28 KDA GST PROTEINS FROM SCHISTOSOMA FOR THE TREATMENT OF VASCULITIS

Abstract

Polypeptides that are glutathione-S-transferases originating from different schistosome parasites, as well as nucleic acids, vectors, compositions or kits, for use in the preventive or therapeutic treatment of vasculitis or of a disease characterized by a M1/M2 macrophage ratio dysregulation, such as e.g. a decrease of the M1-type immune response and/or an increase of the M2-type immune response.

Claims

1-15. (canceled)

16. A method of decreasing the M1-type immune response and/or increasing the M2-type immune response, in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of a polypeptide comprising, or consisting of, an amino acid sequence selected from the group consisting of: a) the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8; b) a fragment of a sequence defined in a), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response; and c) a sequence having at least 80% of identity with a sequence defined in a) or b), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response.

17. The method according to claim 16, for the preventive or therapeutic treatment of: vasculitis, or a disease characterized by a M1/M2 macrophage ratio dysregulation selected from the group consisting of atherosclerosis, endometriosis, hypertension, osteonecrosis, Parkinson's disease, steatohepatitis, obesity-induced pathologies, lipodystrophy and myocardial infarction.

18. A method of preventing or treating vasculitis, in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of a polypeptide comprising, or consisting of, an amino acid sequence selected from the group consisting of: a) the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8; b) a fragment of a sequence defined in a), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response; and c) a sequence having at least 80% of identity with a sequence defined in a) or b), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response.

19. The method according to claim 18, wherein said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response.

20. The method according to claim 16, wherein said fragment has an amino acid sequence selected from the group consisting of SEQ ID NO: 19 to SEQ ID NO: 51.

21. The method according to claim 16, wherein said polypeptide comprises, or consists of, an amino acid sequence selected from the group consisting of: a) the sequence of SEQ ID NO: 1; b) a fragment having an amino acid sequence selected from the group consisting of SEQ ID NO: 19 to SEQ ID NO: 30; and c) a sequence having at least 80% of identity with a sequence defined in a) or b), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response.

22. A method of preventing or treating vasculitis, or a disease characterized by a M1/M2 macrophage ratio dysregulation selected from the group consisting of atherosclerosis, endometriosis, hypertension, osteonecrosis, Parkinson's disease, steatohepatitis, obesity-induced pathologies, lipodystrophy and myocardial infarction, in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of a nucleic acid encoding a polypeptide comprising, or consisting of, an amino acid sequence selected from the group consisting of: a) the sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8; b) a fragment of a sequence defined in a), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response; and c) a sequence having at least 80% of identity with a sequence defined in a) or b), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response; or a vector comprising said nucleic acid.

23. The method according to claim 16, wherein said polypeptide is administered in simultaneous, separate or sequential combination with at least one adjuvant.

24. The method according to claim 23, wherein said adjuvant is a natural or non-natural aluminum salt.

25. The method according to claim 16, wherein said subject suffers from vasculitis, atherosclerosis, endometriosis, hypertension, osteonecrosis, Parkinson's disease, steatohepatitis, obesity-induced pathologies, lipodystrophy, or myocardial infarction.

26. The method according to claim 25, wherein said vasculitis is selected from the group consisting of Behçet's disease (BD), Cogan's syndrome (CS), Takayasu arteritis (TAK), Giant cell arteritis (GCA), Polyarteritis nodosa (PAN), Kawasaki disease (KD), Antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV), Microscopic polyangiitis (MPA), Granulomatosis with polyangiitis (Wegener's) (GPA), Eosinophilic granulomatosis with polyangiitis (Churg-Strauss) (EGPA)), Immune complex small vessel vasculitis, Anti-glomerular basement membrane (anti-GBM) disease, Cryoglobulinemic vasculitis (CV), IgA vasculitis (Henoch-Schanlein) (IgAV), Hypocomplementemic urticarial vasculitis (HUV) (anti-C1q vasculitis), Cutaneous leukocytoclastic angiitis, Cutaneous arteritis, Primary central nervous system vasculitis, Isolated aortitis.

27. The method according to claim 25, wherein said vasculitis is associated to another disease selected from the group consisting of Lupus, Rheumatoid arthritis, Sarcoidosis, Hepatitis C, Hepatitis B, Syphilis and Cancer.

28. The method according to claim 16, wherein said polypeptide is comprised in a pharmaceutical composition further comprising a pharmaceutically acceptable excipient, or in a vaccine composition further comprising at least one adjuvant.

29. The method according to claim 18, wherein said polypeptide is comprised in a pharmaceutical composition further comprising a pharmaceutically acceptable excipient, or in a vaccine composition further comprising at least one adjuvant.

30. The method according to claim 18, wherein said fragment has an amino acid sequence selected from the group consisting of SEQ ID NO: 19 to SEQ ID NO: 51.

31. The method according to claim 18, wherein said polypeptide comprises, or consists of, an amino acid sequence selected from the group consisting of: a) the sequence of SEQ ID NO: 1; b) a fragment having an amino acid sequence selected from the group consisting of SEQ ID NO: 19 to SEQ ID NO: 30; and c) a sequence having at least 80% of identity with a sequence defined in a) or b), provided that said polypeptide decreases the M1-type immune response and/or increases the M2-type immune response.

32. The method according to claim 18, wherein said polypeptide is administered in simultaneous, separate or sequential combination with at least one adjuvant.

33. The method according to claim 32, wherein said adjuvant is a natural or non-natural aluminum salt.

34. The method according to claim 18, wherein said vasculitis is selected from the group consisting of Behçet's disease (BD), Cogan's syndrome (CS), Takayasu arteritis (TAK), Giant cell arteritis (GCA), Polyarteritis nodosa (PAN), Kawasaki disease (KD), Antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV), Microscopic polyangiitis (MPA), Granulomatosis with polyangiitis (Wegener's) (GPA), Eosinophilic granulomatosis with polyangiitis (Churg-Strauss) (EGPA)), Immune complex small vessel vasculitis, Anti-glomerular basement membrane (anti-GBM) disease, Cryoglobulinemic vasculitis (CV), IgA vasculitis (Henoch-Schanlein) (IgAV), Hypocomplementemic urticarial vasculitis (HUV) (anti-C1q vasculitis), Cutaneous leukocytoclastic angiitis, Cutaneous arteritis, Primary central nervous system vasculitis, Isolated aortitis.

35. The method according to claim 18, wherein said vasculitis is associated to another disease selected from the group consisting of Lupus, Rheumatoid arthritis, Sarcoidosis, Hepatitis C, Hepatitis B, Syphilis and Cancer.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0412] FIG. 1 is a diagram of the protocol used for studying the prophylactic effect of P28GST in a skin inflammation mouse model. Mice were immunized with 3 subcutaneous injections of P28GST (0.5 μg/kg) with an adjuvant (Alum), prior to imiquimod-induction of skin inflammation. Different negative controls were used: mice with only NaCl injections (Control), mice with NaCl injections and imiquimod application (IMQ) and mice with injections of adjuvant alone and then application of imiquimod (Placebo). Betamethasone, an anti-inflammatory treatment, was used as a reference treatment.

[0413] FIG. 2 represents the clinical score obtained after imiquimod-induction of skin inflammation in mice immunized with P28GST before imiquimod application, measured daily during the 5 days of imiquimod application. Different negative controls were used: mice with only NaCl injections (Control), mice with NaCl injections and imiquimod application (IMQ) and mice with injections of adjuvant alone and then application of imiquimod (Placebo). Betamethasone, an anti-inflammatory treatment, was used as a reference treatment. *p<0.05 (P28 vs Placebo) and ##p<0.01 (P28 vs IMQ).

[0414] FIG. 3 represents the relative mRNA expression of the inflammation markers TNFα and IL-1β (normalized with the β-actin gene) in mice immunized with P28GST before imiquimod application. Different negative controls were used: mice with only NaCl injections (Control), mice with NaCl injections and imiquimod application (IMQ) and mice with injections of adjuvant alone and then application of imiquimod (Placebo).

[0415] FIG. 4 represents the percentage of CD80+ macrophages and of CD206+ macrophages in the F4/80+ spleen population, the M2/M1 ratio in the spleen, as indicated by the F4/80+CD80+ cell to F4/80+CD206+ cell ratio, and in the skin, as indicated by the Arginase/iNOS mRNA expression ratio, after immunization with P28GST and imiquimod application. Pro-inflammatory M1 macrophages are CD80+ and iNOS+ and anti-inflammatory M2 macrophages are CD206+ and Arginase+. Different negative controls were used: mice with only NaCl injections (Control), mice with NaCl injections and imiquimod application (IMQ) and mice with injections of adjuvant alone and then application of imiquimod (Placebo). *p<0.05, **p<0.01 and ***p<0.001.

[0416] FIG. 5 is a diagram of the study design. Vasculitis induction was performed during the first three days and P28GST (5 μg/kg) injected with an adjuvant (Alum), or anti-TNFα (300 μg/rat), were administered to Lewis rats at day 18, 25 and 32. Different negative controls were used: mice with vasculitis induction and NaCl injection (Nacl), mice with vasculitis induction and injection of adjuvant alone (Placebo). Anti-TNFα, an anti-inflammatory treatment, was used as a positive control.

[0417] FIG. 6 represents histograms showing the concentration of Nitrite (A), Urea (B), Lipocalin-2 (C) and Timp-1 (D) at 25 days (A and C) and 32 days (B and D) in rats treated with control (NaCl), placebo (adjuvant) or P28GST (at 5 μg/kg, with adjuvant). Statistical analyses were performed using a Mann Whitney test and were represented as follows: *p<0.05 and **p<0.01.

[0418] FIG. 7 represents histograms showing the concentration of Nitrite (A), Urea (B), Lipocalin-2 (C) and Timp-1 (D) at 25 days (A and C) and 32 days (B and D) in rats treated with control (NaCl), P28GST (at 5 μg/kg, with adjuvant) or anti-TNFα. Statistical analyses were performed using a Mann Whitney test and were represented as follows: *p<0.05 and **p<0.01.

EXAMPLES

[0419] The present invention is further illustrated by the following examples.

Example 1

[0420] Materials and Methods

[0421] Animals and Ethical Considerations

[0422] Four-week-old male BALB/C mice were purchased from Janvier Labs (Le Genest-Saint-Isle, France). The mice were maintained in pathogen-free animal holding facilities, controlled for clinical and behavioral signs of pain, and weighed daily. All experiments were approved by the local animal ethics committee and the Ministry of Higher Education, Research, and Innovation.

[0423] Immunizations and Induction of Skin Inflammation

[0424] Mice were immunized every 2 weeks with 3 subcutaneous injections of P28GST at 0.5 μg/kg. A week after the last injection of P28GST skin inflammation was induced by daily application of 62.5 mg imiquimod (Aldara®, 5%, MEDA Pharma S.A.) on shaved abdominal skin for 5 consecutive days as described previously (van der Fits et al., 2009). One group was treated with 50 mg betamethasone (Betneval 0.1% cream) directly on the injured skin, 5 hours after IMQ application. Mice were sacrificed by lethal anesthesia using pentobarbital (Dolethal®, Vetoquinol). Skin lesions were excised for histological analysis and real-time quantitative PCR analysis.

[0425] Chemicals and Reagents

[0426] Recombinant ShP28GST protein was expressed in cultured Saccharomyces cerevisiae and purified under Good Manufacturing Practice conditions by Eurogentec S.A (Seraing, Belgium). Batches of P28GST (batchM-BIX-P03-225a) were conserved by lyophilizing in 10 mM NH4HCO3 and 2.8% lactose. This preparation was re-suspended extemporaneously using 0.9% NaCl (Aguettant, Lyon, France) or 0.2% alhydrogel (Eurogentec S.A., Seraing, Belgium) at the appropriate concentrations.

[0427] ARN Extraction and RT-qPCR

[0428] Total RNA was extracted from skin using a nucleospin RNA kit (Macherey Nagel, Hoerdt, France) after being lysed with TRIzol (Thermo Fisher Scientific, Waltham, Mass.) in a Precellys homogenizer. The RNA concentration and purity were determined by the absorbance at 260 nm and 280 nm using a NanoDrop 1000 (Thermo Fisher Scientific, Waltham, Mass.). Retro-transcription was performed using the Superscript RT kit (Applied Biosystems, Foster City, Calif.) and 1 μg of RNA. Gene expression was evaluated by RT-qPCR using Fast SYBR Green Master Mix reagent on a StepOne instrument (Applied Biosystems, Foster City, Calif.) and normalized to β-actin. The following mice primers were used for IL-1β forward AGCTCTCCACCTCAATGGAC (SEQ ID NO: 9) and reverse AGGCCACAGGTATTTTGTCG (SEQ ID NO: 10), TNFα forward CCTGTAGCCCACGTCGTAG (SEQ ID NO: 11) and reverse GGGAGTAGACAAGGTACAACCC (SEQ ID NO: 12), β-actin forward CCTTCTTGGGTATGGAATCCT (SEQ ID NO: 13) and reverse CTTTACGGATGTCAACGTCAC (SEQ ID NO: 14), iNOS forward CAGCTGGGCTGTACAAACCTT (SEQ ID NO: 15) and reverse CATTGGAAGTGAAGCGTTTCA (SEQ ID NO: 16), Arg1 forward CAGAAGAATGGAAGAGTCAG (SEQ ID NO: 17) and reverse CAGATATGCAGGGAGTCACC (SEQ ID NO: 18). Results were expressed as relative expression compared to control using the 2-ΔΔCt method.

[0429] Clinical Score

[0430] The severity of inflammation was blindly evaluated each day using the Psoriasis Area and Severity Index (PASI) adapted to mice according to van der Fits. Three parameters (erythema, scaling and thickening) were scored from 0 to 4 (0: absent, 1: slightly, 2: moderate, 3: marked and 4: severe). The cumulative score (from 0 to 12) was used to evaluate skin inflammation.

[0431] Flow Cytometry

[0432] Spleen cells were extracted after sacrifice and maintained in culture medium after 70-μm filtration and red blood cell lysis. Cells were blocked in 2.4G2 (BD Bioscience) and viability assessed using fixable viability dye (eBioscience, Thermo Fisher Scientific, Waltham, Mass.). Cell surface immunostaining was performed, followed by intra-nuclear immunostaining after fixation and permeation using the true-nuclear factor kit (Ozyme, Saint-Cyr, France). Cells were analyzed on a Fortessa X20 (BD Biosciences, San Jose, Calif.) using the following antibodies fixable-viability dye (13539140), F4/80 (12-4801), CD206 (141729) and CD80 (15-0801) from eBiosciences and Biolegend. Data analysis was performed using FlowJo Software (Tree star, Ashland, Oreg.).

[0433] Statistical Analysis

[0434] Clinical scores were presented as mean±standard error of the mean and analyzed by two-way ANOVA+Bonferroni post-test. All other results were presented as medians. The Mann Whitney non parametric t-test was used to compare two groups and the Kruskal-Wallis+Dunn's post-test when more than two groups were compared. Each test was performed using an alpha level of 0.5%, and results were considered significant when p<0.05. Statistical analyses were performed in GraphPad Prism 5 (GraphPad Software, La Jolla, Calif.).

[0435] Results

[0436] The goal was to test the immunization process with P28GST in an experimental imiquimod-induced skin inflammation Balb/C mice model. Vasculitis being a systemic disease characterized by typical skin inflammation, this animal model is a suitable model of vasculitis. Mice received 3 subcutaneous injections of P28GST (0.5 μg/kg) with adjuvant (Alum) at days 1, 14 and 28. Then, imiquimod was applied into the skin of immunized mice daily during 5 days (FIG. 1). P28GST immunization reduced erythema, as shown by the Clinical score (FIG. 2). P28GST immunization also led to a decrease of the relative expression of the pro-inflammatory cytokines TNFα and IL-1β (FIG. 3). Interestingly, this was associated with a decrease of M1 pro-inflammatory macrophages (CD80+ and iNOS+) and an increase of M2 anti-inflammatory macrophages (CD206+ and Arginase+) in the spleen as well as an increase of the M2/M1 ratio in the skin (FIG. 4). These results showed the induction of M2 macrophages as well as a polarization towards a M2-type immune response. P28GST can thus modulate the inflammatory response in order to reduce skin inflammation, representing a new approach of prevention or treatment of patients suffering from a disease characterized by a M1/M2 macrophage ratio dysregulation, and patients with vasculitis including patients with Behçet's disease (BD).

Example 2

[0437] Materials and Methods

[0438] Vasculitis Induction

[0439] Lewis rats were immunized as described below, on Day 1, the Behçet-like disease (BD) was induced in the rats of the TPM-induced BD groups by injection in both hind foot pads with TPM in the presence of CFA (50 μg/rat; i.e. 25 μg in 50 μL per hind foot pad). The same day and on Day 3, the rats were intraperitoneally (IP) injected with 200 ng of Pertussis Toxin.

[0440] On Day 14, a bioluminescence acquisition was performed on rats in order to assess the development of the BD. As the TPM-induced BD model was not considered as confirmed, another bioluminescence acquisition was performed on Day 17. This last bioluminescence acquisition showed a sufficient systemic inflammation to begin the treatment test. Then, on Day 18, rats were treated with P28GST test item, adjuvant alone, anti-rat TNF-α or saline solution.

[0441] Study Design

[0442] Four groups were tested to evaluate the effect of P28GST (5 μg/kg) therapeutic treatment on symptoms evolution and tissues inflammation, when administered subcutaneously after systemic inflammatory disease induction in rodents. In the study design, different negative controls were used: mice with vasculitis induction and NaCl injection (Nacl), mice with vasculitis induction and injection of adjuvant (Placebo), two doses were injected at day 18 and day 25. Anti-TNFα, a reference drug in the treatment of various inflammatory-mediated autoimmune diseases was used as a positive control (FIG. 5). For anti-TNF treatment, four doses of 300 μg/rat were injected intraperitoneally at day 18, day 22, day 25 and day 29. P28GST (5 μg/kg) was injected at day 18 and day 25.

[0443] Samples

[0444] Whole blood (WB) was sampled once a week in order to assess the level of nitrite and urea and some systemic cytokines. About 1 mL per rat was sampled and deposited in Lithium/Heparin tubes. Tubes were mixed gently in order to ensure an optimal homogenization between blood and anticoagulant and then a centrifugation was performed at 2000 g for 5 minutes at room temperature. The supernatant (i.e. plasma) was split into two microcentrifuge tubes. One tube was stored at −20° C. until biochemical analysis (Nitrite and Urea measurement) and the other tube was stored at −80° C. until Cytokine analysis.

[0445] After euthanasia, eyes were harvested for TIMP-1 analysis. Eyes were sampled and then crushed in Reagent Diluent Concentrate 2 for protein extraction. The dosage of total proteins was performed with Pierce Coomassie assay kit (Thermo Fisher Scientific, Waltham, Mass.). Then, protein extracts were stored at −80° C. until Timp-1 ELISA analysis.

[0446] Biochemical Analysis

[0447] Nitrite: Nitrite concentration was measured by photometric (Griess Reagent) determination at 540 nm using the reagent Griess Reagent Kit for Nitrite Determination G-7921 provided by Thermo Fisher. The measuring range was 1-100 μM.

[0448] Urea (UREE): Urea concentration was measured by photometric determination at 520 nm using the reagent Urea 981820 provided by Thermo Fisher Diagnostics. The measuring range was 1.5-75.0 mmol/L, the detection limit (zero sample+3 SD) was 1.1 mmol/L and the within-run and between-run imprecisions range between 1.9% and 6.4%.

[0449] Lipocalin-2: The test kit was a solid phase enzyme immunometric assay (ELISA) in the microplate format, designed for the quantitative measurement of Rat Lipocalin-2.

[0450] The microplate was coated with a capture antibody. Then, calibrators and samples were added for 2 hours of incubation. During this incubation, endogenous Lipocalin-2 in the sample bound to the antibodies fixed on the inner surface of the wells. Non-reactive sample components were removed by a washing step. Afterwards, a biotinylated detection antibody was added. During a 2 hours incubation, a sandwich complex consisting of the two antibodies and the Lipocalin-2 was formed. Excess of detection antibody was washed out. Then, streptavidin conjugated to horseradish-peroxidase was added to complete the sandwich for 20 minutes of incubation. Excess of enzyme conjugate was washed out. Finally, a chromogenic substrate, TMB (3,3′,5,5′-Tetra-Methyl-Benzidine) was added to all wells. During 20 minutes of incubation, the substrate was converted to a colored end product (blue) by the fixed enzyme. Enzyme reaction was stopped by dispensing of hydrochloric acid as stop solution (change from blue to yellow). The color intensity was directly proportional to the concentration of Lipocalin-2 present in the sample. The optical density of the color solution was measured with a microplate reader at 450 nm.

[0451] TIMP-1: TIMP-1 level was determined by R&D Systems Luminex assays (R&D Systems, Bio-Techne, Lille, France). Measurement process were performed using the manufacturer instructions and the absorbance was read on a FLUOstar Omega (BMG labtech, Champigny-sur-Marne, France).

[0452] Results

[0453] Alpha-tropomyosin was identified as a 37-kDa antigen targeted by antibodies found in sera of patients with systemic autoimmune disease. Induction of pathogenic autoimmunity to α-tropomyosin was tested and confirmed in Lewis rats immunized with bovine α-tropomyosin in Complete Freund's Adjuvant (CFA). The immunized rats developed inflammatory lesions in the uveal tracts, joints and skin (Mor et al 2002 Eur. J. Immunol. 32:356-365). Thus, α-tropomyosin induces multiple symptoms and immune dysregulation closely correlated with those observed in patients with systemic inflammatory autoimmune diseases. The α-tropomyosin model was therefore used by the inventors as a model of vasculitis and of Behçet's disease.

[0454] In the experimental model, inflammation was observed as early as 14 days after the induction of the pathology in the eyes, joints and on the skin. It increased until it become widespread 21 days after induction (data not shown). The goal was to investigate the mechanisms involved by measuring inflammatory and regulatory mediators in the inflamed tissues of treated animals. Nitrite and urea concentration were assessed since Touri et al., 2018 showed that nitrite upregulation is associated with M1 macrophages activity and inflammation, while urea upregulation is associated with M2 macrophages activity and inflammation decrease.

[0455] Twenty-five days after disease induction and thus 7 days after treatment initiation, plasmatic nitrite concentration significantly differed between groups. In particular, there was a significant decrease (p=0.007) of nitrite in the P28GST group compared to placebo (FIG. 6A). Thirty-two days after disease induction and thus 14 days after treatment initiation, plasmatic urea concentration significantly differed between groups. A significant increase (p=0.0045) was observed in the P28GST group compared to placebo (FIG. 6B). These results both show evidences of a resolution of the systemic inflammation.

[0456] Lipocalin-2 (LCN2 aka NGAL) recently emerged as a useful biomarker of inflammatory-mediated autoimmune diseases. The plasmatic concentration of Lipocalin-2 was then assessed. First, a significant increase of Lipocalin-2 serum concentration was observed between D0 and D18 (treatment initiation) confirming the onset of inflammation in all groups (data not shown). However, a slight decline of LCN2 serum concentration appeared in the P28GST treated group at 25 days (FIG. 6C).

[0457] This decline in the LCN2 serum concentration of rats treated with P28GST suggests a weakening of the disease.

[0458] Tissue inhibitor of metalloproteinase-1 (TIMP-1) is involved in the control of inflammation in many inflammatory-mediated autoimmune diseases and in areas of critical function (i.e., eyes). Its upregulation decreases inflammation and then organ destruction. Thirty-two days after disease induction, corresponding to the end of the study and to 14 days after treatment initiation, protein extracts from eyes showed a significant increase in TIMP-1 in the P28GST treated group compared to the control group (NaCl) (FIG. 6D). This significant difference (* p=0.0490) indicates that P28GST induced a regulation of inflammation.

[0459] Altogether, these results strongly suggested a positive effect of P28GST in systemic inflammatory disease.

[0460] Finally, the P28GST effects were compared to the effects mediated by a standard of care which is the anti-TNFα treatment. Twenty-five days after disease induction and 7 days after treatment initiation, plasmatic nitrite concentration significantly differed between groups. There was a significant decrease in the P28GST treated group compared to control group (NaCl) (p=0.007). There was no significant difference between the anti-TNFα treated group and either the control group or the P28GST treated group (FIG. 7A). Thirty-two days after disease induction and 14 days after treatment initiation, plasmatic urea concentration significantly differed between groups. In particular, there was a significant increase (p=0.0045) in the P28GST treated group compared to control group (NaCl) and to the anti-TNFα treated groups (p=0.0067) (FIG. 7B). A significant increase of Lipocalin-2 serum concentration between D0 and D18 after disease induction confirms the onset of inflammation in all groups (data not shown). Twenty-five days after disease induction and 7 days after treatment initiation, a significant decline of LCN2 serum concentration only appeared in the P28GST treated group (p=0.0047) and not in the anti-TNFα treated group (FIG. 7C). Thirty-two days after disease induction and 14 days after treatment initiation, protein extracts from eyes showed a significant increase in TIMP-1 between the P28GST treated group and the control group (NaCl). This significant difference (p=0.049) indicates that P28GST induced a regulation of the inflammation, while anti-TNFα showed no such effect (FIG. 7D).

[0461] In conclusion, the results showed that P28GST may be better than anti-TNFα in treating systemic inflammatory diseases. Indeed, the anti-TNFα treatment induced no modification of the plasmatic urea concentrations, of the Timp-1 concentrations and of serum Lipocalin-2 concentrations, whereas the P28GST treatment did. The P28GST treatment thus induced a resolution of the systemic inflammation and weakened the symptoms of the disease.

[0462] Altogether, the results show that P28GST proteins from Schistosoma are capable of inducing M2-type immune response and/or reducing the M1-type immune response, i.e. of inducing a polarization towards a M2-type immune response. Indeed, the inventors showed that the P28GST proteins decreased the secretion of pro-inflammatory cytokines and mediators known to be produced by M1 macrophages, and increased the secretion of anti-inflammatory cytokines and mediators known to be produced by M2 macrophages. Moreover, this decrease in the M1-type response was associated to a reduction of the symptoms associated with inflammation.

[0463] In conclusion, P28GST proteins from Schistosoma can modulate the inflammatory response and represent a new approach for preventing or treating patients suffering from a disease characterized by a M1/M2 macrophage ratio dysregulation or patients with vasculitis.