Porcine epidemic diarrhea virus vaccine

10702601 ยท 2020-07-07

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to immunogenic compositions, wherein the immunogenic compositions include a recombinant spike antigen porcine epidemic diarrhea virus (PEDV). The immunogenic compositions commonly include an oil-in-water emulsion as an adjuvant. Methods for producing the immunogenic compositions and the recombinant PEDV spike antigen are also provided.

    Claims

    1. An immunogenic composition comprising a recombinant spike antigen of porcine epidemic diarrhea virus (PEDV) having a heterologous C-terminal domain and a heterologous transmembrane domain, and an oil-in-water emulsion as an adjuvant, wherein the porcine epidemic diarrhea virus (PEDV) is a PEDV of North American origin and a. wherein the spike antigen is encoded by a nucleic acid sequence that is at least 95% identical with SEQ ID NO: 8 over the length of SEQ ID NO: 8.

    2. The immunogenic composition of claim 1, wherein the recombinant antigen comprises one or more immunogenic components selected from the group consisting of: a. an isolated nucleic acid encoding an antigen of porcine epidemic diarrhea virus (PEDV) spike protein, wherein the antigen has at least 95% homology with SEQ ID NO:3, 7, 9 or 14, b. a recombinant vector comprising the isolated nucleic acid of a), c. the recombinant PEDV Spike protein encoded by the nucleic acid of a), and d. any combination thereof.

    3. The immunogenic composition of claim 2, wherein such immunogenic composition comprises a pharmaceutical acceptable carrier and/or an excipient.

    4. The immunogenic composition of claim 1, wherein the oil-in-water emulsion is an EMULSIGEN oil-in-water emulsion-based adjuvant.

    5. The immunogenic composition of claim 2, wherein an immunogenic component is the isolated nucleic acid.

    6. The immunogenic composition of claim 2, wherein an immunogenic component is the recombinant vector.

    7. The immunogenic composition of claim 2, wherein an immunogenic component is the recombinant porcine epidemic diarrhea virus (PEDV) Spike protein.

    8. The immunogenic composition of claim 2, wherein an immunogenic component is a combination.

    9. The immunogenic composition of claim 2, further comprising at least one additional antigen associated with a pathogen other than porcine epidemic diarrhea virus.

    10. A kit for inducing an immunogenic response in a pig against porcine epidemic diarrhea virus (PEDV) comprising: a. a dispenser capable of administering an immunogenic composition to a pig; and b. the immunogenic composition according to claim 2.

    11. A method of producing an immunogenic composition comprising: a. expressing an antigen of porcine epidemic diarrhea virus (PEDV) comprising the recombinant antigen of claim 2 in a host cell, b. harvesting the antigen of porcine epidemic diarrhea virus (PEDV) cells, and c. adding an oil-in-water emulsion-based adjuvant to the porcine epidemic diarrhea virus (PEDV) antigen of step b).

    12. The method of claim 11, wherein the PEDV antigen comprises: a. an isolated nucleic acid encoding an antigen of porcine epidemic diarrhea virus (PEDV) spike protein, wherein the recombinant Spike polypeptide has at least 95% homology with SEQ ID NO:3, 7, 9 or 14, b. a recombinant vector comprising the isolated nucleic acid of a), c. the recombinant PEDV Spike protein encoded by the nucleic acid of a), and d. any combination thereof.

    13. The method of claim 11, wherein the antigen of porcine epidemic diarrhea virus (PEDV) is expressed by a recombinant baculovirus vector.

    14. The method of claim 13, wherein the antigen of porcine epidemic diarrhea virus (PEDV) is expressed in insect cells.

    15. The method of claim 11, wherein the oil-in-water emulsion-based adjuvant is an EMULSIGEN oil-in-water emulsion-based adjuvant.

    16. A method for protecting a pig against diseases associated with porcine epidemic diarrhea virus (PEDV), comprising administering to such pig the vaccine of claim 1.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    (1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

    (2) FIG. 1 DNA Alignment of PEDV 1251-125-10 (125-10) genome (SEQ ID NO:1) and closest Chinese PEDV strain AH2012 (GenBank Accession No: KC210145) (SEQ ID NO:10).

    (3) FIG. 2 DNA Alignment of PEDV 1251-125-10 (125-10) genome (SEQ ID NO:1) and closest North American PEDV strain Colorado 2013 (GenBank Accession No: KF272920) (SEQ ID NO:11).

    (4) FIG. 3 Amino Acid Sequence Alignment of PEDV 1251-125-10 (125-10) spike protein (SEQ ID NO:14) aligned and closest GenBank sequence corresponding to North American Colorado strain (GenBank Accession No: AGO58924) (SEQ ID NO:12).

    (5) FIG. 4 Graphical representation of Anti-PEDV-IgG ELISA data (Group least square meanstandard error anti-PEDV-IgG S:P ratios for D-1, 14, 28 and 49).

    (6) FIG. 5 Graphical representation of Anti-PEDV-IgA ELISA data (Group least square meanstandard error anti-PEDV-IgA S:P ratios for D-1, 14, 28 and 49).

    DETAILED DESCRIPTION

    (7) The invention provides immunogenic compositions including inactivated/killed, forms of PEDV and/or recombinantly expressed PEDV-Spike antigen. The vaccines are designed for protecting swine against diseases associated with PEDV. The vaccines typically include a chemically inactivated form of PEDV and those which include chemically inactivated/killed PEDV virus are particularly desirable. In another embodiment the vaccines include a recombinant expressed Spike antigen generated, for example, in insect cells via a recombinant baculovirus expressing a modified PEDV Spike protein.

    (8) One embodiment of the invention can be a vaccine comprising one or more antigens of PEDV genotype 2a. In a preferred embodiment PEDV is of North American origin. More preferably, the PEDV of North American genotype is any PEDV encoded by SEQ ID NO:1, or comprising the sequence of SEQ ID NO:1, and/or comprises the RNA equivalent of SEQ ID NO:1; which sequence is at least 99% identical with the SEQ ID NO:1, and/or is at least 99% identical with the RNA equivalent of SEQ ID. NO:1; which spike protein is encoded by nucleic acid sequences of SEQ ID NO:2, 6, 8, or 13; which spike protein is encoded by a nucleic acid sequence that is at least 90% identical with the SEQ ID NO:2, 6, 8, or 13; that is encoded by SEQ ID NO:15; or which sequence is at least 99% identical SEQ ID NO:15.

    (9) In other embodiments of the invention, the vaccine is a recombinant vaccine or a killed vaccine. In exemplary embodiments of the invention, PEDV is chemically inactivated, for example, by treatment with a chemical inactivating agent which includes a compound selected from the group consisting of ethylenimine, binary ethylenimine, acetylethylenimine and mixtures thereof. In a preferred embodiment, PEDV is chemically inactivated by treatment with binary ethylenimine.

    (10) In yet other embodiments of the invention, the vaccine further comprises an adjuvant. In a preferred embodiment, the adjuvant is an EMULSIGEN based oil-in-water emulsion.

    (11) In one embodiment of the invention, the vaccine is recombinant vaccine. In a preferred embodiment, such a recombinant vaccine comprises one or more immunogenic components selected from the group consisting of an isolated nucleic acid encoding an antigen of PEDV spike protein, wherein the recombinant Spike polypeptide has at least 90% homology with SEQ ID NO:3, 7, 9 or 14; a vector comprising the isolated nucleic acid of a); the recombinant PEDV Spike protein encoded by the nucleic acid of a); and/or any combination thereof. Optionally, such a recombinant vaccine comprises a pharmaceutical acceptable carrier and/or excipient. In one embodiment the excipient is one or more adjuvants. Preferably, the adjuvant is an EMULSIGEN oil-in-water emulsion-based adjuvant.

    (12) In yet another aspect of the invention, the recombinant vaccine further comprises one or more additional antigens, for example, the additional antigen can be structural protein M, E, or N of a PEDV.

    (13) In another embodiment, the recombinant vaccine comprises an immunogenic component that can be an isolated nucleic acid, a vector, a recombinant PEDV Spike protein, and/or a combination of at least two of the later.

    (14) Embodiments of the invention also include methods of preventing clinical signs and/or for protecting a pig against diseases associated with PEDV, comprising administering to such pig any of the killed/inactivated and/or recombinant vaccines described herein. For example the administered vaccine comprises one or more antigens of PEDV of genotype 2a. In a preferred embodiment PEDV is of North American origin. More preferably, PEDV) of North American genotype is any PEDV encoded by or comprising the sequence of SEQ ID NO:1; which sequence is at least 99% identical with the SEQ ID NO:1; which spike protein is encoded by nucleic acid sequences of SEQ ID NO:2, 6, 8, or 13; and/or which spike protein is encoded by a nucleic acid sequence at least 90% identical with the SEQ ID NO:2, 6, 8, or 13.

    (15) In another embodiment the method includes administration of a vaccine comprising one or more immunogenic components selected from the group consisting of a PEDV that is encoded by SEQ ID NO:1, or comprising the sequence of SEQ ID NO:1, and/or comprises the RNA equivalent (SEQ ID NO:16); which sequence is at least 99% identical with the SEQ ID NO:1, and/or is at least 99% identical with the RNA equivalent (SEQ ID NO:15); which spike protein is encoded by nucleic acid sequences of SEQ ID NO:2, 6, 8, or 13; which spike protein is encoded by a nucleic acid sequence that is at least 90% identical with the SEQ ID NO:2, 6, 8, or 13; that is encoded by SEQ ID NO:15; or which sequence is at least 99% identical SEQ ID NO:15.

    (16) In another embodiment the method includes administration of a vaccine comprising one or more immunogenic components selected from the group consisting of an isolated nucleic acid encoding an antigen of PEDV spike protein, wherein the recombinant Spike polypeptide has at least 90% homology with SEQ ID NO:3, 7, 9 or 14; a vector comprising the isolated nucleic acid of a); the recombinant PEDV Spike protein encoded by the nucleic acid of a); and any combination thereof.

    (17) Yet another embodiment of the invention includes a kit for vaccinating a pig against diseases associated with PEDV comprising: a dispenser capable of administering a vaccine to a pig; and a PEDV vaccine as described herein.

    (18) An embodiment of the invention includes a method of producing a porcine epidemic diarrhea vaccine according to claim 5 comprising: (a) inoculating simian cells with PEDV; (b) incubating the inoculated simian cells; (c) harvesting PEDV from the incubated cells; and (d) treating the harvested cells with a chemical inactivating agent, preferably with a compound selected from the group consisting of ethylenimine, binary ethylenimine, acetylethylenimine or a mixture thereof to form inactivated PEDV vaccine. In a preferred embodiment, the method comprises a (PEDV comprising a sequence that is encoded by SEQ ID NO:1, or comprising the sequence of SEQ ID NO:1, and/or comprises the RNA equivalent of SEQ ID NO:1; which sequence is at least 99% identical with the SEQ ID NO:1, and/or is at least 99% identical with the RNA equivalent of SEQ ID. NO:1; which spike protein is encoded by nucleic acid sequences of SEQ ID NO:2, 6, 8, or 13; which spike protein is encoded by a nucleic acid sequence that is at least 90% identical with the SEQ ID NO:2, 6, 8, or 13; that is encoded by SEQ ID NO:15; or which sequence is at least 99% identical SEQ ID NO:15.

    (19) In one embodiment, the method includes PEDV of genogroup 2a comprising SEQ ID NO:1 and or SEQ ID NO:15. In alternative embodiments of the method, the inoculated simian cells are Vero cells. In a preferred embodiment of the method the chemical inactivating agent includes binary ethylenimine. The method can further comprise adding an adjuvant to the PEDV vaccine, preferably, the adjuvant is an EMULSIGEN oil-in-water emulsion-based adjuvant.

    (20) Another embodiment of the invention includes a method of producing a recombinant vaccine comprising: expressing one or more antigens of PEDV in a host cell; and harvesting one or more antigens from PEDV-expressing cells. In one such embodiment the method can include one or more antigens comprising an isolated nucleic acid encoding an antigen of PEDV spike protein, wherein the recombinant Spike polypeptide has at least 90% homology with SEQ ID NO:3, 7, 9 or 14; a vector comprising the isolated nucleic acid of a); the recombinant PEDV Spike protein encoded by the nucleic acid of a); and any combination thereof. In one exemplary embodiment, one or more antigens of PEDV are expressed by a recombinant baculovirus vector. The method can include one or more antigens of PEDV expressed in insect cells. One embodiment further comprises the addition of an adjuvant to the PEDV vaccine, preferably wherein the adjuvant is an EMULSIGEN oil-in-water emulsion-based adjuvant.

    (21) In more general terms, a variety of chemical inactivating agents known to those skilled in the art may be employed to inactivate the virus. Ethylenimine and related derivatives, such as binary ethylenimine (BEI) and acetylethylenimine, are examples of suitable chemical inactivating agents for use in inactivating the PED virus. Other chemical inactivating agents, e.g., beta-propiolactone, aldehydes (such as formaldehyde) and/or detergents (e.g., Tween detergent, Triton X, or alkyl trimethylammonium salts) can also be used to inactivate the virus. The inactivation can be performed using standard methods known to those of skill in the art. Samples can be taken at periodic time intervals and assayed for residual live virus. Monitoring of cytopathic effect on an appropriate cell line and/or fluorescent staining with an appropriate specific monoclonal or polyclonal antibody can be used to detect the presence of residual live virus.

    (22) Inactivation with BEI can be accomplished by combining a stock BEI solution (e.g., a solution formed by adding 0.1-0.2 M 2-bromo-ethylamine hydrobromide to 0.1-0.2 N aqueous NaOH) with viral fluids to a final concentration of about 1-5 mM BEI. Inactivation is commonly performed by holding the BEI-virus mixture at 35-40 C. (e.g., 37 C.) with constant mixing for 24-72 hours. Virus inactivation can be halted by the addition of sodium thiosulfate solution to a final concentration in excess of the BEI concentration (e.g., addition of sodium thiosulfate at 17% of the volume of BEI to neutralize excess BEI) followed by mixing.

    (23) The present immunogenic compositions usually include an adjuvant and, if desired, one or more emulsifiers such as Tween detergent incorporated with the inactivated/killed PEDV. Suitable adjuvants include, for example, vitamin E acetate solubilisate, aluminum hydroxide, aluminum phosphate or aluminum oxide, (mineral) oil emulsions, non-ionic detergents, squalene and saponins. Other adjuvants which may be used include an oil based adjuvants such as Freund's complete adjuvant (FCA), and Freund's incomplete adjuvant (FIA). It has been found that cross-linked olefinically unsaturated carboxylic acid polymers, such as CARBOPOL 971 polymer, are particularly suitable adjuvants for use in the present inactivated PEDV immunogenic compositions.

    (24) Examples for suitable oil-in water emulsions are EMULSIGEN based adjuvants, such as EMULSIGEN (an oil-in-water emulsion), EMULSIGEN-D (an oil-in-water) with dimethyldioctadecylammonium bromide (DDA)), EMULSIGEN-P (an oil-in-water) with a proprietary immunostimulant), EMULSIGEN-75 (a double adjuvant comprised of an oil-in-water) with a cross-linked polymer), and EMULSIGEN-BCL (an oil-in-water emulsion that is free of animal origin components). (MVP Technologies, Inc. Omaha, Nebr., USA). Pharmaceutical/vaccine compositions that comprise inactivated PEDV or recombinant PEDV proteins, have been effectively adjuvanted with oil-in water emulsions, preferably with such EMULSIGEN-based adjuvants, more preferably with EMULSIGEN (an oil-in-water emulsion that is free of animal origin components) and EMULSIGEN-BCL (an oil-in-water emulsion that is free of animal origin components).

    (25) It is generally advantageous to formulate the present compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to the treated; each unit containing a predetermined quantity of the active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of inactivated/killed PEDV, and/or recombinantly expressed PEDV antigen are dictated by and depend on among other factors (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved; (b) the limitations inherent in the art of compounding such active material for the treatment of disease; and (c) the manner of intended administration of the dosage unit form.

    (26) The principal active ingredient is typically compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form as disclosed herein. A unit dosage form can, for example, contain the PEDV antigen in amounts ranging from 1 to about 5 relative potency units (RPUs). This amount of the antigen is generally present in from about 1 to about 25/ml of carrier. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the supplementary active ingredients.

    (27) The present vaccines typically include inactivated PEDV formulated with a pharmaceutically acceptable carrier. The pharmaceutical forms suitable for injectable use commonly include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The formulation should desirably be sterile and fluid to the extent that easy syringability exists. The dosage form should be stable under the conditions of manufacture and storage and typically is preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils. One possible carrier is a physiological salt solution. The proper fluidity of the solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabenes, chlorobutanol, phenol, sorbic acid, thimerosal (sodium ethylmercuri-thiosalicylate), deomycin, gentamicin and the like. In many cases it may be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions, if desired, can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

    (28) Sterile injectable solutions may be prepared by incorporating the inactivated virus in the desired amount in an appropriate solvent with various other ingredients as enumerated above, as required, followed by filtered sterilization. Generally, dispersions can be prepared by incorporating the various active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

    (29) It may also be advantageous to add a stabilizer to the present compositions to improve the stability of inactivated virus. Suitable stabilizers include, for example, glycerol/EDTA, carbohydrates (such as sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose), proteins (such as albumin or casein) and protein degradation products (e.g., partially hydrolyzed gelatin). If desired, the formulation may be buffered by methods known in the art, using reagents such as alkali metal phosphates, e.g., sodium hydrogen phosphate, sodium dihydrogen phosphate, potassium hydrogen phosphate and/or potassium dihydrogen phosphate. Other solvents, such as ethanol or propylene glycol, can be used to increase solubility of ingredients in the vaccine formulation and/or the stability of the solution. Further additives which can be used in the present formulation include conventional antioxidants and conventional chelating agents, such as ethylenediamine tetraacetic acid (EDTA).

    (30) The compositions and methods of the present invention may be illustrated by the following examples, which are presented to illustrate the present invention and to assist in teaching one of ordinary skill how to make and use the same. These examples are not intended in any way to narrow or otherwise limit the scope of the present invention.

    (31) The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA technology, protein chemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Vols. I, II and III, Second Edition (1989); DNA Cloning, Vols. I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Animal Cell Culture (R. K. Freshney ed. 1986); Immobilized Cells and Enzymes (IRL press, 1986); Perbal, B., A Practical Guide to Molecular Cloning (1984); the series, Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Protein purification methodsa practical approach (E. L. V. Harris and S. Angal, eds., IRL Press at Oxford University Press); and Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell eds., 1986, Blackwell Scientific Publications).

    (32) It is to be understood that this invention is not limited to particular DNA, RNA, polypeptide sequences, or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. It must be noted that, as used in this specification and the appended claims, the singular forms a, an and the include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to an antigen includes a mixture of two or more antigens; reference to an excipient includes mixtures of two or more excipients, and the like.

    Definitions

    (33) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs at the time of filing. The meaning and scope of terms should be clear; however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Herein, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including, as well as other forms such as includes and included is not limiting. All patents and publications referred to herein are incorporated by reference herein.

    (34) Protection against disease, protective immunity, functional immunity and similar phrases, means a response against a disease or condition generated by administration of one or more therapeutic compositions of the invention, or a combination thereof, that results in fewer deleterious effects than would be expected in a non-immunized subject that has been exposed to disease or infection. That is, the severity of the deleterious effects of the infection are lessened in a vaccinated subject. Infection may be reduced, slowed, or possibly fully prevented, in a vaccinated subject. Herein, where complete prevention of infection is meant, it is specifically stated. If complete prevention is not stated then the term includes partial prevention.

    (35) Herein, reduction of the incidence and/or severity of clinical signs or reduction of clinical symptoms means, but is not limited to, reducing the number of infected subjects in a group, reducing or eliminating the number of subjects exhibiting clinical signs of infection, or reducing the severity of any clinical signs that are present in one or more subjects, in comparison to wild-type infection. For example, it should refer to any reduction of pathogen load, pathogen shedding, reduction in pathogen transmission, or reduction of any clinical sign symptomatic of PEDV. Preferably these clinical signs are reduced in one or more subjects receiving the therapeutic composition of the present invention by at least 10% in comparison to subjects not receiving the composition and that become infected. More preferably clinical signs are reduced in subjects receiving a composition of the present invention by at least 20%, preferably by at least 30%, more preferably by at least 40%, and even more preferably by at least 50%.

    (36) The term increased protection herein means, but is not limited to, a statistically significant reduction of one or more clinical symptoms which are associated with infection by an infectious agent, preferably PEDV, respectively, in a vaccinated group of subjects vs. a non-vaccinated control group of subjects. The term statistically significant reduction of clinical symptoms means, but is not limited to, the frequency in the incidence of at least one clinical symptom in the vaccinated group of subjects is at least 10%, preferably 20%, more preferably 30%, even more preferably 50%, and even more preferably 70% lower than in the non-vaccinated control group after the challenge with the infectious agent.

    (37) Long-lasting protection shall refer to improved efficacy that persists for at least 3 weeks, but more preferably at least 3 months, still more preferably at least 6 months. In the case of livestock, it is most preferred that the long lasting protection shall persist until the average age at which animals are marketed for meat.

    (38) An immunogenic or immunological composition refers to a composition of matter that comprises at least one porcine epidemic diarrhea virus, or immunogenic portion thereof, that elicits an immunological response in the host of a cellular or antibody-mediated immune response to the composition. In a preferred embodiment of the present invention, an immunogenic composition induces an immune response and, more preferably, confers protective immunity against one or more of the clinical signs of a PEDV infection.

    (39) The immunogenic composition as used herein also refers to a composition that comprises any of the PEDV Spike proteins described herein. According to a further embodiment, such immunogenic composition further comprises at least a portion of a viral vector expressing said PEDV Spike protein, preferably of a recombinant baculovirus. Moreover, the immunogenic composition can comprise i) any of the PEDV proteins described above, preferably in concentrations described above, ii) at least a portion of the viral vector expressing said PEDV Spike protein, preferably of a recombinant baculovirus, and iii) a portion of the cell culture supernatant.

    (40) Thus according to one aspect, the present invention relates to a method for reducing the percentage of PEDV infections in a herd of pigs comprising the step administering to said pig(s) an effective amount of PEDV Spike antigen or an immunogenic composition comprising PEDV antigen, wherein the PEDV antigen is recombinant PEDV Spike antigen, preferably a baculovirus expressed PEDV Spike protein. Preferably those recombinant or baculovirus expressed PEDV Spike having the sequence as described herein.

    (41) An immune response or immunological response means, but is not limited to, the development of a cellular and/or antibody-mediated immune response to the composition or vaccine of interest. Usually, an immune or immunological response includes, but is not limited to, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or a protective immunological (memory) response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction in number of symptoms, severity of symptoms, or the lack of one or more of the symptoms associated with the infection of the pathogen, a delay in the of onset of viremia, reduced viral persistence, a reduction in the overall viral load and/or a reduction of viral excretion.

    (42) As used herein, a pharmaceutical- or veterinary-acceptable carrier includes any and all solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. In some preferred embodiments, and especially those that include lyophilized immunogenic compositions, stabilizing agents for use in the present invention include stabilizers for lyophilization or freeze-drying.

    (43) In some embodiments, the immunogenic composition of the present invention contains an adjuvant. Adjuvants as used herein, can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge Mass.), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, Ala.), water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion.

    (44) The emulsion can be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri-(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L121. See Hunter et al. The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D. E. S.), John Wiley and Sons, NY, pp 51-94 (1995) and Todd et al. Vaccine 15:564-570 (1997). Exemplary adjuvants are the SPT emulsion described on page 147 of Vaccine Design, The Subunit and Adjuvant Approach edited by M. Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of this same book.

    (45) Examples for suitable oil-in water emulsions are EMULSIGEN based adjuvants, such as EMULSIGEN (an oil-in-water emulsion o/w), EMULSIGEN-D (an oil-in-water (o/w) with dimethyldioctadecylammonium bromide (DDA)), EMULSIGEN-P (an oil-in-water (o/w) with a proprietary immunostimulant), EMULSIGEN-75 (a double adjuvant comprised of an oil-in-water (o/w) with a cross-linked polymer), and EMULSIGEN-BCL (an oil-in-water emulsion that is free of animal origin components). (MVP Laboratories, Inc. Omaha, Nebr., USA). Pharmaceutical/vaccine compositions that comprise inactivated PEDV or recombinant PEDV proteins, have been effectively adjuvanted with oil-in water emulsions, preferably with such EMULSIGEN-based adjuvants, more preferably with EMULSIGEN (an oil-in-water emulsion o/w) and/or EMULSIGEN-BCL (an oil-in-water emulsion that is free of animal origin components).

    (46) Examples of suitable adsorbent aluminum hydroxide gels for use in veterinary vaccines include REHYDRAGEL, REHYDRAGEL-CG; REHYDRAGEL-LV; REHYDRAGEL-HPA; REHYDRAPHOS (General Chemical, Berkeley Heights, N.J., USA)?

    (47) A further instance of an adjuvant is a compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative. Advantageous adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Pat. No. 2,909,462 which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name CARBOPOL (also known as polyacrylic acid); (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned CARBOPOL 974P (also known as polyacrylic acid), CARBOPOL 934P (also known as polyacrylic acid) and CARBOPOL 971P (also known as polyacrylic acid). Most preferred is the use of CARBOPOL 971P (also known as polyacrylic acid). Among the copolymers of maleic anhydride and alkenyl derivative, the copolymers EMA (Monsanto) which are copolymers of maleic anhydride and ethylene. The dissolution of these polymers in water leads to an acid solution that will be neutralized, preferably to physiological pH, in order to give the adjuvant solution into which the immunogenic, immunological or vaccine composition itself will be incorporated.

    (48) Further suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), Block co-polymer (CytRx, Atlanta Ga.), SAF-M (Chiron, Emeryville Calif.), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, or muramyl dipeptide among many others.

    (49) It is expected that an adjuvant can be added in an amount of about 100 g to about 10 mg per dose, preferably in an amount of about 100 g to about 10 mg per dose, more preferably in an amount of about 500 g to about 5 mg per dose, even more preferably in an amount of about 750 g to about 2.5 mg per dose, and most preferably in an amount of about 1 mg per dose. Alternatively, the adjuvant may be at a concentration of about 0.01 to 50%, preferably at a concentration of about 2% to 30%, more preferably at a concentration of about 5% to 25%, still more preferably at a concentration of about 7% to 22%, and most preferably at a concentration of 10% to 20% by volume of the final product.

    (50) Diluents can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin and alkali salts of ethylendiamintetracetic acid, among others.

    (51) Isolated means altered by the hand of man from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or polypeptide naturally present in a living organism is not isolated, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is isolated, as the term is employed herein.

    (52) Safety refers to the absence of adverse consequences in a vaccinated animal following vaccination, including but not limited to: potential reversion of a viral-based vaccine to virulence, clinically significant side effects such as persistent, systemic illness or unacceptable inflammation at the site of vaccine administration.

    (53) The terms vaccination or vaccinating or variants thereof, as used herein means, but is not limited to, a process which includes the administration of an immunogenic composition of the invention that, when administered to an animal, elicits, or is able to elicitdirectly or indirectly, an immune response in the animal against PEDV.

    (54) Mortality, in the context of the present invention, refers to death caused by PEDV infection, and includes the situation where the infection is so severe that an animal is euthanized to prevent suffering and provide a humane ending to its life.

    (55) Herein, effective dose means, but is not limited to, an amount of antigen that elicits, or is able to elicit, an immune response that yields a reduction of clinical symptoms in an animal to which the antigen is administered.

    (56) As used herein, the term effective amount means, in the context of a composition, an amount of an immunogenic composition capable of inducing an immune response that reduces the incidence of or lessens the severity of infection or incident of disease in an animal. Particularly, an effective amount refers to colony forming units (CFU) per dose. Alternatively, in the context of a therapy, the term effective amount refers to the amount of a therapy which is sufficient to reduce or ameliorate the severity or duration of a disease or disorder, or one or more symptoms thereof, prevent the advancement of a disease or disorder, cause the regression of a disease or disorder, prevent the recurrence, development, onset, or progression of one or more symptoms associated with a disease or disorder, or enhance or improve the prophylaxis or treatment of another therapy or therapeutic agent.

    (57) Sequence Identity as it is known in the art refers to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, namely a reference sequence and a given sequence to be compared with the reference sequence. Sequence identity is determined by comparing the given sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis, e.g., the sequences are identical at a particular position if at that position, the nucleotides or amino acid residues are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to give % sequence identity. Sequence identity can be readily calculated by known methods, including but not limited to, those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), the teachings of which are incorporated herein by reference. Preferred methods to determine the sequence identity are designed to give the largest match between the sequences tested. Methods to determine sequence identity are codified in publicly available computer programs which determine sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al. Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S. F. et al. J. Molec. Biol., 215:403-410 (1990). The BLAST programs are publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al. NCVI NLM NIH Bethesda, Md. 20894, Altschul, S. F. et al. J. Molec. Biol., 215:403-410 (1990), the teachings of which are incorporated herein by reference). These programs optimally align sequences using default gap weights in order to produce the highest level of sequence identity between the given and reference sequences. As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity to a reference nucleotide sequence, it is intended that the nucleotide sequence of the given polynucleotide is identical to the reference sequence except that the given polynucleotide sequence may include up to 15, preferably up to 10, even more preferably up to 5 point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 85%, preferably 90%, even more preferably 95% identity relative to the reference nucleotide sequence, up to 15%, preferably 10%, even more preferably 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 15%, preferably 10%, even more preferably 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5 or 3 terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Analogously, by a polypeptide having a given amino acid sequence having at least, for example, 85%, preferably 90%, even more preferably 95% sequence identity to a reference amino acid sequence, it is intended that the given amino acid sequence of the polypeptide is identical to the reference sequence except that the given polypeptide sequence may include up to 15, preferably up to 10, even more preferably up to 5 amino acid alterations per each 100 amino acids of the reference amino acid sequence. In other words, to obtain a given polypeptide sequence having at least 85%, preferably 90%, even more preferably 95% sequence identity with a reference amino acid sequence, up to 15%, preferably up to 10%, even more preferably up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 15%, preferably up to 10%, even more preferably up to 5% of the total number of amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or the carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in the one or more contiguous groups within the reference sequence. Preferably, residue positions which are not identical differ by conservative amino acid substitutions. However, conservative substitutions are not included as a match when determining sequence homology.

    (58) A conservative substitution refers to the substitution of an amino acid residue or with another amino acid residue having similar characteristics or properties including size, hydrophobicity, etc., such that the overall functionality does not change significantly.

    (59) Sequence homology, as used herein, refers to a method of determining the relatedness of two sequences discounting conservative substitutions. To determine sequence homology, two or more sequences are optimally aligned, and gaps are introduced if necessary. In other words, to obtain a polypeptide having 95% sequence homology with a reference sequence, 85%, preferably 90%, even more preferably 95% of the amino acid residues in the reference sequence must match or comprise a conservative substitution with another amino acid, or a number of amino acids up to 15%, preferably up to 10%, even more preferably up to 5% of the total amino acid residues, not including conservative substitutions, in the reference sequence may be inserted into the reference sequence. Preferably the homolog sequence comprises at least a stretch of 50, even more preferred of 100, even more preferred of 250, even more preferred of 500 amino acids.

    (60) The terms sequence identity or percent identity are used interchangeably herein. For the purpose of this invention, it is defined here that in order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid for optimal alignment with a second amino or nucleic acid sequence). The amino acid or nucleotide residues at corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid or nucleotide residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=number of identical positions/total number of positions (i.e. overlapping positions)100). Preferably, the two sequences are the same length. When sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have sequence similarity or similarity.

    (61) A sequence comparison may be carried out over the entire lengths of the two sequences being compared or over fragment of the two sequences. Typically, the comparison will be carried out over the full length of the two sequences being compared. However, sequence identity may be carried out over a region of, for example, twenty, fifty, one hundred or more contiguous amino acid residues.

    (62) The skilled person will be aware of the fact that several different computer programs are available to determine the homology between two sequences. For instance, a comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) algorithm which has been incorporated into the GAP program in the Accelrys GCG software package (available at http://www.accelrys.com/products/gcg/), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. The skilled person will appreciate that all these different parameters will yield slightly different results but that the overall percentage identity of two sequences is not significantly altered when using different algorithms.

    (63) The protein sequences or nucleic acid sequences of the present invention can further be used as a query sequence to perform a search against public databases to, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTN and BLASTP programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST protein searches can be performed with the BLASTP program, score=50, wordlength=3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTP and BLASTN) can be used. See the homepage of the National Center for Biotechnology Information at http://www.ncbi.nlm.nih.gov/.

    (64) The claimed PEDV of the invention shall also encompass variants of the PEDV isolate 1251-125-10 (125-10) and variants of sub-fragments thereof. Such variants have essentially the same immunological properties as characteristic of the Oklahoma strain (SEQ ID NO 1 and 15). The term having essentially the same immunological properties encompass (but is not restricted to) that said variants are essentially effective in treating or preventing the clinical signs caused by PEDV as described below or in improving the efficacy parameters as described below.

    (65) The term variant with respect to sequence SEQ ID NO:1, 2, 3, 6, 7, 8, 9, 14 and 15 (e.g., a polypeptide or nucleic acid sequence) is intended to mean substantially similar sequences. For nucleotide sequences comprising an open reading frame, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis and for open reading frames, encode the native protein, as well as those that encode a polypeptide having amino acid substitutions relative to the native protein for the purposes of codon optimization. Generally, nucleotide sequence variants of the invention will have at least at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most preferably at least 95%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%. 99.99% sequence identity compared to a reference sequence using one of the alignment programs described using standard parameters.

    (66) The term genogroup as it is known in the art refers to related viruses within a genus; which may be further subdivided into genetic clusters. Identified genogroups of PEDV include group G1, comprising subgroups G1a, G1b, R (attenuated/adapted); and G2, comprising subgroups G2a, and G2b. Members of the G2a genogroup include the Chinese strain AH2012 (GenBank accession no: KC210145) and the North American strains, sharing several unique nucleotides changes. Strains MN and IA2 had 99.6% and strain IA1 had 99.5% nucleotide identity with AH2012, respectively. Researchers have speculated that an AH2012-like virus was possibly transmitted to the eastern China regions and then transported to the United States and is the most likely closest ancestor to the North American strains. Members of the genogroup 2a share only approximately 96.9% similarity to the prototype PEDV strain CV777 of genogroup 1a (Bridgen, et al. 1993; Huang et al. 2013; GenBank: AF353511.1). As such, the attenuated PEDV vaccines based on the historical CV777-derived G1a strains or DR13-derived G1b strains may be antigenically less related to the newly emergent Chinese and North American G2a PEDV strains.

    (67) A closely related North American isolate US/Colorado/2013 (GenBank Accession No: KF272920.1) has also been reported by Marthaler et al. 2013. Like the North American isolates above the complete PEDV genome of CO/13 has a nucleotide identity of 96.5 to 99.5% with other complete PEDV genomes available in GenBank, with the highest nucleotide identity (99.5%) with Chinese strain AH2012 (GenBank Accession No. KC210145). Chinese strain AH2012 is a member of the 2a genogroup. Comparison of the complete genome of North American isolate CO/13 to that of PEDV reference strain CV777, shows that CO/13 contains a 1-nucleotide insertion (at position 48) and deletions of 5 nucleotides in the 5 UTR (at positions 73 and 83 to 86), while the spike gene contains insertions of 16 nucleotides (positions 20804, 20810 to 20820, 20843, and 21053 to 21055) and deletions of 7 nucleotides (positions 20853 and 21118 to 21124).

    (68) The term PEDV of North American origin means a PEDV isolate comprising SEQ ID NO:1 and/or SEQ ID NO:15, and/or any PEDV isolates having at least 99% sequence identity to SEQ ID NO:1, and/or is at least 99% identical with the RNA equivalent of SEQ ID. NO:1, and/or a PEDV isolate in which a Spike protein is encoded by SEQ ID NO:13, and/or any PEDV isolate in which a Spike protein has at least 98% sequence identity to SEQ ID:13, and/or any PEDV isolate in which the expressed Spike protein has at least 90% homology with SEQ ID NO:14.

    (69) The term clade as it is known in the art refers to a group consisting of an ancestor and all its descendants, a single branch in a phylogenetic tree. The ancestor may be, as an example an individual, a population or a species. A genogroup can include multiple clades, for example AH2012 is in a different clade than the North American isolates.

    (70) According to a further embodiment, the present invention also relates to a vector that comprises any of such nucleic acid molecules as described herein. In other words, the present invention relates to a vector, that includes the coding sequence of any such Spike, M, E, N PEDV protein, or part thereof. Preferably, said vector is an expression vector, which allows the expression of any such Spike, M, E, and/or N PEDV protein or part of the protein. Vectors according to the invention are those which are suitable for the transfection or infection of bacterial, yeast or animal cells, in vitro or in vivo.

    (71) Vectors and methods for making and/or using vectors (or recombinants) for expression can be by or analogous to the methods disclosed in: U.S. Pat. Nos. 4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848, 5,942,235, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 382,425, PCT publications WO 94/16716, WO 96/39491, WO 95/30018; Paoletti, Applications of pox virus vectors to vaccination: An update, PNAS USA 93: 11349-11353, October 1996; Moss, Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety, PNAS USA 93: 11341-11348, October 1996; Smith et al., U.S. Pat. No. 4,745,051 (recombinant baculovirus); Richardson, C. D. (Editor), Methods in Molecular Biology 39, Baculovirus Expression Protocols (1995 Humana Press Inc.); Smith et al., Production of Human Beta Interferon in Insect Cells Infected with a Baculovirus Expression Vector, Molecular and Cellular Biology, December, 1983, Vol. 3, No. 12, p. 2156-2165; Pennock et al., Strong and Regulated Expression of Escherichia coli B-Galactosidase in Infect Cells with a Baculovirus vector, Molecular and Cellular Biology March 1984, Vol. 4, No. 3, p. 406; EPAO 370 573; U.S. application No. 920,197, filed Oct. 16, 1986; EP Patent publication No. 265785; U.S. Pat. No. 4,769,331 (recombinant herpesvirus); Roizman, The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors, PNAS USA 93:11307-11312, October 1996; Andreansky et al., The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors, PNAS USA 93: 11313-11318, October 1996; Robertson et al., Epstein-Barr virus vectors for gene delivery to B lymphocytes, PNAS USA 93: 11334-11340, October 1996; Frolov et al., Alphavirus-based expression vectors: Strategies and applications, PNAS USA 93: 11371-11377, October 1996; Kitson et al., J. Virol. 65, 3068-3075, 1991; U.S. Pat. Nos. 5,591,439, 5,552,143; WO 98/00166; allowed U.S. application Ser. Nos. 08/675,556, and 08/675,566 both filed Jul. 3, 1996 (recombinant adenovirus); Grunhaus et al., 1992, Adenovirus as cloning vectors, Seminars in Virology (Vol. 3) p. 237-52, 1993; Ballay et al. EMBO Journal, vol. 4, p. 3861-65, Graham, Tibtech 8, 85-87, April, 1990; Prevec et al., J. Gen Virol. 70, 42434; PCT WO 91/11525; Felgner et al. (1994), J. Biol. Chem. 269, 2550-2561, Science, 259: 1745-49, 1993; and McClements et al., Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease, PNAS USA 93: 11414-11420, October 1996; and U.S. Pat. Nos. 5,591,639, 5,589,466, and 5,580,859, as well as WO 90/11092, WO93/19183, WO94/21797, WO95/11307, WO95/20660; Tang et al., Nature, and Furth et al., Analytical Biochemistry, relating to DNA expression vectors, inter alia. See also WO 98/33510; Ju et al., Diabetologia, 41: 736-739, 1998 (lentiviral expression system); Sanford et al., U.S. Pat. No. 4,945,050; Fischbach et al. (Intracel); WO 90/01543; Robinson et al., Seminars in Immunology vol. 9, pp. 271-283 (1997), (DNA vector systems); Szoka et al., U.S. Pat. No. 4,394,448 (method of inserting DNA into living cells); McCormick et al., U.S. Pat. No. 5,677,178 (use of cytopathic viruses); and U.S. Pat. No. 5,928,913 (vectors for gene delivery); as well as other documents cited herein.

    (72) Preferred viral vectors include baculovirus such as BaculoGold (BD Biosciences Pharmingen, San Diego, Calif.), in particular provided that the production cells are insect cells. Although the baculovirus expression system is preferred, it is understood by those of skill in the art that other expression systems will work for purposes of the present invention, namely the expression of HG into the supernatant of a cell culture. Such other expression systems may require the use of a signal sequence in order to cause H5 expression into the media.

    (73) Effective Dose:

    (74) The compounds described herein can be administered to a subject at therapeutically effective doses to prevent PEDV-associated diseases. The dosage will depend upon the host receiving the vaccine as well as factors such as the size, weight, and age of the host.

    (75) The precise amount of immunogenic composition of the invention to be employed in a formulation will depend on the route of administration and the nature of the subject (e.g., age, size, stage/level of disease), and should be decided according to the judgment of the practitioner and each subject's circumstances according to standard clinical techniques. An effective immunizing amount is that amount sufficient to treat or prevent a PEDV infectious disease in a subject.

    (76) Immunogenicity of a composition can be determined by monitoring the immune response of test subjects following immunization with the composition by use of any immunoassay known in the art. Generation of a humoral (antibody) response and/or cell-mediated immunity may be taken as an indication of an immune response. Test subjects may include animals such as pigs, mice, hamsters, dogs, cats, rabbits, cows, horses, sheep, poultry (e.g. chickens, ducks, geese, and turkeys), and humans.

    (77) The immune response of the test subjects can be analyzed by various approaches such as: the reactivity of the resultant immune serum to the immunogenic conjugate, as assayed by known techniques, e.g., enzyme linked immunosorbent assay (ELISA), immunoblots, immunoprecipitations, virus neutralization, etc.; or, by protection of immunized hosts from infection by the pathogen and/or attenuation of symptoms due to infection by the pathogen in immunized hosts as determined by any method known in the art, for assaying the levels of an infectious disease agent, e.g., the viral levels (for example, by culturing of a sample from the subject), or other technique known in the art. The levels of the infectious disease agent may also be determined by measuring the levels of the antigen against which the immunoglobulin was directed. A decrease in the levels of the infectious disease agent or an amelioration of the symptoms of the infectious disease indicates that the composition is effective.

    (78) The therapeutics of the invention can be tested in vitro for the desired therapeutic or prophylactic activity, prior to in vivo use in animals. For example, in vitro assays that can be used to determine whether administration of a specific therapeutic is indicated include in vitro cell culture assays in which appropriate cells from a cell line or cells cultured from a subject having a particular disease or disorder are exposed to or otherwise administered a therapeutic, and the effect of the therapeutic on the cells is observed.

    (79) Alternatively, the therapeutic may be assayed by contacting the therapeutic to cells (either cultured from a subject or from a cultured cell line) that are susceptible to infection by the infectious disease agent but that are not infected with the infectious disease agent, exposing the cells to the infectious disease agent, and then determining whether the infection rate of cells contacted with the therapeutic was lower than the infection rate of cells not contacted with the therapeutic. Infection of cells with an infectious disease agent may be assayed by any method known in the art.

    (80) In addition, the therapeutic can be assessed by measuring the level of the molecule against which the antibody is directed in the animal model or human subject at suitable time intervals before, during, or after therapy. Any change or absence of change in the amount of the molecule can be identified and correlated with the effect of the treatment on the subject. The level of the molecule can be determined by any method known in the art.

    (81) After vaccination of an animal to PEDV using the methods and compositions of the present invention, any binding assay known in the art can be used to assess the binding between the resulting antibody and the particular molecule. These assays may also be performed to select antibodies that exhibit a higher affinity or specificity for the particular antigen.

    (82) Administration to a Subject:

    (83) Preferred routes of administration include but are not limited to intranasal, oral, intradermal, and intramuscular. The skilled artisan will recognize that compositions of the invention may also be administered in one, two or more doses, as well as, by other routes of administration. For example, such other routes include subcutaneously, intracutaneously, intravenously, intravascularly, intraarterially, intraperitnoeally, intrathecally, intratracheally, intracutaneously, intracardially, intralobally, intramedullarly, intrapulmonarily, and intravaginally. Depending on the desired duration and effectiveness of the treatment, the compositions according to the invention may be administered once or several times, also intermittently, for instance on a daily basis for several days, weeks or months and in different dosages.

    (84) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

    EXAMPLES

    Example 1: Isolation and Production of Inactivated PEDV Strain

    (85) To produce the porcine epidemic diarrhea virus vaccine, killed virus, a master seed culture of a PEDV (isolate) was first produced. From this master seed, a culture of PEDV was grown and then inactivated. The inactivated virus culture was then mixed with an adjuvant in order to produce the porcine epidemic diarrhea virus vaccine. The following method was used to produce the porcine epidemic diarrhea virus vaccine.

    (86) Animals or tissues from animals exhibiting extreme diarrhea were acquired in 2013. Homogenates from mucosal scrapings were generated from these animals filtered through a 0.2 micron syringe filter and the filtrate was used to inoculate African Green Monkey kidney cells (VERO). Virus was grown in the presence of PEDV maintenance media containing modified MEM, porcine trypsin, tryptose phosphate broth, yeast extract and HEPES buffer. Virus growth was evaluated and visualized by checking for characteristic syncytia formation and fusion of cell monolayer. CPE positive material was subjected to sequencing using Illumina-based MiSeq technology.

    (87) In order to produce the PEDV master seed virus culture (PEDV MSV), porcine epidemic diarrhea virus strain (isolate) (PEDV isolate) was isolated in BI VERO cells and passed a total nineteen times in BI VERO cells and then virus was grown in 2013 EU VERO cells till passage 30. The 30.sup.th passage of the virus was diluted and put down as the master seed virus designated PEDV KV-1251-125-10-OK.

    (88) From the master seed virus, a culture of PEDV (KV-1251-125-10-OK, to be referred to herein as 125-10) was produced by infecting 2013 EU VERO cells with PEDV KV-1251-125-10-OK MSV in PEDV maintenance media containing modified Minimal Essential Media, porcine trypsin (10 g/ml), tryptose phosphate broth (0.3%), yeast extract (0.02%) and 1M HEPES buffer (2.5%) The 2013 EU VERO cells were typically infected with the PEDV (125-10) MSV at a minimum dose of 10.sup.4 TCID.sub.50/850 cm.sup.2 roller bottle. Such cultures can be grown in sterile disposable roller bottles or on microcarrier beads. The culture was incubated at 36 C.2 C. for 24 to 48 hours until cytopathic effect (CPE) was observed. Typically, characteristic syncytia can be seen within 12 hours of infection, syncytia expand and cell monolayer fuses from 24-48 hours followed by sloughing of cells. During incubation, the culture was monitored for PEDV induced CPE to ensure a pure PEDV strain. If atypical CPE was observed or any macroscopic or microscopic evidence of contamination existed, the culture was discarded. Pure virus culture was aseptically harvested into sterile polypropylene carboys. Virus was freeze thawed to release cell associated virions and was clarified by centrifugation or by filtration through filters of 0.45 microns followed by 0.2 microns. Bulk virus harvest fluids were tested to ensure the absence of mycoplasma prior to inactivation. Harvested fluids which were not immediately inactivated were stored at 70 C. or below.

    (89) The volume of harvested fluids is determined and the temperature of the fluids is brought to 362 C. A 0.4 M solution of 2-bromoethyleneamine (BEA) is mixed with a stock solution of 0.3 N NaOH to generate a binary ethyleneimine (BEI) stock solution which is then added to the harvest fluids to give a final concentration of BEI of 5 mM. The fluids are stirred continuously for a minimum of 24 hours. A 1.0 M sodium thiosulfate solution to give a final minimum concentration of 5 mM is added to neutralize any residual BEI. The inactivated fluids can be stored at 703 C. for long term storage or at 43 C. for short term.

    (90) After treatment with BEI, the culture was tested for its ability to induce CPE typical of PEDV to ensure inactivation of the virus. This task was accomplished by passing the BEI treated viral fluids over Vero cells and checking the Vero cells for any viral infection. The BEI treated culture fluids were typically stored at 70 C. or below until the inactivation assay had been completed.

    (91) The inactivated virus was formulated as an adjuvanted vaccine by thoroughly blending the inactivated PEDV culture with adjuvant EMULSIGEN-BCL at a 20% inclusion rate to form a bulk serial. The bulk serial was maintained at 2-8 C. until being transferred into vials containing either one or ten doses (@2.0 ml per dose).

    Example 2: Genome Sequence Analysis of PEDV Isolate 1251-125-10 125-10

    (92) Sample Preparation and Analysis:

    (93) Prior to extraction virus tissue culture supernatants were pre-treated with a cocktail of DNase and RNase to remove residual host cell genomic nucleic acids. Viral genomic RNA was then extracted from the nuclease-treated samples using the Qiagen viral RNA extraction kit (Cat #52906). Post extraction, samples were again treated with DNase to further enrich for viral genomic RNA. Subsequently, viral genomic RNA was converted to double stranded cDNA (ds cDNA) through randomly primed reverse transcription and Klenow fragment treatment. The ds cDNA products were then used to generate a library for Illumina MiSeq-based sequencing using the NextEraXT library preparation kit (Cat # FC-131-1024). Each sample was barcoded with unique tags on both the 5- and 3-ends to minimize the chances of bioinformatic mis-binning. This library was run on the MiSeq using the 500-cycle kit (Cat # MS-102-2003) and data was analyzed using a combination of NextGene (version 2.3.4) and Sequencher software (version 5.1). High quality sequences were selected as those containing a median Q-score of greater than 25 and trimmed with a cut-off of no more than three uncalled bases at 3-end or 3-consecutive bases with Q-score measuring less than 16. The sequences were then assembled de novo using criteria of 85% or greater match over a 35 bp stretch to generate a putative PEDV full genome for each strain. The putative complete genome sequence for each was then verified by template-based alignment to verify single nucleotide polymorphisms (SNP) or variable small insertions/deletions.

    (94) For sample 1251-125-10, a total of 570,253 sequences were generated with an average length of 136 bp after trimming of low quality data. Of those sequences; 484,247 (84.9%) assembled into a single contig 27,995 bp long which through BLASTn analysis revealed strong identity to the single-stranded RNA alphacoronavirus PEDV. A total of 11 positions exhibited polymorphism at either a single nucleotide or a small insertion/deletion, these positions are listed in Table 1.

    (95) TABLE-US-00001 TABLE 1 Polymorphic Residues in Isolate 1251-125-10 125-10 Residue Position Frequencies Gene 3,315 T (51%) ORF1A/B A (49%) 3,423-3,426 DEL (50%) ORF1A/B TTA (50%) 9,425 C (64%) ORF1A/B T (36%) 10,136 T (52%) ORF1A/B A (48%) 14,416 A (69%) ORF1A/B G (31%) 18,179 C (73%) ORF1A/B T (27%) 19,100 C (73%) ORF1A/B T (27%) 23,101 G (63%) Spike A (37%) 25,057 T (59%) Spike 10bp INS (41%) 25,165-25,169 TTATG ORF3 (74%) DEL (26%) 27,510 C (73%) ORF3 T (27%)

    (96) The putative complete/near-complete PEDV genome of 1251-125-10 (SEQ ID NO:1) was aligned to the closest Chinese AH2012 (GenBank Accession No: KC210145) and North American Colorado 2013 isolate (GenBank Accession No: AGO58924) of PEDV (See FIG. 1 and FIG. 2). The identities to both isolates exceed 99.2% indicating very close relation to both strains, both in genogroup 2a.

    (97) Next, the immunogenic spike protein sequence was examined for protein identity/similarity to the larger GenBank repository of PEDV spike proteins. Again, the closest GenBank isolate submitted was derived from the North American Colorado 2013 strain deposited by the University of Minnesota Veterinary diagnostic laboratory (GenBank Accession No: AGO58924) exhibiting over 99.5% identity (1380/1386 identical amino acids) (FIG. 3). Of the 6 amino acid changes, 1 was due to the polymorphism at position 23,101 which would encode either CGA (Arg) in the majority or CAA (Gln) in minority at position 838. The North American Colorado 2013 strain contains a Gln at this position.

    Example 3: Method of Monitoring Inactivation of Viruses

    (98) Each lot of PEDV virus or pool is tested for inactivation by passage in VERO cells. Seventy five cm.sup.2 of 24 hour cell culture are inoculated with 2.0 mL of inactivated PEDV fluids and maintained at 363 C. for 48 hours. One flask of VERO cells remains uninoculated. For positive virus controls one culture of VERO cells is inoculated with a positive control PEDV. At the end of the incubation period, the cell monolayers are examined for CPE typical of PEDV. The material is frozen and thawed three times and then 2 ml of each material is inoculated onto one day old VERO cells. The culture should be maintained at 372 C. for 48 hours. Following the second passage, a third passage is performed. After incubation and passage, the absence of virus-infected cells in the BEI treated viral fluids as determined by lack of immunofluorescence staining constitutes a satisfactory inactivation test. The control cells inoculated with the positive control virus shall show CPE typical of PEDV and the uninoculated flask shall show no evidence of PEDV CPE.

    Example 4: Construction of a Recombinant Baculoviruses Coding for and Expressing PEDV Spike Antigens

    (99) The BaculoDisplay-Spike antigen was generated in insect cells via a recombinant baculovirus expressing a modified PEDV Spike protein. Briefly, the nucleic acid sequence (SEQ ID NO:2) encoding the PEDV Spike protein (SEQ ID NO:3) was cloned from a diagnostic sample using specific primers (Forward primer: SEQ ID NO:4 and Reverse primer: SEQ ID NO:5). The cloned PEDV Spike coding sequence was modified to remove the PEDV Spike signal peptide, transmembrane domain, and c-terminal domain (SEQ ID NO:6). These domains were replaced with the equivalent domains from the Vesicular stomatitis virus G protein (VSVG) by overlap extension PCR. The VSVG-PEDVS-VSVG coding sequence (SEQ ID NO:8) was transferred into a baculovirus transfer vector (pVL1393) using complementary restriction sites. The pVL1393 vector containing the VSVG-PEDV-VSVG Spike coding sequence expressing the modified Spike protein (SEQ ID NO:9) was used to co-transfect Sf9 insect cells along with FlashBAC ULTRA baculovirus DNA. Recombinant baculovirus were amplified and checked for PEDV Spike protein expression by IFA and Western blot using PEDV-specific serum. The PEDV Spike protein was shown to co-pellet with the baculovirus particles after a 100,000 g centrifugation step, suggesting that it was associated with the baculovirus.

    Example 5: Preparation of Pharmaceutical Compositions (Vaccines) Comprising PEDV Spike Antigens

    (100) For the inactivated PEDV material, PEDV viral harvest was inactivated for a minimum of 24 hours using 5 mM BEI, clarified and 0.45 m filtered.

    (101) After neutralization various adjuvants were added and the following vaccine/pharmaceutical compositions were generated.

    Example 6: Inoculation of Pigs with Inactivated PEDV and Baculovirus Spike Vaccine and Assessment of the Serological Response

    (102) The purpose of the study was to demonstrate immunogenicity of an inactivated PEDV virus for protection of vaccinated pigs. The vaccine used in the study included inactivated PED virus and a BaculoDisplay-Spike (Baculo-S) protein construct. Both the inactivated PEDV vaccine and the BaculoDisplay-Spike (Baculo-S) protein vaccines were adjuvanted with EMULISGEN-BCL. A previous challenge study had shown a strong positive correlation between clinical protection and the IgA and IgG responses detected in the blood 21 days following challenge with PEDV (De Arriba et al. 2002). Therefore, the serological response of each of the prototype vaccines was assessed by IgG and IgA ELISA analysis. In addition, a virus neutralizing assay was done on the sera.

    (103) Experimental Design:

    (104) Experiments were designed to evaluate the serological response to two prototype PEDV vaccines.

    (105) Eighteen pigs (287 days of age at D-1) were randomized into three treatment groups (See Table 2) and housed in a single room for the duration of the study. The animals were intramuscularly vaccinated on D0, 14 and 28 with either a placebo or one of the two PEDV prototype vaccines. Pigs were monitored for clinical signs daily from D0 through D49. Rectal temperatures and injection sites were monitored to evaluate the vaccines' safety from D0-D4, D14-18, and D28-D32. Fecal, oral and nasal swabs and serum were taken from the piglets on D-1, 3, 14, 17, 28, 31 and 49. The serum samples taken on D-1, 14, 28 and 49 were screened by ELISA for anti-PEDV-IgG and by FFN assay for the presence of neutralizing antibodies. Fecal samples and serum collected on D-1, D3, 17 and 31 were evaluated by PCR to confirm that neither prototype was able to replicate in the pig. Fecal samples from D14, 28 and 49 were stored at 70 C. for potential future evaluation. On D49, animals were humanely euthanized and necropsied.

    (106) TABLE-US-00002 TABLE 2 Summary of experimental design Group Volume/ (name) n Vaccine Dose 1 (BEI-VH) 7 BEI inactivated PEDV viral harvest 2 ml/5.6 log adjuvanted with EMULSIGEN-BCL TCID.sub.50 (20% v/v) 2 (Baculo-S) 7 BaculoDisplay-Spike protein adjuvanted 1 ml/ with EMULSIGEN-BCL(20% v/v) 866 g/ml total protein 3 (Control) 4 Placebo 2 ml

    (107) Prototype Vaccines:

    (108) Tables 4a and b describe the prototype vaccines. For the placebo treatment, 2 ml of Production PBS was administered. The BaculoDisplay-Spike antigen was generated in insect cells via a recombinant baculovirus expressing a modified PEDV Spike protein. Briefly, the coding sequence for the PEDV Spike protein was cloned from a diagnostic sample using specific primers. The cloned PEDV Spike coding sequence was modified to remove the PEDV Spike signal peptide, transmembrane domain, and c-terminal domain (SEQ ID NO:7). These domains were replaced with the equivalent domains from the Vesicular stomatitis virus G protein (VSVG) by overlap extension PCR (SEQ ID NO:8). The VSVG-PEDVS-VSVG coding sequence was transferred into a baculovirus transfer vector (pVL1393) using complementary restriction sites. The pVL1393 vector containing the VSVG-PEDV-VSVG Spike coding sequence was used to co-transfect Sf9 insect cells along with FlashBAC ULTRA baculovirus DNA. Recombinant baculovirus were amplified and checked for PEDV Spike expression by IFA and Western blot using PEDV-specific serum. The PEDV Spike protein was shown to co-pellet with the baculovirus particles after a 100,000 g centrifugation step, suggesting that it was associated with the baculovirus. For the inactivated PEDV material, PEDV viral harvest was inactivated for 24 hours using 5 mM BEI, clarified and 0.45 m filtered.

    (109) TABLE-US-00003 TABLE 4a Summary of PEDV prototype vaccine material - Inactivated viral harvest Material: 0.45 m filtered, BEI inactivated porcine epidemic disease virus p7 on BI-Vero (production grade trypsin); 5.3 log TCID.sub.50/ml Testing of vaccine BEI inactivated material was passed once in BI-Veros at various material dilutions. Lack of viral growth was confirmed by IFA using anti- PEDV polyclonal sera. Sterility of the formulated vaccine was determined by inoculating a blood agar plate and a MacConkey agar plate with 50 l of material. Plates were incubated aerobically and anaerobically for 48 hrs. No growth was noted following incubation. The sterility testing was done for each of the prepared vaccine batches (D0, D14 and D28). Formulation: 42 ml of BEI inactivated material was divided into three 14 ml aliquots. One aliquot was thawed in a 37 C. waterbath on D0, 14 and 28. On each of the vaccination days, 3.5 ml of EMULSIGEN-BCL (MVP) was added to 14 ml of inactivated material slowly over 1 minute while stirring. The mixture was stirred for 10 min, transferred to a vaccine bottle, than stored at 4 C.

    (110) TABLE-US-00004 TABLE 4b Summary of the PEDV prototype vaccine material - BaculoDisplay-Spike Material: BaculoFBU/PEDVS p2 Testing of Sterility of the formulated vaccine was determined by vaccine inoculating a blood agar plate and a MacConkey agar plate material with 50 l of material. Plates were incubated aerobically and anaerobically for 48 hrs. No growth was noted following incubation. The sterility testing was done for each of the prepared vaccine batches (D0, D14 and D28). Formulation: 27 ml of BaculoDisplay-Spike protein was divided into three 9 ml aliquots and stored at 4 C. On D0, 14 and 28, 2.0 ml of EMULSIGEN-BCL (MVP) was added to 8.0 ml of material slowly over 1 minute while stirring. Mixture was stirred for 10 min then stored at 4 C.

    (111) PEDv Vaccination:

    (112) On D0, 14 and 28, the Investigator or designee administered the vaccine material to all pigs. Each pig received 2 ml of the BEI inactivated PEDV vaccine, 1 ml of the BaculoDisplay-Spike prototype or 2 ml of the placebo intramuscularly using a sterile needle and syringe appropriate for their age. On D0 and D28, the vaccine was given in the right neck musculature and on D14 it was given in the left neck musculature.

    (113) Tissue Collection:

    (114) Pigs were evaluated for macroscopic lesions. Abnormalities were recorded on the necropsy form. Fresh samples of small intestine and colon and fixed sections of lung, heart, spleen, kidney, small intestine, colon and liver were collected. Fresh samples were stored at BIVI-Ames at 70 C. for a minimum of six months after the completion of the study. Fixed sections were stored at BIVI-Ames at room temperature for a minimum of six months after the completion of the study.

    (115) Viral Assays:

    (116) PEDV RT-PCR: Samples were screened by RT-PCR as described in Table 3. The quantitative one-step RT-PCR kit (ISCRIPT One-Step RT-PCR kit for probes; BioRad, cat no. 170-8895) was used for the assay. Sequence information for the primers, probe and ultramer are as follows: PEDV-qPCR-probe, 5-6-FAM/ACAGAGCCTGTGTTGGTGTATAGTAACAT-3BHQ_1 (SEQ ID NO: 16); PEDV-qPCR-F, 5-TATAGTGGGTGTTATTTCTAGTT-3 (SEQ ID NO: 17); PEDV-qPCR-R, 5-GCCAATACTGCCAGATTTACA-3(SEQ ID NO: 18), PEDV-ultramer, 5-TGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAGCTCCACTTTTAACAGTACTAGG GAGTTGCCTGGTTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGT TGGTGTATAGTAACATAGGTGTTTGTAAATCTGGCAGTATTGGCTATGTCCCAT-3 (SEQ ID NO: 19). Real-time RT-PCR was carried out in a 25 l reaction containing 2 l of extracted total nucleic acid, 0.75 l of probe (4 M), 0.5 l of each primer (10 M), 12.5 l of 2 RT-PCR mix, 0.5 l ISCRIPT reverse transcriptase and 8.25 l of DEPC-treated water. The reaction took place using a CFX96 real-time PCR detection system (BioRad) under the following conditions: initial reverse transcription at 50 C. for 30 min, followed by initial denaturation at 95 C. for 5 min, 40 cycles of denaturation at 95 C. for 15 s and annealing and extension at 57 C. for 30 s. The optical data were analyzed using CFX Manager software (version 2.1, BioRad). For each determination, the threshold lines were automatically calculated using the regression setting for cycle threshold (Ct) determination mode. Baseline subtraction was done automatically using the baseline subtracted mode. Curves with baseline end values of less than 10 were manually corrected. Samples were run in single reactions and quantitative amounts were determined using an ultramer-based standard curve and reported as genomic copies per microliter (gc/l). Samples with no detection following 40 cycles were considered negative.

    (117) Anti-PEDV-IgG ELISA:

    (118) Samples were screened by ELISA as described in Table 3. For the assay, plates were coated with 4 ng/l of PEDV-1251-125-2 for one hour at 37 C. Following washing, wells were coated with 100 l of a 1:100 diluted serum sample (for the IgG a assay) and incubated for one hour at 37 C. Following washing, wells were blocked with 0.05% non-fat milk and incubated for one hour at 37 C. Following washing, wells were coated with 100 l of a 1:10,000 dilution of horse-radish peroxidase (HRP)-conjugated-goat-anti-swine-IgG and incubated for one hour at 37 C. Following washing, the plate was developed with 3,5,3,5-tetramethylbenzidine for 5 minutes and the reaction was stopped with 2 M H.sub.2SO.sub.4 before optical density (OD) measurement at 450 nm. Samples were run in duplicate wells and results are reported as the average sample to positive (S:P) ratio. As no cut-off values for positive versus negative interpretation have been generated for either of the ELISA assays, samples with S:P ratios greater than the sum of two standard deviations higher plus the highest control group mean were considered positive (S:P ratio>0.28 or >0.16 for the IgG assay).

    (119) PEDV Fluorescent Focus Assay:

    (120) The PEDV FFN assay was run consisted of a duplicate serum dilution series screened in a 96-well plate format by a virus neutralization assay using a cell culture adapted PEDV stain. Titers were reported as the greatest serum dilution showing a 90% reduction of fluorescent foci in comparison to the negative control. For each sample, duplicate well titers were averaged.

    (121) Statistical Analysis of Data:

    (122) Data analysis was performed using JMP 9.0.3 (SAS Institute, Inc., Cary, N.C., USA) by the Monitor. For all analysis, a p-value less than 0.05 was considered significant. For repeated measures of data (serology), a multiple analysis of variance was performed using time as the repeated variable in the model. If a significant p-value was noted, a one-way ANOVA was performed using group as the independent factor; separate analyses were done for each day. If a significant p-value was noted; pair-wise differences between group means were evaluated using Wilcoxon adjusted pairwise comparisons.

    (123) Serology:

    (124) PEDV Fluorescent focus neutralization (FFN) assay: See Table 5 for individual animal results. All animals in the BEI-VH group showed four-fold increases in neutralizing titers, while only two of seven animals in Group 2 had a similar response. The control animals had no detectable neutralizing titers.

    (125) TABLE-US-00005 TABLE 5 PEDV Fluorescent focus neutralization assay results for study D-1, 14, 28 and 49. Highlighted cells indicate titers greater than 0. Animal PEDV Study day no. group -1 14 28 49 131 BEI-VH 0 0 80 120 132 0 0 60 80 134 0 0 40 80 142 0 0 160 80 143 0 0 80 160 146 0 0 30 60 148 0 0 40 160 133 Baculo-S 0 0 20 0 135 0 0 0 0 136 0 0 0 0 139 0 0 0 0 141 0 0 0 0 144 0 0 0 40 145 0 0 0 120 137 Control 0 0 0 0 138 0 0 0 0 140 0 0 0 0 147 0 0 0 0

    (126) Anti-PEDV-IgG ELISA:

    (127) Sample to positive (S:P) ratios for individual animals are listed in Table 6 below. All animals in Group 1 (BEI-VH) had a detectable IgG response by D28 that was at least two standard deviations higher in comparison to mean S:P ratios of the control group. In contrast, only two animals in Group 2 (Baculo-S) had detectable IgG responses and only after receiving three doses of the vaccine. Group least square mean S:P ratiosstandard error are presented in FIG. 4. By D28, animals in Group 1 (BEI-VH) had significantly higher S:P ratios in comparison to Group 2 and Group 3 (p<0.01, Wilcoxon adjusted pairwise comparisons).

    (128) TABLE-US-00006 TABLE 6 Individual anti-PEDV-IgG S:P ratios for D-1, 14, 28 and 49. Highlighted values indicate S:P ratios at least two standard deviations greater than the mean S:P ratios of the control group on D49. Animal PEDV Study days no. group D-1 D14 D28 D49 131 BEI-VH 0.078995 0.119838 0.452301 0.93054393 132 0.085278 0.126571 0.317992 0.58200837 134 0.069569 0.183124 0.328033 0.65230126 142 0.057002 0.094704 0.392887 0.62552301 143 0.049372 0.150808 0.351464 0.59874477 146 0.048923 0.079443 0.296653 0.65104603 148 0.069569 0.130162 0.498326 0.75774059 133 Baculo-S 0.066427 0.093806 0.086611 0.13807531 135 0.058348 0.109964 0.156904 0.28410042 136 0.04623 0.09605 0.094142 0.18995816 139 0.054309 0.067325 0.093305 0.18158996 141 0.051167 0.061041 0.079916 0.14937238 144 0.061041 0.14632 0.138075 0.34644351 145 0.042639 0.064183 0.079916 0.20292887 137 Control 0.05386 0.071364 0.135146 0.21464435 138 0.050269 0.062837 0.082427 0.21631799 140 0.048923 0.060144 0.089121 0.18661088 147 0.064632 0.090664 0.127615 0.25941423

    (129) PEDV Viremia/Shedding:

    (130) To assess the potential for shedding and viremia following vaccination, serum and fecal samples were screened by RT-PCR for the presence of PEDV RNA on the fourth day following each vaccination (D3, D18 and D31). No PEDV RNA was detected in any of the samples.

    (131) Conclusions:

    (132) Based on the combined serological data (IgG and FFN) of the above study, three doses of the PEDV Spike protein expressed by the BacuoloDisplay method given at 866 g per dose and adjuvanted with EMULSIGEN-BCL was not able to generate a consistent serological response. In this case, the lack of response indicates that the vaccine was either not sufficiently immunogenic (i.e. protein was not delivered in sufficient quantity or a non-suitable adjuvant was used) or that the confirmation of the recombinant Spike protein was not similar to the wildtype virus.

    (133) Conversely, the anti-PEDV IgG and FFN serological data does suggest that two or three doses of the BEI inactivated PEDV viral harvest given at 5.6 log/dose and adjuvanted with EMULSIGEN-BCL was able to consistently elicit a serological response in nave swine. However, the average anti-PEDV-IgG S:P ratio in vaccinated animals was lower in comparison to animals administered feedback material. Specifically, the average anti-PEDV-IgG S:P ratio (standard deviation) in 45 animals from one herd administered feedback material prior to sampling was found to be 0.900.20 in comparison to 0.690.12 in vaccinated animals (data not shown). In addition, via personal communications with Dr. Eric Nelson, FFN titers in five of seven of the vaccinated animals in this study were below titers typically seen following feedback administration.

    Example 7: Efficacy BEI Inactivated PEDV (Three Dose, Various Adjuvants)

    (Study 2013131)Troy Kaiser

    (134) The following study evaluated whether a vaccination with three 2-mL does of a killed PEDV vaccine could elicit an immune response when administered to pigs three weeks of age at 14 day intervals. The primary outcome was serology tested by fluorescent focus neutralization (FFN).

    (135) Study groups included: T01=PBS (n=10); T02=6.04 log TCID.sub.50/ml BEI PEDV+20% EMULSIGEN-BCL (n=18); T03=6.04 log TCID.sub.50/ml BEI PEDV+10% EMULSIGEN-D (n=20); T04=6.04 log TCID.sub.50/ml BEI PEDV+15% REHYDRAGEL; T05=6.04 log TCID.sub.50/ml BEI PEDV+5% S:P oil (n=20).

    (136) TABLE-US-00007 TABLE 7 Vaccine Formulations and Controls Treatment Description T01 Negative Phosphate Buffered Saline (1x) Control (NC) T02 Experimental PEDv at 6.04 log.sub.10 TCID.sub.50/mL inactivated Vaccine (EV) with binary ethyleneimine, adjuvanted with 20% EMULSIGEN-BCL T03 Experimental PEDv at 6.04 log.sub.10 TCID.sub.50/mL inactivated Vaccine (EV) with binary ethyleneimine, adjuvanted with 10% EMULSIGEN-D T04 Experimental PEDv at 6.04 log.sub.10 TCID.sub.50/mL inactivated Vaccine (EV) with binary ethyleneimine, adjuvanted with 15% REHYDRAGEL T05 Experimental PEDv at 6.04 log.sub.10 TCID.sub.50/mL inactivated Vaccine (EV) with binary ethyleneimine, adjuvanted with 5% S:P oil

    (137) On D0, pigs were administered the 2-mL treatment intramuscularly in the right neck. A second treatment was administered on D14 in the left neck, and a third treatment was administered on D28 in the right neck for all groups. Blood samples were collected on D-1, D13, D27, D42, and D49. Serum was tested for PEDV neutralizing antibodies using FFN.

    (138) Serology:

    (139) Seroconversion occurred in 11.2% of pigs after two vaccinations and 55.6% of pigs when vaccinated three times with PEDV vaccine adjuvanted with 20% EMULSIGEN BCL (T02; Table 8). The geometric mean titer for seropositive pigs1:20 for all treatment groups are presented below in Table 8. The frequency distribution of titers by treatment group of all pigs is presented in Table 9.

    (140) TABLE-US-00008 TABLE 8 Proportion of seropositive pigs and geometric mean titer by group for pigs responding serologically Group Pigs with 1:20 Response Geometric Mean Titer T01 0/10 (0%) Not applicable T02 10/18 (55.6%) 1:45.9 T03 6/20 (30%) 1:44.8 T04 2/20 (10%) 1:40.0 T05 2/20 (10%) 1:56.6

    (141) TABLE-US-00009 TABLE 9 Frequency distribution of titers by group PEDv Neutralizing Antibodies* Group n <1:20 1:20 1:28 1:40 1:80 1:113 1:160 T01 10 10 (100%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) T02 18 8 (44.4%) 2 (11.1%) 1 (5.6%) 4 (22.2%) 1 (5.6%) 1 (5.6%) 1 (5.6%) T03 20 14 (70.0%) 1 (5.0%) 1 (5.0%) 2 (10.0%) 1 (5.0%) 1 (5.0%) 0 (0.0%) T04 20 18 (90.0%) 1 (5.0%) 0 (0.0%) 0 (0.0%) 1 (5.0%) 0 (0.0%) 0 (0.0%) T05 20 18 (90.0%) 0 (0.0%) 0 (0.0%) 1 (5.0%) 1 (5.0%) 0 (0.0%) 0 (0.0%) *Maximum titer on D42 or D49

    (142) Conclusions:

    (143) Seroconversion occurred in 11.2% of T02 pigs after two doses and seroconversion occurred in 55.6% of pigs when vaccinated three times with the experimental vaccine formulated with 6.04 log 10 TCID50/mL PEDv inactivated with binary ethyleneimine and adjuvanted with 20% EMULSIGEN BCL. The data collected from this study indicate that this experimental vaccine elicited an immune response that supports a claim of reasonable expectation of efficacy.

    Example 8: Efficacy of Baculovirus Vaccines (Two Dose, Various Adjuvants)

    (Study 2014236) Kara Claxton

    (144) The following study evaluated the serological response to vaccination with two 2-mL does of a killed Porcine Epidemic Diarrhea Virus (PEDv) Vaccine, or a baculovirus construct vaccine, as measured after administration of either vaccine to pigs at three weeks of age. The primary outcome was serology tested by fluorescent focus neutralization (FFN) for serum samples collected following vaccination in the treated pigs.

    (145) The study groups included: T01=PBS (n=10); T02=6.93 log TCID.sub.50/ml BEI PEDV+20% EMULSIGEN-BCL (n=20); T03=Baculovirus with PEDV Spike Ag (n=9); 6 Concentrated Baculovirus with PEDV Spike Ag (n=10); Trypsin Baculovirus with PEDV Spike Ag (n=10); and Killed Positive Control vaccine conditionally licensed (POS CON) (n=10). On D0, pigs were administered the 2-mL treatment intramuscularly in the right neck. A second treatment was administered on D14 in the left neck for T01-T05 and on D21 for T06.

    (146) TABLE-US-00010 TABLE 10 Vaccine Formulation and Controls Treatment Description T01 Negative Saline (PBS 1x) Control (NC) T02 Experimental Porcine epidemic diarrhea virus at 6.93 log.sub.10 Vaccine TCID.sub.50/mL PEDv inactivated with BEI, adjuvanted (EV) with 20% Emulsigen BCL. T03 EV Recombinant baculovirus with PEDv Spike glycoprotein displayed in the viral envelope.* T04 EV Recombinant baculovirus with PEDv Spike glycoprotein displayed in the viral envelope.* The clarified inactivated material was concentrated ~6X prior to formulation. T05 EV Recombinant baculovirus with PEDv Spike glycoprotein displayed in the viral envelope.* Recombinant PEDv Spike-Display Baculovirus was produced in insect cells with 10 g/mL trypsin added during infection. T06 Positive iPED+ (Harris vaccine - Conditionally Licensed) Control (PC) BEI = binary ethyleneimine *The PEDV Spike signal sequence and C-terminal tail were replaced with the baculovirus gp64 equivalent. Recombinant PEDv Spike-Display Baculovirus was produced in insect cells. Infected cultures were harvested and clarified by centrifugation and 0.2-m filtration. Clarified harvest material was inactivated with 5 mM BEI for 72 hours at 37 C. then clarified by centrifugation and 0.2-m filtration.

    (147) Serology:

    (148) Seroconversion post-vaccination (D28 & D35) occurred in 20% of pigs vaccinated with PEDv vaccine adjuvanted with 20% EMULSIGEN BCL (T02; [0171]1) and 60% of pigs vaccinated with trypsin-grown PEDV SPIKE-baculovirus (T05; [0171]1). The geometric mean titer for seropositive pigs1:20 for all treatment groups are presented below in Table 11. The frequency distribution of titers by treatment group of all pigs is presented in Table 12.

    (149) TABLE-US-00011 TABLE 11 Proportion of seropositive pigs and geometric mean titer by group for pigs responding serologically Group Pigs with 1:20 Response Geometric Mean Titer T01 0/10 (0%) Not applicable T02 4/20 (20%) 1:30.7 T03 0/9 (0%) Not applicable T04 0/10 (0%) Not applicable T05 6/10 (60%) 1:35.5 T06 7/10 (70%) 1:41.9

    (150) TABLE-US-00012 TABLE 12 Frequency distribution of titers by group PEDv Neutralizing Antibodies* Group n <1:20 1:20 1:28 1:40 1:57 1:80 1:113 1:160 T01 10 10 (100%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) T02 20 16 (80%) 1 (5%) 2 (10%) 0 (0.0%) 1 (5%) 0 (0.0%) 0 (0.0%) 0 (0.0%) T03 9 9 (100%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) T04 10 10 (100%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) T05 10 4 (40%) 2 (20%) 2 (20%) 1 (10%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 1 (10%) T06 10 3 (30%) 2 (20%) 2 (20%) 0 (0.0%) 0 (0.0%) 2 (20%) 1 (10%) 0 (0.0%)

    (151) Conclusion:

    (152) Seroconversion occurred in 20% of T02 pigs after two administrations of the experimental vaccine formulated with 6.93 log.sub.10 TCID.sub.50/mL PEDV inactivated with BEI and adjuvanted with 20% EMULISGEN BCL. Seroconversion occurred in 60% of T05 pigs after two administrations of the experimental recombinant trypsin grown-baculovirus vaccine formulated with PEDV Spike glycoprotein.

    Example 9: Efficacy Study

    POC Efficacy (Study 2014030)Abby Patterson

    (153) The below study was designed to assess the efficacy of killed vaccine and other prototype vaccines in sows. The primary outcome parameter is piglet mortality following challenge with porcine epidemic diarrhea virus (PEDV). The secondary outcome parameter was dam serology. Other parameters measured included: clinical signs (including ISL) in sows following vaccination; PEDV shedding in sows following vaccination (via qRT-PCR); clinical signs in piglets; and PEDV serology in piglets

    (154) At four and two weeks pre-farrow (D0 and D14), each gestating dam was administered 2 mL of one of the following treatments by three routes (intramuscular, intranasal and oral): T01 (negative control, NC) phosphate buffered saline; T02 (BEI-VH) adjuvanted with 20% EMULSIGEN BCL; T03 (strict control, SC) served as non-vaccinated/non-challenged control. Eight animals were used per group, excluding T06 which had four animals. On D35 or D36, pigs were challenged orally with 1 mL of 2.0 log 10 TCID50/mL PEDV viral harvest. Clinical signs (vomiting and diarrhea) in dams and pigs were observed daily during the challenge phase. Serum was collected from dams at four- and two-weeks pre-farrow (D0 and D14), the day prior to piglet challenge (D34 or D35) and the day of off-test (D57).

    (155) On D0 and D14, the PEDV prototype vaccines were administered to the sows. At each vaccination, the sows received a total of 6 mL of vaccine where 2 mL were administered by intramuscular, intranasal and oral route. For the intramuscular administration route, a 2 mL injection was given into the musculature of the neck below the ear. The side of the neck for administration was alternated for the initial and booster vaccination. For the oral administration route, 2 ml were delivered over the caudal oropharynx using an 8 Fr polypropylene catheter (2.7 mm diameter by 254 mm length) attached to a syringe. For the intranasal route, 1 ml was injected into each nare using a 4.5 inch catheter attached to a syringe.

    (156) TABLE-US-00013 TABLE 13 Experimental Vaccine and Control Product Treatment Group Serial # Description T01 NC 2842-182-D 1X Phosphate Buffered Saline; Gibco catalog no. 10010-023; Lot no. 1510272 T02 BEI-VH 2842-182-E KV-1251-125-10-OK, 0.2 m filtered, passage MSV + 5, 6.04 log TCID.sub.50/mL. Viral harvest was inactivated with 5 mM BEI for 72 hr at 37 C. For formulation, Emulsigen BCL (MVP lot no. 17006, manufacture date Feb. 11, 2011) was added at a 20% inclusion rate.

    (157) TABLE-US-00014 TABLE 14 Challenge Material PEDV Challenge Strain: Isolate id. 1251-140-4; passage 5 Challenge preparation: Propagated in Vero cells Dose of Challenge material: 1 mL at 2.0 log.sub.10 TCID.sub.50/mL Testing of Challenge Challenge virus was titrated prior to Material: administration on 2013 EU Vero cells (5.03 TCID50/ml) and diluted to 2 log TCID.sub.50/mL. Method of Administration: Oral administration (by syringe) with pigs manually restrained.

    (158) Vaccine Efficacy:

    (159) Pig mortality: Pig mortality following challenge with a virulent PEDV isolate was the primary outcome parameter used to assess vaccine efficacy. A summary of mortality by group during the challenge period is listed below. With 55% mortality and all litters affected in T01 (NC), the challenge was considered sufficiently virulent. In comparison to T01 (NC), T02 (BEI-VH) demonstrated a numerical reduction in pig mortality with a PF (95% CI) of 0.20 (0.550, 0.586). The reduction was not statistically significant as the 95% CI (0.550, 0.586) included zero.

    (160) Extra-binomial variation was evident in this study, resulting in a wide confidence interval for T02 (BEI-VH) PF when utilizing the underlying binomial distribution. Mortality varied greatly among litters within a group, including ranging from 0% to 100% for T02 (BEI-VH).

    (161) An intestinal sample or intestinal content was taken at the time necropsy and tested by qRT-PCR to detect PEDV antigen. Of samples tested from animals during the time of peak mortality, PEDV was detected in 55.5% of samples.

    (162) TABLE-US-00015 TABLE 15 Proportion 95% Mortality Standard Prevented Confidence Median Minimum %/ Group Estimate Error Fraction* interval Mortality Maximum % NC 0.55 0.11 . . 52.78 12.50/100.00 BEI-VH 0.44 0.10 0.20 (0.550, 0.586) 34.29 0.00/100.00 *Based on T01 (NC) proportion affected. **NC = Not Calculated. Confidence Interval possible for T02 (BEI-VH) based on study design

    (163) Sow Serology:

    (164) Fluorescent Focus Neutralizing (FFN) assay: The FFN assay was used to assess the dam virus neutralizing response following vaccination and challenge. Geometric mean titers listed by group are presented below for days on which blood was collected from sows.

    (165) Following two doses of vaccine, 2/8 (25%) of sows in T02 (BEI-VH) had detectable levels of neutralizing antibody. Detectable levels of neutralizing antibody were not observed in any of the other groups.

    (166) Following lateral exposure to PEDV, all sows in exposed treatment groups had detectable levels of neutralizing antibody. Animals in T03 (SC) group remained seronegative throughout the trial. The geometric mean titer on D57 (approximately 21 days post-exposure) indicated that vaccination resulted in numerically higher titers in comparison to T01 (NC). Sows in T02 (BEI-VH) group had a GMT of 613, which is an approximately three-fold higher titer in comparison to the GMT of 200 for sows in T01 (NC) (p=0.005). As multiple samples in T02 (BEI-VH) group had detectable neutralizing antibodies at the highest dilution tested (1:640), these results likely represent a conservative estimate of the differences between groups.

    (167) TABLE-US-00016 TABLE 16 Geometric Mean Titer* Study Day** D34 or Treatment Group D0 D14 D35 D57 T01 NC <20 <20 <20 200 T02 BEI-VH <20 <20 15 613 T03 SC <20 <20 <20 <20 Where all values were <20, geometric mean titer is presented as <20. Otherwise, values of <20 were set to 10 for GMT calculation **D57 GMT for T01 (NC) and T02 (BEI-VH) are back-transformed Least-Squares Means

    (168) S1-Based ELISA Data:

    (169) An S1-based ELISA was used to assess the dam's response to the PEDV-spike protein following vaccination and challenge. Assay results for colostrum, milk and serum are listed by group for days on which samples were collected.

    (170) At the time of pig challenge, sows in T02 (BEI-VH) had significantly higher geometric mean titer in serum as compared to sows in T01 (NC) (p=0.0005). Following exposure to PEDV, a larger significant difference was noted between the two groups (p<0.0001).

    (171) Significant differences in geometric mean titers of anti-PEDV IgA in colostrum and in milk were not observed between T02 (BEI-VH) and T04 (NC).

    (172) TABLE-US-00017 TABLE 17 Geometric Mean Titer* Study Day D27 through D34 or D32: D35: D57: Treatment Group Colostrum Serum Serum D57: Milk T01 NC 0.186 0.098 0.504 0.220 T02 BEI-VH 0.139 0.256 1.499 0.244 T03 SC 0.134 0.125 0.164 0.088 *GMT for T01 (NC) and T02 (BEI-VH) are back-transformed Least-Squares Means

    (173) Pig Serology:

    (174) Serum was collected at the time of necropsy from pigs to evaluate the presence of neutralizing antibodies. The table below presents the geometric mean FFN titers of positive pigs by group. The table also includes the frequency of detection expressed as the number of pigs with a GMT greater than or equal to 20 over the number of animals tested. Testing was performed on all available samples. Samples from numerous pigs were unable to be obtained due to the time difference between death and necropsy.

    (175) Descriptive statistics for FFN titers by mortality status (Died: Yes/No) and group (Overall) are listed below. Overall, a similar proportion of pigs in the vaccinated groups seroconverted (or had maternal antibodies) regardless of time of necropsy. However, in T01 (NC), a higher percentage of pigs that died prior to off test had titers (88%) in comparison to pigs that lived for the duration of the study (43%).

    (176) When looking at the overall pig titers by group, the proportion mortality estimate was inversely related to the overall group FFN percentage for T02 (BEI-VH).

    (177) TABLE-US-00018 TABLE 18 Proportion Pigs (Died = Mortality Group yes) Pigs (Died = no) Overall Estimate NC 55 33 (9/21; 43%) 63 (37/53; 59%) 0.55 (28/32; 88%) BEI-VH 44 50 (9/16; 56%) 64 (32/58; 55%) 0.44 (23/42; 55%) *GMT (no. animals titer 20/total pigs tested; percentage); note that serum was not obtained from all pigs

    (178) Clinical Observations Following Challenge:

    (179) Pig fecal scores: Descriptive statistics for the duration of abnormal fecal observations in pigs, by group and mortality status (Died: Yes/No), are listed below. Overall, the median duration of abnormal fecal scores in pigs with the same mortality status was similar among groups. In animals that died or were euthanized, there was a numerically shorter median duration of abnormal fecal scores. This trend was most evident in T01 (NC) pigs and is likely secondary to the fact that the majority of these animals died within the first week following challenge.

    (180) TABLE-US-00019 TABLE 19 Duration (days) abnormal fecal score # Died Group pigs Median Minimum Maximum Std Dev No NC 32 5.5 3.5 7.0 0.8 BEI-VH 42 6.0 4.5 8.5 0.8 Yes NC 39 2.3 0.5 6.0 1.3 BEI-VH 33 4.3 2.0 6.0 1.4

    (181) The severity of fecal scores in pigs is summarized in the frequency table below. In all treatment groups a high portion of pigs (>91%) presented with a fecal score of 2 during at least one observation following challenge.

    (182) TABLE-US-00020 TABLE 20 Maximum Fecal Score Group 0 1 2 Total NC 1 5 65 71 1.41 7.04 91.55 BEI-VH 1 0 74 75 1.33 0.00 98.67 Total 2 5 139 146

    (183) Conclusions:

    (184) A 20% reduction in pig mortality was observed in T02 (BEI-VH) as compared to T01 (NC) group. Three routes of administration were attempted in this study. Although 3 routes were used, there is no expectation that routes other than IM contributed to the efficacy of T02 (BEI-VH) based on the adjuvant and vaccine formulation. Overall the inactivated PEDV adjuvanted with 20% EMULSIGEN-BCL vaccine with a minimum pre-inactivation titer of 6.04 log TCID.sub.50/ml appears to induce better immune responses in the piglets and sows. The preferred vaccination schedule is IM route of administration for piglets 3 weeks of age or older, three 2 ml doses at 2-week intervals. Clinical signs in sows following vaccination were not observed in T02 (BEI-VH) and were limited in the other treatment groups. The use of vaccination did not appear to affect the percentage of pigs born live (data not shown).

    (185) Dam serology was evaluated as a secondary parameter by two separate assays (focus fluorescent neutralization, S1-based ELISA). Both assays indicated a significant increase in titer in T02 (BEI-VH) following vaccination and exposure as compared to T01 (NC). Due to known limitations of the FFN assay, samples were also tested by an S1-based ELISA. This ELISA was chosen as the S1 domain of the spike protein is expected to contain neutralizing epitopes.

    (186) Following lateral exposure to PEDV, all animals in exposed treatment groups had detectable levels of neutralizing antibody. Sows in T02 (BEI-VH) had approximately three-fold higher titers in comparison to the T01 (NC) animals. This is evidence that use of the vaccine stimulated an initial primary response and resulted in a greater secondary response following exposure to the challenge virus. As multiple samples in T02 (BEI-VH) group had detectable neutralizing antibodies at the highest dilution tested (1:640), these results likely represent a conservative estimate of the differences between groups.

    (187) TABLE-US-00021 TABLE 21 Pig mortality and sow serological data are summarized below. FFN (Sow IgG ELISA Pig Prevented serum, (Sow serum, Mortality Fraction Treatment Group D21) D21) (%) (pig mortality) T01 NC 200 0.504 55% . T02 BEI-VH 613 1.499 44% 0.20 T03 SC <20 0.164 NA NA

    (188) All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the following claims.

    (189) The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. 1. Bridgen A, Duarte M, Tobler K, Laude H, Ackermann M. 1993. Sequence determination of the nucleocapsid protein gene of the porcine epidemic diarrhoea virus confirms that this virus is a coronavirus related to human coronavirus 229E and porcine transmissible gastroenteritis virus. J. Gen. Virol. 74 (Pt 9):1795-1804. 2. Duarte M, Gelfi J, Lambert P, Rasschaert D, Laude H. 1993. Genome organization of porcine epidemic diarrhoea virus. Adv. Exp. Med. Biol. 342:55-60 3. Tobler K, Bridgen A, Ackermann M. 1993. Sequence analysis of the nucleocapsid protein gene of porcine epidemic diarrhoea virus. Adv. Exp. Med. Biol. 342:49-54. 4. Oldham J. 1972. Letter to the editor. Pig Farming 1972 (October suppl):72-73. 5. Pensaert M B, de Bouck P. 1978. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 58:243-247. 6. Chen J F, Sun D B, Wang C B, Shi H Y, Cui X C, Liu S W, Qiu H J, Feng L. 2008. Molecular characterization and phylogenetic analysis of membrane protein genes of porcine epidemic diarrhea virus isolates in China. Virus Genes 36:355-364. 7. Nagy B, Nagy G, Meder M, Mocsri E. 1996. Enterotoxigenic Escherichia coli, rotavirus, porcine epidemic diarrhoea virus, adenovirus and calici-like virus in porcine postweaning diarrhoea in Hungary. Acta Vet. Hung. 44:9-19. 8. Martelli P, Lavazza A, Nigrelli A D, Merialdi G, Alborali L G, Pensaert M B. 2008. Epidemic of diarrhoea caused by porcine epidemic diarrhoea virus in Italy. Vet. Rec. 162:307-310. 9. Takahashi K, Okada K, Ohshima K. 1983. An outbreak of swine diarrhea of a new-type associated with coronavirus-like particles in Japan. Nippon Juigaku Zasshi 45:829-832. 10. Chae C, Kim O, Choi C, Min K, Cho W S, Kim J, Tai J H. 2000. Prevalence of porcine epidemic diarrhoea virus and transmissible gastroenteritis virus infection in Korean pigs. Vet. Rec. 147:606-608 11. Puranaveja S, Poolperm P, Lertwatcharasarakul P, Kesdaengsakonwut S, Boonsoongnern A, Urairong K, Kitikoon P, Choojai P, Kedkovid R, Teankum K, Thanawongnuwech R. 2009. Chinese-like strain of porcine epidemic diarrhea virus, Thailand. Emerg. Infect. Dis. 15:1112-1115. 12. Stevenson G W, Hoang H, Schwartz K J, Burrough E R, Sun D, Madson D, Cooper V L, Pillatzki A, Gauger P, Schmitt B J, Koster L G, Killian M L, Yoon K J. 2013. Emergence of porcine epidemic diarrhea virus in the United States: clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Invest. 25:649-654. 13. Kim S H, Kim I J, Pyo H M, Tark D S, Song J Y, Hyun B H. 2007. Multiplex real-time RT-PCR for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus. J. Virol. Methods 146:172-177. 14. Hofmann M, Wyler R. 1988. Propagation of the virus of porcine epidemic diarrhea in cell culture. J. Clin. Microbiol. 26:2235-2239. 15. Marthaler D, Jiang Y, Otterson T, Goyal S, Rossow K, Collins J. 2013. Complete genome sequence of porcine epidemic diarrhea virus strain USA/Colorado/2013 from the United States. Genome Announc. 1 (4):e00555-13.10.1128/genomeA.00555-13 16. Song D, Park B. 2012. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 44:167-175. 17. Huang Y W, Dickerman A W, Pieyro P, Li L, Fang L, Kiehne R, Opriessnig T, Meng X J. 2013. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. mBio 4(5):e00737-13. 18. Bi J, Zeng S, Xiao S, Chen H, Fang L. 2012. Complete genome sequence of porcine epidemic diarrhea virus strain AJ1102 isolated from a suckling piglet with acute diarrhea in China. J. Virol. 86:10910-10911. 19. Chen J, Wang C, Shi H, Qiu H J, Liu S, Shi D, Zhang X, Feng L. 2011. Complete genome sequence of a Chinese virulent porcine epidemic diarrhea virus strain. J. Virol. 85:11538-11539. 20. Chen J, Liu X, Shi D, Shi H, Zhang X, Feng L. 2012. Complete genome sequence of a porcine epidemic diarrhea virus variant. J. Virol. 86:3408.10.1128/JVI. 07150-11 21. Fan H, Zhang J, Ye Y, Tong T, Xie K, Liao M. 2012. Complete genome sequence of a novel porcine epidemic diarrhea virus in south China. J. Virol. 86:10248-10249. 22. Gao Y, Kou Q, Ge X, Zhou L, Guo X, Yang H. 2013. Phylogenetic analysis of porcine epidemic diarrhea virus field strains prevailing recently in China. Arch. Virol. 158:711-715. 23. Li B, Liu H, He K, Guo R, Ni Y, Du L, Wen L, Zhang X, Yu Z, Zhou J, Mao A, Lv L, Hu Y, Yu Y, Zhu H, Wang X. 2013. Complete genome sequence of a recombinant porcine epidemic diarrhea virus strain from eastern China. Genome Announc. 1(2):e00105-13.10.1128/genomeA.00105-13 24. Luo Y, Zhang J, Deng X, Ye Y, Liao M, Fan H. 2012. Complete genome sequence of a highly prevalent isolate of porcine epidemic diarrhea virus in south China. J. Virol. 86:9551-9551. 25. Wang X M, Niu B B, Yan H, Gao D S, Huo J Y, Chen L, Chang H T, Wang C Q, Zhao J. 2013. Complete genome sequence of a variant porcine epidemic diarrhea virus strain isolated in central China. Genome Announc. 1(1):e00243-12.10.1128/genomeA.00243-12 26. Wei Z Y, Lu W H, Li Z L, Mo J Y, Zeng X D, Zeng Z L, Sun B L, Chen F, Xie Q M, Bee Y Z, Ma J-Y. 2012. Complete genome sequence of novel porcine epidemic diarrhea virus strain GD-1 in China. J. Virol. 86:13824-13825. 27. Zhao M, Sun Z, Zhang Y, Wang G, Wang H, Yang F, Tian F, Jiang S. 2012. Complete genome sequence of a Vero cell-adapted isolate of porcine epidemic diarrhea virus in eastern China. J. Virol. 86:13858-13859. 28. S. H. Chang, J. L. Bae, T. J. Kang, J. Kim, G. H. Chung, C. W. Lim, H. Laude, M. S. Yang, Y. S. Jang. 2002. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol. Cells 14, 295-299. 29. D. J. Cruz, C. J. Kim, H. J. Shin. 2008. The GPRLQPY motif (SEQ ID NO: 20) located at the carboxy-terminal of the spike protein induces antibodies that neutralize Porcine epidemic diarrhea virus. Virus Res. 132, 192-196. 30. M. Godet, J. Grosclaude, B. Delmas, H. Laude. 1994. Major receptor-binding and neutralization determinants are located within the same domain of the transmissible gastroenteritis virus (coronavirus) spike protein. J. Virol. 68, 8008-8016. 31. M. W. Jackwood, D. A. Hilt, S. A. Callison, C. W. Lee, H. Plaza, E. Wade. 2001. Spike glycoprotein cleavage recognition site analysis of infectious bronchitis virus. Avian Dis. 45, 366-372. 32. L. S. Sturman, K. V. Holmes. 1984 Proteolytic cleavage of peplomeric glycoprotein E2 of MHV yields two 90K subunits and activates cell fusion. Adv. Exp. Med. Biol. 173, 25-35. 33. D. Sun, L. Feng, H. Shi, J. Chen, X. Cui, H. Chen, S. Liu, Y. Tong, Y. Wang, G. Tong. 2008. Identification of two novel B cell epitopes on porcine epidemic diarrhea virus spike protein. Vet. Microbiol. 131, 73-81. 34. S. J. Park, H. J. Moon, J. S. Yang, C. S. Lee, D. S. Song, B. K. Kang, B. K. Park. 2007. Sequence analysis of the partial spike glycoprotein gene of porcine epidemic diarrhea viruses isolated in Korea. Virus Genes 35, 321-332. 35. L. J. Saif. 1993. Coronavirus immunogens. Vet. Microbiol. 285-297. 36. S. J. Park, H. K. Kim, D. S. Song, H. J. Moon, B. K. Park. 2011 Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field isolates in Korea. Arch. Virol. 156, 577-585. 37. D. S. Song, J. S. Yang, J. S. Oh, J. H. Han, B. K. Park. Differentiation of a Vero cell adapted porcine epidemic diarrhea virus from Korean field strains by restriction fragment length polymorphism analysis of ORF 3. 2003. Vaccine 21, 1833-1842. 38. D. S. Song, J. S., B. K. Park. 2012 Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 44, 167-175. 39. J. F. Chen, D. B. Sun, C. B. Wang, H. Y. Shi, X. C. Cui, S. W. Liu, H. J. Qiu, L. Feng. 2008. Molecular characterization and phylogenetic analysis of membrane protein genes of porcine epidemic diarrhea virus isolates in China. Virus Genes 36, 355-364. 40. L. Yuan, S. Y. Kang, L. A. Ward, T. L. To, L. J. Saif. 1998 Antibody-secreting cell responses and protective immunity assessed in gnotobiotic pigs inoculated orally or intramuscularly with inactivated human rotavirus. J. Virol. 72, 330-338. 41. C. H. Kweon, B. J. Kwon, J. G. Lee, G. O. Kwon, Y. B. Kang. 1999. Derivation of attenuated porcine epidemic diarrhea virus (PEDV) as vaccine candidate. Vaccine 17, 2546-2553. 42. Y. Usami, O. Yamaguchi, K. Kumanomido, Y. Matsumura. 1998. Antibody response of pregnant sows to porcine epidemic diarrhea virus live vaccine and maternally-derived antibodies of the piglets. J. Jpn. Vet. Med. Assoc. 51, 652-655. 43. L. A. Ward, L. Yuan, B. I. Rosen, T. L. To, L. J. Saif. 1996. Development of mucosal and systemic lymphoproliferative responses and protective immunity to human group A rotaviruses in a gnotobiotic pig model. Clin. Diagn. Lab. Immunol. 3, 342-350. 44. A. Pijpers, A. P. van Nieuwstadt, C. Terpstra, J. H. Verheijden. 1993. Porcine epidemic diarrhoea virus as a cause of persistent diarrhoea in a herd of breeding and finishing pigs. Vet. Rec. 132, 129-131. 45. T. Sato, Takeyama, N., Katsumata, A., Tuchiya, K., Kodama, T., Kusanagi, K. 2011. Mutations in the spike gene of porcine epidemic diarrhea virus associated with growth adaptation in vitro and attenuation of virulence in vivo. Virus Genes, 43, 1, 72. 46. Park, S. J., Kim, H. K., Song, D. S., An, D. J. and Park, B. K. 2012. Complete genome sequences of a Korean virulent porcine epidemic diarrhea virus and its attenuated counterpart J. Virol. 86 (10), 5964. 47. Kusanagi K, Kuwahara H, Katoh T, Nunoya T, Ishikawa Y, Samejima T, Tajima M. 1992. Isolation and serial propagation of porcine epidemic diarrhea virus in cell cultures and partial characterization of the isolate. J Vet Med Sci. 1992 April; 54(2):313-8. 48. Hofmann M, Wyler R. 1988. Propagation of the virus of porcine epidemic diarrhea in cell culture. J Clin Microbiol. November; 26(11):2235-9. 49. de Arriba M L, Carvajal A, Pozo J, Rubio P. 2002. Mucosal and Systemic Isotype-specific Antibody Responses and Protection in Conventional Pigs Exposed to Virulent or Attenuated Porcine Epidemic Diarrhoea Virus. Vet Immunol Immunopathol. 85(1-2): p. 85-97.