METHOD FOR RAPIDLY AND EFFICIENTLY CREATING DIRECTED GENE MUTATED NON-TRANSGENIC PLANTS AND ITS APPLICATIONS

Abstract

The invention relates to a plant genetic engineering field, and more particularly to a method for creating directed gene mutated non-transgenic plants. The method including performing a transgenic method onto directed gene mutated plants by introducing exogenous nucleic acid molecules; wherein the transgenic method includes introducing constructs into the directed gene mutated plants, each of the constructs contains a first nucleic acid molecule and a second nucleic acid molecule, wherein the first nucleic acid molecule serves as a gene editing element, and the second nucleic acid molecule serves as a lethal or stop development element, and can be used in a plant gene editing system such as CRISPR/CAS9. It can actively and automatically eliminate plant transgenic fragments, leaving enough time for gene editing elements to perform directed gene editing before removing transgenic fragments, providing a simple and effective method for gene editing without transgenic plants.

Claims

1. A method for creating directed gene mutated non-transgenic plants, comprising: performing a transgenic method onto directed gene mutated plants by introducing exogenous nucleic acid molecules; wherein the transgenic method comprises introducing constructs into the directed gene mutated plants, each of the constructs contains a first nucleic acid molecule and a second nucleic acid molecule, the first nucleic acid molecule serves as a gene editing element, and the second nucleic acid molecule serves as a lethal or stop development element; wherein the second nucleic acid molecule is selected from a group consisting of a gene element A, a gene element B, and a gene element C; wherein the gene element A is a gene element that causes death or stop development of a fertilized egg or embryo; wherein the gene element B is a gene element that causes death or stop development of a fertilized polar nuclei or endosperm; wherein the gene element C is a combined gene element, which comprises a combined element of a gene element D and the gene element A, or a combined element of the gene element D and the gene element B, or a combined element of the gene element D and a gene element E; wherein the gene element D is a gene element that causes death or stop development of a male gamete cell or pollen, and the gene element E is a gene element that causes death or stop development of a female gamete cell or a polar nucleus cell.

2. The method for creating directed gene mutated non-transgenic plants according to claim 1, wherein the first nucleic acid molecule is a gene element capable of editing a nucleic acid.

3. The method for creating directed gene mutated non-transgenic plants according to claim 2, wherein the gene element capable of editing the nucleic acid is selected from a group consisting of gene elements of a gene editing system.

4. The method for creating directed gene mutated non-transgenic plants according to claim 3, wherein the gene editing system is a ZFN gene editing system, a TALEN gene editing system, a CRISPR/CAS9 gene editing system, or a CRISPR/CPF1 gene editing system.

5. The method for creating directed gene mutated non-transgenic plants according to claim 4, wherein gene elements of the CRISPR/CAS9 gene editing system comprise a CAS9 gene and an sgRNA gene; a nucleotide sequence of the CAS9 gene is expressed by SEQ ID NO: 1 ; a nucleotide sequence of a core skeleton of the sgRNA gene is expressed by SEQ ID NO: 2.

6. The method for creating directed gene mutated non-transgenic plants according to claim 1, wherein a nucleotide sequence of the gene element A is expressed by SEQ ID NO: 3.

7. The method for creating directed gene mutated non-transgenic plants according to claim 1, wherein a nucleotide sequence of the gene element D is expressed by SEQ ID NO: 4.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The sequence listing SEQ ID NO: 1 is the nucleotide sequence of the CAS9 gene. The sequence length is 4131 bp.

[0031] The sequence listing SEQ ID NO: 2 is the core backbone nucleotide sequence of the sgRNA gene. The sequence length is 80 bp.

[0032] The sequence listing SEQ ID NO: 3 is the nucleotide sequence of the gene element A. The sequence length is 2400 bp.

[0033] The sequence listing SEQ ID NO: 4 is the nucleotide sequence of the gene element D. The sequence length is 1452 bp.

[0034] The sequence listing SEQ ID NO: 5 is the nucleotide sequence of the TKE plasmid. The sequence length is 18964 bp.

[0035] FIG. 1 is a schematic diagram of self-elimination of a suicide transgene-mediated CRISPR/Cas9 construct after editing a target gene. a) is a schematic representation of the three key components of a TKE (transgenic killer CRISPR) plasmid. The cytoplasmic male sterility system gene MGL is under the control of the CaMV 35S promoter. NOS refers to the terminator of the nopaline synthase gene from Agrobacterium tumefaciens. The REG2 promoter is specific in early embryonic development and is used to drive the BARNASE gene, which encodes a toxic enzyme to plant cells. The rbcs-E9 terminator was originally cloned from the pea rbcS-E9 gene. Codon-optimized Cas9 was placed under the control of maize's ubiquitin promoter, UBQ. b) is a TKE-mediated flowchart for the isolation of transgenic and CRISPR/Cas9-edited rice plants. The TKE plasmid was transformed into rice callus by Agrobacterium-mediated transformation. During callus growth and vegetative growth, the BARNASE gene is not expressed, and the target gene may be edited by Cas9. However during reproduction, any male gametes containing Cas9 were killed by MGL and any embryos containing Cas9 were killed by BARNASE. Therefore, all seeds from T0 plants are free of transgenes.

[0036] FIG. 2 is a schematic diagram of mutation and isolation patterns in T1 plants produced by TKE-LAZY1 (SEQ ID NOS: 36-60). a) is the TKE-LAZY1 plasmid to test the efficiency of transgene elimination and gene editing. The target sequence of the LAZY1 gene containing the Pstl restriction site immediately before the PAM site AGG was selected. The loss of function lazy1 mutant showed a distinct tillering horn phenotype. b) is the PAM station AGG required for Cas9 cutting. WT refers to the wild-type plant rice variety Zhonghua 11 (referred to as ZH11). The DNA sequence (genotype) of a T1 plant from a single T0 plant is shown. - means to delete a base pair. The a in the superscript refers to the insertion of A. Progeny from T0 plant #34 produced only homozygous offspring. Progeny from T0 plant #3 have three genotypes, indicating the chimeric nature of T0 plants.

[0037] FIG. 3: TKE plasmid map constructed by the invention.

[0038] FIG. 4 is a detection of transgenic fragments of T1 plants produced by TKE-LAZY1.Wherein 5 plants (numbers #3, #30, #34, #40, #49) with lazy1 phenotype in the T0 generation were randomly selected, and the seeds were germinated after harvesting to obtain T1 seedlings, and the transgenic fragments were detected. At the same time, the five T0 plants were tested to make sure whether they contain transgenic fragments or not. The results showed that these five plants with lazy1 phenotype were all transgenic positive in the T0 generation and negative in the T1 generation.

DETAILED DESCRIPTION OF EMBODIMENTS

[0039] The first nucleic acid molecule is a genetic element of the CRISPR/CAS9 gene editing system as an example; the second nucleic acid molecule is a combination element of a gene element A and a gene element D as an example. The feasibility verification gene of the technical scheme of the invention is taken as an example of rice LAZY1 gene. The transgenic method takes the Agrobacterium-mediated method for stable transformation of rice as an example, and it is a conventional method (see the relevant rice transgenic patent authorization document or patent publication published by the applicant before the application date).

[0040] Embodiment 1: Preparation of intermediate plasm id vector and final vector

[0041] Prior to the invention, the applicant's research has successfully constructed a plant gene editing vector pCXUN-CAS9 using the CRISPR/CAS9 gene editing system gene elements (the nucleotide sequence of the CAS9 gene of this system is shown in SEQ ID NO: 1) (He et al., 2017). On this basis, the applicant added the gene element A and the gene element D to the pCXUN-CAS9 vector to verify the TKE system of the invention. The gene element A is an example of a BARNASE gene expression cassette (see SEQ ID NO: 3 for its nucleotide sequence), and the gene element D is an MGL gene expression cassette (for a nucleotide sequence of SEQ ID NO: 4) as an example.

[0042] The specific construction steps are as follows:

[0043] The MGL and REG2 promoters were cloned (FIG. 1). The DNA of the male sterile line YTA (from the Rice Research Institute of Guangdong Academy of Agricultural Sciences) was used as a template to amplify the DNA of the MGL gene (Hu et al., 2012) with MGL-TAF (TGACAAATCTGCTCCGATG) (SEQ ID NO: 6) and MGL-TAR (CTTACTTAGGAAAGACTAC) (SEQ ID NO: 7) as primers; using the genomic DNA of rice 11 (ZH11) as a template and using REG2P-TAF (GTCGACGAGCGAGTCATTAGCTAGTATAG) (SEQ ID NO: 8) and REG2P-TAR (GGTGTTCGATCGATCCTAGCGGTG) (SEQ ID NO: 9) as primers to amplify the DNA of the promoter of REG2 (Sun et al., 1996), then they were ligated into the T vector pEASY-T5 (TransGen Biotech) by TA cloning to obtain two plasmids, MGL-TA and REG2P-TA.

[0044] Constructing a TKE vector. 1) Using pHEE401 plasmid (Wang et al., 2015) as a template, rE9T-F (CTGCAGGAATTCGATATCATTTAAATATTATGGCATTGGG AAAACTGTTT) (SEQ ID NO: 10) and rE9T-R (GTAAAACGACGGCCAGTGC CAGTTTGGGATGTTTTACTCCTCATATTAAC) (SEQ ID NO: 11) as primers to amplify rbcsE9 terminator DNA, the gel was recovered and ligated into the pCXUN-CAS9 vector digested with Hind III to obtain pCXR9T. 2) using the pCXUN-CAS9 plasmid (He et al., 2017) as a template and 35S-F (GATTACGAATTCGAGCTCGGTACCCGGAGAGGCGGTTTGCGTATTGGCTA) (SEQ ID NO: 12) and 35S-R (GAAGAGCCATCGGAGCAGATTTGTCATATCTCATT GCCCCCCGGATCTGCG) (SEQ ID NO: 13) as primers to amplify the 35S promoter DNA; using the MGL-TA plasmid as a template, and MGL-TAF (TGACAAATCT GCTCCGATG) (SEQ ID NO: 14) and MGL-R (AGCACATCCCCCTTTCGCCAGGGTT TAATTTTACTTAGGAAAGACTACACGAAT) (SEQ ID NO: 15) as primers to amplify MGL DNA;

[0045] The above two PCR products are cut into DNA and recovered as a template. DNA was amplified using 35S-F (GATTACGAATTCGAGCTCGGTACCCGGAGAG GCGGTTTGCGTATTGGCTA) (SEQ ID NO: 12) and MGL-R (AGCACATCCCCCTTTCGCCAGGGTTTAATTTTACTTAGGAAAGACTACACGAAT) (SEQ ID NO: 16) as primers, and the DNA was digested and recovered and ligated into pCXR9T vector digested with Kpn I to obtain 355-MGL-pCXR9T.

[0046] 3) using the BpFULL1::BARNASE plasmid (Lannenpaa et al., 2005) as a template, BAR-F (CTGCAGGAATTCGATATCATTTAAATATGGCACAGGTTATCAA CACG) (SEQ ID NO: 17) and BAR-R (CAGTTTTCCCAATGCCAT AATTTTAATTTTAAGAAAGTATGATGGTGATGTCGCAG) (SEQ ID NO: 18) were used as primers to amplify BARNASE DNA; the DNA was cut and recovered and ligated into the 355-MGL-pCXR9T vector cut by Swa I to obtain the 35SMGL+BARNASE-pCXR9T vector. 4) using the REG2P-TA plasmid as a template and REG2P-F (CTGCAGGAATTCGATATCATTTAAATGTCGACGAGCGAGTCATTAGCT) (SEQ ID NO: 19) and REG2P-R (CGTGTTGATAACCTGTGCCATGGTGTTCGATC GATCCTAGCGGTG) (SEQ ID NO: 20) as primers, the promoter DNA of REG2 was amplified. The gel was recovered and ligated into the 35S-MGL+BARNASE-pCXR9T vector digested with Swa I to obtain the 35S-MGL+REG2-BARNASE-pCXR9T vector, which is the TKE plasmid (FIG. 3). The complete nucleotide sequence of this plasmid is shown in SEQ ID NO: 5.

[0047] Embodiment 2: Construction of transformation vector TKE-LAZY1

[0048] In order to test the effectiveness of the technical solution of the invention, the applicant used the LAZY1 gene (LOC_Os11g29840) (Li et al., 2007) as a gene known to play an important role in the geotropic response. The loss of function lazy1 mutant showed a larger tiller angle (FIG. 2a). The visible phenotype of the lazy1 mutant allows a qualitative assessment of the editing efficiency of the construction vectors of the invention.

[0049] A specific sgRNA was designed with the LAZY1 gene in rice as the target gene, and the target sequence was GTCGCGCCCGGAGTACCTGC (SEQ ID NO: 21). The final vector TKE (see FIG. 3) obtained in Embodiment 1 was digested with Pme I into linear DNA, and sgRNA was introduced by overlapping PCR (as a conventional method). In this embodiment, the OsU6 promoter is used as the promoter of the sgRNA transcription unit. The specific steps are as follows:

[0050] The TKE vector (FIG. 3) was ligated into the sgRNA element (see SEQ ID NO: 2 for the nucleotide sequence of the core backbone of the sgRNA gene). Using the pCXUN-CAS9 vector (He et al., 2017) with OsU6P-sgRNA-OsU6T transcription cassette that has been constructed in our laboratory as template DNA, two types of DNA were amplified using OsU6PF (GTCGTTTCCCGCCTTCAGTTTATGTA CAGCATTACGTAGG) (SEQ ID NO: 22) and LAZY1-U6R (GCAGGTACTCC GGGCGCGACAACCTGAGCCTCAGCGCAGC) (SEQ ID NO: 23) primer pairs and OsU6TR (CTGTCAAACACTGATAGTTTAAACGATGGTGCTTACTGTTTAG) (SEQ ID NO: 24) and LAZY1-U6F (GTCGCGCCCGGAGTACCTGCGTTTTAGAGCTAGAA ATAGCAAGTTA) (SEQ ID NO: 25) primer pairs, respectively. The above two types of DNA cut gels are recovered and mixed as a template, and OsU6PF and OsU6TR are used as primers to amplify a complete sgRNA transcription unit DNA. The DNA digestion gel was recovered and ligated into the TKE vector digested with Pme I to obtain TKE-LAZY1.

[0051] Embodiment 3: Transformation of Agrobacterium with Recombinant Vector TKE-LAZY1 and Transformation of Rice Host

[0052] The sequenced positive plasmid TKE-LAZY1 was electrotransformed into Agrobacterium (EHA105) and infected rice callus. The transformed variety is rice Zhonghua 11 (also known as ZH11, from the Crop Science Institute of the Chinese Academy of Agricultural Sciences). The specific transformation steps are as follows:

[0053] 1) hull the mature embryo of the rice variety Zhonghua 11, first soak it with 70% ethanol for 1 minute, disinfect it with 0.15% liter of mercury for 20 minutes, and wash it with sterile water 3 to 4 times; the obtained explants were inoculated on an induction medium, and the callus was induced by dark culture at 26 C.;

[0054] 2) after 35 days of induction culture, take the viable and granular callus and transfer it to the subculture medium for subculture;

[0055] 3) take the callus granules subcultured for 20 days, insert them into the pre-culture medium, and culture them in the dark for 4 days at 26

[0056] 4) on the third day of pre-cultivation, inoculate Agrobacterium strain with LA (LB +1.5% agar) streaks, and culture at 28 for 2 days; after that, scrape all the Agrobacterium into the suspension medium; shake culture at 28 and 200 rpm for 0.5-1 hours; measure the concentration of the bacterial solution in a spectrophotometer at 600 nm, and adjust it to 1.0 OD;

[0057] 5) put the pre-cultured callus into a 100 ml Erlenmeyer flask (about 40 ml), add the prepared Agrobacterium liquid, and soak it for 30 minutes, shaking it several times during the period. Preparation of suspension medium: (500 l AS+5 ml 50% glucose);

[0058] 6) pour off the bacterial solution, put the rice callus on the sterilized filter paper, and blot the surface bacterial solution (be sure to suck the bacterial solution to make the callus white), but can't blow dry directly on the clean bench, access the co-culture medium (recipe: 250 p1 AS+5 ml 50% glucose), dark culture for 3 days, and then transfer to 250 ml co-culture medium for co-culture;

[0059] 7) wash the co-cultured callus quickly with sterile water and shake it twice quickly; then add soaked sterile water for 10 minutes to free the bacteria inside the callus; pour off the washing solution and add 400 mg/L of Cn sterile water for 15 minutes; pour dry cleaning solution, place the callus on sterilized filter paper, blot it dry, and insert it into the screening medium; culture in the dark at 26; subgenerations are carried out every 3 weeks for a total of two generations; for each plasmid transformation, 1 or 2 bottles of sterilized single distilled water are required; in the first screening, 500 ul Cn and 300 ul Hn are added to the 300 ml screening medium; for the second pass selection, 400 ul Cn and 300 ul Hn were added to the selection medium;

[0060] 8) the resistant callus cultured in the screening medium is connected to the pre-differentiation medium, and cultured at 26 for one week in the dark; transfer the resistant callus cultured for one week into the differentiation medium (50 ml/bottle; use a triangle flask or flat-bottomed test tube as the culture flask); culture at 25 under 2000 Lux light to obtain transgenic plants through regeneration.

[0061] 9) plants to be 3 to 5 cm long; transferred to rooting medium to promote rooting.

[0062] 10) move the strong root plant into a pot, and transition in a pergola for 3 to 5 days; then move to natural conditions to grow until it matures.

[0063] The above various medium formulations are shown at the end of the instructions.

[0064] Embodiment 4: Detection of Transgenic Fragments and Phenotypic Observation and Statistics of Transgenic Contemporary (T.sup.TKE-0)

[0065] 1) take mature transgenic T0 rice leaves and extract rice genomic DNA by conventional CTAB method;

[0066] 2) design the positive primers for detecting transgenic plants, the sequence is as follows:

TABLE-US-00001 (SEQIDNO:26) CC-F:TCCATATTTCATCTTCGGTGTCGT, (SEQIDNO:27) CC-R:AAGAAGGACCTCATCATCAAGCTC;

[0067] PCR Reaction System:

TABLE-US-00002 10 PCR Buffer 2 l 2.5 mM dNTP 2 l 10 M CC-F 0.3 l 10 M CC-R 0.3 l Rice genomic DNA 2 l rTaq polymerase 0.1 l Add double distilled water 20 l

[0068] PCR Amplification Program:

TABLE-US-00003 95 5 min 95 30 s 58 30 s 72 1 min (Skip to 95 30 s, cycle 35 times) 72 7 min 25 1 min

[0069] The product size is 1105 bp. The wild type (ie non-transgenic) Zhonghua 11 (ZH11) genomic DNA was used as a negative control.

[0070] All genomic DNAs were ActinM-F (CTCAACCCCAAGGCTAACAG) (SEQ ID NO: 28) and ActinM-R (ACCTCAGGGCATCGGAAC) (SEQ ID NO: 29) as internal control primer pairs. The quality of genomic DNA was determined by PCR amplification.

[0071] The results of transgenic positive statistics are shown in Table 1.

TABLE-US-00004 TABLE 1 T0 transgenic positive test results Number of tested T0 plants Proportion of plants containing constructs 63 78%

[0072] Since the loss-of-function lazy1 mutant shows a larger tiller angle (FIG. 2a), the phenotype with increased tiller angle of the lazy1 mutant can be used to qualitatively evaluate the editing efficiency of the constructs of the invention. Of the 63 T0 plants obtained by the invention, 29 have obvious tillering horn types, indicating that the CRISPR construct of the invention can generate a loss-of-function mutation in the target gene LAZY1.

[0073] Embodiment 5: Detection of Transgenic Fragments of T.sup.TKE-0 Offspring (T.sup.TKE-1)

[0074] Seeds were harvested from each individual T0 plant and the progeny (T1 generation) from 5 independent positive T0 plants were analyzed, these 5 independent T0 plants having a visible lazy1 phenotype.

[0075] Specific Steps are as Follows:

[0076] 1) take mature transgenic T0 rice leaves and extract rice genomic DNA by conventional CTAB method;

[0077] 2) design two pairs of positive primers for detecting transgenic plants:

[0078] first pair of primers:

TABLE-US-00005 (SEQIDNO:30) MGL-429F:TCTTCCATATTTCATCTTCGGTGT, (SEQIDNO:31) MGL-429R:GCATGACGTTATTTATGAGATGGG;

[0079] the size of the amplified product was 429 bp.

[0080] second pair of primers:

TABLE-US-00006 (SEQIDNO:32) BAR-377F:AATTCAGACCGGATTCTTTACTCA, (SEQIDNO:33) BAR-377R:GTCGCTGATACTTCTGATTTGTTC;

[0081] the size of the amplified product was 377 bp.

[0082] PCR Reaction System:

TABLE-US-00007 10 PCR Buffer 2 l 2.5 mM dNTP 2 l 10 M CC-F 0.3 l 10 M CC-R 0.3 l Rice genomic DNA 2 l rTaq polymerase 0.1 l Add double distilled water 20 l

[0083] PCR Amplification Program:

TABLE-US-00008 95 5 min 95 30 s 58 30 s 72 1 min (Skip to 95 30 s, cycle 35 times) 72 7 min 25 1 min

[0084] The above genomic DNA used ActinM-F (CTCAACCCCAAGGCTAACAG) (SEQ ID NO: 28) and ActinM-R (ACCTCAGGGCATCGGAAC) (SEQ ID NO: 29) as internal control primer pairs, and the quality of genomic DNA was determined by PCR amplification.

[0085] The Hyg-280F and Hyg-280R primers were used to PCR-amplify the genomic DNA of T1 plants transformed with the common CRISPR vector pCXUN-CAS9 to identify positive transgenic plants.

[0086] The test results of TKE T1 plants are shown in FIG. 4. The results of transgenic positive statistics are shown in Table 2.

TABLE-US-00009 TABLE 2 T1 transgenic positive test results TKE system Common CRISPR system Number Proportion Number Proportion T1 of T1 of plants T1 of T1 of plants family plants containing family plants containing number tested constructs number tested constructs T0 # 3 19 0% ZCR144-7 30 90% T0 # 30 9 0% ZCR147-ZH11-44 30 93% T0 # 34 7 0% HCR35-1 20 75% T0 # 40 20 0% HCR35-21 48 79% T0 # 49 4 0% ZCR147-ZH11-7 26 85%

[0087] From Table 2, when using a conventional CRISPR/Cas9 construct, at least 75% of the T1 generation transgenic plants have a CRISPR/Cas9 construct; when the TKE plasmid technical solution was used, all T1 generation transgenic plants (total 59) from 5 independent T0 generation transgenic plants did not contain CRISPR constructs, indicating that the TKE plasmid technical solution of the invention is very effective in eliminating transgenes.

Example 6: T.SUP.TKE.-1 Directed Mutation Detection

[0088] Using LAZY1-GT1 (CCTGCAACTGCATCACCGGGCTTG) (SEQ ID NO: 34) and LAZY1-GT2 (TCCAAGGAAACCTCATGAAATAGTCAGCCA) (SEQ ID NO: 35) as genotype detection primers, all plants in 6 independent T1 generation families were PCR amplified. Then, the PCR products were sequenced, and the sequencing results were analyzed through the Dsdecode website (http://dsdecode.scgene.com/) to identify the mutant forms of each T1 generation plant.

[0089] After sequencing 59 T1 generation plants of 5 independent T0 generation transgenic offsprings, it was found that all transgenic plants contained mutations at the target site with a mutation efficiency of 100%. The specific mutation forms and mutation efficiency are shown in FIG. 2. It is shown that the TKE system of the invention can automatically clear transgenic constructs of transgenic T1 generation plants and ensure efficient directed mutations in offspring. The invention can greatly reduce the time and manpower required to isolate rice without transgenic fixed-point DNA editing, and provides a very useful tool for crop genetic improvement. It can be easily applied to any other plant species that can be transgenic through tissue culture.

[0090] Appendix: Various Culture Media and Their Formulations According to the Invention

TABLE-US-00010 Induction medium: N.sub.6max stock solution (10X) 100 ml; N.sub.6min stock solution (100X) 10 ml; Vitamin (100X) 10 ml; Fe.sup.2+-EDTA stock solution (100X) 10 ml; 2,4-D stock solution (1 mg/ml) 2.5 ml; CH 0.6 g; Proline 0.3 g; Sucrose 30 g; Phytagel 3 g; pH: 5.9 Replenish distilled water to 1000 ml. Subculture medium: N.sub.6max stock solution (10X) 100 ml; N.sub.6min stock solution (100X) 10 ml; Vitamin (100X) 10 ml; Fe.sup.2+-EDTA stock solution (100X) 10 ml; 2,4-D stock solution (1 mg/ml) 2.0 ml; CH 0.6 g; Proline 0.5 g; Sucrose 30 g; Phytagel 3 g; pH: 5.9; Replenish distilled water to 1000 ml. Pre-culture medium: N.sub.6max stock solution (10X) 12.5 ml; N.sub.6min stock solution (100X) 1.25 ml; Vitamin (100X) 2.5 ml; Fe.sup.2+-EDTA stock solution (100X) 25 ml; 2,4-D stock solution (1 mg/ml) 0.75 ml; CH 0.15 g; Sucrose 5 g; Agarose 1.75 g; pH: 5.6; Replenish distilled water to 250 ml. Co-culture medium: N.sub.6max stock solution (10X) 12.5 ml; N.sub.6min stock solution (100X) 1.25 ml; Vitamin (100X) 2.5 ml; Fe.sup.2+-EDTA stock solution (100X) 25 ml; 2,4-D stock solution (1 mg/ml) 0.75 ml; CH 0.2 g; Sucrose 5 g; Agarose 1.75 g; pH: 5.6; Replenish distilled water to 250 ml. Suspension medium: N.sub.6max stock solution (10X) 5 ml; N.sub.6min stock solution (100X) 0.5 ml; Vitamin (100X) 1 ml; Fe.sup.2+-EDTA stock solution (100X) 0.5 ml; 2,4-D stock solution (1 mg/ml) 0.2 ml; CH 0.08 g; Sucrose 2 g; pH: 5.4; Replenish distilled water to 100 ml. Screening medium: N.sub.6max stock solution (10X) 25 ml; N.sub.6minstock solution (100X) 2.5 ml; Vitamin (100X) 2.5 ml; Fe.sup.2+-EDTA stock solution (100X) 2.5 ml; 2,4-0 stock solution (1 mg/ml) 0.625 ml; CH 0.15 g; Sucrose 7.5 g; Agarose 1.75 g; pH: 6.0; Replenish distilled water to 250 ml. Differentiation medium: MS.sub.max stock solution (10X) 100 ml; MS.sub.min stock solution (100X) 10 ml; Vitamin (100X) 10 ml; Fe.sup.2+-EDTA stock solution (100X) 10 ml; 6-BA (6-benzylaminopurine) 2.0 ml; KT (Cytokinin) 2.0 ml; IAA (Indoleacetic acid) 0.2 ml; NAA (Naphthaleneacetic acid) 0.2 ml; Sucrose 30 g; CH 1 g; Phytagel 3 g; pH: 6.0; Replenish distilled water to 1000 ml. Rooting medium: MSmax stock solution (10X) 50 ml; MSmin stock solution (100X) 5 ml; Vitamin (100X) 10 ml; Fe.sup.2+-EDTA stock solution (100X) 10 ml; Sucrose 20 g; Phytagel 3 g; pH: 5.8; Replenish distilled water to 1000 ml.

[0091] Main References

[0092] 1. Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini L A, Zhang F. Multiplex genome engineering using CRISPR/Cas systems. Science, 2013, 339(6121): 819-823;

[0093] 2. Gao X, Chen J, Dai X, Zhang D, Zhao Y. An Effective Strategy for Reliably Isolating Heritable and Cas9-Free Arabidopsis Mutants Generated by CRISPR/Cas9-Mediated Genome Editing. Plant Physiol, 2016, 171(3): 1794-1800;

[0094] 3. He Y, Zhang T, Yang N, Xu M, Yan L, Wang L, Wang R, Zhao Y. Self-cleaving ribozymes enable the production of guide RNAs from unlimited choices of promoters for CRISPR/Cas9 mediated genome editing. J Genet Genomics, 2017, 44(9): 469-472;

[0095] 4. Hu J, Wang K, Huang W, Liu G, Gao Y, Wang J, Huang Q, Ji Y, Qin X, Wan L, Zhu R, Li S, Yang D, Zhu Y. The Rice Pentatricopeptide Repeat Protein RF5 Restores Fertility in Hong-Lian Cytoplasmic Male-Sterile Lines via a Complex with the Glycine-Rich Protein GRP162. Plant Cell, 2012, 24(1): 109-122;

[0096] 5. Lannenpaa M, Hassinen M, Ranki A, Holtta-Vuori M, Lemmetyinen J, Keinonen K, Sopanen T. Prevention of flower development in birch and other plants using a BpFULL1:: BARNASE construct. Plant Cell Rep, 2005, 24(2): 69-78;

[0097] 6. Li P, Wang Y, Qian Q, Fu Z, Wang M, Zeng D, Li B, Wang X, Li J. LAZY1 controls rice shoot gravitropism through regulating polar auxin transport. Cell Res, 2007, 17(5): 402-410;

[0098] 7. Liang Z, Chen K, Li T, Zhang Y, Wang Y, Zhao Q, Liu J, Zhang H, Liu C, Ran Y, Gao C. Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat Commun, 2017, 8: 14261;

[0099] 8. Lu H P, Liu S M, Xu S L, Chen W Y, Zhou X, Tan Y Y, Huang J Z, Shu Q Y. CRISPR-S: an active interference element for a rapid and inexpensive selection of genome-edited, transgene-free rice plants. Plant Biotechnol J, 2017, 15(11): 1371-1373;

[0100] 9. Sun J L, Nakagawa H, Karita S, Ohmiya K, Hattori T. Rice embryo globulins: amino-terminal amino acid sequences, cDNA cloning and expression. Plant Cell Physiol, 1996, 37(5): 612-620;

[0101] 10. Symington L S, Gautier J. Double-strand break end resection and repair pathway choice. Annu Rev Genet, 2011, 45: 247-271;

[0102] 11. Zou YanJiao: Functional Study of BT-type Cytoplasmic Male Sterility Gene and Restorer Gene in Rice. Guangzhou: South China Agricultural University; 2006.