon according to claim 4 wherein said acceptor polypeptide is selected from the group consisting of: DVNVT (SEQ ID NO 24), EVNAT (SEQ ID NO 25), DQNAT (SEQ ID NO 26), DNNNT (SEQ ID NO 27), DNNNS (SEQ ID NO 28), DQNRT (SEQ ID NO 29), ENNFT (SEQ ID NO 30), DSNST (SEQ ID NO 31), DQNIS (SEQ ID NO 32), DQNVS (SEQ ID NO 33), DNNVS (SEQ ID NO 34), DYNVS (SEQ ID NO 35), DFNVS (SEQ ID NO 36), DFNAS (SEQ ID NO 37), DFNSS (SEQ ID NO 38), DVNAT (SEQ ID NO 39), DFNVT (SEQ ID NO 40), and DVNAS(SEQ ID NO 41).
6. The transposon according to claim 1, wherein said bacterial resistance marker gene confers resistance to an antibiotic.
7. The transposon according to claim 6, wherein said antibiotic is selected from the group consisting of: kanamycin, chloramphenicol, ampicillin, rifampicin, tetracycline, carbenicillin and phleomycin.
8. The transposon according to claim 1, wherein said bacterial resistance marker gene comprises 5 end and 3 end flanking nucleotide sequences comprising recombination sites.
9. The transposon according to claim 8 wherein: the 5 end flanking nucleotide sequence comprises or consists essentially of the nucleotide sequence 5-ATAACTTCGTATAATGTAT GCTATACGAA GTAG-3 (SEQ ID NO 9) and the 3 end flanking nucleotide sequence comprises or consists essentially o the nucleotide sequence f 5-ATAAC TTCGTATAATGTATGCTATA CGAAGTTAT-3 (SEQ ID NO 10); or the 5 end flanking nucleotide sequence comprises or consists essentially of the nucleotide sequence 5-GAAGT TCCTATTCCG AAGTTCCTAT TCTCTAGAAAGTATAGGAAC TTC-3 (SEQ ID NO 11) and the 3 end flanking nucleotide sequence comprises or consists essentially of the nucleotide sequence 5-GAAGTACCTATTC CGAAGTTCCT ATTCTCTAGA AAGTATAGGA ACTTC-3 SEQ ID NO 12).
10. The transposon according to claim 1, wherein said transposon comprises Tn5, Tn10, Himar1, Tn7, Tn917, or Tn916.
11. A bacterial cell transformed with a transposon according to claim 1.
12. The bacterial cell according to claim 11, wherein said bacterial cell is transformed with one or more heterologous polysaccharide biosynthetic genes encoding capsular polysaccharides or O antigens.
13. The bacterial cell of claim 11, wherein said bacterial cell is a human pathogen.
14. The bacterial cell of claim 13, wherein said human pathogen is a Neisseria spp, Moraxella spp, Escherichia spp, Salmonella spp, Shigella spp, Pseudomonas spp, Helicobacter spp, Legionella spp, Haemophilus spp, Klebsiella spp, Enterobacter spp, Cronobacter spp or Serratia spp.
15. The bacterial cell of claim 11, wherein said bacterial cell is a non-human pathogen.
16. The bacterial cell of claim 15, wherein said non-human pathogen is a Mannheimia spp., Actinobacillus spp., Pasteurella spp., Haemophilus spp. or Edwardsiella spp.
17. The bacterial cell of claim 16, wherein said non-human pathogen is an Actinobacillus pleuropneumoniae.
18. The bacterial cell of claim 11, wherein said bacterial cell is a zoonotic bacterial species.
19. The bacterial cell of claim 18, wherein said zoonotic bacterial species is a Brucella spp., Campylobacter spp., Vibrio spp., Yersina spp. or Salmonella spp.
20. A process for producing one or more glycoconjugates, comprising: i) culturing the bacterial cell of claim 11 in a cell culture medium; and ii) isolating one or more glycoconjugates from the bacterial cell or cell culture medium.
21. A bacterial cell transformed with the transposon according to claim 1; and a nucleic acid molecule encoding one or more heterologous polysaccharide biosynthetic genes encoding capsular polysaccharides or O antigens.
22. A process for producing one or more glycoconjugates, comprising: i) culturing the bacterial cell of claim 21 in a cell culture medium; and ii) isolating one or more glycoconjugates from the bacterial cell or cell culture medium.
23. The bacterial cell of claim 13, wherein said human pathogen is Streptococcus pneumoniae.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
SEQUENCE LISTING
[0143] The Sequence Listing is submitted as an ASCII text file in the form of the file named Sequence listing.txt (16 kB), which was created on Mar. 11, 2020, 2019, which is incorporated by reference herein.
MATERIALS AND METHODS
[0144] Construction of pJAN25
[0145] The gene coding for C. jejuni PglB was amplified by PCR with the pTac promoter and Lacl repressor from plasmid pEXT20 as a template using Pfx Polymerase with (SEQ ID 15: 5-TTTTGCGGCCGCTTCTACGTGTTCCGCTTCC-3-) as forward primer and (SEQ ID 16: 5-TTTTGCGGCCGCATTGCGTTGCGCTCACTGC-3) reverse primer using the following cycling conditions, 94 C./2 minutes followed by 35 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 68 C. for 4 minutes. The PCR product was then cloned in pJET2.0 plasmid (Thermo Scientific U.K.) according to the manufacturer's instructions and named pOST9. The plasmid was maintained in into E. coli DH5a (Stratagene U.K.) The vector pOST9 cut with the restriction enzyme Notl (New England Biolabs U.K. Ltd.) and ligated into the unique NotI site in pUTminiTn5km2 resulting in plasmid pJAN25 and maintained in Transformax E. coli strain EC100D pir+(Cambio U.K.).
[0146] Construction of pFEB11
[0147] The gene coding for C. jejuni AcrA was amplified by PCR with the ter cassette promoter and chloramphenicol resistance cassette from the plasmid pMH5 as a template using (SEQ ID 17: 5-TTTTGCGGCCGCTTCTCATGTTTGACAGCTTATC-3) as forward primer and (SEQ ID 18: 5-TTTTGCGGCCGCAGCGAGTCAGTGAGCGAGG-3) reverse primer using the following cycling conditions, 94 C./2 minutes followed by 35 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 68 C. for 2 minutes. The product was cut by Notl and cloned into the unique Notl site in pUTminiTn5km2 resulting in plasmid pFEB11 and maintained in Transformax E. coli strain EC100D pir+(Cambio U.K.).
[0148] Construction of pEFNOV19
[0149] The gene coding for C. jejuni AcrA was amplified by PCR with the tet cassette promoter and cam resistance cassette from the plasmid pMH5 as a template using (SEQ ID 19: 5-TTTTGCGATCGCTTCTCATGTTTGACAGCTTATC-3) as forward primer and (SEQ ID 20: 5-TTTTAGGCCTAGCGAGTCAGTGAGCGAGG-3) as reverse primer 94 C./2 minutes followed by 35 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 68 C. for 2 minutes. The product was cut by Asisl and Stul(New England Biolabs U.K. Ltd) and cloned in Asisl and Stu/digested pJAN25 generating the plasmid pEFNOV19 and maintained in Transformax E. coli strain EC100D pir+ (Cambio U.K.).
[0150] Construction of pJCUSA1
[0151] We devised a novel transposon cargo loading procedure where the cloning experiments are carried out within a modified version of the commercially available high copy number vector pUC57, this modified plasmid has a chloramphenicol resistance cassette in its backbone from plasmid pMH5 and a Zeocin resistance cassette flanked by loxP sites allowing for downstream removal of antibiotic marker from the final target strain via the introduction of the CRE enzyme. It has a pMB1 origin of replication and thus can be maintained in any E. coli strain prior to being cut out and transferred along with the Zeocin resistance cassette using Sfil restriction enzyme digestion and transfer into the pUT delivery vector thus generating a functional transposon. The sequence of this novel construct is shown below (SEQ ID 21):
TABLE-US-00001 5GGCCGCCTAGGCCGCGGCCGCCTACTTCGTATAGCATACATTATAC GAAGTTATGTCTGACGCTCAGTGGAACGACGCGTAACTCACGTTAAGG GATTTTGGTCATGATCAGCACGTTGACAATTAATCATCGGCATAGTAT ATCGGCATAGTATAATACGACAAGGTGAGGAACTAAAACATGGCCAAG TTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCG GTCGAGTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAG GACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGC GCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGG GTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAGGTCGTGTCC ACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAG CAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGC GTGCACTTCGTGGCCGAGGAGCAGGACTGAATAACTTCGTATAGCATA CATTATACGAAGTTATGGCCGCCTAGGCC-3.
[0152] Bacterial Conjugation
[0153] To enable transfer of the pg/B and acrA transposon cargo into the chromosome of a recipient E. coli strain the plasmids pJAN25, pFEB11 or pEFNOV19 were transferred into the E.coli strain19851pirfor direct mating. When necessary the donor E. coli strain used was E. coli MFD a diaminopimelic acid (DAP) auxotroph. Growth medium was supplemented with kanamycin 50 g/ml and ampicillin 100 g/ml for pJAN25 or pFEB11 whilst chloramphenicol 30 g/ml and ampicillin 100 g/ml were added to maintain pEFNOV19. Both donor and recipient bacteria were growth until late exponential phase. Bacterial cells were pelleted by centrifugation , washed 3 times with PBS and mixed together in a ratio of 1:3 recipient to donor and spotted on a dry LB agar plate with no antibiotics for 4-8 hrs . The cells were scraped and suspended in PBS and dilutions plated on LB agar with appropriate selection antibiotics to select for transconjugants. Individual colonies were picked up and screened for loss of the pUT backbone and for the presence of the transposon.
[0154] Generation of Unmarked pglB Insertion
[0155] The transposon carrying pglB and IoxP recombination sites around a Zeocin resistance cassette was introduced into E. coli. Following selection for Zeocin resistant colonies, the antibiotic selection marker was removed by introduction via electroporation, the temperature sensitive vector pCRE5 (Reference: Appl Environ Microbiol. 2008 February; 74(4): 1064-1075. Genetic Tools for Select-Agent-Compliant Manipulation of Burkholderia pseudomallei. Kyoung-Hee Choi, Takehiko Mima, Yveth Casart, Drew Rholl, Ayush Kumar, Ifor R. Beacham and Herbert P. Schweizer).
[0156] E. coli was cultured at 28 C. in the presence of kanamycin 50 g/ml, rhamnose was added to induce expression at 0.2% final concentration and the organism subcultured several times to select for colonies that had lost resistance to Zeocin but maintained resistance to kanmaycin indicating that the bleomycin resistance gene had been flipped out of the chromosome.
[0157] This E. coli mutant was then sub-cultured at 42 C. to cure out the pCRE5 plasmid. Screening for colonies that had once again become sensitive to kanamycin confirmed loss of pCRE5 and completed generation of an unmarked inducible copy of pglB on the chromosome of E. coli.
[0158] To test glycosylation, this E. coli strain was transformed with the plasmid pACYCpglB::kan (Linton Molecular Microbiology (2005) 55(6), 1695-1703 Functional analysis of the Campylobacter jejuni N-linked protein glycosylation pathway. Dennis Linton, Nick Dorrell, Paul G. Hitchen, Saba Amber, Andrey V. Karlyshev, Howard R. Morris, Anne Dell, Miguel A. Valvano, Markus Aebi and Brendan W. Wren) and the plasmid pWA2 coding for the HIS tagged acceptor protein AcrA (PNAS vol. 102, pp 3016-3021. Engineering N-linked protein glycosylation with diverse O antigen lipopolysaccharide structures in Escherichia coli. Mario F. Feldman, Michael Wacker, Marcela Hernandez, Paul G. Hitchen, Cristina L. Marolda, Michael Kowarik, Howard R. Morris, Anne Dell, Miguel A. Valvano, and Markus Aebi).
[0159] 10 ml of LB broth carrying 30 g/ml of chloramphenicol and 100 g/ml of ampicillin to select for pACYCpgIB::kan were inoculated with a single colony of E. coli strain W3110pglB.
[0160] Cultures were incubated at 37 C. with shaking until an optical density 600 nm of 0.6 was reached. IPTG was added to a final concentration of 1 mM and the cultures were incubated for a further 16 hours overnight. Protein was HIS purified and western blots carried out using anti campy glycan and anti HIS antibodies and the images visualised on an Odyssey LI-COR scanner.
EXAMPLE 1
[0161] The E. coli strain W3110 carrying a plasmid coding for a Streptococcus pneumonia capsular polysaccharide encoded on the plasmid pB4-4 was subjected to conjugation with E. coli 19851 pir+carrying the plasmid pFEB19 coding for an IPTG inducible copy of pg/B and a constitutively expressed copy acrA. Previous attempts to make a glycoconjugate using the standard three plasmid system failed presumably due to the combined toxicity of PglB and the metabolic burden of the polysaccharide coding region. The transposon system resulted for the first time in a stable strain. IPTG was added to induce chromosomal expression of pg/B and HIS tagged AcrA was purified from the cells using NiNTA binding.
EXAMPLE 2
[0162] We have used the transposon pJAN25 carrying an IPTG inducible copy of Cjpg/B to integrate this gene into the chromosomes of glycoengineering E. coli strains W3110, CLM24, CLM37, Se874, SCM7, SCM6, SCM3.
EXAMPLE 3
[0163] We have used the transposon pJAN25 carrying an IPTG inducible copy of Cjpg/B to integrate this gene into the chromosomes of the following organisms: Vibrio cholerae, Yersinia pseudotuberculosis, Citrobacter freundii, Actinobacillus pleuropneumoniae. In the case of Vibro cholerae and Actinobacillus pleuropneumoniae the standard glycoengineering plasmids used in the tri-plasmid system could not be normally maintained in these organisms.
EXAMPLE 4
[0164] pJCUSA1 has been used to generate a transposon with an IPTG inducible copy of Cjpg/B and a Zeocin resistance cassette flanked by loxP recombination sites. This was delivered into a recipient E. coli strain by conjugation. This strain can be cured of Zeocin resistance by the introduction of a CRE recombinase coding plasmid that has a temperature sensitive origin of replication leading to an unmarked E. coli strain capable of generating a glycoconjugate. This is illustrated in
EXAMPLE 5
[0165] Demonstration of the integration of Campylobacter jejuni PglB into the chromosome of Actinobacillus pleuropneumoniae serotype 8.
[0166] E. coli Mu free donor cells (MFD) were transformed with the plasmid pJAN25: Coding for an IPTG inducible copy of CjPgIB carried on a pUTminiTn5km2 transposon backbone. This donor strain was conjugated with Actinobacillus pleuropneumoniae serotype 8 and colonies screened for gain of resistance to kanamycin and no resistance to ampicillin indicating that the transposon had left thebackbone and inserted into the chromosome of A. pleuropneumoniae.
[0167] To demonstrate that this chromosomally inserted copy of pglB was active, membranes were isolated from the newly constructed mutant of A. pleuropneumoniae after expression of pglB was induced. 16 h A. pleuropneumoniae cultures were diluted 1:25 in fresh media and grown to an OD600 of 0.4-0.6. Expression was induced at this point by addition of IPTG to 1 mM. Incubation was resumed for a further 16 h. Cells were harvested by centrifugation.
[0168] Solubilized membranes were prepared by isolating cells expressing CjPgIB and by re-suspending the bacterial cell pellet in 2 ml 50 mM Tris-HCl (pH 7.0), 25 mM NaCl and then lysing the pellet using a GE50 ultrasonic processor. Lysates were centrifuged twice at 40 000g, 4 C. for 20 min to remove unbroken cells. The supernatant was ultracentrifuged at 100 000g, 4 C. for 1 h, and the resulting total membrane pellet resuspended in 2 ml 50 mM Tris-HCl (pH 7.0), 25 mM NaCl, 1% Triton X-100 per gram of initial wet cell pellet. Samples were incubated at room temperature for 1 h then ultracentrifuged once more at 100 000g, 4 C. for 1 hour. Supernatants were collected as Triton X-100-solubilised membrane fractions.
[0169] The in vitro assay was performed by preparing reaction mixtures that typically contained 3p1 of the fluorescently-labelled peptide FAM-ADQNATA-NH2 (30 pM), 1 l MnCl2 (150 mM), 4 l membranes from A. pleuropneumoniae expressing CjPglB and 22 l membrane preparation from E. coli expressing the C. jejuni heptasaccharide. Samples were incubated at 30 C. with agitation for 16 h. Reactions were stopped by the addition of 10 l 4SDS-PAGE gel loading buffer and incubated at 95 C. for 5 min. Samples were loaded on a 4-16% Tricine gel and separated by SDS-PAGE at 30 V for 30 min followed by 200 V for 60 min. Fluorescent peptides were visualized using a Typhoon Trio Imager (