FUSION PEPTIDES OF CD4 HELPER T CELL EPITOPES AND VACCINES THEREOF

20200216516 ยท 2020-07-09

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed are a fusion peptide of CD4 helper T cell epitopes, a nucleic acid encoding the same and an immunogenic composition comprising the same. The epitope fusion peptide comprises a cytomegalovirus epitope and an influenza virus epitope. The epitope fusion peptide can substantially improve the level of cellular immune response to a target immunogen, particularly a weak immunogen, and is an effective means for overcoming the immune tolerance of immune system to an antigen, particularly to a tumor antigen or an infection-related antigen, and is suitable for efficiently enhancing the efficacy of vaccine.

Claims

1. A fusion peptide of CD4 helper T cell epitopes comprising a cytomegalovirus (CMV) epitope and/or an influenza virus epitope.

2. The epitope fusion peptide of claim 1, comprising one or more of CMV epitopes selected from those shown in SEQ ID NOs: 1-10, and/or one or more of influenza virus epitopes selected from those shown in SEQ ID NOs: 11-23.

3. The epitope fusion peptide of claim 1 or 2, consisting of one or more of CMV epitopes selected from those shown in SEQ ID NOs: 1-10, and/or one or more of influenza virus epitopes selected from those shown in SEQ ID NOs: 11-23; preferably, the epitope fusion peptide consists of or 10 CMV epitopes, and/or 8 or 13 influenza virus epitopes, such as the epitope fusion peptide shown in SEQ ID NO: 34 or 44; preferably, the epitope fusion peptide consists of 13 influenza virus epitopes, such as the epitope fusion peptide shown in SEQ ID NO: 48.

4. The epitope fusion peptide of any one of claims 1-3 that induces a humoral or cellular immune response.

5. A fusion protein comprising an epitope fusion peptide of any one of claims 1 to 4, and a target immunogen.

6. The fusion protein of claim 5, wherein the target immunogen is selected from a peptide, an antigen, a hapten, a carbohydrate, a protein, a nucleic acid, an allergen, a virus or a part of a virus, a bacterium, a parasite or other whole microorganism; preferably, the antigen is a tumor antigen or an infection-related antigen; further preferably, the tumor antigen is one or more tumor antigens selected from lung cancer antigen, testicular cancer antigen, melanoma antigen, liver cancer antigen, breast cancer antigen or prostate cancer antigen; preferably, the tumor antigen is one or more tumor antigens selected from LACE antigen, MAGE antigen or NY-ESO-1 antigen; further preferably, the LACE antigen is LAGE-1, and the MAGE antigen is MAGE-A3; preferably, the amino acid sequence of LAGE-1 is shown in SEQ ID NO: 24, the amino acid sequence of MAGE-A3 is shown in SEQ ID NO: 25, and the amino acid sequence of NY-ESO-1 is shown in SEQ ID NO: 26; still further preferably, the tumor antigen comprises LAGE-1, MAGE-A3 and NY-ESO-1; preferably, the infection-related antigen is one or more infection-related antigens selected from an HIV antigen, an influenza virus antigen or an HBV antigen; preferably, the fusion protein is shown in one of SEQ ID NOs: 55-58.

7. A polynucleotide encoding the epitope fusion peptide of any one of claims 1-4 or the fusion protein of claim 5 or 6.

8. An immunogenic composition comprising a prophylactically or therapeutically effective amount of the epitope fusion peptide of any one of claims 1-4, the thsion protein of claim 5 or 6, and/or the polynucleotide of claim 7, and a pharmaceutically acceptable carrier.

9. The immunogenic composition of claim 8 in the form of a vaccine. 10, A kit comprising the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, the polynucleotide of claim 7 and/or the immunogenic composition of claim 8 or 9, and instructions for use thereof.

11. Use of the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, a polynucleotide of claim 7 and/or an immunogenic composition of claim 8 or 9 in the preparation of a medicament for increasing the immunogenicity of a target immunogen.

12. Use of the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, the polynucleotide of claim 7 and/or the immunogenic composition of claim 8 or 9 in the preparation of a vaccine for increasing the immunogenicity of a target immunogen.

13. Use of the epitope fusion peptide of any one of claims 1-4, the fusion protein of claim 5 or 6, the polynucleotide of claim 7 and/or the immunogenic composition of claim 8 or 9 in the preparation of a medicament for treating or preventing a condition in a subject in need thereof.

14. The use of claim 13, wherein the condition is one or more conditions selected from malignant tumors, and bacterial and viral chronic infections.

15. The use of claim 14, wherein the malignant tumor is breast cancer or colon cancer.

Description

DESCRIPTION OF DRAWINGS

[0039] Hereinafter, the embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0040] FIGS. 1 and 2 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-hLMN carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens, respectively.

[0041] FIGS. 3 and 4 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-hLMN-CTB carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens and cholera toxin subunit B, respectively.

[0042] FIGS. 5 and 6 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-C1 carrying the encoding sequences of CMV and Flu virus-derived CD4 epitopes, respectively.

[0043] FIGS. 7 and 8 are a plasmid map and a map of double enzyme digestion for identification of the DNA vaccine vector pVKD1.0-C1-LMNB carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens, cholera toxin subunit B, and CMV and Flu virus-derived CD4 epitopes, respectively.

[0044] FIGS. 9 and 10 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-LMN carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens, respectively.

[0045] FIGS. 11 and 12 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-LMN-CTB carrying the encoding sequences of LAGE-1, MAGE-A3 and NY-ESO-1 antigens and cholera toxin subunit B, respectively.

[0046] FIGS. 13 and 14 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV Th carrying the encoding sequence of a CMV-derived epitope, respectively.

[0047] FIGS. 15 and 16 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV10-LMNB carrying the encoding sequences of a CMV-derived epitope, LAGE-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0048] FIGS. 17 and 18 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV Th carrying the encoding sequences of a Flu virus-derived epitope, respectively.

[0049] FIGS. 19 and 20 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-Influ8-LMNB carrying the encoding sequences of a Flu virus-derived epitope, LAGE-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0050] FIGS. 21 and 22 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-Influ13-LMNB carrying the encoding sequences of a Flu virus-derived epitope, LAGS-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0051] FIG. 23 shows the detection results of cellular immune responses in the animal immunization experiment.

[0052] FIGS. 24 and 25 are a plasmid map and a map of double enzyme digestion for identification of the prokaryotic vector pET-30a(+)-CMV5-LMNB carrying the encoding sequences of a CMV-derived epitope, LAGE-1, MAGE-A3 and NY-ESO-1 antigens, and cholera toxin subunit B, respectively.

[0053] FIG. 26 shows the detection results of cellular immune responses in the animal immunization experiment in Example 12.

[0054] FIG. 27 shows the tumor growth of mice in Example 13.

[0055] FIGS. 28 and 29 show the tumor-free survival and overall survival of mice in Example 13, respectively.

[0056] FIG. 30 shows the tumor growth of mice in each treatment group for the 4T1-hNY-ESO-1 mouse tumor model.

[0057] FIG. 31 shows the tumor growth of mice in each treatment group for the CT26-hLAGE-1 mouse tumor model.

SPECIFIC EMBODIMENTS

[0058] The present invention is described in further detail below with reference to the specific embodiments. The examples are given for the purpose of illustration of the present invention only, and are not intended to limit the scope of the present invention.

EXAMPLE 1

Construction of DNA Vaccine pVKD1.0-hLMN

[0059] The amino acid sequences of LAGE-I, MAGE-A3 and NY-ESO-1 are shown in SEQ ID NOs: 24-26, respectively. By means of an online codon optimization software (http://www.jcatdel), the nucleotide sequences for mammalian codon usage preference as shown in SEQ ID NOs: 27-29 respectively were obtained by optimization based on the above antigen amino acid sequences. The nucleotide sequences were synthesized by Shanghai Generay Biotech Co., Ltd., and then cloned between the multiple cloning sites Sal I and BamH I on the DNA vaccine vector pVKD1.0 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park) by a method well known in the art to construct the DNA vaccine vector pVKD1.0-hLMN capable of expressing the fusion protein as an antigen (the plasmid map is shown in FIG. 1), which was stored after being sequenced for identification. The vector pVKD1.0-hLMN was identified by the restriction endonucleases Sal I and BamH I (the enzyme digestion system is shown in Table 1), and its enzyme digestion map for verification is shown in FIG. 2.

TABLE-US-00001 TABLE 1 Enzyme digestion system for identification of the plasmid pVKD1.0-hLMN (enzyme digestion at 37 C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-hLMN 3 L, about 1 g Sal I (Takara, Cat. No. 1080A) 1 L BamH I (Takara, Cat. No. 1010A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 2

Construction of DNA Vaccine pVKD1.0-hLMN-CTB

[0060] The mammalian codon optimized sequence (SEQ ID NO: 31) of the amino acid sequence (SEQ ID NO: 30) of cholera toxin subunit B (CTB) and its eukaryotic expression vector pVKD1.0-CTB were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The primers were designed by using pVKD1.0-CTB as a template (see Table 2). The CTB gene fragment was amplified by PCR, and the corresponding fragment was then recovered from the gel. The CTB fragment was inserted into a corresponding position on the linearized vector pVKD1.0-hLMN by a homologous recombination method, to construct the DNA vaccine vector pVKD1.0-hLMN-CTB (the plasmid map is shown in FIG. 3), which was stored after being sequenced for identification. The vector pVKD1.0-hLMN-CTB was identified by the restriction endonucleases Sal I and BamH I (the enzyme digestion system is shown in Table 3), and its enzyme digestion map for verification is shown in FIG. 4.

TABLE-US-00002 TABLE2 PrimersinExample2 Primer Sequence 1F(SEQID TCCCTCAGGGCAGAGGCGCATCAAGCTGAAGTTCGG NO:32) CGTG IR(SEQID GAAGGCACAGCAGATCTGGATCCTCAGTTGGCCATG NO:33) CTGATGGC

TABLE-US-00003 TABLE 3 Enzyme digestion system for identification of plasmid pVKD1.0-hLMN-CTB (enzyme digestion at 37 C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-hLMN-CTB 3 L, about 1 g Sal I (Takara, Cat. No. 1080A) 1 L BamH I (Takara, Cat. No. 1010A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 3

Construction of DNA Vaccine pVKD1.0-CI-LMNB

[0061] The strong Th epitopes derived from cytomegalovirus (CMV) and influenza (Flu) virus (see Table 4) were obtained from an immune epitope database (IEDB, http://wwwiedb.org), wherein the strong Th epitopes of CMV include pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104, and the strong Th epitopes of Flu virus include HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221, HA434, HA440, NP324, M1-127 and M1-210. The selected epitopes in Table 4 cover most subtypes of MHC class II molecules in both human and mouse. The selected epitopes pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, NP221 were then linked together in tandem to form an fusion peptide of CMV virus epitopes and Flu virus epitopes having the amino acid sequence shown in SEQ ID NO: 34. The epitope fusion peptide was subjected to mammal codon optimization to give the nucleic acid sequence shown in SEQ ID NO: 35, which was sent to Suzhou Synbio Technologies Co., Ltd for synthesis, and then inserted into the DNA vaccine vector pVKD1.0 (Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park) by a molecular biology method well known in the art to form the vector pVKD1.0-CI (the plasmid map is shown in FIG. 5), and stored after being sequenced fbr identification. The vector pVKD1.0-CI was identified by the restriction endonucleases Pst I and Bgl II (the enzyme digestion system is shown in Table 5) and its enzyme digestion map for verification is shown in FIG. 6.

TABLE-US-00004 TABLE4 ThEpitopesinExample3 EpitopeName Source Aminoacidsequence pp65-11 CMV LLQTGIHVRVSQPSL (SEQIDNO:1) pp65-71 CMV IIKPGKISHIMLDVA (SEQIDNO:2) pp65-92 CMV EHPTFTSQYRIQGKL (SEQIDNO:3) pp65-123 CMV AGILARNLNPMVATV (SEQIDNO:4 pp65-128 CMV KYQEFFWDANDIYRI (SEQIDNO:5) pp65-57 CMV KVYLESFCEDVPSGK (SEQIDNO:6) pp65-62 CMV TLGSDVEEDLTMTRN (SEQIDNO:7) pp65-30 CMV PLKMLNIPSINVHHY (SEQIDNO:8) pp65-112 CMV ACTSGVMTRGRLKAE (SEQIDNO:9) pp65-104 CMV TERKTPRVTGGGAMA (SEQIDNO:10) HA203 Influ NQRALYHTENAYVSVVS (SEQIDNO:11) NP438 Influ SDMRAEIIKMMESARPE (SEQIDNO:12) NS1-84 Influ ALASRYLTDMTIEEMSR (SEQIDNO:13) M1-181 Influ LASTTAKAMEQMAGSSE (SEQIDNO:14) HA375 Influ SGYAADQKSTQNAINGITNKVN (SEQIDNO:15) NP24 influ EIRASVGKMIDGIGRFYI (SEQIDNO:16) NP95 influ PIYRRVDGKWMRELVLY (SEQIDNO:17) NP221 Influ RMCNILKGKFQTAAQRAM (SEQIDNO:18) HA434 Influ IWTYNAELLVLLENERT (SEQIDNO:19) HA440 Influ ELLVLLENERTLDFHDS (SEQIDNO:20) NP324 Influ HKSQLVWMACNSAAFED (SEQIDNO:21) M1-127 Influ CMGLIYNRMGAVTTESA SEQIDNO:22) M1-210 Influ RQMVQAMRAIGTHPSSSTGLKND SEQIDNO:23)

TABLE-US-00005 TABLE 5 Enzyme digestion system for identification of plasmid pVKD1.0-CI (enzyme digestion at 37 C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-CI 3 L, about 1 g Pst I (Takara, Cat. No. 1073A) 1 L Bgl II (Takara, Cat. No. 1021A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

[0062] Finally, the primers were designed by using the vector pVKD1.0-hLMN-CTB in Example 2 as a template (see table 6). The target gene fragment hLMN-CTB was amplified by PCR, and was then inserted between the restriction sites Not I and Bam HI on the pVKD1.0-CI vector by a molecular biology method well known in the art to construct the DNA vaccine vector pVKD1.0-CI-LNINB (the plasmid map is shown in FIG. 7), which was stored after being sequenced for identification. The vector pVKD1.0-CI-LMNB was identified by the restriction endonucleases Barn HI and EcoR V (the enzyme digestion system is shown in Table 7), and its enzyme digestion map for verification is shown in FIG. 8.

TABLE-US-00006 TABLE6 PrimersinExample3 Primer Sequence 3F(SEQID GCGCGGCCGCTGTCACCGTCGTCGACATGCAGGCCG NO:36) AA 3R(SEQID GCGATCCTCAGTTGGCCATGCTGATGGCGGCGATG NO:3

TABLE-US-00007 TABLE 7 Enzyme digestion system for identification of plasmid pVKD1.0-CI-LMNB (enzyme digestion at 37 C., 2 h) Enzyme digestion system Volume Plasmid pVKD1.0-CI-LMNB 3 L, about 1 g Bam HI (Takara, Cat, No. 1010A) 1 L EcoR V (Takara, Cat. No. 1042A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 4

Construction of LMN Prokaryotic Expression Vector

[0063] The amino acid sequences of LAGE-1, MAGE-A3 and NY-ESO-1 are shown in SEQ ID NOs: 24-26, respectively. By means of an online codon optimization software (http://www.jcat.de/), the nucleotide sequences for E. coli codon usage preference shown in SEQ ID NOs: 38-40 respectively were obtained through optimization based on the antigen amino acid sequences. The nucleotide sequences were synthesized by Suzhou Synbio Technologies Co., Ltd., and then inserted between the multiple cloning sites Nco I and Xho I on the prokaryotic expression vector pET-30a(+) (Novagen, Cat. No. 69909) by a molecular biology method well known in the art to construct the prokaryotic expression construct pET-30a(+)-LMN (the plasmid map is shown in FIG. 9), which was stored after being sequenced for identification. The vector pET-30a(+)-LMN was identified by the restriction endonucleases Nco I and Xho I (the enzyme digestion system is shown in Table 8), and its enzyme digestion map for verification is shown in FIG. 10.

TABLE-US-00008 TABLE 8 Enzyme digestion system for identification of plasmid pET-30a(+)-LMN (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-LMN 3 L, about 1 g Nco I (Takara, Cat. No. 1160A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 5

Construction of LMN-CTB Prokaryotic Expression Vector

[0064] The amino acid sequence of cholera toxin subunit B (CTB) (SEQ ID NO: 30) and its prokaryotic codon optimized nucleic acid sequence (SEQ ID NO: 41) were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The primers were designed (see table 9), and a nucleic acid fragment containing the CTB encoding sequence was amplified by a PCR method using the pET-30a(+)-CTB (Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park) as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted into the pET-30a(+)-LMN vector by means of homologous recombination to construct the pET-30a(+)-LMN-CTB vector (the plasmid map is shown in FIG. 11), which was stored after being sequenced for identification. The vector pET-30a(+)-LMN-CTB was identified by the restriction endonucleases Nco I and Xho I (the enzyme digestion system is shown in Table 10), and its enzyme digestion map for verification is shown in FIG. 12.

TABLE-US-00009 TABLE9 PrimersinExample5 Primer Sequence 5F(SEQID GGTGGTGGTGGTGCTCGAGTTAGTTAGCCATAGAGA NO:42) 5R(SEQID TCTGCGTGAAGGTGAAGAAGCTCAGGCTGAAGGTCG NO:43) TGG

TABLE-US-00010 TABLE 10 Enzyme digestion system for identification Example 5 (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-LMN-CTB 3 L, about 1 g Nco I (Takara, Cat. No. 1160A) 1 L Xho 1 (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 6

Construction of Prokaryotic Expression Vector Containing Fusion Protein of LMN-CTB and CMV Th Epitopes

[0065] Ten (10) CMV-derived Th epitopes pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104 were selected from Table 4, and linked together in tandem to form the amino acid sequence shown in SEQ ID NO: 44, wherein the sequence segment EFELRRQ in SEQ ID NO: 44 is formed due to the introduction of enzyme restriction site, which belongs to a common technique for fusion and construction. By means of an online codon optimization software (http://www.jcat.del), the nucleotide sequence for E. coli codon usage preference (SEQ ID NO: 45) was obtained through optimization based on the amino acid sequence of Th epitopes. The nucleotide sequence was synthesized by Shanghai Generay Biotech Co., Ltd., and then inserted between the multiple cloning sites Nco I and Xho I on the prokaryotic expression vector pET-30a(+) (Novagen, Cat. No. 69909) by a molecular biology method well known in the art to construct the prokaryotic expression construct pET-30a(+)-CMV Th (the plasmid map is shown in FIG. 13) capable of expressing the fusion protein as an antigen, which was stored after being sequenced for identification. The vector pET-30a (+)-CMV Th was identified by the restriction endonucleases Mlu I and Xho I (the enzyme digestion system is shown in Table 11), and its enzyme digestion map for verification is shown in FIG. 14.

[0066] As shown in FIG. 13, CMV Th1 contains 5 CMV Th epitopes consisting of pp65-1L pp65-71, pp65-92, pp65-123 and pp65-128 in tandem, and CMV Th2 contains 5 CMV Th epitopes consisting of pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104. Three restriction enzyme sites such as EcoR I, Sac I and Sal I were introduced between CMV Th1 and CMV Th2.

TABLE-US-00011 TABLE 11 Enzyme digestion system for identification of plasmid pET-30a(+)-CMV Th (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-CMV Th 3 L, about 1 g Mlu I (Takara, Cat. No. 1071A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

[0067] The Primers were designed (see Table 12), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted between Not I and Xho I on the pET-30a(+)-CMV Th vector in Example 6 by a molecular biology method well known in the art to construct the pET-30a(+)-CMV10-LMNB vector (the plasmid map is shown in FIG. 15), which was stored after being sequenced for identification. The vector pET-30a(+)-CMV10-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 13) and its enzyme digestion map for verification is shown in FIG. 16. As shown in FIG. 15, pET-30a(+)-CMV10-LMNB contains CMV Th1 and CMV Th2 fragments, i.e. all 10 CMV Th epitopes in Table 4. These epitopes are pp65-11, pp65-71, pp65-92, pp65-123, pp65-128, pp65-57, pp65-62, pp65-30, pp65-112 and pp65-104.

TABLE-US-00012 TABLE12 PrimerdesigninExample6 Primer Sequence 6F(SEQIDNO:46 GCGCGGCCGCGACGACAAGGCCATGGCT 6R(SEQIDNO:47) GCCTCGAGGTTAGCCATAGAGATAGC

TABLE-US-00013 TABLE 13 Enzyme digestion system for identification of pET-30a(+)-CMV10-LMNB (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-CMV10-LMNB 3 L, about 1 g BamH I (Takara, Cat. No. 1010A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 7

Construction of Prokaryotic Expression Vector Containing Fusion Protein of LMN-CTR and Influ Th Epitopes

[0068] Thirteen (13) Th Epitopes derived from Flu virus, HA203, NP438, NSI-84, M1-181, HA375, NP24, NP95, NP221, HA434, HA440, NP324, M1-127 and M1-210 were selected from Table 4, and linked together in tandem to form the amino acid sequence shown in SEQ ID NO: 48. By means of an online codon optimization software (http://www.jcat.de/), the nucleotide sequence for E. coli codon usage preference (SEQ ID NO: 49) was obtained through optimization based on the amino acid sequence containing Flu virus Th epitopes. The nucleotide sequence was synthesized by Shanghai Generay Biotech Co., Ltd., and then inserted between the multiple cloning sites Nco I and Xho I on the prokaryotic expression vector pET-30a(+) (Novagen, Cat. No. 69909) by a molecular biology method well known in the art to construct the prokaryotic expression construct pET-30a(+)-Influ Th (the plasmid map is shown in FIG. 17) capable of expressing the fusion protein as an antigen, which was stored after being sequenced for identification. The vector pET-30a(+)-Influ Th was identified by the restriction endonucleases Nco I and Xho I (the enzyme digestion system is shown in Table 14), and its enzyme digestion map for verification is shown in FIG. 18.

[0069] As shown in FIG. 17, Influ Th1 contains 8 Flu virus Th epitopes consisting of HA203, NP438, HA375, NP24, NP95 and NP221 in tandem, and Influ Th2 contains 5 Flu virus Th epitopes consisting of RA434, HA440, NP324, M1-127 and M1-210. Three restriction sites such as EcoR 1, Sac I and Sal I were introduced between Influ Th1 and Influ Th2.

TABLE-US-00014 TABLE 14 Enzyme digestion system for identification in Example 7 (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-Influ Th 3 L, about 1 g Nco I (Takara, Cat. No. 1160A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

[0070] The primers were designed (see Table 15), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted between Not I and Sal I on the pET-30a(+)-Influ Th vector in Example 7 by a molecular biology method well known in the art to construct the pET-30a(+)-Influ8-LMNB vector (containing 8 Flu virus Th epitopes; the plasmid map is shown in FIG. 19), which was stored after being sequenced for identification. The vector pET-30a(+)-Influ8-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 16) and its enzyme digestion map for verification is shown in FIG. 20. As shown in FIG. 19, the pET-30a(+)-Influ8-LMNB vector contains the Influ Th1 segment, i.e., 8 Flu virus Th epitopes including HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, and NP221 in Table 4.

TABLE-US-00015 TABLE15 PrimersinExample7 Primer Sequence 7F1(SEQIDNO;50) GGCGGCCGCGTTAGCCATAGAGATAGC 7R1(SEQIDNO:51) GCGTCGACAAGACGACAAGGCCATGGC TATGC

TABLE-US-00016 TABLE 16 Enzyme digestion system for identification of plasmid pET-30a(+)-Influ8-LMNB (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-Influ8-LMNB 3 L, about 1 g BamH I (Takara, Cat. No. 1010A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

[0071] The primers were designed (see Table 17), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) was referred to for the specific method. This nucleic acid fragment was then inserted between Not I and Xho I on the pET-30a(+)-Influ Th vector in Example 6 by a molecular biology method well known in the art to construct the pET-30a(+)-Influ13-LMNB vector (containing 13 Flu virus Th epitopes; the plasmid map is shown in FIG. 21), which was stored after being sequenced for identification. The vector pET-30a(+)-CMV10-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 18) and its enzyme digestion map for verification is shown in FIG. 22.

[0072] As shown in FIG. 21, the pET-30a(+)-Influ13-LMNB vector contains both the Influ Th1 and Influ Th2 segments, i.e., 8 Flu virus Th epitopes including HA203, NP438, NS1-84, M1-181, HA375, NP24, NP95, and NP221 in Table 4, and 5 Flu virus Th epitopes including HA434, HA440, NP324, M1-127 and M1-210 in Table 4, The vector includes all 13 Flu virus Th epitopes in total in Table 4

TABLE-US-00017 TABLE17 PrimerdesigninExample7 Primer Sequence 7F2(SEQIDNO:52) GCCTCGAGGTTAGCCATAGAGATAGCA 7R2(SEQIDNO:53) GCGCGGCCGCGACGACAAGGCCATGGC TATG

TABLE-US-00018 TABLE 18 Enzyme digestion system for identification in Example 7 (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-Influ13-LMNB 3 L, about 1 g BamH I (Takara, Cat. No. 1010A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 8

Expression and Purification of Fusion Protein

[0073] The prokaryotic expression vector pET-30a(+)-LMN constructed in Example 4, the prokaryotic expression vector pET-30a(+)-LMN-CTB constructed in Example 5, the prokaryotic expression vectors pET-30a(+)-CMV5-LMNB and pET-30a(+)-CMV10-LMNB constructed in Example 6, the prokaryotic expression vectors pET-30a(+)-Influ8-LMNB and pET-30a(+)-Influ13-LMNB constructed in Example 7 were respectively transformed into BL21 (DE3) competent cells (Tiangen Biotech (Beijing) Co., Ltd., Cat. No. CB105; the instructions of competent cells were referred to for the transformation method) to prepare the recombinant proteins LMN (its amino acid sequence is shown in SEQ ID NO: 59), LMNB (its amino acid sequence is shown in SEQ ID NO: 54), LMNB-C10 (its amino acid sequence is shown in SEQ ID NO: 58), LMNB-18 (its amino acid sequence is shown in SEQ ID NO: 55), and LMNB-13 (its amino acid sequence is shown in SEQ ID NO: 56) according to the pET System Manual (TB055 8th Edition February 1999, Novagen respectively, which were stored at 80 C. after subpackage.

[0074] The concentrations of the recombinant proteins prepared are 1 mg/mL, as detected by a BCA method (Beyotime Institute of Biotechnology, Cat. No. P0009), and the instructions of detection kit were referred to for the detection method. The contents of endotoxin in the prepared recombinant proteins were less than IEU/mg, as measured by a gel method (Chinese Horseshoe Crab Reagent Manufactory Co., Ltd., Xiamen, Cat. No. G011000), which meet the requirements of an animal experiment, and the instructions of horseshoe crab agent were referred to for the detection method.

EXAMPLE 9

Animal Immunization Experiment

[0075] The information of the vaccines prepared in Examples 2, 3 and 8 is shown in Table 19. The DNA vaccine vector pVKD1.0 was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park, and the Flu antigen NP (NCBI reference sequence: YP_009118476.1) of the DNA vaccine pVKD1.0-NP (the expression is derived from the virus strain A/Shanghai/02/2013 (H7N9)) was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park, and the protein vaccine VP1 (VP1 protein of enterovirus 71, see the Chinese Patent Application No. 201310088364.5) was provided by the Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park.

[0076] Sixteen (16) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 20. All DNA vaccines were injected into the tibialis anterior muscle of the calf at 100 g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 g/animal. Two weeks after the last immunization, the mice were sacrificed, and their serum and splenocytes were collected for an enzyme-linked immunospot (ELISPOT) assay and an enzyme-linked immunosorbent assay (ELISA), respectively. The mouse IFN- ELISPOT kit was purchased from BD, USA (Cat. No. 551083), and the instructions of IFN- ELISPOT kit from BD were referred to for the method. The stimulating peptide was NY-ESO-1 41# peptide (WITQCFLPVFLAQPP) synthesized by Shanghai Science Peptide Biological Technology Co., Ltd., with the final concentration of 10 g/mL. The positive stimuli phorbol-12-myristate-13-acetate (PMA) and ionomycin were purchased from Sigma, USA.

[0077] An ELISA method is well known for a person skilled in the art, and is briefly described below. The 96-Well ELISA plates were purchased from Jianghai Glass Instrument General Factory. Both the recombinant LMN and NY-ESO-1 were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The plates were coated with the proteins in NaHCO.sub.3 buffer (pH 9.6) at 4 C. overnight at a coating concentration of 10 g/mL, followed by blocking with 0.1% bovine serum albumin (BSA) in phosphate buffered saline (PBS) at 37 C. for 30 minutes and then washing 5 times with 0.5% Tween 20 in phosphate buffered saline (PBST). An incubation with the mouse serum at room temperature was carried out for 1 hour at an initial dilution of 1:100 and washed 5 times with PBST, and another incubation with goat anti-mouse HRP secondary antibody (Santacruz, USA) was carried out at 1:5000 at 37 C. for 30 min. After being washing 5 times with PBST, the substrate was developed with 3,3,5,5-tetramethylbenzidine (TMB) at 37 C. for 15 min and stopped with 2M dilute sulfuric acid, and then the absorbance (A) values were read at 450 nm using a microplate reader (Thermo, USA). A value which is 2.1 times greater than the negative control A value was judged to be positive, and the reciprocal of the highest dilution with respect to the positive values was defined as the serum antibody titer. A titer was defined as 50 when it was less than the initial dilution of 1:100.

TABLE-US-00019 TABLE 19 Vaccine information Vaccine Attribute Antigen CD4 Th epitope pVKD1.0-LMN-CTB DNA LAGE-1, Epitope-free MAGE-A3, NY-ESO-1, pVKD1.0-CI-LMNB DNA LAGE-1, 5 CMV epitopes, MAGE-A3, 8 influenza virus NY-ESO-1 epitopes pVKD1.0-CI DNA None 5 CMV epitopes, 8 influenza virus epitopes pVKD1.0-NP DNA NP 5 influenza virus epitopes LMNB Recombinant LACE-1, Epitope-free protein MAGE-A3, NY-ESO-1 LMNB-18 Recombinant LAGE-1, First 8 influenza protein MAGE-A3, virus epitopes NY-ESO-1 LMNB-I13 Recombinant LAGE-1, 13 influenza virus protein MAGE-A3, epitopes NY-ESO-1 LMNB-C5 Recombinant LAGE-1, First 5 CMV protein MAGE-A3, epitopes NY-ESO-1 LMNB-C10 Recombinant LAGE-1, 10 CMV epitopes protein MAGE-A3, NY-ESO-1 VP1 Recombinant VP1 Epitope-free protein

TABLE-US-00020 TABLE 20 Grouping and immunization schemes Week 0, 4, 8 Week 12, 16, 20 Week 24 Week 28 Grouping Vaccine Dose Vaccine Dose Vaccine Dose Vaccine Dose A(n = 4) pVKD1.0-NP 100 g pVKD1.0 100 g VP1/CFA 100 g VPI/IFA 100 g B(n = 4) pVKD1.0-NP 100 g pVKD 1.0- 100 g LMNB/CFA 100 g LMNB/IFA 100 g LMNB C(n = 4) pVKD1.0-NP 100 g pVKD 1.0- 100 g LMNB- 100 g LMNB- 100 g CI-LMNB I8/CFA I8/IFA D(n = 4) pVKD1.0-NP 100 g pVKD 1.0- 100 g LMNB- 100 g LMNB- 100 g CI-LMNB I13/CFA I13/IFA

[0078] The results of cellular immune response assay are shown in FIG. 23. Among them, the group primed with pVKD1.0-CI-LMNB DNA vaccine and boosted with LMNB-I13 protein (i.e., group D in Example 8) had the best immune effect, which was significantly higher than those of the parallel control group (group B) and the group boosted with LMNB-18 (group C). Moreover, the level of cellular immune response in the group boosted with LMNB-I13 protein was nearly 3-fold higher than that in the parallel control group (group B). The results showed that a load of 13 Flu virus Th epitopes (group D) could significantly increase the cellular immune response level of weak immunogens.

EXAMPLE 10

Construction of Prokaryotic Expression Vector Containing Fusion Protein of LMN-CTB and CMV Th Epitope

[0079] The primers were designed (see Table 21), and a nucleic acid fragment containing the LMN-CTB encoding sequence was amplified by a PCR method using pET-30a(+)-LMN-CTB in Example 5 as a template, and the instructions of Ex Taq Enzyme Reagent (Takara, Cat. No. RR001B) were referred to for the specific method. The nucleic acid fragment was then inserted between Not I and Sal I on the pET-30a(+)-CMV Th vector in Example 6 by a molecular biology method well known in the art to construct the pET-30a(+)-CMV5-LMNB vector (the plasmid map is shown in FIG. 24), which was stored after being sequenced for identification. The vector pET-30a(+)-CMV5-LMNB was identified by the restriction endonucleases BamH I and Xho I (the enzyme digestion system is shown in Table 22) and its enzyme digestion map for verification is shown in FIG. 25. As shown in FIG. 24, pET-30a(+)-CMV5-LMNB contains a CMV Th1 fragment, i.e. the first 5 CMV Th epitopes in Table 4. These epitopes are pp65-11, pp65-71, pp65-92, pp65-123 and pp65-128.

TABLE-US-00021 TABLE21 PrimerdesigninExample10 Primer Sequence 7F1(SEQIDNO:50) GCGCGGCCGCGTTAGCCATAGAGATAGC 7R1(SEQIDNO:51) GCGTCGACAAGACGACAAGGCCATGGCT ATGC

TABLE-US-00022 TABLE 22 Enzyme digestion system for identification of pET-30a(+)-CMV10-LMNB (enzyme digestion at 37 C., overnight) Enzyme digestion system Volume Plasmid pET-30a(+)-CMV10-LMNB 3 L, about 1 g BamH I (Takara, Cat. No. 1010A) 1 L Xho I (Takara, Cat. No. 1094A) 1 L Enzyme digestion buffer 1 L ddH.sub.2O q.s. to 10 L

EXAMPLE 11

Expression and Purification of Fusion Protein

[0080] As described in Example 8, the prokaryotic expression vector pET-30a(+)-CMV5-LMNB constructed in Example 10 was transformed into BL21 (DE3) competent cells ('Tangen Biotech (Beijing) Co., Ltd., Cat. No. CB105; the instructions of competent cells were referred to for the transformation method) to prepare the recombinant protein LMNB-05 (its amino acid sequence is shown in SEQ ID NO: 57) according to the pET System Manual (TB055 8th Edition February 1999, Novagen), which was stored at 80 C. after subpackage.

[0081] The concentration of the recombinant protein prepared was 1 mg/mL, as detected by a BCA method (Beyotime Institute of Biotechnology, Cat. No. P0009), and the instructions of detection kit were referred to for the detection method. The content of endotoxin in the prepared recombinant protein was less than IEU/mg, as measured by a gel method (Chinese Horseshoe Crab Reagent Manufactory Co., Ltd., Xiamen, Cat. No. G011000), which met the requirements of an animal experiment, and the instructions of Horseshoe Crab agent were referred to for the detection method.

EXAMPLE 12

Animal Immunization Experiment

[0082] The vaccine information is shown in Table 19. The DNA vaccine pVKD1.0-CI (Example 3) was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park.

[0083] Twenty (20) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 23. All DNA vaccines were injected into the tibial anterior muscle of the calf at 1.00 g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA), and injected subcutaneously into the back at 10 g/animal. Two weeks after the last immunization, the mice were sacrificed, and serum and splenocytes were collected for an enzyme-linked immunospot (ELISPOT) assay and an enzyme-linked immunosorbent assay (ELISA), respectively. The mouse IFN- ELISPOT kit was purchased from BD, USA (Cat. No. 551083), and the instructions of IFN- ELISPOT kit from BD were referred to for the method. The stimulating peptide was NY-ESO-1 41# peptide (WITQCFLPVFLAQPP) synthesized by Shanghai Science Peptide Biological Technology Co., Ltd., with a final stimulating concentration of 10 g/mL. The positive stimuli phorbol-12-myristate-13-acetate (PMA) and ionomycin were purchased from Sigma, USA.

[0084] An ELISA method is well known in the art and briefly described below. 96-Well ELISA plates were purchased from Jianghai Glass Instrument General Factory. Both recombinant LMN and NY-ESO-1 were provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park. The plates were coated with the proteins in NaHCO.sub.3 buffer (pH 9.6) at 4 C. overnight at a coating concentration of 10 g/mL, followed by blocking with 0.1% bovine serum albumin (BSA) in phosphate buffered saline (PBS) at 37 C. for 30 minutes and then washing 5 times with 0.5% Tween 20 in phosphate buffered saline (PBST). An incubation with mouse serum was carried out at room temperature for 1 hour at an initial dilution of 1:100 and washed 5 times with PBST. Another incubation with goat anti-mouse HRP secondary antibody (Santacruz, USA) was carried out at 1:5000 at 37 C. for 30 min, and washed 5 times with PBST. The substrate was then developed with 3,3,5,5-tetramethylbenzidine (TMB) at 37 C. for 15 min and stopped with 2M dilute sulfuric acid, and the absorbance (A) values were read at 450 nm using a microplate reader (Thermo, USA). A value which is 2 times greater than the negative control A value was judged to be positive, and the reciprocal of the highest dilution with respect to the positive values was defined as the serum antibody titer. A titer was defined as 50 when it was less than the initial dilution of 1:100.

TABLE-US-00023 TABLE 23 Grouping and immunization schemes Week 0, 4, 8 Week 12, 16, 20 Week 24 Week 28 Grouping Vaccine Dose Vaccine Dose Vaccine Dose Vaccine Dose A (n = 5) pVKD1.0-CI 100 g pVKD1.0 100 g VP1/CFA 100 g VPI/IFA 100 g B (n = 5) pVKD1.0-CI 100 g pVKD1.0-LMNB 100 g LMNB/CFA 100 g LMNB/IFA 100 g C (n = 5) pVKD1.0-CI 100 g pVKD1.0-CI-LMNB 100 g LMNB-C5/CFA 100 g LMNB-C5/CFA 100 g D (n = 5) PVKD1.0-CI 100 g pVKD1.0-CI-LMNB 100 g LMNB-C10/CFA 100 g LMNB-C10/CFA 100 g

[0085] The results of cellular immune response assay are shown in FIG. 26. Among them, the group primed with the pVKD1.0-CI-LMNB DNA vaccine, boosted with the LMNB-C5 protein (i.e. group C in Example 11) and boosted with the LMNB-C10 protein (i.e. group D in Example 11) had the best immune effect, which was significantly higher than that in the parallel control (group B). The results showed that a load of 5 CMV virus Th epitopes (group C) and 10 CMV virus Th epitopes (group D) could significantly improve the cellular immune response of weak immunogens.

EXAMPLE 13

Animal Experiment for Tumor Prevention

[0086] The information of vaccines prepared in Examples 2, 3 and 8 is shown in Table 19. The DNA vaccine vector pVKD1.0 was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park, and the Flu antigen NP (NCBI reference sequence: YP_009118476.1) of the DNA vaccine pVKD1.0-NP (the expression is derived from the virus strain A/Shanghai/02/2013 (H7N9)) was provided by Vacdiagn. Biotechnology Co., Ltd., Suzhou Industrial Park, and the protein vaccine VPI (VPI protein of enterovirus 71, see the Chinese Patent Application No. 201310088364.5) was provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park.

[0087] Sixty (60) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 24. All DNA vaccines were injected into the tibials anterior muscle of the calf at 100 g/animal protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 g/animal. Two weeks after the last immunization, the mice were inoculated subcutaneously with the cell line transfected stably by 4T1-hNY-ESO-1 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park), at an inoculation dose of 110.sup.5 cells/mouse, and the tumor growth was continuously observed and measured after the inoculation. The tumor volume was calculated according to the following equation: tumor volume (mm.sup.3)=lengthwidth.sup.2/2. The mice were sacrificed when the tumor volume exceeded 2000 mm.sup.3.

TABLE-US-00024 TABLE 24 Grouping and immunization schemes Week 0, 4, 8 Week 12, 16, 20 Week 24 Week 28 Grouping Vaccine Dose Vaccine Dose Vaccine Dose Vaccine Dose A (n = 10) pVKD1.0-NP 50 g pVKD1.0 100 g VP1/CFA 10 g VP1/IFA 10 g pVKD1.0-CI 50 g B (n = 10) pVKD1.0-NP 50 g pVKD1.0-LMNB 100 g LMNB/CFA 10 g LMNB/IFA 10 g pVKD1.0-CI 50 g C (n = 10) pVKD1.0-NP 50 g pVKD1.0-CI-LMNB 100 g LMNB-I8/CFA 10 g LMNB-I8/IFA 10 g pVKD1.0-CI 50 g D (n = 10) pVKD1.0-NP 50 g pVKD1.0-CI-LMNB 100 g LMNB-I13/CFA 10 g LMNB-I13/IFA 10 g pVKD1.0-CI 50 g E (n = 10) pVKD1.0-NP 50 g pVKD1.0-CI-LMNB 100 g LMNB-I13/CFA 10 g LMNB-C10/IFA 10 g pVKD1.0-CI 50 g F (n = 10) pVKD1.0-NP 50 g pVKD1.0-CI-LMNB 100 g LMNB-C10/CFA 5 g LMNB-C10/IFA 5 g pVKD1.0-CI 50 g LMNB-I13/CFA 5 g LMNB-I13/IFA 5 g

[0088] The tumor growth of immunized mice in each group is shown in FIG. 27. Among them, all the mice in the control group (group A) developed tumors on the 14th day after the tumor challenge (i.e. after the tumor innoculation), and the tumors grew rapidly. The tumor growth of mice in each immunization group lagged behind that in the control group, wherein the mice in the group boosted with LMNB-I13 (group D) and the nice in the group boosted with a mixture of LMNB-I13 and LMNB-C10 (group E) had the slowest tumor growth, so these two groups of vaccines had the best effects.

[0089] In addition, an analysis of tumor-free survival was performed for the mice, and the results are shown in FIG. 28. The median tumor-free survival (TFS) of the mice in the control group A was 14 days. The tumor-free survival of the mice in each vaccine immunized group was significantly higher than that in the control group, indicating that all vaccines could increase the tumor-free survival of immunized mice. Among them, group D with the I13 epitope fusion peptide, and group E and F with the I13 and C10 epitope fusion peptide had the best effects, and the tumor-free survival of mice was doubled at the most. In the vaccine group with the I13 epitope fusion peptide (group D), the tumor-free survival was significantly increased by about 40% compared to the conventional vaccine group (group B), showing that a load of 13 Th epitopes of Flu virus or 10 Th epitopes of CMV could significantly improve the protection effect of tumor vaccine against tumor.

[0090] Finally, an analysis of mouse overall survival was also performed and the results are shown in FIG. 29. Among them, the median overall survival (OS) of mice in control group A was 35 days. The overall survival of mice in each vaccine immunized group was significantly higher than that in the control group, indicating that all vaccines could increase the survival of mice after immunization. Among them, group D with I13 epitope fusion peptide and groups E and F with I13 and C10 epitope fusion peptides had the best effects, and the overall survival rate was increased by 83%. Compared with the conventional vaccine group (group B), the vaccine group with the I13 epitope fusion peptide (groups D and group F) significantly increased the tumor-free survival by 28% at the most, indicating that a load of thirteen (13) Flu virus Th epitopes or ten (10) CMV Th epitopes could greatly improve the tumor protection effect of tumor vaccine.

EXAMPLE 14

Tumor Treatment Experiment

[0091] The vaccines involved are shown in Example 9. Thirty (30) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 25. All DNA vaccines were injected into the tibialis anterior muscle of the calf at 100 g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 g/animal. Two weeks after the last immunization, the mice were inoculated subcutaneously with the cell line transfected stably by the tumor cells 4T1-hNY-ESO-1 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park), at a dose of 110.sup.5 cells/mouse, and the corresponding mice were inoculated subcutaneously with the protein vaccine on day 1, 8 and 15 after the tumor cell inoculation, respectively. The tumor growth was continuously observed and measured after the inoculation. The tumor volume was calculated according to the following equation: tumor volume (mm.sup.3)=lengthwidth.sup.2/2. The mice were sacrificed when the tumor volume exceeded 2000 mm.sup.3.

TABLE-US-00025 TABLE 25 Grouping and immunization schemes Week 0, 4, 8 Week 10 Week 11, 12 Grouping Vaccine Dose Vaccine Dose Vaccines Dose A (n = 10) pVKD1.0-NP 100 g pVKD1.0 100 g VP1/CFA 10 g B (n = 10) pVKD1.0-NP 100 g LMNB/CFA 10 g LMNB/IFA 10 g C (n = 10) pVKD1.0-NP 100 g LMNB-I13/CFA 10 g LMNB-I13/IFA 10 g

[0092] The tumor growth of immunized mice in each group is shown in FIG. 30. Among them, all the mice in the control group (group A) developed tumors on the 14th day after the tumor challenge (i.e. after the tumor innoculation), and the tumors grew rapidly. The mice in the LMNB-I13 protein vaccine treated group (group C) had the slowest tumor growth compared to the untreated control group (group A). Furthermore, the tumor size of mice in the LMNB-I13 protein vaccine treated group was significantly smaller than that in the control group (group A) on day 22 after the tumor challenge, and there was still a significant difference in tumor size between the two groups until day 30. By day 35, the tumor growth of mice began to accelerate in group C, which is possibly associated with the cease of vaccination with the LMNB-I13 protein vaccine. The results indicated that the LMNB-I13 protein vaccine could inhibit tumor growth in mice.

EXAMPLE 15

Tumor Treatment Experiment

[0093] The vaccines involved are shown in Example 9. Thirty (30) 6-8 weeks old female BAL B/c mice were purchased from the Laboratory Animal Center of Suzhou University and raised in the SPF animal house of the Laboratory Animal Center of Suzhou University. The experimental animal grouping and vaccination schemes are shown in Table 26. All DNA vaccines were injected into the tibialis anterior muscle of the calf at 100 g/animal. All protein vaccines were fully emulsified with complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA) and injected subcutaneously into the back at 10 g/animal. Two weeks after the last immunization, the mice were inoculated subcutaneously with the cell line transfected stably by the tumor cells CT26-hLAGE-1 (provided by Vacdiagn Biotechnology Co., Ltd., Suzhou Industrial Park), at an inoculation dose of 110.sup.5 cells/mouse, and the corresponding mice were inoculated subcutaneously with the protein vaccine on day 1, 8 and 15 after the tumor cell inoculation, respectively. The tumor growth was continuously observed and measured after the inoculation. The tumor volume was calculated according to the following equation: tumor volume (mm.sup.3)=lengthwidth.sup.2/2. The mice were sacrificed when the tumor volume exceeded 2000 mm.sup.3.

TABLE-US-00026 TABLE 26 Grouping and immunization schemes Week 0, 4, 8 Week 10 Week 11, 12 Grouping Vaccine Dose Vaccine Dose Vaccine Dose A (n = 10) pVKD1.0-NP 100 g pVKD1.0 100 g VP1/CFA 10 g B (n = 10) pVKD1.0-NP 100 g LMNB/CFA 10 g LMNB/IFA 10 g C (n = 10) pVKD1.0-NP 100 g LMNB-I13/CFA 10 g LMNB-I13/IFA 10 g

[0094] The tumor growth of immunized mice in each group is shown in FIG. 31. Due to the failure of tumor innoculation of some mice in the untreated control group (group A) after the tumor challenge (i.e. after the tumor innoculation), such mice were not included for the analysis, and the parallel controlled vaccine group (group B) and the LMNB-I13 treated group (group C) were compared. Compared with group B, the tumor growth of mice in group C was slower, and the tumor size of mice in the LMNB-I13 protein vaccine treatment group was significantly smaller than that in parallel controlled vaccine group (group B) on day 22 after the tumor challenge. There was still a significant difference in tumor size between the two groups until day 30. Similarly, the increased tumor growth of mice in group C was also observed at a later stage in the CT26 mouse model, which is possibly associated with the cease of vaccination with the LMNB-I13 protein vaccine, These results indicated that the LMNB-I13 protein vaccine could inhibit tumor growth in mice.