A CONJUGATE COMPLEX FACILITATING THE TRANSPORT OF A CARGO THROUGH A MEDIUM

20200215202 ยท 2020-07-09

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to conjugate complexes, comprising at least one biological entity, at least one cargo moiety, and at least one effector moiety that is capable of converting, degrading, and/or modifying a given medium, wherein the at least one cargo moiety and the at least one effector moiety are directly or indirectly coupled to the biological entity. The present invention further relates to uses thereof and methods for facilitating the transport of a cargo moiety through a given medium.

    Claims

    1. A conjugate complex comprising: (a) at least one biological entity; (b) at least one cargo moiety; and (c) at least one effector moiety that is capable of converting, degrading and/or modifying a given medium; wherein the at least one cargo moiety and the at least one effector moiety are directly or indirectly coupled to the biological entity.

    2. The conjugate complex of claim 1, wherein the biological entity is selected from the group consisting of viral nanoparticles (VNP), virus like particles (VLP), and bacteriophages.

    3. The conjugate complex of claim 1, wherein the cargo moiety is selected from the group consisting of organic or inorganic molecules, nucleic acids, peptides, proteins, organic or inorganic micro- or nanoparticles, magnetic micro- or nanoparticles, piezoelectric micro- or nanoparticles, hydrophilic micro- or nanoparticles, hydrophobic micro- or nanoparticles, and biological entities.

    4. The conjugate complex of claim 1, wherein the cargo moiety is a pharmaceutical agent.

    5. The conjugate complex of claim 1, wherein the medium is a tissue, an organ, or a protective layer in the human or animal body, wherein the protective layer is selected from the group consisting of biological fluids and biological gel-like media.

    6. The conjugate complex of claim 5, wherein the protective layer is selected from the group consisting of mucus linings, and the vitreous humor of the eye.

    7. The conjugate complex of claim 1, wherein the effector moiety is selected from the group consisting of enzymes, peptides, catalysts, functional chemical groups, and biological entities.

    8. The conjugate complex of claim 7, wherein the effector moiety is an enzyme selected from the group consisting of ureases, hyaluronidases, proteases, peptidases, and collagenases.

    9. The conjugate complex of claim 1, wherein the conjugate complex is self-assembling.

    10. The conjugate complex of claim 1, wherein coupling of the at least one cargo moiety and/or the at least one effector moiety to the biological entity is via covalent binding or via non-covalent interactions.

    11. (canceled)

    12. A method for facilitating the transport of a cargo moiety through a medium, comprising the step of contacting said medium with the conjugate complex of claim 1.

    13. The method of claim 12, wherein the transport is effected by diffusion.

    14. The method of claim 12, wherein a cargo moiety is a magnetic particle and the transport is effected by application of a magnetic field, or a cargo moiety is a light-interacting particle and the transport is effected by application of a light field, or a cargo moiety allows for self-propulsion by means of chemical reactions.

    15. (canceled)

    Description

    [0028] The figures show:

    [0029] FIG. 1:

    [0030] Schematic representation of a conjugate complex of the present invention comprising its single components, the biological entity, the cargo moiety and the effector moiety, and the coupling strategy.

    [0031] FIG. 2:

    [0032] Schematic representation of the mode of action of a conjugate complex of the present invention. The a conjugate complex is moved actively or passively. Effector moieties are coupled on the biological entity for converting, degrading and/or modifying a medium.

    [0033] The present invention will be further illustrated in the following examples without being limited thereto.

    EXAMPLES

    Material and Methods:

    [0034]

    TABLE-US-00001 DNAprimers. p3HT-for (SEQIDNO:1) 5AGTGGTACCTTTCTATTCTCACTCTCATCATCACCATCACCACCTGG TTCCGCGTGGATCCTCGGCCGAAA3 p3HT-rev (SEQIDNO:2) 5TTTCGGCCGAGGATCCAGCGGGAACCAGGTGGTGATGGTGATGATGA GAGTGAGAATAGAAAGTACCACT3 p7HXa_minus (SEQIDNO:3) 5TCTGCGCCGCTAGCATTGATGGACGTATGGAGCAGGTCGCGGATTTC GACACAATTTATC3 p7HXa_plus (SEQIDNO:4) 5ATTGTGCTAGCGTGGTGATGGTGATGATGCATGTTACTTAGCCGGAA CGAGGCGCAGAC3 p9HXa_minus (SEQIDNO:5) 5TGGTATGCTAGCATTGATGGACGTATGAGTGTTTTAGTGTATTCTTT TGCCTCTTTCGTT3 p9HXa_plus (SEQIDNO:6) 5ACGAGAGCTAGCGTGGTGATGGTGATGATGCATCTTTGACCCCCAGC GATTATACCAA3

    Example 1

    Genetic Modifications of Bacteriophages.

    [0035] The His-tag fusion proteins with the minor coat proteins p3, p7, and p9, respectively, of M13 bacteriophages and fd Y21M bacteriophages were established by genetic manipulations.

    [0036] p3-His-tag: Single stranded DNA primers p3HT-for and p3HT-rev were hybridized and digested with the restriction enzymes Barn HI and Kpn I, 1 hour at 37 C., and gel purified. This DNA fragment is referred to as insert hereinafter. M13KE bacteriophage DNA was digested with restriction enzymes Hind III and Kpn I, 1 hour at 37 C., and gel purified. This DNA fragment is referred to as vector hereinafter. Appropriate amounts of insert and vector were ligated by T4 DNA ligase and transformed into Escherichia coli. ER2738 cells. Bacteriophage clones expressing the His-tag were determined by DNA sequencing.

    [0037] p7-His-tag/p9-His-tag: His-tags were introduced by reverse polymerase chain reaction (PCR) with abutting primers introducing an additional Nhe I restriction site. M13KE bacteriophage DNA was used as template for the introduction of the His-tag and Nhe I restriction site by reverse PCR with primers p9HXa_minus/p9HXa_plus and p7HXa_minus/p7HXa_plus, respectively. PCR products were digested with Nhe I restriction enzyme and ligated with T4 DNA ligase. Escherichia coli ER2738 cells were transformed with one of the constructs. Bacteriophage clones were identified by DNA sequencing. The fd Y21M bacteriophages were genetically modified in an analogous manner.

    [0038] Bacteriophages expressing His-tag as fusion to any minor coat protein couple to Ni-NTA surface coated magnetic beads.

    Example 2

    Covalent Coupling of Urease to M13 Bacteriophage.

    [0039] Specific urease was coupled to bacteriophage by Sulfo-SIAB bifunctional linker. 50 L His-tagged bacteriophage-magnetic beads were incubated with 10 L Sulfo-SIAB in 440 L phosphate buffer for one hour at 20 C. Excessive Sulfo-SIAB was eliminated by washing with phosphate buffer. Bacteriophage-magnetic beads were resuspended in 500 L phosphate buffer and mixed with 200 L (0.05 mg/L) urease in phosphate buffer and incubated one hour, 20 C. in the dark. Excessive urease was eliminated by washing steps with phosphate buffer.