RNA EDITING INHIBITORS AND METHODS OF USE
20230235322 · 2023-07-27
Inventors
- Janne Juha Turunen (Leiden, NL)
- Lenka Van Sint Fiet (Leiden, NL)
- Lisanne Alieda Van Wissen (Leiden, NL)
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
An antisense oligonucleotide (AON) capable of inhibiting ADAR-mediated deamination of a target adenosine present in an editing-site sequence (ESS) of a target RNA molecule, wherein under physiological conditions the ESS would hybridize with an editing-site complementary sequence (ESCS) of an RNA molecule to form a double stranded RNA complex, wherein the AON comprises a sequence configured to compete with the ESCS for hybridization with the ESS.
Claims
1. An antisense oligonucleotide (AON) capable of inhibiting ADAR-mediated deamination of a target adenosine present in an editing-site sequence (ESS) of an endogenous target RNA molecule, wherein under physiological conditions the ESS would hybridize with an editing-site complementary sequence (ESCS) of an endogenous RNA molecule to form a double stranded RNA complex, wherein the AON comprises a sequence configured to compete with the ESCS for hybridization with the ESS.
2. The AON of claim 1, wherein the nucleotide in the AON opposite the target adenosine and/or the nucleotides in the AON opposite the nucleotides surrounding the target adenosine is/are chemically modified to compete with the ESCS and inhibit the ADAR-mediated deamination of the target adenosine.
3. The AON of claim 2, wherein the nucleotides surrounding the target adenosine consist of the adjacent two bases in the 3′ direction and the adjacent two bases in the 5′ direction.
4. The AON of claim 1, wherein the nucleotides in the AON opposite all adenosines in the target RNA molecule are each chemically modified to compete with the ESCS and inhibit the ADAR-mediated deamination of each corresponding adenosine in the target RNA molecule.
5. The AON of claim 2, wherein the chemical modification comprises a 2′-O ribosyl derivative.
6. The AON of claim 5, wherein the 2′-O ribosyl derivative is 2′-O-alkyl, 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), a locked nucleic acid, or a constrained nucleic acid (cEt).
7. The AON of claim 1, wherein the nucleotide opposite the target adenosine is uridine.
8. The AON of claim 1, wherein the ADAR is ADAR1 or ADAR2.
9. The AON claim 1, wherein the ESS and ESCS are located on the same RNA molecule.
10. The AON of claim 1, wherein under physiological conditions the ESS would hybridize with the ESCS to form a double stranded RNA complex in a cell.
11. The AON of claim 1, wherein the ESS is of a pre-messenger RNA, a messenger RNA, a long non-coding RNA, a ribosomal RNA, a transfer RNA, a long non-coding RNA or a miRNA or a precursor of any of the foregoing RNAs.
12. The AON of claim 1, wherein the target adenosine is located within a coding sequence of an RNA molecule.
13. A pharmaceutical composition comprising AON of claim 1, and a pharmaceutically acceptable carrier, excipient and/or adjuvant.
14. A method of inhibiting ADAR-mediated deamination of a target adenosine present in an ESS of a target RNA molecule, wherein under physiological conditions the ESS would hybridize with an ESCS of an RNA molecule in a cell to form a double stranded RNA complex, the method comprising contacting the target RNA molecule with the AON of claim 1.
15. (canceled)
16. (canceled)
17. (canceled)
18. A method of treating or preventing a condition associated with erroneous or unwanted ADAR-mediated adenosine deamination, the method comprising administering an effective amount of the AON any of claim 1 to a patient in need thereof.
19. (canceled)
20. The method of claim 18, wherein the condition associated with erroneous or unwanted ADAR-mediated adenosine deamination is selected from the group consisting of : - a viral infection, optionally a respiratory viral infection, optionally a respiratory viral infection caused by a coronavirus, optionally wherein the coronavirus is SARS-CoV-2; - a metabolic disorder, optionally wherein the metabolic disorder is selected from the group consisting of hyperuricemia, obesity and cardiovascular disease; - a mental disorder, optionally wherein the mental disorder is selected from the group consisting of depression, bipolar disorder, schizophrenia and suicide risk; and - cancer, optionally wherein the cancer is selected from the group consisting of hepatocellular carcinoma, esophageal squamous cell carcinoma, non-small-cell lung cancer, colorectal cell carcinoma, cervical cancer, multiple myeloma, breast cancer, lung adenocarcinoma, prostate cancer, chronic myelogenous leukemia, head and neck squamous cell carcinoma, kidney renal papillary cell carcinoma, thyroid carcinoma and uterine corpus endometrial carcinoma.
21. The AON of claim 2, wherein the nucleotides surrounding the target adenosine consist of the adjacent base in the 3′ direction and the adjacent base in the 5′ direction.
22. The AON of claim 6, wherein the 2′-O ribosyl derivative is 2′-OMe or 2′-MOE.
23. The AON of claim 8, wherein the ADAR is human ADAR1 or human ADAR2.
24. The AON of claim 9, wherein the ESS and ESCS would hybridize under physiological conditions to form a stem-loop structure.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] One or more embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which:
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DETAILED DESCRIPTION
[0045] The AONs of the present invention are capable of inhibiting ADAR-mediated deamination of a target adenosine. As discussed, this occurs through a two-step process. In the first step, the AON competes with the ESCS for hybridization with the ESS of the target RNA, to form an AON-ESS duplex. In the second step, the AON-ESS duplex inhibits the ADAR from deaminating the target adenosine. This inhibition can occur through the AON-ESS duplex not being capable of binding to the ADAR or, if the AON-ESS duplex does bind to the ADAR the ADAR catalytic site is prevented from carrying out the catalytic deamination of the target adenosine to inosine. Examples of sequences configured to compete with the ESCS and inhibit ADAR-mediated deamination of the target adenosine are set out below.
[0046] To assist with identification of positions, where applicable the following numbering is used. The nucleotide on the AON opposite the target adenosine is nucleotide position 0 and the linkage 5′ from nucleotide position 0 is linkage position 0, and the nucleotide positions and the linkage positions in the AON are both positively (+) and negatively (-) incremented towards the 5′ and 3′ ends respectively. In the case of two or more target adenosines, the numbering can be applied independently to each adenosine, to create overlapping numbering systems.
[0047] In one embodiment, the chemical modification comprises a 2′-O ribosyl modification. Different chemical modifications of the nucleotides in the AON (including 2′-O ribosyl modifications) are discussed in great detail in WO2016/097212, WO2017/220751, WO2018/041973, WO2018/134301, WO2019/158475, and WO2019/219581, which are herein incorporated in their entirety.
[0048] In one embodiment, the chemical modification comprises a 2′-O ribose modification. In this embodiment, it is preferred that one or more or all of positions +14, +13, +12, +6, +2, +1, 0, -1, -2, -3, -4, and/or -5 comprise a 2′-O ribose modification. In a particularly preferred embodiment, one or more or all of positions +14, +13, +12, 0, -1, -2 and/or -3 comprise a 2′-O ribose modification. In a yet more preferred embodiment, positions 0 and/or -1 comprise a 2′-O ribose modification. In one embodiment, all positions comprise a 2′-O ribose modification. The ribose sugar may be modified by substitution of the 2′-O moietywith a lower alkyl (C1-4, such as 2′-OMe), alkenyl (C2-4), alkynyl (C2-4), methoxyethyl (2′-MOE), or other substituent. Preferred substituents of the 2′ OH group are a methyl, methoxyethyl, F, constrained ethyl (cEt) or 3,3′-dimethylallyl group. The latter is known for its property to inhibit nuclease sensitivity due to its bulkiness, while improving efficiency of hybridization (Angus & Sproat FEBS 1993 Vol. 325, no. 1, 2, 123-7). Alternatively, locked nucleic acid sequences (LNAs), comprising a 2′-4′ intramolecular bridge (usually a methylene bridge between the 2′ oxygen and 4′ carbon) linkage inside the ribose ring, may be applied. Purine nucleobases and/or pyrimidine nucleobases may be modified to alter their properties, for example by amination or deamination of the heterocyclic rings. The exact chemistries and formats may depend from oligonucleotide construct to oligonucleotide construct and from application to application, and may be worked out in accordance with the wishes and preferences of those of skill in the art. In a preferred embodiment, the 2′-O ribose modification is a 2′-OMe and/or 2′-MOE ribose modification. The modifications can be exclusively 2′-OMe or exclusively 2′-MOE, or can be a mixture of 2′-OMe and 2′-MOE, or can be a mixture of 2′-OMe and/or 2′-MOE and/or unmodified 2′-O and/or further 2′-O modifications. It is particularly preferred that the position opposite the target adenosine comprises a 2′-OMe or 2′-MOE modification, preferably a 2′-MOE modification.
[0049] In one embodiment, the chemical modification comprises an unlocked nucleic acid (UNA). In this modification, there is no carbon-carbon bond between the ribose 2′ and 3′ carbon atoms. UNA ribose modifications therefore increase the local flexibility in oligonucleotides. In addition to inhibiting ADAR-mediated deamination, UNAs can lead to effects such as improved pharmacokinetic properties through improved resistance to degradation. UNAs can also decrease toxicity. In this embodiment, it is preferred that an unlocked nucleic acid modification is present at one or more or all of nucleotide positions +14, +13, +12, +2, 0, and -3. The UNA modification may also exist in addition to modifications to the ribose 2′ group, either at positions different to the UNA modifications or at the same positions as the UNA modifications. The ribose 2′ groups in the AON can be independently selected from 2′-H (i.e. DNA), 2′-OH (i.e. RNA), 2′-OMe, 2′-MOE, 2′-F, or 2′-4′-linked (i.e. a locked nucleic acid or LNA). The 2′-4′ linkage can be selected from linkers known in the art, such as a methylene linker or constrained ethyl linker.
[0050] In one embodiment one or more or all internucleoside linkages are modified. That is, they can be a phosphodiester wherein the OH group of the phosphodiester has been replaced by alkyl, alkoxy, aryl, alkylthio, acyl, -NR1R1, alkenyloxy, alkynyloxy, alkenylthio, alkynylthio, -S-Z+, -Se-Z+, or- BH3-Z+, and wherein R1 is independently hydrogen, alkyl, alkenyl, alkynyl, or aryl, and wherein Z+ is ammonium ion, alkylammonium ion, heteroaromatic iminium ion, or heterocyclic iminium ion, any of which is primary, secondary, tertiary or quaternary, or Z is a monovalent metal ion, and is preferably a phosphorothioate (PS) linkage. In a preferred embodiment the internucleotide linkage modification is at position +8, +7, +6, +5, -4 and/or -5.
[0051] Where a PS linkage modification is at position 10, it is preferably in the R configuration.
[0052] Where a PS linkage modification is at position +4, -1, -3 and/or -6, it is preferably in the S configuration. The preference for specific PS stereochemistry at different positions is described further in WO2019/219581.
[0053] In one embodiment, one or more or all internucleoside linkages are modified to be a methylphosphonate (MP) linkage. It is preferred that the AON comprises one or more MP linkages at linkage positions 0, -1, -2, -3, -4, -5 and/or -6, more preferably the AON comprises MP linkages at linkage positions -0 and/or -2. In one embodiment, the AON comprises a single MP linkage. Especially preferred is the aspect that the MP linkage renders the AON more stable than an AON lacking that MP linkage when compared in an in vitro stability assay. The preference for specific MP linkages is described in PCT/EP2020/059369 (unpublished).
[0054] In one embodiment, the chemical modification comprises a phosphonoacetate linkage modification. Phosphonoacetate linkages are well-referenced and highly relevant RNA modifications for therapeutically optimized oligonucleotides. In addition to inhibiting ADAR-mediated deamination, an important role of this modification is to protect the polymer from nuclease-mediated degradation. Phosphonoacetate modifications can also be responsible for improved uptake of the EONs into target cells. In this embodiment, it is preferred that a phosphonoacetate modification is present at one or more or all of linkage positions +13, +12, +11, +8, +7, +6, -1, -2, -3, -4 and -5, particularly at one or more or all of linkage positions +13, +12, +7, -4 and -5. As discussed in PCT/EP2020/053283 (unpublished), phosphonoacetate modifications at these positions can cause disruption of binding with ADAR. The internucleotide linkages that are not phosphonoacetate internucleotide linkages are preferably an unmodified phosphodiester or another linkage such as PS, phosphodithioate, 3′-methylenephosphonate, 5′-methylenephosphonate, 3′-phosphoroamidate and the like.
[0055] The AON can comprise one or more mismatches, wobbles and/or bulges with the ESS, as long as the AON still competes with the ESCS for hybridisation of the ESS. In a preferred embodiment, the AON comprises no mismatches, wobbles and/or bulges with the ESS, and in particular comprises no mismatches, wobbles and/or bulges with the ESS at the target adenosine.
[0056] The AON can comprise further sequence in addition to the sequence that hybridises with the ESS, as long as the AON still competes with the ESCS for hybridisation of the ESS.
[0057] When the nucleotide opposite the target adenosine is a uridine or a deoxyuridine, the EON may be 100% complementary and not have any mismatches, wobbles or bulges in relation to the target RNA. The AON of the invention will usually comprise the normal nucleotides A, G, U and C, but may also include inosine (I), for example instead of one or more G nucleotides.
[0058] In one particular embodiment of the present invention, the AON is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides in length. Preferably, the AON is shorter than 100 nucleotides, more preferably shorter than 60 nucleotides, and even more preferably, the AON comprises 18 to 70 nucleotides, 18 to 60 nucleotides, or 18 to 50 nucleotides.
[0059] Preferably the AON of the present invention does not have a portion that allows the AON in itself to fold into an intramolecular hairpin or other type of (stem) loop structure (herein also referred to as “auto-looping” or “self-looping”), and which may potentially act as a structure that sequesters ADAR.
[0060] The invention concerns the modification of target RNA sequences in eukaryotic, preferably metazoan, more preferably mammalian cells. In principle the invention can be used with cells from any mammalian species, but it is preferably used with a human cell. The invention can be used with cells from any organ e.g. skin, lung, heart, kidney, liver, pancreas, gut, muscle, gland, eye, brain, blood and the like. The cell can be located in vitro or in vivo. One advantage of the invention is that it can be used with cells in situ in a living organism, but it can also be used with cells in culture. In some embodiments, cells are treated ex vivo and are then introduced into a living organism (e.g. re-introduced into an organism from whom they were originally derived).
[0061] The amount of oligonucleotide to be administered, the dosage and the dosing regimen can vary from cell type to cell type, the disease to be treated, the target population, the mode of administration (e.g. systemic versus local), the severity of disease and the acceptable level of side activity, but these can and should be assessed by trial and error during in vitro research, in pre-clinical and clinical trials. The trials are particularly straightforward when the modified sequence leads to an easily detected phenotypic change.
[0062] One suitable trial technique involves delivering the oligonucleotide construct to cell lines, or a test organism and then taking biopsy samples at various time points thereafter. The sequence of the target RNA can be assessed in the biopsy sample and the proportion of cells having the modification can easily be followed. After this trial has been performed once then the knowledge can be retained, and future delivery can be performed without needing to take biopsy samples. A method of the invention can thus include a step of identifying the presence of the desired change in the cell’s target RNA sequence, thereby verifying that the target RNA sequence has been modified. This step will typically involve sequencing of the relevant part of the target RNA, or a cDNA copy thereof (or a cDNA copy of a splicing product thereof, in case the target RNA is a pre-mRNA), as discussed above, and the sequence change can thus be easily verified. Alternatively the change may be assessed on the level of the protein (length, glycosylation, function or the like), or by some functional read-out, such as a(n) (inducible) current, when the protein encoded by the target RNA sequence is an ion channel, for example. In the case of CFTR function, an Ussing chamber assay or an NPD test in a mammal, including humans, are well known to a person skilled in the art to assess restoration or gain of function.
[0063] Oligonucleotides of the invention are particularly suitable for therapeutic use, and so the invention provides a pharmaceutical composition comprising an oligonucleotide of the invention and a pharmaceutically acceptable carrier. In some embodiments of the invention the pharmaceutically acceptable carrier can simply be a saline solution. This can usefully be isotonic or hypotonic, particularly for pulmonary delivery. The invention also provides a delivery device (e.g. syringe, inhaler, nebuliser) which includes a pharmaceutical composition of the invention. Especially when the AON is to be delivered to the epithelial cells of the airways (for instance to prevent or treat a respiratory viral infection, e.g. in the case of an influenza- or coronavirus) the use of a nebuliser to administer the AON to the subject in need thereof, is preferred.
[0064] The invention also relates to a method for inhibiting the deamination of at least one specific target adenosine present in a target RNA sequence in a cell, the method comprising the steps of: providing the cell with an AON according to the invention; allowing uptake by the cell of the AON; and allowing annealing of the AON to the target RNA sequence; and optionally identifying the presence of the adenosine or inosine in the RNA sequence.
[0065] Introduction of the AON according to the present invention into the cell is performed by general methods known to the person skilled in the art. The read-out of the effect (e.g. alteration or prevention of alteration of the target RNA sequence) can be monitored through different ways. Hence, the identification step of whether deamination of the target adenosine has taken place depends generally on the position of the target adenosine in the target RNA sequence, and the effect that is incurred by the presence of the adenosine (point mutation, early stop codon). Hence, in a preferred aspect, depending on the ultimate deamination effect of A to I conversion, the identification step comprises: sequencing the target RNA; assessing the presence of a functional, elongated, full length and/or wild type protein; assessing whether splicing of the pre-mRNA was altered by deamination; or using a functional read-out, wherein the target RNA before deamination encodes a functional, full length, elongated and/or wild type protein. The identification of prevention of deamination into inosine may also be a functional read-out, for instance an assessment on whether a functional protein is present, or even the assessment that a disease that is caused by the deamination is (partly) reversed. The functional assessment for each of the diseases mentioned herein will generally be according to methods known to the skilled person. A very suitable manner to identify the presence of adenosine or an inosine after deamination of the target adenosine is of course RT-PCR and sequencing, using methods that are well-known to the person skilled in the art.
[0066] The AON according to the invention is suitably administrated in aqueous solution, e.g. saline, or in suspension, optionally comprising additives, excipients and other ingredients, compatible with pharmaceutical use, at concentrations ranging from 1 ng/ml to 1 g/ml, preferably from 10 ng/ml to 500 mg/ml, more preferably from 100 ng/ml to 100 mg/ml. Dosage may suitably range from between about 1 .Math.g/kg to about 100 mg/kg, preferably from about 10 .Math.g/kg to about 10 mg/kg, more preferably from about 100 .Math.g/kg to about 1 mg/kg. Administration may be by inhalation (e.g. through nebulization), intranasally, orally, by injection or infusion, intravenously, subcutaneously, intra-dermally, intra-cranially, intravitreally, intramuscularly, intra-tracheally, intra-peritoneally, intra-rectally, and the like. Administration may be in solid form, in the form of a powder, a pill, or in any other form compatible with pharmaceutical use in humans. The invention is particularly suitable for treating genetic diseases, such as cystic fibrosis. The invention is also particularly suitable for treating viral infections, such as respiratory viral infections, more preferably, viral infections caused by coronaviruses such as SARS-CoV-1, MERS-CoV, and SARS-CoV-2, and derivatives thereof.
[0067] In some embodiments the oligonucleotide construct can be delivered systemically, but it is more typical to deliver an oligonucleotide to cells in which the target sequence’s phenotype is seen.
Definitions of Terms as Used Herein
[0068] The terms ‘adenine’, ‘guanine’, ‘cytosine’, ‘thymine’, ‘uracil’ and ‘hypoxanthine’ (the nucleobase in inosine) as used herein refer to the nucleobases as such.
[0069] The terms ‘adenosine’, ‘guanosine’, ‘cytidine’, ‘thymidine’, ‘uridine’ and ‘inosine’ refer to the nucleobases linked to the (deoxy)ribosyl sugar.
[0070] The term ‘nucleoside’ refers to the nucleobase linked to the (deoxy)ribosyl sugar.
[0071] The term ‘nucleotide’ refers to the respective nucleobase-(deoxy)ribosyl-phospholinker, as well as any chemical modifications of the ribose moiety or the phospho group. Thus the term would include a nucleotide including a locked ribosyl moiety (comprising a 2′-4′ bridge, comprising a methylene group or any other group, well known in the art), an unlocked nucleic acid, a nucleotide including a linker comprising a phosphodiester, phosphonoacetate, phosphotriester, phosphoro(di)thioate, methylphosphonates, phosphoramidate linkers, and the like.
[0072] Sometimes the terms adenosine and adenine, guanosine and guanine, cytidine and cytosine, uracil and uridine, thymine and thymidine/uridine, inosine and hypo-xanthine, are used interchangeably to refer to the corresponding nucleobase on the one hand, and the nucleoside or nucleotide on the other.
[0073] Sometimes the terms nucleobase, nucleoside and nucleotide are used interchangeably, unless the context clearly requires differently. The terms ‘ribonucleoside’ and ‘deoxyribonucleoside’, or′ribose’ and ‘deoxyribose’ are as used in the art.
[0074] Whenever reference is made to an ‘oligonucleotide’, both oligoribonucleotides and deoxyoligoribonucleotides are meant unless the context dictates otherwise. Whenever reference is made to an ‘oligoribonucleotide’ it may comprise the bases A, G, C, U or I. Whenever reference is made to a ‘deoxyoligoribonucleotide’ it may comprise the bases A, G, C, T or I. In a preferred aspect, the EON of the present invention is an oligoribonucleotide that may comprise chemical modifications and may include deoxynucleotides (DNA) at certain specified positions. Terms such as oligonucleotide, oligo, ON, oligonucleotide composition, antisense oligonucleotide, AON, and RNA (antisense) oligonucleotide may be used herein interchangeably.
[0075] Whenever reference is made to nucleotides in the oligonucleotide construct, such as cytosine, 5-methylcytosine, 5-hydroxymethylcytosine and β-D-Glucosyl-5-hydroxymethylcytosine are included; when reference is made to adenine, N6-Methyladenine and 7-methyladenine are included; when reference is made to uracil, dihydrouracil, 4-thiouracil and 5-hydroxymethyluracil are included; when reference is made to guanine, 1-methylguanine is included.
[0076] Whenever reference is made to nucleosides or nucleotides, ribofuranose derivatives, such as 2′-desoxy, 2′-hydroxy, and 2′-O -substituted variants, such as 2′-O-methyl, are included, as well as other modifications, including 2′-4′ bridged variants.
[0077] Whenever reference is made to oligonucleotides, linkages between two mono-nucleotides may be phosphodiester linkages as well as modifications thereof, including, phosphonoacetate, phosphodiester, phosphotriester, phosphoro(di)thioate, methylphosphonate, phosphor-amidate linkers, and the like.
[0078] The term ‘comprising’ encompasses ‘including’ as well as ‘consisting’, e.g. a composition comprising X′ may consist exclusively of X or may include something additional, e.g. X + Y.
[0079] The term ‘about’ in relation to a numerical value x is optional and means, e.g. x±10%.
[0080] The word ‘substantially’ does not exclude ‘completely’, e.g. a composition which is ‘substantially free from Y’ may be completely free from Y. Where relevant, the word ‘substantially’ may be omitted from the definition of the invention.
[0081] The term “complementary” as used herein refers to the fact that the AON hybridizes under physiological conditions to the target sequence. The term does not mean that each nucleotide in the AON has a perfect pairing with its opposite nucleotide in the target sequence. In other words, while an AON may be complementary to a target sequence, there may be mismatches, wobbles and/or bulges between AON and the target sequence, while under physiological conditions that AON still hybridizes to the target sequence competitively with the ESCS. The term “substantially complementary” therefore also means that despite the presence of the mismatches, wobbles, and/or bulges, the AON has enough matching nucleotides between AON and target sequence that under physiological conditions the AON hybridizes to the target RNA. As shown herein, an AON may be complementary, but may also comprise one or more mismatches, wobbles and/or bulges with the target sequence, if under physiological conditions the AON is able to hybridize to its target.
[0082] The term ‘downstream’ in relation to a nucleic acid sequence means further along the sequence in the 3′ direction; the term ‘upstream’ means the converse. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon in the sense strand but is downstream of the stop codon in the antisense strand.
[0083] References to ‘hybridisation’ typically refer to specific hybridisation and exclude non-specific hybridisation. Specific hybridisation can occur under experimental conditions chosen, using techniques well known in the art, to ensure that the majority of stable interactions between probe and target are where the probe and target have at least 70%, preferably at least 80%, more preferably at least 90% sequence identity.
[0084] The term ‘mismatch’ is used herein to refer to opposing nucleotides in a double stranded RNA complex which do not form perfect base pairs according to the Watson-Crick base pairing rules. Mismatched nucleotides are G-A, C-A, U-C, A-A, G-G, C-C, U-U pairs. In some embodiments EONs of the present invention comprise fewer than four mismatches, for example 0, 1 or 2 mismatches. Wobble base pairs are: G-U, I-U, I-A, and I-C base pairs.
EXAMPLES
Example 1: Chemically Modified AONs Do Not Allow Editing of a Target Adenosine When Duplexed With an ESS
[0085] To investigate whether chemical modifications are indeed an effective method to prevent editing, when duplexed with the ESS of a target RNA, the inventors tested this in an in vitro editing assay. As a positive control, an RNA duplex mimicking a natural ADAR editing target was generated by annealing an in vitro transcribed RNA sequence (the edited, or ESS, strand) from the mouse Idua (W392X) mRNA (as discussed in more detail in, for example, WO2017220751 or WO2018041973) to a partially complementary RNA oligonucleotide (the guide strand, or ESCS; IDUA7; see
[0086] The RNA guide strand (IDUA7), ADAR102-20 and ADAR102-32 were separately annealed to the mIDUA target RNA. Annealing was done in a buffer (5 mM Tris-Cl pH 7.4, 0.5 mM EDTA and 10 mM NaCl) with a concentration of 1 nM target RNA and 3 nM IDUA7, ADAR102-20 or ADAR102-32. The samples were heated at 95° C. for 3 min and then slowly cooled down to room temperature. Next, the editing reaction was carried out by mixing with protease inhibitor (cOmpleteTM, Mini, EDTA-free Protease I, Sigma-Aldrich), RNase inhibitor (RNasin, Promega), poly A (Qiagen), tRNA (Invitrogen) and editing reaction buffer (15 mM Tris-Cl pH 7.4, 1.5 mM EDTA, 3% glycerol, 60 mM KCl, 0.003% NP-40, 3 mM MgCl.sub.2 and 0.5 mM DTT). The reaction was started by adding purified human ADAR2, which was produced by GenScript, to a final concentration of 3 nM into the mix and incubated for predetermined time points (0, 4, 10, or 25 min) at 37° C. The reaction was stopped by adding 190 .Math.L boiling water and then the mixture was incubated for 5 min at 95° C. Then, 6 .Math.l of the stopped reaction mixture was used as template for cDNA synthesis using Maxima reverse transcriptase kit with random hexamer primers (Thermo Fisher) according to the manufacturer’s instructions in a total volume of 20 .Math.l and using an extension temperature of 62° C.
[0087] Products were amplified for pyrosequencing analysis by PCR, using the Amplitaq gold 360 DNA Polymerase kit (Applied Biosystems) according to the manufacturer’s instructions, with 1 .Math.l of the cDNA as template. The following primers were used at a concentration of 10 .Math.M: Pyroseq Fwd2 IDUA, 5′-AGTACTCACAGTCATGGGGCTCA-3′ (SEQ ID NO: 8), and Pyroseq Rev2 IDUA Biotin, 5′-GCCAGGACACCCACTGTATGAT-3′ (SEQ ID NO: 9). The latter primer also contains a biotin conjugated to its 5′ end, as required for the automatic processing during the pyrosequencing reactions. The PCR was performed using the following thermal cycling protocol: Initial denaturation at 95° C. for 5 min, followed by 45 cycles of 95° C. for 30 sec, 60° C. for 30 sec and 72° C. for 30 sec, and a final extension of 72° C. for 7 min.
[0088] As inosines base-pair with cytidines during the cDNA synthesis in the reverse transcription reaction, the nucleotides incorporated in the edited positions during PCR will be guanosines. The percentage of guanosine (edited) versus adenosine (unedited) was defined by pyrosequencing. Pyrosequencing of the PCR products and the following data analysis were performed by the PyroMark Q48 Autoprep instrument (QIAGEN) following the manufacturer’s instructions, with 10 .Math.l input of the PCR product and 4 .Math.M of the following sequencing primer: IDUA-Seq2, 5′-TGGGGCTCATGGCCCT -3′ (SEQ ID NO: 10). The settings specifically defined for this target RNA strand included two sets of sequence information. The first of these defines the sequence for the instrument to analyse, in which the potential for a particular position to contain either an adenosine or a guanosine is indicated by a “/”: GTTGGATGGAGAACAACTCTA/GGGCAGAGGTCTCAA/GAGGCTGGGGCTGTGTTGGACAG (SEQ ID NO: 11). The second set defines the order in which the sequencing reagents corresponding to each nucleotide are to be dispensed, and also includes blank controls (i.e. nucleotides that should not be incorporated at that particular position), which is used by the instrument to define the background signal. The dispensation order was defined for this analysis as follows, with the blank controls highlighted:
TABLE-US-00001 CGTGATGAGACACTCGTAGCAGAGTCTGCAGAGCTGCA (SEQ ID NO : 13).
[0089] The analysis performed by the instrument provides the results for the selected nucleotide as a percentage of adenosine and guanosine detected in that position, and the extent of A-to-I editing at a chosen position (here, specifically the A in codon W392X) will therefore be measured by the percentage of guanosine in that position.
[0090] The results shown in
Example 2: Inhibition of A-to-I Editing by a Chemically Modified AON That Prevents the Formation of an Editing Capable Duplex by Competing With an Editing-Site Complementary Strand
[0091] To investigate whether an AON can compete with an ESCS and inhibit ADAR-mediated editing, and whether chemical modifications are necessary for this inhibition, an RNA duplex mimicking a natural ADAR editing target was generated by annealing an in vitro transcribed RNA sequence (the edited, or ESS, strand) from the mouse Idua (W392X) mRNA to a partially complementary RNA oligonucleotide (the guide strand, or ESCS; IDUA7; see
[0092] Products were amplified for pyrosequencing analysis by PCR, using the Amplitaq gold 360 DNA Polymerase kit (Applied Biosystems) according to the manufacturer’s instructions, with 1 .Math.l of the cDNA as template. The following primers were used at a concentration of 10 .Math.M: Pyroseq Fwd2 IDUA and Pyroseq Rev2 IDUA Biotin (see example 1). The PCR was performed as described in example 1.
[0093] As inosines base-pair with cytidines during the cDNA synthesis in the reverse transcription reaction, the nucleotides incorporated in the edited positions during PCR will be guanosines. The percentage of guanosine (edited) versus adenosine (unedited) was defined by pyrosequencing. Pyrosequencing of the PCR products and the following data analysis were performed by the PyroMark Q48 Autoprep instrument (QIAGEN) following the manufacturer’s instructions, with 10 .Math.l input of the PCR product and 4 .Math.M of sequencing primer IDUA-Seq2. The settings specifically defined for this target RNA strand included two sets of sequence information. The first of these defines the sequence for the instrument to analyse, in which the potential for a particular position to contain either an adenosine or a guanosine is indicated by a “/”: GTTGGA/GTGGA/GGAACAA/GCTCTA/GGGCA/GGAGGTCTCAAA/GGGCTGGGGCTGTGTTGGA/G CAG (SEQ ID NO: 14). The second set defines the order in which the sequencing reagents corresponding to each nucleotide are to be dispensed, and also includes blank controls (i.e. nucleotides that should not be incorporated at that particular position), which is used by the instrument to define the background signal. The dispensation order was defined for this analysis as follows, with the blank controls highlighted: AGCTGACTGGAGAGCGAGCTCATAGTCAGAGTCTGCGAGAGCTGGCTGTGCTGACA (SEQ ID NO: 12). The analysis performed by the instrument provides the results for the selected nucleotide as a percentage of adenosine and guanosine detected in that position, and the extent of A-to-I editing at a chosen position will therefore be measured by the percentage of guanosine in that position.
[0094] The pyrosequencing results (percentage of guanosine) for the selected target adenosine are plotted in
Example 3: Inhibition of A-to-I Editing by a Chemically Modified AON in Cells
[0095] To further investigate whether the inhibition of RNA could be achieved in a setting with endogenous ADAR, the inventors selected two targets that were known to be edited in nature: XIAP and 5-HT2RC, and to see whether transfection with chemically modified AONs targeting their respective ESS sequences would lower the level of editing seen under normal circumstances. XIAP was primarily chosen because of the location of the editing sites in the 3′ UTR. 5-HT2RC is a potential therapeutic target (Dracheva et al. 2008).
[0096] For XIAP, HEK-293 cells were plated in a 6-well plate 24 h prior to transfections in a density of 2.5×10.sup.5 cells per well and cultured in Dulbecco’s Modified Eagle Medium (Gibco) supplemented with 10% FBS. Cells were either not transfected (NT), treated with transfection reagent only (Mock), transfected with an unrelated non-targeting oligo (scrambled control; 100 nM of a 24-mer oligonucleotide) or transfected with final concentration of 100 nM of the following four XIAP specific AONs (see
[0097] nEON1 mer):
TABLE-US-00002 mG*mA*mG*mC*mC*mA*mA*mG*mA*mU*mU*mG*mU*mG*mC*mC*mA *mU*mU*mG*mC*mA*mC*mU
[0098] nEON2 mer):
TABLE-US-00003 moeG*moeA*moeG*moeC*moeC*moeA*moeA*moeG*moeA*moeT* moeT*moeG*moeT*moeG*moeC*moeC*moeA*moeT*moeT*moeG* moeC*moeA*moeC*moeT
[0099] nEON3 mer):
TABLE-US-00004 mG*mA*InG*mC*mC*InA*mA*mG*InA*mU*mU*InG*mU*mG*InC* mC*mA*InT*mU*mG*InC*mA*mC*mU
[0100] nEON4 mer):
TABLE-US-00005 mC*mC*mA*mA*mG*mA*mU*mU*mG*mU*mG*mC*mC*mA*mU*mU*mG *mC*mA
[0101] The AONs above are given from 5′ to 3′. The asterisk (*) indicates a phosphorothioate linkage. ‘m’ indicates a 2′-OMe modification of the sugar moiety. ‘moe’ indicates a 2′-MOE modification of the sugar moiety. ‘In’ indicates a locked nucleic acid (LNA) modification. Since all nucleosides are modified at the 2′ position or are LNA, there is no distinction between RNA or DNA. The reason for the U or T notation is that the 2′-OMe modified AONs are built with 2′-OMe/U building blocks and the 2′-MOE modified AONs were built with 2′-MOE/T building blocks (2′-OMe/T building blocks were not applied in the manufacturing).
[0102] Transfections were performed using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol at a ratio of 2 .Math.l Lipofectamine 2000 to 1 .Math.g EON). Prior to transfection, medium was replaced to 1.7 mL/well fresh medium and a transfection mix (300 .Math.l) was added, making a total of 2 mL/well. After 24 h medium was removed and cells were washed once with 1X PBS and then 350 .Math.l of Trizol was added to each well for cell lysis. The lyzed cells were then collected and RNA was extracted using the Direct-zol RNA MiniPrep (Zymo Research) kit according to the manufacturer’s instructions. RNA concentrations were measured using the Nanodrop and 500 ng RNA was used for cDNA synthesis. cDNA synthesis was performed using the Maxima reverse transcriptase kit (Thermo Fisher) according to the manufacturer’s instructions, with a combination of random hexamer and oligo-dT primers. Then, cDNA was subjected to RT-PCR using the Amplitaq Gold 360 DNA Polymerase 1000U kit (Applied Biosystems) according to the manufacturer’s instructions to amplify the target region. The following primers were used: [0103] XIAP PCR forward: 5′-CTACTCCGGAGCCTGAGGT-3′ (SEQ ID NO: 24) [0104] XIAP PCR reverse: 5′-TGGGAGATGAATCACTTGAGGT-3′ (SEQ ID NO: 25) [0105] XIAP sequencing: 5′-CAGAAATTCAAGACTAGCCTGGC-3′ (SEQ ID NO: 26)
[0106] For 5-HT2RC, human neuroblastoma SH-SY5Y cells were plated in a 6-well plate 24 h prior to transfections in a density of 3×10.sup.5 cells per well and were cultured in Eagle’s Minimum Essential Medium F12 medium (Gibco) supplemented with 15% FBS and 1% non-essential amino acids. Cells were either not transfected (NT), treated with transfection reagent only (Mock), transfected with an unrelated non-targeting oligo (scrambled control; 100 nM of a 24-mer oligonucleotide) or transfected with final concentration of 100 nM of the following four AONs (see
[0107] nEON1 mer):
TABLE-US-00006 mA*mG*mG*mA*mU*mU*mA*mC*mG*mU*mA*mU*mU*mG*mC*mU*mA *mC*mA*mU*mA*mC*mC*mG
[0108] nEON2 mer):
TABLE-US-00007 moeA*moeG*moeG*moeA*moeT*moeT*moeA*moeC*moeG*moeT* moeA*moeT*moeT*moeG*moeC*moeT*moeA*moeC*moeA*moeT* moeA*moeC*moeC*moeG
[0109] nEON3 mer):
TABLE-US-00008 mA*mG*InG*mA*mU*InT*mA*mC*InG*mU*mA*InT*mU*mG*InC* mU*mA*InC*mA*mU*InA*mC*mC*mG
[0110] nEON4 mer):
TABLE-US-00009 mU*mA*mC*mG*mU*mA*mU*mU*mG*mC*mU*mA*mC*mA*mU*mA*mC *mC*mG
[0111] nEON5 mer):
TABLE-US-00010 moeT*moeA*moeC*moeG*moeT*moeA*moeT*moeT*moeG*moeC* moeT*moeA*moeC*moeA*moeT*moeA*moeC*moeC*moeG
[0112] nEON6 mer):
TABLE-US-00011 mU*mA*InC*mG*mU*InA*mU*mU*InG*mC*mU*InA*mC*mA*InT* mA*mC*InC*mG
[0113] The AONs above are given from 5′ to 3′. The asterisk (*) indicates a phosphorothioate linkage. ‘m’ indicates a 2′-OMe modification of the sugar moiety. ‘moe’ indicates a 2′-MOE modification of the sugar moiety. ‘In’ indicates a locked nucleic acid (LNA) modification.
[0114] Since all nucleosides are modified at the 2′ position or are LNA, there is no distinction between RNA or DNA. The reason for the U or T notation is that the 2′-OMe modified AONs are built with 2′-OMe/U building blocks and the 2′-MOE modified AONs were built with 2′-MOE/T building blocks (2′-OMe/T building blocks were not applied in the manufacturing).
[0115] Transfections, culturing, RNA extraction, cDNA synthesis and PCR were performed as outlined above. PCR products were analysed by Sanger sequencing in order to detect inhibition of A-I editing. The following primers were used: [0116] 5-HT2RC PCR forward: 5′- GGCAATCCTTTATGATTATGTCTGG -3′ (SEQ ID NO: 27) [0117] 5-HT2RC PCR reverse: 5′-TGCCCAAACAATAGCAATCTTCA-3′ (SEQ ID NO: 28) [0118] 5-HT2RC sequencing: 5′-TCATGATGGCCTTAGTCCGC-3′ (SEQ ID NO: 29)
[0119]
[0120] These experiments clearly show that the inventors were able to inhibit naturally occurring RNA editing in cells, with endogenous RNA editing enzymes, on a natural target, by targeting chemically modified AONs to the ESS in two instances, with 5-HT2RC showing that inhibition can be achieved within a coding region of a (pre-)mRNA, and with XIAP showing that inhibition is similarly possible in a non-coding region.