METHOD FOR PRODUCING L-TRYPTOPHAN USING IMPROVED STRAINS OF THE ENTEROBACTERIACEAE FAMILY

Abstract

The invention provides a method of producing L-tryptophan, the method comprising culturing a L-tryptophan producing microorganism belonging to the Enterobacteriaceae family in a fermentation medium; wherein the L-tryptophan producing microorganism has been modified by enhancing the expression level of the mdfA gene or by enhancing the expression level of an mdfA allele.

Claims

1-15. (canceled)

16. A method of producing L-tryptophan, comprising culturing an L-tryptophan producing microorganism belonging to the Enterobacteriaceae family in a fermentation medium, wherein L-tryptophan producing microorganism has been modified by enhancing the expression level of an mdfA gene or by enhancing the expression level of an mdfA allele.

17. The method of claim 16, wherein the mdfA allele is a polynucleotide selected from the group consisting of: a) a polynucleotide sequence comprising the nucleotide sequence of SEQ ID NO.:1; b) a polynucleotide that hybridizes with a complementary strand of SEQ ID NO.:1 under stringent conditions; c) a naturally occurring mutant or polymorphic form of a polynucleotide according to a) or b); d) a polynucleotide having a sequence identity of at least 80% of the nucleotide sequence of SEQ ID NO.:1; e) a polynucleotide including substitutions, deletions, insertions or additions of 1 to 60 nucleotides in relation to the nucleotide sequence of SEQ ID NO.:1; f) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO.:2; and g) a polynucleotide encoding a protein comprising an amino acid sequence which includes substitution, deletion, insertion or addition of 1 to 20 amino acids in SEQ ID NO.:2.

18. The method of claim 16, wherein the expression level of the mdfA gene or of the mdfA allele is enhanced by increasing the copy number of the mdfA gene or of the mdfA allele.

19. The method of claim 18, wherein the copy number of the mdfA gene or of the mdfA allele is increased by integrating the gene into the chromosome of the microorganism.

20. The method of claim 16, wherein the expression level of the mdfA gene or of the mdfA allele is enhanced by modifying a regulatory sequence of the gene.

21. The method of claim 16, wherein the expression level of the mdfA gene or of the mdfA allele is enhanced by using an inducible promoter.

22. The method of claim 16, wherein a copy of the mdfA gene or of the mdfA allele is integrated in the mtr locus with simultaneous deletion of the mtr gene.

23. The method of claim 22, wherein the chromosomal environment of the mtr locus regulates the expression of the mdfA gene or the mdfA allele integrated in the mtr locus.

24. The method of claim 16, wherein the L-tryptophan producing microorganism is selected from the genera Escherichia, Erwina and Providencia.

25. The method of claim 16, wherein the L-tryptophan producing microorganism is Escherichia coli.

26. A method for enhancing the expression level of the mdfA gene or of an mdfA allele in a microorganism, wherein the enhanced expression is due to transformation, transduction or conjugation of the microorganism by a vector comprising any one of the following: a) a polynucleotide sequence comprising the nucleotide sequence of SEQ ID NO.:1; b) a polynucleotide that hybridizes with a complementary strand of SEQ ID NO.:1 under stringent conditions; c) a naturally occurring mutant or polymorphic form of a polynucleotide according to a) or b); d) a polynucleotide having a sequence identity of at least 80% of the nucleotide sequence of SEQ ID NO.:1; e) a polynucleotide including substitutions, deletions, insertions or additions of 1 to 60 nucleotides in relation to the nucleotide sequence of SEQ ID NO.:1; f) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO.:2; g) a polynucleotide encoding a protein comprising an amino acid sequence which includes substitution, deletion, insertion or addition of 1 to 20 amino acids in SEQ ID NO.:2; and comprising a promoter regulating the expression of polynucleotides a) to g).

27. The method of claim 26, wherein said microorganism is of the Enterobacteriaceae family.

28. An L-tryptophan producing microorganism wherein said microorganism comprises a polynucleotide selected from the group consisting of: a) a polynucleotide sequence comprising the nucleotide sequence of SEQ ID NO.:1; b) a polynucleotide that hybridizes with a complementary strand of SEQ ID NO.:1 under stringent conditions; c) a naturally occurring mutant or polymorphic form of a polynucleotide according to a) or b); d) a polynucleotide having a sequence identity of at least 80% of the nucleotide sequence of SEQ ID NO.:1; e) a polynucleotide including substitutions, deletions, insertions or additions of 1 to 60 nucleotides in relation to the nucleotide sequence of SEQ ID NO.:1; f) a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO.:2; and g) a polynucleotide encoding a protein comprising an amino acid sequence which includes substitution, deletion, insertion or addition of 1 to 20 amino acids in SEQ ID NO.:2.

29. The L-tryptophan producing microorganism of 28, wherein a copy of the mdfA gene or of the mdfA allele is integrated in the mtr locus of the microorganism in the place of the mtr gene.

30. The L-tryptophan producing microorganism of 29, wherein the chromosomal environment of the mtr locus regulates the expression of the mdfA gene or the mdfA allele integrated in the mtr locus

Description

BRIEF DESCRIPTION OF THE FIGURES

[0098] FIG. 1: Map of the DaroP deletion fragment-containing replacement vector pKO3DaroP

[0099] FIG. 2: Map of the mdfA gene-containing replacement vector pKO3DaroP::mdfA

[0100] FIG. 3: Map of the Dmtr deletion fragment-containing replacement vector pKO3Dmtr

[0101] FIG. 4: Map of the mdfA gene-containing replacement vector pKO3Dmtr::mdfA

[0102] FIG. 5: Map of the plasmid pMU91

[0103] Specified lengths are to be understood as approximations. The meanings of the abbreviations and designations used are as follows: [0104] CmR: Chloramphenicol-resistance gene [0105] sacB: sacB gene from Bacillus subtilis [0106] RepA: Temperature-sensitive replication region of the plasmid pSC101 [0107] pdhR: Part of the coding region of the pdhR gene [0108] mdfA: Coding region of the mdfA gene [0109] ampE: Part of the coding region of the ampE gene [0110] yhbW: Part of the coding region of the yhbW gene [0111] deaD: Part of the coding region of the deaD gene [0112] pSC101: Plasmid fragment pSC101 [0113] serA: Coding region of the serA gene encoding D-3-phosphoglycerate dehydrogenase [0114] trpE476DCBA: Part of the tryptophan operon trpLEDCBA with trpE476 allele [0115] tetA: Tetracycline-resistance gene

[0116] The meanings of the abbreviations for the restriction enzymes are as follows [0117] SaII: Restriction endonuclease from Streptomyces albus G [0118] HindIII: Restriction endonuclease from Haemophilus influenzae Rd [0119] XhoI: Restriction endonuclease from Xanthomonas holcicola

[0120] Further details may be found in the examples.

[0121] In the following, the invention is illustrated by non-limiting examples and exemplifying embodiments.

EXAMPLES

[0122] Minimal (M9) and full media (LB) used for Escherichia coli are described by J. H. Miller (A Short Course in Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press). The isolation of plasmid DNA from Escherichia coli and all techniques for restriction digestion, ligation, Klenow treatment and alkaline-phosphatase treatment are carried out as per Sambrook et al. (Molecular CloningA Laboratory Manual (1989) Cold Spring Harbor Laboratory Press). Unless otherwise described, the transformation of Escherichia coli is carried out in accordance with Chung et al. (Proceedings of the National Academy of Sciences of the United States of America, USA (1989) 86: 2172-2175).

[0123] Unless otherwise described, the incubation temperature in the production of strains and transformants is 37 C.

Example 1

[0124] Construction of the Replacement Vector pKO3DaroP

[0125] The deletion flanks for the deletion of aroP are amplified using the polymerase chain reaction (PCR) and the deletion fragment was produced by overlap PCR. Proceeding from the nucleotide sequence of the aroP gene in E. coli K-12 MG1655 (accession number NC_000913.3, region: 120178-121551, Blattner et al. (Science 277: 1453-1462 (1997)) and the flanking regions, PCR primers are synthesized (Eurofins Genomics GmbH (Ebersberg, Germany)). The primers are designed such that the entire aroP gene is deleted.

[0126] Primer Design and PCR of the Two Flanks

TABLE-US-00002 Flank1 aroP-up1 SEQIDNO.:3 5GATCTGAGCTCTAGACCTGGCGACGAAGCAACAAG3 Xbal aroP-up6 SEQIDNO.:4 5GCGTTGGTGTAATCGCGAACCTCGTGCGGTGGTTGTT3 Nrul

[0127] The chromosomal E. coli MG1655 DNA used for the PCR is isolated using the QIAGEN DNeasy Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany) according to the information from the manufacturer. Using the two specific primers aroP-up1 and aroP-up6, PCR amplification is carried out under standard PCR conditions (Innis et al.: PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using the Phusion DNA Polymerase (Thermo Fisher Scientific, Wattham, Mass. USA) with MG1655 DNA as template to amplify the fragment aroP-Flank1 (length: 775 bp). Via the primers, an XbaI and an NruI restriction site are inserted into the PCR product.

TABLE-US-00003 Flank2 SEQIDNO.:5 aroP-down25GATCTATCTAGACTGTTACGCGCATTGCAGG3 Xbal aroP-down3 SEQIDNO.:6 5ACCGCACGAGGTTCGCGATTACACCAACGCCCCGTAAATCG3 Nrul

[0128] Using the two primers aroP-down2 and aroP-down3, PCR is carried out with MG1655 DNA as template to amplify the fragment aroP-Flank2 (length: 717 bp). Via the primers, an XbaI and an NruI restriction site are inserted into the PCR product.

[0129] Fusion of the Two Flanks by Overlap PCR

[0130] The two flanks are fused together via their overlapping regions by means of an overlap PCR using the two outer primers aroP-up1 and aroP-down2. The resulting product aroP-Del-Fragment has a length of 1462 bp. Recognition sequences for the restriction enzyme XbaI are at both ends.

[0131] Cloning of the Insert into pKO3

[0132] The above fusion product is purified using the Qiaquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany) and then digested using XbaI. This generates XbaI sticky ends. The digest is purified again using the Qiaquick PCR Purification Kit, and this also results in the short cut-off sequences being removed.

[0133] The vector pKO3 is likewise cut using XbaI and simultaneously dephosphorylated using alkaline phosphatase. Thereafter, the digest is purified using the Qiaquick PCR Purification Kit, and this also results in the short fragment between the XbaI sites being removed. The restriction product likewise has XbaI sticky ends. These are unphosphorylated, preventing a self-ligation of the plasmid.

[0134] Ligation is carried out by using T4 ligase to ligate vector and insert in the molar ratio of 1:3. Chemically competent cells of the E. coli cloning strain NEB5alpha are transformed using 1 l of the ligation reaction and spread out on LB agar containing 20 mg/l chloramphenicol. The plates are incubated at 30 C. for 40 h.

[0135] Checking of the Plasmid Clones

[0136] Successful cloning is verified by cleavage of the plasmid pKO3DaroP using the restriction enzyme AvaI.

[0137] 10 colonies are picked and cultivated overnight at 30 C./180 rpm in 10 ml LB+20 mg/l chloramphenicol in each case.

[0138] The following day, 2 ml of the cultures are centrifuged in each case and minipreps are prepared from the pellets.

[0139] The ligation products can contain the insert in two orientations. An AvaI restriction allows to prove the insert as well as to determine the orientation: [0140] Insert in orientation s: Fragments 148 bp, 1447 bp and 5494 bp [0141] Insert in orientation as: Fragments 1351 bp, 1447 bp and 4291 bp [0142] pKO3 empty vector: Fragments 1043 bp and 5263 bp

[0143] The 10 plasmid clones are cut using AvaI and the products are separated on a 0.8% TAE agarose gel. One plasmid clone containing the insert in orientation s was selected and called pKO3DaroP.

[0144] The insert of said clone is sequenced using the primers pKO3-L and pKO3-R.

TABLE-US-00004 SEQIDNO.:7 pKO3-L5AGGGCAGGGTCGTTAAATAGC3 SEQIDNO.:8 pKO3-R5TTAATGCGCCGCTACAGGGCG3

[0145] The DNA sequence of the amplified fragment DaroP is determined by using the primers pKO3-L and pKO3-R (Eurofins Genomics GmbH (Ebersberg, Germany)). The expected sequence of the fragment was confirmed and the cloned fragment is described in SEQ ID NO.:9.

[0146] The resultant replacement vector pKO3DaroP is depicted in FIG. 1.

Example 2

[0147] Construction of the Replacement Vector pKO3Dmtr

[0148] The deletion flanks for the deletion of mtr are amplified using the polymerase chain reaction (PCR) and the deletion fragment was produced by overlap PCR. Proceeding from the nucleotide sequence of the mtr gene in E. coli K-12 MG1655 (accession number NC_000913.3, region: 3304573-3305817, Blattner et al. (Science 277: 1453-1462 (1997)) and the flanking regions, PCR primers are synthesized (Eurofins Genomics GmbH (Ebersberg, Germany)). The primers are designed such that the entire mtr gene is deleted.

[0149] Primer Design and PCR of the Two Flanks

TABLE-US-00005 Flank1 SEQIDNO.:10 mtr-del-Xba-15TTGAGAACCGCGAGCGTCGTCTG3 mtr-del-Xba-2 SEQIDNO.:11 5TCTAGATTCGCGAGGGCTTCTCTCCAGTGAAA3 XbalNrul

[0150] The chromosomal E. coli MG1655 DNA used for the PCR is isolated using the QIAGEN DNeasy Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany) according to the information from the manufacturer. Using the two specific primers mtr-del-Xba-1 and mtr-del-Xba-2, PCR is carried out under standard PCR conditions (Innis et al.: PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using the Phusion DNA Polymerase (Thermo Fisher Scientific, Wattham, Mass. USA) with MG1655 DNA as template to amplify the fragment mtr-Flank1 (length: 1009 bp). Via the primers, an XbaI and an NruI restriction site are inserted into the PCR product.

TABLE-US-00006 Flank2 mtr-del-Xba-3 SEQIDNO.:12 5AAGCCCTCGCGAATCTAGAGTAATCAGCGGTGCCTTATC3 NrulXbal SEQIDNO.:13 mtr-del-Xba-45GCTGGCAGAACACCACAATATG3

[0151] Using the two primers mtr-del-Xba-3 and mtr-del-Xba-4, PCR is carried out with MG1655 DNA as template to amplify the fragment mtr-Flank2 (length: 1014 bp). Via the primers, an XbaI and an NruI restriction site are inserted into the PCR product.

[0152] Fusion of the Two Flanks by Overlap PCR

[0153] The two flanks are fused together via their overlapping regions by means of an overlap PCR using the two outer primers mtr-del-Xba-1 and mtr-del-Xba-4. The resulting product mtr-del-Fragment has a length of 2004 bp.

[0154] Cloning of the Insert into pKO3

[0155] According to information from the manufacturer, the amplified mtr-del-Fragment is ligated into the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific, Wattham, Mass. USA) and transformed into E. coli TOP10. Cells containing a plasmid are selected on LB agar containing 50 g/ml kanamycin. After isolation of the plasmid DNA, successful cloning is verified by cleavage of the plasmid using the restriction enzyme HincII and separation of the products on a 0.8% TAE agarose gel. The successfully cloned vector is called pCRBI-mtr-del.

[0156] The vector is then cleaved using the restriction enzymes NotI and SpeI and the mtr-del-Fragment is resolved on a 0.8% TAE agarose gel. This is followed by the isolation of the fragment from the gel using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and cloning into the replacement vector pKO3 (Link et al, 1997, J. Bacteriol., 179, 20, 6228-6237).

[0157] The vector pKO3 is cut using NotI and XbaI. Thereafter, the digest is purified using the Qiaquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany).

[0158] Ligation is carried out by using T4 ligase to ligate vector and insert in the molar ratio of 1:3. Chemically competent cells of the E. coli cloning strain NEB5alpha are transformed using 1 l of the ligation reaction and spread out on LB agar containing 20 mg/l chloramphenicol. The plates are incubated at 30 C. for 40 h.

[0159] Checking of the Plasmid Clones

[0160] Successful cloning is verified by cleavage of the plasmid pKO3Dmtr using the restriction enzyme HincII.

[0161] Correct clones have the following cleavage pattern: [0162] Insert mtr-del: Fragments 822 bp, 1251 bp, 1611 bp and 4020 bp [0163] pKO3 empty vector: Fragments 822 bp, 1617 bp and 3232 bp

[0164] 10 colonies are picked and cultivated overnight at 30 C./180 rpm in 10 ml LB+20 mg/l chloramphenicol in each case.

[0165] The following day, 2 ml of the cultures are centrifuged in each case and minipreps are prepared from the pellets.

[0166] The 10 plasmid clones are cut using HincII and the products are separated on a 0.8% TAE agarose gel. One plasmid clone containing the correct insert was selected and called pKO3Dmtr.

[0167] The insert of said clone is sequenced using the primers pKO3-L and pKO3-R.

TABLE-US-00007 SEQIDNO.:7 pKO3-L5AGGGCAGGGTCGTTAAATAGC3 SEQIDNO.:8 pKO3-R5TTAATGCGCCGCTACAGGGCG3

[0168] The DNA sequence of the amplified fragment Dmtr is determined by using the primers pKO3-L and pKO3-R (Eurofins Genomics GmbH (Ebersberg, Germany)). The expected sequence of the fragment was confirmed and the cloned fragment is described in SEQ ID NO.:14.

[0169] The resultant replacement vector pKO3Dmtr is depicted in FIG. 3.

Example 3

[0170] Construction of the Replacement Vectors pKO3DaroP::mdfA and pKO3Dmtr::mdfA

[0171] 3.1 Construction of the Vector pB-mdfA

[0172] The mdfA allele is amplified using the polymerase chain reaction (PCR). Proceeding from the nucleotide sequence of the mdfA gene in E. coli K12 MG1655 (accession number NC_000913.3, region: 883673-884905, Blattner et al. (Science 277: 1453-1462 (1997)), PCR primers are synthesized (Eurofins Genomics GmbH (Ebersberg, Germany)).

[0173] Primer Design and PCR of the mdfA Gene Region

TABLE-US-00008 SEQIDNO.:15 cmr-for:5CGTCGCGATACAGGCAAGTCGTTGAG3 Nrul SEQIDNO.:16 cmr-rev:5CCTCGCGACAGATTGACGACCATCAC3 Nrul

[0174] The chromosomal E. coli MG1655 DNA used for the PCR is isolated using the QIAGEN DNeasy Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany) according to the information from the manufacturer. Using the two specific primers crmr-for and cmr-rev, PCR is carried out under standard PCR conditions (Innis et al.: PCR Protocols. A Guide to Methods and Applications, 1990, Academic Press) using the Phusion DNA Polymerase (Thermo Fisher Scientific, Wattham, Mass. USA) with MG1655 DNA as template to amplify the fragment mdfA-Insert (length: 1562 bp), described in SEQ ID NO.: 19. Via the primers, NruI restriction sites are inserted into the PCR product.

[0175] Cloning of the Insert into pCR-Blunt II

[0176] According to information from the manufacturer, the amplified fragment mdfA-Insert is ligated into the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific, Wattham, Mass. USA) and transformed into E. coli TOP10. Cells containing a plasmid are selected on LB agar containing 50 g/ml kanamycin. After isolation of the plasmid DNA, successful cloning is verified by cleavage of the plasmid using the restriction enzyme SphI and separation of the products on a 0.8% TAE agarose gel.

[0177] The ligation products can contain the insert in two orientations. A SphI restriction allows to prove the insert as well as to determine the orientation: [0178] Insert in orientation s: Fragments 1351 bp, 1385 bp and 2345 bp [0179] Insert in orientation as: Fragments 305 bp, 1385 bp and 3391 bp [0180] pCR-Blunt II empty vector: Fragments 1385 bp and 2134 bp

[0181] The plasmid clones are cut using SphI and the products are separated on a 0.8% TAE agarose gel. One plasmid clone containing the insert in orientation as was selected and called pB-mdfA.

[0182] The insert of said clone is sequenced using the primers M13uni(-21) and M13rev(-29).

TABLE-US-00009 SEQIDNO.:17 M13uni(-21)5TGTAAAACGACGGCCAGT3 SEQIDNO.:18 M13rev(-29)5CAGGAAACAGCTATGACC3

[0183] The DNA sequence of the amplified fragment mdfA is determined by using the primers M13uni(-21) and M13rev(-29) (Eurofins Genomics GmbH (Ebersberg, Germany)). The expected sequence of the fragment was confirmed.

[0184] 3.2 Construction of the Vector pKO3DaroP::mdfA

[0185] The vector pB-mdfA is cleaved using the restriction enzyme NruI and the mdfA fragment is resolved on a 0.8% TAE agarose gel. This is followed by the isolation of the fragment from the gel using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and cloning into the replacement vector pKO3DaroP that was generated.

[0186] The vector pKO3DaroP is cut using NruI and simultaneously dephosphorylated using alkaline phosphatase. This cleavage preserves the promoter region of aroP that is still present. Thereafter, the digest is purified using the Qiaquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany).

[0187] Ligation is carried out by using T4 ligase to ligate vector and insert in the molar ratio of 1:3. Chemically competent cells of the E. coli cloning strain NEB5alpha are transformed using 1 l of the ligation reaction and spread out on LB agar containing 20 mg/l chloramphenicol. The plates are incubated at 30 C. for 40 h.

[0188] Checking of the Plasmid Clones

[0189] Successful cloning is verified by cleavage of the plasmid pKO3DaroP::mdfA using the restriction enzyme AseI.

[0190] 10 colonies are picked and cultivated overnight at 30 C./180 rpm in 10 ml LB+20 mg/l chloramphenicol in each case.

[0191] The following day, 2 ml of the cultures are centrifuged in each case and minipreps are prepared from the pellets.

[0192] The ligation products can contain the insert in two orientations. An AseI restriction allows to prove the insert as well as to determine the orientation: [0193] Insert in orientation s: Fragments 1603 bp and 7038 bp [0194] Insert in orientation as: Fragments 101 bp and 8540 bp

[0195] The 10 plasmid clones are cut using AseI and the products are separated on a 0.8% TAE agarose gel. One plasmid clone containing the insert in orientation s was selected and called pKO3DaroP::mdfA.

[0196] The insert of said clone is sequenced using the primers pKO3-L, pKO3-R, cmr-for and cmr-rev.

TABLE-US-00010 SEQIDNO.:7 pKO3-L5AGGGCAGGGTCGTTAAATAGC3 SEQIDNO.:8 pKO3-R5TTAATGCGCCGCTACAGGGCG3 SEQIDNO.:15 cmr-for5TACAGGCAAGTCGTTGAG3 SEQIDNO.:16 cmr-rev5CAGATTGACGACCATCAC3

[0197] The DNA sequence of the insert DaroP::mdfA is determined by using the primers pKO3-L, pKO3-R, cmr-for and cmr-rev (Eurofins Genomics GmbH (Ebersberg, Germany)).

[0198] The expected sequence of the fragment was confirmed and the cloned fragment is described in SEQ ID NO.: 20.

[0199] The resultant replacement vector pKO3DaroP::mdfA is depicted in FIG. 2.

[0200] 3.3 Construction of the Vector pKO3Dmtr::mdfA

[0201] The vector pB-mdfA is cleaved using the restriction enzyme NruI and the mdfA fragment is resolved on a 0.8% TAE agarose gel. This is followed by the isolation of the fragment from the gel using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and cloning into the replacement vector pKO3Dmtr that was generated.

[0202] The vector pKO3Dmtr is cut using NruI and simultaneously dephosphorylated using alkaline phosphatase. This cleavage preserves the promoter region of mtr that is still present. Thereafter, the digest is purified using the Qiaquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany).

[0203] Ligation is carried out by using T4 ligase to ligate vector and insert in the molar ratio of 1:3. Chemically competent cells of the E. coli cloning strain NEB5alpha are transformed using 1 l of the ligation reaction and spread out on LB agar containing 20 mg/l chloramphenicol. The plates are incubated at 30 C. for 40 h.

[0204] Checking of the Plasmid Clones

[0205] Successful cloning is verified by cleavage of the plasmid pKO3Dmtr::mdfA using the restriction enzyme HincII.

[0206] 10 colonies are picked and cultivated overnight at 30 C./180 rpm in 10 ml LB+20 mg/l chloramphenicol in each case.

[0207] The following day, 2 ml of the cultures are centrifuged in each case and minipreps are prepared from the pellets.

[0208] The ligation products can contain the insert in two orientations. A HincII restriction allows to prove the insert as well as to determine the orientation: [0209] Insert in orientation s: Fragments 354 bp, 822 bp, 1613 bp, 2449 bp and 4025 bp [0210] Insert in orientation as: Fragments 822 bp, 1181 bp, 1613 bp, 1622 bp and 4025 bp

[0211] The 10 plasmid clones are cut using HincII and the products are separated on a 0.8% TAE agarose gel. One plasmid clone containing the insert in orientation s was selected and called pKO3Dmtr::mdfA.

[0212] The insert of said clone is sequenced using the primers pKO3-L, pKO3-R, cmr-for and cmr-rev.

TABLE-US-00011 SEQIDNO.:7 pKO3-L5AGGGCAGGGTCGTTAAATAGC3 SEQIDNO.:8 pKO3-R5TTAATGCGCCGCTACAGGGCG3 SEQIDNO.:15 cmr-for5TACAGGCAAGTCGTTGAG3 SEQIDNO.:16 cmr-rev5CAGATTGACGACCATCAC3

[0213] The DNA sequence of the insert Dmtr::mdfA is determined by using the primers pKO3-L, pKO3-R, cmr-for and cmr-rev (Eurofins Genomics GmbH (Ebersberg, Germany)). The expected sequence of the fragment was confirmed and the cloned fragment is described in SEQ ID NO.: 21.

[0214] The resultant replacement vector pKO3Dmtr::mdfA is depicted in FIG. 4.

Example 4

[0215] Replacement of the aroP Allele of Strain DM2186 by the Deletion Fragments DaroP and DaroP::mdfA

[0216] The L-tryptophan-producing E. coli strain DM2186/pMU91 is a P1-transduction-obtainable trpS.sup.+ derivative of the Escherichia coli K-12 strain JP6015/pMU91 described in the patent specification U.S. Pat. No. 5,756,345. pMU91 is a plasmid derived from pSC101 (Cohen et al., Journal of Bacteriology 132: 734-737 (1977)), which bears Tet.sup.R, trpE476DCBA and serA.sup.+. JP6015/pMU91 is deposited as DSM 10123 at the Leibniz Institute DSMZGerman Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) in accordance with the Budapest treaty. DM2186 is deposited on Nov. 22, 2018 as DSM 32961 at the Leibniz Institute DSMZGerman Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) in accordance with the Budapest treaty.

[0217] In the chromosomal aroP allele of the strain DM2186, there is a frame-shift mutation.

[0218] The replacement of the chromosomal aroP allele by the plasmid-coded deletion construct was carried out by transforming DM2186 with the plasmid pKO3DaroP. The gene replacement is done using the selection method described by Link et al. (Journal of Bacteriology 179: 6228-6237 (1997)) and was verified by sequencing.

[0219] After replacement has been carried out, what is present in DM2186 is the form of the deleted aroP allele that is described in SEQ ID NO.:22 (sequencing by Eurofins Genomics GmbH (Ebersberg, Germany)). The strain obtained is referred to as DM2186DaroP.

[0220] Increased Expression of the mdfA Gene in the E. coli Strain DM2186/pMU91 Integrated in the aroP Locus

[0221] The replacement of the chromosomal aroP allele by the plasmid-coded mdfA allele with simultaneous deletion of the aroP gene, the promoter region of aroP being preserved, was carried out by transforming DM2186 with the plasmid pKO3DaroP::mdfA. The gene replacement is done using the selection method described by Link et al. (Journal of Bacteriology 179: 6228-6237 (1997)) and was verified by sequencing.

[0222] After replacement has been carried out, what is present in DM2186 is the form of the mdfA gene, as described in SEQ ID NO.: 23, integrated in the aroP locus with simultaneous deletion of the aroP allele (sequencing by Eurofins Genomics GmbH (Ebersberg, Germany)). The strain obtained is referred to as DM2186DaroP::mdfA.

[0223] The plasmid pMU91 which is described in the patent specification U.S. Pat. No. 5,756,345 and which carries the genetic information for tryptophan production was isolated from the strain JP6015/pMU91. The plasmid is depicted in FIG. 5. The strains DM2186DaroP and DM2186DaroP::mdfA were each transformed with this plasmid. The respective transformants are referred to as DM2186DaroP/pMU91 and DM2186DaroP::mdfA/pMU91.

Example 5

[0224] Replacement of the Mtr Allele of Strain DM2186 by the Deletion Fragments Dmtr and Dmtr::mdfA

[0225] The L-tryptophan-producing E. coli strain DM2186/pMU91 is a P1-transduction-obtainable trpS.sup.+ derivative of the Escherichia coli K-12 strain JP6015/pMU91 described in the patent specification U.S. Pat. No. 5,756,345. pMU91 is a plasmid derived from pSC101 (Cohen et al., Journal of Bacteriology 132: 734-737 (1977)), which bears Tet.sup.R, trpE476DCBA and serA.sup.+. JP6015/pMU91 is deposited as DSM 10123 at the Leibniz Institute DSMZGerman Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) in accordance with the Budapest treaty. DM2186 is deposited on Nov. 22, 2018 as DSM 32961 at the Leibniz Institute DSMZGerman Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) in accordance with the Budapest treaty.

[0226] In the chromosomal mtr allele of the strain DM2186, there is a frame-shift mutation.

[0227] The replacement of the chromosomal mtr allele by the plasmid-coded deletion construct was carried out by transforming DM2186 with the plasmid pKO3Dmtr. The gene replacement is done using the selection method described by Link et al. (Journal of Bacteriology 179: 6228-6237 (1997)) and was verified by sequencing.

[0228] After replacement has been carried out, what is present in DM2186 is the form of the deleted mtr allele that is described in SEQ ID NO.: 24 (sequencing by Eurofins Genomics GmbH (Ebersberg, Germany)). The strain obtained is referred to as DM2186Dmtr.

[0229] Increased Expression of the mdfA Gene in the E. coli Strain DM2186/pMU91 Integrated in the Mtr Locus

[0230] The replacement of the chromosomal mtr allele by the plasmid-coded mdfA allele with simultaneous deletion of the mtr gene, the promoter region of mtr being preserved, was carried out by transforming DM2186 with the plasmid pKO3Dmtr::mdfA. The gene replacement is done using the selection method described by Link et al. (Journal of Bacteriology 179: 6228-6237 (1997)) and was verified by sequencing.

[0231] After replacement has been carried out, what is present in DM2186 is the form of the mdfA gene, as described in SEQ ID NO.: 25, integrated in the mtr locus with simultaneous deletion of the mtr allele (sequencing by Eurofins Genomics GmbH (Ebersberg, Germany)). The strain obtained is referred to as DM2186Dmtr::mdfA.

[0232] The plasmid pMU91 which is described in the patent specification U.S. Pat. No. 5,756,345 and which carries the genetic information for tryptophan production was isolated from the strain JP6015/pMU91. The plasmid is depicted in FIG. 5. The strains DM2186Dmtr and DM2186Dmtr::mdfA were each transformed with this plasmid. The respective transformants are referred to as DM2186Dmtr/pMU91 and DM2186Dmtr::mdfA/pMU91.

Example 6

[0233] Production of L-Tryptophan Using the Strains DM2186DaroP/pMU91, DM2186DaroP::mdfA/pMU91, DM2186Dmtr/pMU91 and DM2186Dmtr::mdfA/pMU91

[0234] To test the effect of an additional copy of the mdfA gene expressed from various regulatory sequences in two different chromosomal environments DM2186DaroP/pMU91, DM2186DaroP::mdfA/pMU91, DM2186Dmtr/pMU91, DM2186Dmtr::mdfA/pMU91 and DM2186/pMU91 were further propagated at 30 C. on LB medium having the following composition: 10 g/l Bacto tryptone, 5 g/l yeast extract, 10 g/l NaCl (pH adjustment to 7.5 using NaOH), 2 g/l glucose, 20 g/l agar and 5 mg/l tetracycline. The formation of L-tryptophan is checked in batch cultures of 10 ml contained in 100 ml conical flasks. To this end, 10 ml of preculture medium of the following composition are inoculated, and incubated at 30 C. and 180 rpm for 16 hours on an Infors HT Multitron standard incubator from Infors AG (Bottmingen, Switzerland): 1 g/l yeast extract, 100 ml/I MOPS buffer (10), 10 g/l glucose, 0.1 mg/l thiamine and 5 mg/l tetracycline.

[0235] 10MOPS buffer is prepared from solutions A and B according to Tables 1 to 3; two volumes of solution A are added aseptically to three volumes of solution B.

TABLE-US-00012 TABLE 1 Solution A for 10x MOPS buffer (sterile-filtered). Component Concentration MOPS (morpholinopropanesulfonic acid) 418.6 g/L KOH (solid) For adjustment of pH to 7.4

TABLE-US-00013 TABLE 2 Solution B for 10x MOPS buffer. Sterilized by autoclaving (30 minutes, 121 C.). Component Concentration Na.sub.3 citrate 2H.sub.2O 2.35 g/l FeSO.sub.4 7H.sub.2O 0.22 g/l NH.sub.4Cl 32.0 g/l MgSO.sub.4 7H.sub.2O 6.7 g/l KCl 4.0 g/l CaCl.sub.2 2H.sub.2O 0.25 mg/l Trace-elements stock solution (Tab. 4) 3.33 ml/l

TABLE-US-00014 TABLE 3 Trace-elements stock solution (in demin. water) for 10x MOPS buffer. Component Concentration (NH.sub.4).sub.6Mo.sub.7O.sub.24 4H.sub.2O 3.7 mg/l H.sub.3BO.sub.3 24.0 mg/l CoCl.sub.2 6H.sub.2O 7.1 mg/l ZnSO.sub.4 7H.sub.2O 28.7 mg/l MnCl.sub.2 4H.sub.2O 15.8 mg/l CuSO.sub.4 5H.sub.2O 2.5 mg/l

[0236] 100 l of said preculture are in each case inoculated in 10 ml of production medium PM3P according to Table 4 and incubated at 33 C. and 180 rpm for 44 hours on an Infors HT Multitron standard incubator from Infors AG (Bottmingen, Switzerland). After incubation, the optical density (OD) of the culture suspension is determined using a Nanocolor 400D photometer from Macherey-Nagel GmbH & Co. KG (Diren, Germany) at a measurement wavelength of 660 nm.

TABLE-US-00015 TABLE 4 PM3P medium: for production tests in 100 ml conical flasks Component Concentration 10x MOPS buffer 100 ml/l Thiamine HCl (0.01%) 1.0 ml/l KH2PO4 (45 mM) 10 ml/l Glucose 10 g/l Tyrosine 0.02 g/l Phenylalanine 0.02 g/l Tetracycline 5 mg/l

[0237] Thereafter, the concentration of L-tryptophan formed in the sterile-filtered culture supernatant is determined by reversed-phase HPLC, for instance as described in Lindroth et al. (Analytical Chemistry (1979) 51: 1167-1174).

[0238] Table 5 shows the result of the experiment.

TABLE-US-00016 TABLE 5 Production of L-tryptophan using the strains DM2186DaroP/pMU91, DM2186DaroP::mdfA/pMU91, DM2186Dmtr/pMU91 and DM2186Dmtr::mdfA/pMU91 OD L-Tryptophan, Yield, Strain (660 nm) g/l net % DM2186DaroP/pMU91 4.17 1.63 13.60 DM2186DaroP::mdfA/pMU91 4.02 1.66 13.82 DM2186Dmtr/pMU91 4.29 1.62 13.61 DM2186Dmtr::mdfA/pMU91 3.85 1.82 15.16 DM2186/pMU91 4.38 1.62 13.54

[0239] As derivable therefrom, the enhancement of mdfA gene increases the yield of L-tryptophan. However, the expression level of mdfAand thereby the L-tryptophan yieldis strongly influenced by choosing the integration locus and the chromosomal environment of the integrated mdfA gene or allele.

[0240] Integration of the mdfA into the chromosomal aroP locus leads to a slight increase in L-tryptophan productivity, whereas integration of the mdfA into the chromosomal mtr locus leads to a strong increase in L-tryptophan productivity, i.e. the chromosomal environment regulates the expression of mdfA. The positive effect on L-tryptophan synthesis is much more pronounced in DM2186Dmtr::mdfA/pMU91 compared to the integration of mdfA into the aroP gene locus. Obviously, creation of a defined expression level of the additional copy of the mdfA gene in a specific gene locus is more important for L-tryptophan production than the general enhancement of expression by gene copy number increasement. Especially the expression levels of membrane proteins, such as transport proteins and amino acid exporters have to be modulated in an appropriate way without affecting cellular fitness and production capacities when commercial relevant concentrations accumulate in the fermentation broth.

[0241] All references cited herein are fully incorporated by reference. Having now fully described the invention, it will be understood by one of skill in the art that the invention may be performed within a wide and equivalent range of conditions, parameters and the like, without affecting the spirit or scope of the invention or any embodiment thereof.