1. Patent Search
  2. Details

METHODS FOR DIFFERENTIATING STEM CELLS INTO DOPAMINERGIC PROGENITOR CELLS

20230233617 · 2023-07-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to methods for differentiating stem cells into ventral midbrain dopaminergic progenitor cells, and into mesencephalic dopaminergic neurons, and compositions, kits, and uses thereof.

    Claims

    1. A method for differentiating stem cells into ventral midbrain dopaminergic progenitor cells, the method comprising contacting a plurality of stem cells with an effective amount of at least one activator of retinoic acid (RA) signalling, and culturing the stem cells under conditions sufficient to cause differentiation of the stem cells into a cell population comprising ventral midbrain dopaminergic progenitor cells.

    2. The method of claim 1, wherein the at least one activator of retinoic acid (RA) signalling is effective to specify ventral midbrain identity to neural stem cells

    3. The method of claim 1, wherein the ventral midbrain dopaminergic progenitor cells express forkhead box protein A2 (FOXA2) and LEVI homeobox transcription factor 1 alpha (LMX1A).

    4. The method of claim 1, wherein the cell population comprises at least about 50%, at least about 60%, at least about 70%, or at least about 80% ventral midbrain dopaminergic progenitor cells.

    5. The method of claim 1, wherein the cell population comprises at least about 50%, at least about 60%, at least about 70%, or at least about 80% ventral midbrain dopaminergic progenitor cells at least after 7 days, such as 9-16 days, such as about 14 days, after first contacting said cell population with the at least one activator of Retinoic Acid (RA) signalling.

    6. The method of claim 1, wherein the method is an in vitro method.

    7. The method of claim 1, wherein the plurality of stem cell is selected from the group comprising: pluripotent stem cells; multipotent stem cells; non-embryonic stem cells such as adult stem cells (ASCs); and wherein the plurality of stem cells are derived from human, optionally wherein the human is a patient with a symptom of a neurological disorder; rodent; or primate.

    8. The method of claim 1, wherein culturing the stem cells under conditions sufficient to cause differentiation of the stem cells into a cell population comprising ventral midbrain dopaminergic progenitor cells comprises contacting the stem cells with at least one activator of the Hedgehog (Hh) signalling.

    9. The method of claim 1, wherein the at least one activator of the Hedgehog (Hh) signalling is selected from the group comprising: Sonic Hedgehog (SHH), Indian hedgehog (IHH), Desert hedgehog (DHH), purmorphamine, Smoothened agonists (SAGs) such as SAG 1.3 (Hh-1.3), Hh-1.2, Hh-1.4, Hh-1.5, and combinations thereof.

    10. The method of claim 1, wherein culturing the stem cells under conditions sufficient to cause differentiation of the stem cells into a cell population comprising ventral midbrain dopaminergic progenitor cells comprises contacting the stem cells with at least one inhibitor of TGFβ/Activin-Nodal signalling and at least one inhibitor of bone morphogenetic protein (BMP) signalling.

    11. The method of claim 10, wherein said at least one inhibitor of TGFβ/Activin-Nodal signaling is selected from the group comprising SB 431542 and SB-505124.

    12. The method of claim 11, wherein said at least one inhibitor of BMP signalling is selected from the group comprising DMH-1; LDN-193189; and Noggin.

    13. The method of claim 1, wherein the stem cells are contacted with the activator of retinoic acid (RA) signalling for about 1-4 days, optionally about 1-3 days.

    14. The method of claim 13, wherein the at least one activator of retinoic acid (RA) signalling is not present at an effective amount after contacting the plurality of stem cells for about 1-4 days, optionally about 1-3 days.

    15. The method claim 8, wherein the stem cells are contacted with the at least one activator of Hedgehog (Hh) signalling, the at least one inhibitor of TGFβ/Activin-Nodal signalling, and the at least one inhibitor of bone morphogenetic protein (BMP) signalling simultaneously with the at least one activator of retinoic acid (RA) signalling.

    16. The method of claim 8, wherein the stem cells are contacted with the at least one activator of Hedgehog (Hh) signalling, the at least one inhibitor of TGFβ/Activin-Nodal signalling, and the at least one inhibitor of bone morphogenetic protein (BMP) signalling prior to being contacted with the at least one activator of retinoic acid (RA) signalling.

    17. The method of claim 1, wherein the method does not comprise contacting the plurality of stem cells with an activator of wingless (Wnt) signalling simultaneously with the at least one activator of retinoic acid (RA) signalling.

    18. The method of claim 1, wherein the method does not comprise contacting the plurality of stem cells with an activator of fibroblast growth factor (FGF) family signalling simultaneously with the at least one activator of retinoic acid (RA) signalling.

    19. The method of claim 1, wherein the at least one activator of Retinoic Acid (RA) signalling is selected from the group comprising: a retinoic acid analogue; a RARα agonist; a RARβ agonist; a RARγ agonist; and an RXR agonist.

    20. The method of claim 1, wherein the at least one activator of Retinoic Acid (RA) signalling is selected from the group comprising: retinoic acid, all-trans retinoic acid (ATRA); AM 580; TTNPB; Ch 55; CD437; BMS 961; BMS 753; AM 80; CD 2314; AC 261066; AC 55649; CD 1530; Adapalene; Tazarotenic Acid; Tazarotene; EC 19; EC23; or a functional analogue, isomer, metabolite, or derivative thereof.

    21. The method of claim 1, wherein the at least one activator of Retinoic Acid (RA) signalling is selected from the group comprising: retinoic acid; and all-trans retinoic acid (ATRA), such as 9-cis RA and 13-cis RA, and Tazarotenic acid.

    22. The method of claim 1, wherein the at least one activator of Retinoic Acid (RA) signalling is derived from an exogenous source.

    23. The method of claim 1, wherein culturing the stem cells under conditions sufficient to cause differentiation of said stem cells to produce a cell population comprising ventral midbrain dopaminergic progenitor cells takes place in a two-dimensional and/or three-dimensional cell culture.

    24. The method of claim 1, wherein the cell population comprises a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells.

    25. The method of claim 1, further comprising differentiating the population comprising ventral midbrain dopaminergic progenitor cells into mesencephalic dopaminergic neurons.

    26. The method of claim 25, wherein the mesencephalic dopaminergic neurons express one or more of forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1 alpha (LMX1A), LIM homeobox transcription factor 1 beta (LMX1B), Orthodenticle homeobox 2 (OTX2), Nuclear receptor related 1 (NURR1); Paired Like Homeodomain 3 (PITX3), GIRK2, vesicular monoamine transporter (VMAT2), synaptophysin, and Tyrosine hydroxylase (TH).

    27. The method of claim 25, wherein the population comprising differentiated mesencephalic dopaminergic neurons is obtainable within about 30-40 days after first contacting the plurality of stem cells with the at least one activator of Retinoic Acid (RA) signalling.

    28. The method of claim 25, wherein within about 30-40 days after first contacting the plurality of stem cells with the at least one activator of Retinoic Acid (RA) signalling, the total neuronal cell population comprises at least 70%, such as at least 80%, or at least 90% mesencephalic dopaminergic neurons.

    29. A method of screening for a candidate drug comprising (a) providing a population of ventral midbrain dopaminergic progenitor cells obtainable or obtained by claim 1, or providing a population of differentiated mesencephalic dopaminergic neurons obtainable or obtained by claim 25 (b) contacting the population with a candidate drug; and (c) determining the effect of the candidate drug on the cell population.

    30. A method for providing an enriched population of: i. ventral midbrain dopaminergic progenitor cells, wherein the method comprises carrying out the method as defined in any of claim 1; or ii. differentiated midbrain dopaminergic (DA) neurons, wherein the method comprises carrying out the method as defined in claim 25.

    31. A neuronal cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells obtained or obtainable by a method according to claim 1, optionally wherein at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, or at least 80% of the cell population are ventral midbrain dopaminergic progenitor cells.

    32. The neuronal cell population of claim 31, wherein at least about 80% of the cell population express forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1 alpha (LMX1A), LIM homeobox transcription factor 1 beta (LMX1B) and Orthodenticle homeobox 2 (OTX2).

    33. A differentiated cell population comprising a therapeutically effective amount of mesencephalic dopaminergic neurons obtained or obtainable by a method according to claim 25, optionally wherein at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, or at least 80% of the total cells are mesencephalic dopaminergic neurons.

    34. Use of at least one activator of Retinoic Acid (RA) signalling for differentiating stem cells into ventral midbrain dopaminergic progenitor cells.

    35. The use of claim 34, wherein differentiating stem cells into ventral midbrain dopaminergic progenitor cells is as defined in claim 1.

    36. An isolated cell population, comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells.

    37. The isolated cell population of claim 36, wherein at least about 80% of the cell population express forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1 alpha (LMX1A), LIM homeobox transcription factor 1 beta (LMX1B) and Orthodenticle homeobox 2 (OTX2).

    38. A pharmaceutical composition comprising a cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells of claim 36, and/or obtained or obtainable by the method of claim 1, for use in medicine.

    39. The pharmaceutical composition of claim 38, further comprising a pharmaceutically acceptable carrier, diluent and/or excipient.

    40. The pharmaceutical composition of claim 38, formulated for transplantation.

    41. A kit for differentiating a plurality of stem cells into ventral midbrain dopaminergic progenitor cells or into mesencephalic dopaminergic neurons in vitro, comprising: at least one activator Retinoic Acid (RA) signalling; at least one activator of Sonic Hedgehog (SHH) signalling; at least one inhibitor of TGFβ/Activin-Nodal signalling; and/or at least one inhibitor of bone morphogenetic protein (BMP) signalling.

    42. The kit of claim 41, wherein the kit further comprises a plurality of markers of ventral midbrain dopaminergic progenitor cells or mesencephalic dopaminergic neurons.

    43. A kit comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells obtained or obtainable by the method of claim 1 and one or more dopaminergic neuron lineage specific activators and/or inhibitors.

    44. A cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells of claim 36, and/or obtained or obtainable by the method of claim 1, for use in medicine.

    45. A cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells of claim 36, and/or obtained or obtainable by the method of claim 1, for use in treating or preventing neurodegeneration in a subject and/or a disease and/or condition characterized by the loss of midbrain dopaminergic neurons in a subject.

    46. A method for treating or preventing neurodegeneration in a subject and/or a disease and/or condition characterized by the loss of midbrain dopaminergic neurons in a subject, comprising administering to the subject a cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells of claim 36, and/or obtained or obtainable by the method of claim 1, in an amount effective to treat or prevent the neurodegeneration in the subject and/or a disease and/or condition characterized by the loss of midbrain dopaminergic neurons in a subject.

    47. Use of a cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells of claim 36, and/or obtained or obtainable by the method of claim 1, for the manufacture of a medicament for treating or preventing neurodegeneration in a subject and/or a disease and/or condition characterized by the loss of midbrain dopaminergic neurons in a subject.

    48. The cell population for use of claim 44, wherein the subject exhibits at least one neurological symptom, wherein the neurological symptom is selected from the group comprising of: resting tremor, rigidity, bradykinesia (slow movement), and postural instability and/or impaired balance and coordination.

    49. The cell population for use, method, or use of claim 48, wherein said subject shows a reduction of at least one of said neurological symptom.

    50. The cell population for use of claim 44 wherein the population comprising ventral midbrain dopaminergic progenitor cells is administered by transplantation to a subject under conditions that allow in vivo engraftment of the population of cells.

    51. A cell population comprising a therapeutically effective amount of ventral midbrain dopaminergic progenitor cells of claim 36, for use in transplanting into a subject in need thereof.

    52. The cell population for use of any of claim 44, wherein the subject has or is at risk of a neurodegenerative disease selected from the group comprising: Parkinson's disease, Parkinsonism syndrome, Alzheimer's disease, stroke, amyotrophic lateral sclerosis, Binswanger's disease, Huntington's chorea, multiple sclerosis, myasthenia gravis and Pick's disease.

    53. A method of differentiating, a population for use, use of a population, a method of treating, or a kit substantially as described herein, with reference to the accompanying description, examples and drawings.

    Description

    [0293] FIG. 1: A two-day RA-pulse results in a rapid induction of NSCs expressing a MB-like identity. (a) Schematic of hPSCs differentiation with timeline of treatment with dSMADi and RA. (b) Immunocytochemistry of ESC and 3-day cultures differentiated in dual SMAD inhibitors (dSMADi) or in dSMADi with a two-day RA-pulse (RA.sup.2D) for the pluripotency marker OCT4 and the neuronal markers SOX1 and PAX6. (c) Density plot of single cell expression of SOX1 and OCT4 in dSMADi or dSMADi with a RA.sup.2D pulse at indicated days in differentiation conditions (DDC). (d) Immunocytochemistry for neural progenitor markers NES and SOX1 and bright-field (BF) images of cultures at 7 DDC differentiated in the indicated conditions. (e) Changes in expression of genes associated with pluripotency or neuroectodermal fate in dSMADi+RA.sup.2D-pulsed cultures at 2 DDC relative to ESCs. (f) Western blot for OCT4 and SOX1 of ESC and 3 DDC cultures grown in dSMADi-conditions and treated with indicated concentrations of RA for 2 days. (g) Western blot for OCT4 and SOX1 of ESC and 3 DDC cultures grown in indicated differentiation conditions. (h) Immunocytochemistry for the markers identifying forebrain (FOXG1), forebrain and midbrain (OTX2), hindbrain (HOXA2), and caudal hindbrain (HOXB4) regions in 9 DDC cultures differentiated in dSMADi conditions and treated with a RA-pulse as indicated. (i) Summary of the effects of RA-pulse duration on NSC's regional identity.

    [0294] A.U., arbitrary units. FB, forebrain. MB, midbrain. HB, hindbrain.

    [0295] FIG. 2: Specification of NSC with ventral midbrain identity using RA and SHH signaling. (a) Schematic of hPSCs differentiation with timeline of treatment with RA and activator of SHH signaling (SAG) (top). All cultures were differentiated in dSMADi conditions as indicated in FIG. 1a. Immunocytochemistry for indicated markers at 9 DDC in cultures differentiated in dSMADi+SAG-condition and pulsed with RA for 1-, 2- or 4-days (bottom). (b) Relative gene expression (FPKM) of indicated genes in 9 DDC cultures differentiated in dSMADi+SAG-conditions and treated with RA for the indicated time. (c) Heatmap and hierarchical clustering of differentially expressed genes of 9 DDC cultures differentiated in dSMADi+SAG-condition and treated with RA for the indicated time. (d) Schematic of gene expression profiles defining distinct ventral progenitors in the diencephalon (Di), midbrain (MB) and hindbrain (HB) positions. (e) Expression of genes associated with the indicated regional progenitors at 14 DDC in cultures differentiated in dSMADi+SAG+RA.sup.2D condition. (f) Immunocytochemistry for β-CATENIN (left) and boxplots of β-CATENIN nuclear levels (right) in cultures at 2 DDC differentiated in dSMADi+SAG-condition (control) and treated with RA or CHIR99021. Boxplot, whiskers define 5.sup.th and 95.sup.th percentile. Asterisks, Student t test; **p<0.01, ***p<0.001. (g) Immunocytochemistry for the indicated markers in cultures at 14 DDC differentiated in dSMADi+SAG+RA.sup.2D condition.

    [0296] FIG. 3: A RA-CYP26 regulatory loop is central for robust RA-mediated patterning response. (a-c) Effect of changes in RA (a) or CHIR99221 (b) concentration on the expression of markers defining ventral forebrain (NKX2.1+LMX1A+), midbrain (NKX2.1.sup.−LMX1A.sup.+) or hindbrain (NKX2.2.sup.+) in 9 DDC cultures differentiated in dSMADi+SAG− condition, and corresponding quantification of NKX2.1.sup.+LMX1A.sup.+ and NKX2.1.sup.−LMX1A.sup.+ populations (c). (d) Effect of RA concentration (50, 100, 300, 500 and 1,000 nM RA) on CYP26A1 expression in 1 DDC cultures differentiated in dSMADi-condition. (e) Temporal expression profile of CYP26A1 in cultures differentiated in dSMADi and pulsed with no RA or 300, 500 or 1,000 nM of RA for 2 days. (f) Effect of inhibition of CYP26 activity with 500 nM of the inhibitor R115866 on the expression of NKX2.1, LMX1A and PHOX2B at 9 DDC in cultures differentiated in SAG and the indicated RA conditions. (g) Relative gene expression of indicated genes in 9 DDC cultures differentiated in RA.sup.1D+SAG condition and in the presence of different concentrations of the CYP26 inhibitor R115866. (h,i) Immunocytochemistry of NKX2.1, LMX1A and PHOX2B at 9 DDC in cultures differentiated in dSMADi plus the indicated conditions and in the presence or absence of 500 nM of inhibitor R115866. (j) Schematic summary of the regulatory interactions between RA and CYP26A1. (c-e) values, mean±S.D.

    [0297] FIG. 4: Fast generation of functional dopaminergic neurons in in vitro cultures. (a-m) Analysis of cultures differentiated in dSMADi+RA.sup.2D+SAG (a,b,e-m) or in dSMADi+SAG and indicated RA, CHIR99021 or CHIR99021+FGF8 condition (c,d). (a) Expression level changes of genes associated with floorplate identity and neurogenesis between 14 and 21 DDC cultures. (b) LMX1A and SHH immunocytochemistry in 14 and 21 DDC cultures. (c) Immunocytochemistry of neuronal marker HuCD at 17 DDC and dopaminergic neuron marker TH at 21 DDC in cultures differentiated in indicated conditions. (d) Quantification of HuCD.sup.+ neurons in differentiating cultures at 14, 17 and 21 DDC in indicated conditions. (e-g) Immunocytochemistry of indicated markers at 33 DDC (e,f) and 45 DDC (g). (h) Violin plot of neurite length and quantification of complexity in 30 and 40 DDC TH.sup.+ neurons. n=40; number of branches are represented as mean±SEM. (i) Immunocytochemistry of indicated markers in 35-40 DDC cultures. (j) Quantification of dopaminergic (TH.sup.+), GABAergic (GABA.sup.+), motor (PRPH.sup.+) and serotonergic (5-HT.sup.+) neurons in 35 DDC cultures. (k) HPLC detection of noradrenaline (NA), dopamine (DA) and serotonin (5-HT) in supernatant of 42 DDC cultures. (l) Quantification of dopamine levels in media of 42 DDC cultures in control or after KCL induced dopamine release, and in total cell lysate. Values, mean±S.D., Asterisks, Student t test, ***p<0.001. (m) Cell attached recording, showing spontaneous action potentials (top) and isolated spontaneous action potentials from cells at 40 or 45 DDC cultures (bottom). (n) Immunocytochemistry on Biocytin labelled neuron for TH at 40 DDC (top) and evoked spike train in 40 DDC neuron (bottom). (o) Schematic summary of differentiation conditions and processes timeline during dopaminergic neuron differentiation.

    [0298] FIG. 5: RA-specified vMB preparations differentiate into functional dopaminergic neurons and restore motor deficits after transplantation into a rat model of PD. (a-h) Immunohistological analysis of unilaterally 6-OHDA lesioned rats seven months after grafting of vMB preparations (150.000 cells) into the striatum. (a) TH expression in striatum and substantia nigra (SN). Note TH immuno-reactivity throughout the striatum and lack of TH expression in the SN on the lesioned side (right). (b-g) Immunohistochemistry of indicated markers in grafts. (h) Quantification of net rotations per minute in rats with baseline amphetamine-induced rotation scores ≥5 ipsilateral turns per minute (n=5). (i) Rotational behavior over time after administration of amphetamine before (solid lines) and after grafting (dashed lines) of all grafted animals (n=9). (j) Preference for contralateral paw use after lesion and seven months after transplantation.

    [0299] FIG. 6: Sequential treatment with RA and CHIR99021 results in the specification of caudal midbrain identity. (a) (a) Immunocytochemical analysis of ventral MB progenitor identities at 14 DDC. Cells differentiated in RA.sup.2D+SAG condition express midbrain markers LMX1A and OTX2 but not caudal midbrain marker EN1. Additional treatment of cells differentiated in RA.sup.2D+SAG condition with 5 μM CHIR99021 between 4-9 DDC induces EN1 in LMX1A+OTX2+ cells. Nuclei of cells visualized with DAPI staining. (b) Immunocytochemistry of dopaminergic neuron marker TH and caudal midbrain marker EN1 expression in 40 DDC cultures differentiated in indicated conditions. Many TH neurons treated with 5 μM CHI R99021 (4-9 DDC) express caudal midbrain marker EN1.

    [0300] FIG. 7 (Supplementary FIG. 1):

    [0301] (a) Immunocytochemistry of 4-day and 2-day cultures differentiated in dSMADi or in dSMADi+RA.sup.2D for the pluripotency marker OCT4 and the neuronal markers SOX1 and PAX6. Yellow arrows (left side panel) indicate OCT4.sup.+/SOX1.sup.+ cells. Boxplot of PAX6 nuclear level (right) in 3 DDC cultures differentiated in dSMADi or dSMADi+RA.sup.2D. Whiskers define 5.sup.th and 95.sup.th percentile. (b) Expression of genes associated with neuroectodermal, endodermal and mesodermal lineages differentiated in dSMADi+RA.sup.2D condition for 2 days. (c) Western blot for OCT4 and SOX1 of 3 DDC cultures differentiated in indicated conditions. (d) Q-PCR for the markers identifying forebrain (FOXG1, SIX3), forebrain and midbrain (OTX2) regions in 9 DDC cultures differentiated in dSMADi conditions and treated with indicated RA-pulse.

    [0302] FIG. 8 (Supplementary FIG. 2):

    [0303] (a) Principal component analysis of 9 DDC cultures differentiated in dSMADi+SAG-condition and pulsed with RA from 0 DDC for 0 (RA.sup.0D), 1 (RA.sup.1D), 2 (RA.sup.2D) or 4 (RA.sup.4D) days.

    [0304] (b) Immunocytochemistry for NKX2.1, LMX1A and PHOX2B or NKX2.2 and PHOX2B in 9 DDC cultures. Cells were differentiated in dSMADi+SAG conditions only (no RA+SAG) or together with a 2-day RA pulse (RA.sup.2D+SAG) applied at different times during differentiation (0-2, 1-3, 2-4, 3-5 or 4-6 days in differentiation conditions-DDC). (c) Schematic of hESC differentiation (in dSMADi-condition) with timeline of addition of SAG to cultures (top). Immunofluorescence for LMX1A, NKX2.2 and FOXA2 (middle) and western blot for LMX1A, NKX2.2 and FOXA2 (bottom) in 9 DDC cultures treated with SAG from day 0, 1 or 2. (d) Immunofluorescence for LMX1A and FOXA2 (top) and western blot for LMX1A, FOXA2 and PAX3 (bottom) in 9 DDC cultures differentiated in dSMADi-conditions and treated from day 0 with different concentrations of SAG. (e,f) Differentiation of the hESCs lines 980 and 401, and the hiPSCs lines SM55 and SM56 in dSMADi+RA.sup.2D+SAG.sup.0DDC, and immunocytochemistry for the progenitor markers LMX1A, FOXA2, OTX2, Nkx2.1 and NKX6.1 in 9-day differentiating cultures (e), and for TH, FOXA2, and MAP2 in 30 DDC cultures (f).

    [0305] FIG. 9 (Supplementary FIG. 3):

    [0306] (a) Analysis of the expression of NKX2.1, LMX1A and PHOX2B in 9 DDC cultures differentiated in dSMADi+SAG.sup.0DDC condition and pulsed with RA for 1 day or EC23 for 2 days in the presence or absence of inhibitor R115866. (b) Analysis of the expression of NKX2.1, LMX1A and PHOX2B in 9 DDC cultures differentiated in dSMADi+SAG.sup.0DDC condition and pulsed with the all-trans-RA-analogues tazarotenic (TA), 13-cis-RA and 9-cis-RA for 2 days at different concentrations (10, 100, 500 and 1000 nM). (c) Analysis of the expression of NKX2.1, LMX1A and PHOX2B in 9 DDC cultures differentiated in dSMADi+SAG.sup.0DDC condition and pulsed with EC23 at the indicated concentrations for 1 or 2 days.

    [0307] FIG. 10 (Supplementary FIG. 4):

    [0308] (a) RNA-seq data showing expression levels of floor plate genes between 9-21 DDC in cultures differentiated in dSMADi+RA.sup.2D+SAG condition. (b) Immunocytochemistry for neuronal marker Tuj1 in 12 DDC culture differentiated in dSMADi+RA.sup.2D+SAG condition. Nuclei visualized with DAPI. (c) TH, EN1, and GABA immunocytochemistry in 40 DDC culture. (d) Mean sodium currents of cells that showed a sodium current (whiskers cover the extend of all data points, red plus is an outlier, n=57 cells). Pie charts denote the percentage of patched cells that show a sodium current (yellow) and the percentage of cells that show no activity.

    [0309] FIG. 11 (Supplementary FIG. 5):

    [0310] (a) Schematic of the timeline of transplantation assay and analysis in 6-OHDA lesioned rats. (b) Immunohistological analysis of the expression of the human marker (HuNu) and dopaminergic neuron marker (TH) in grafts of all transplanted rats. (c) DAB staining of graft-derived TH.sup.+ neurons innervating the surrounding dorsolateral striatum (dISTR).

    EXAMPLE 1: A NOVEL RETINOIC ACID-BASED METHOD FOR RAPID AND ROBUST DERIVATION OF TRANSPLANTABLE DOPAMINE NEURONS FROM HUMAN PLURIPOTENT STEM CELLS

    [0311] Significant progress has been made in directing the differentiation of human pluripotent stem cells (hPSCs) into mesencephalic dopamine (mDA) neurons for cell replacement therapy or disease modeling in Parkinson's disease (PD), but there is a continuous incentive to increase the robustness, efficiency and speed of differentiation procedures. In this study, we outline a novel retinoic acid (RA)-based method for robust and fast derivation of human mDA neurons at a high yield. The duration of RA exposure is a key determinant for a switch-like conversion of hPSCs into neural stem cells expressing a mesencephalic identity. Unlike the GSK3β inhibitor CHIR99021 commonly used to specify mesencephalic fate, the patterning response of cells to RA is remarkably tolerant to altered RA levels. Combinatorial activation of RA- and SHH signaling induces mDA neuron progenitors that initiate neurogenesis at an early time and at a high pace, and mDA neurons exhibiting functional features are attained within 40 days of culture. When transplanted into an animal model of PD, RA-specified progenitors matured into functional DA neurons that relieved motor deficits. This study provides a new approach to produce human mDA neurons that should facilitate disease modeling and drug development in vitro, and that may provide an alternative route for the generation of cells to use for cell replacement therapy of PD.

    [0312] Introduction

    [0313] Human pluripotent stem cells (hPSCs) in the form of embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs) provide a scalable cellular source for the production of specific subtypes of neurons that can be utilized for high-throughput drug development, disease modeling or cell replacement therapy in neurodegenerative disorders.sup.1,2. While this field is progressing rapidly, the extended time required to produce functional human neurons via stem cell differentiation in vitro provides a challenge to experimental studies and some biomedical applications.sup.3. Mesencephalic dopamine (mDA) neurons in the ventral midbrain (vMB) are of a particular interest to study due to their selective degeneration on Parkinson's disease (PD) and the potential to restore lost dopamine neurotransmission and reverse motor deficits by cell replacement therapy.sup.4.

    [0314] Protocols for derivation of mDA neurons from hPSCs have been progressively improved, and have now, after extensive evaluation in pre-clinical grafting experiments, reached the point of clinical trials using allogeneic ESCs or autologous iPSCs as starting material.sup.2. In these studies and trials, cells are transplanted as immature precursors that terminally differentiate and functionally mature in vivo over several months. Thus, although mature and functional DA neurons can be generated after transplantation, the slow differentiation and maturation of human mDA neurons also in in vitro cultures presents a challenge for the establishment of cellular platforms for disease modeling or drug development in vitro. While the yield of mDA neurons in culture has increased, the time required to obtain mature mDA neurons has remained essentially constant since the first hPSC-based protocol was described in 2004.sup.5. It takes ˜60 days to generate human mDA neurons exhibiting mature electrophysiological characteristics in culture.sup.6,7 which could reflect the minimal time required for cells to acquire mature functional features. However, single cell analyses suggest slower kinetics and less tightly controlled developmental progression of hPSC-derived mDA neurons relative to their in vivo counterparts.sup.8, raising the possibility that current methods have not yet been fully optimized regarding the timing of differentiation.

    [0315] There is also a continuous need to further enhance the robustness of differentiation procedures in order to increase consistency between lines and to minimize batch-to-batch variability.sup.9. This is particularly important if working with multiple iPSC-lines in disease modeling or drug development efforts, or if considering clinical application of patient-specific autologous iPSC-lines or large numbers of human leukocyte antigen (HLA) matched donor iPSCs which may be favorable over allogeneic ESC-lines from an immunological perspective.sup.10,11. In vitro derivation of mDA neurons is a multistep process in which timed activation and/or deactivation of developmental signaling pathways is used to direct the differentiation of hPSCs into progenitors with a vMB regional identity, which can differentiate into functionally mature mDA neurons in culture or after transplantation into animal models of PD.sup.1,12,13. Inhibition of BMP and TGFβ signaling by a method termed dual SMAD inhibition (dSMADi) is deployed to promote a generic neural fate by preventing hPSCs from selecting alternative somatic or extraembryonic fate options.sup.14. In the absence of patterning signals NSCs acquire a cortical forebrain (FB) fate by default. Current mDA neuron protocols utilize timed activation of WNT signaling, or of WNT and FGF signaling, to specify midbrain (MB) character by mimicking the patterning activity of WNT1 and FGF8b produced by the isthmic organizer at the boundary between the MB and hindbrain (HB).sup.15. Sonic hedgehog (SHH) signaling, in turn, is applied to ventralize cells and induce a LMX1A.sup.+/FOXA2.sup.+/OTX2.sup.+ vMB identity characteristic of mDA neuron progenitors.sup.12,13. The glycogen synthase kinase 3β(GSK3β) inhibitor CHIR99021 is applied to activate the WNT pathway. The specification of anteroposterior (AP) identity by CHIR99021 is very precise and the patterning effect is concentration-sensitive, meaning that increased CHIR99021 leads to progressively more caudal fates.sup.16. Different cell lines respond differently to the concentration applied, which necessitates careful titrations for individual hPSC-lines.sup.9. As such, the development of differentiation paradigms that sidestep the reliance on precise CHIR99021 concentration to specify midbrain fate could potentially increase robustness and reduce the need for batch-to-batch adjustments. Additionally, albeit the task of generating mDA neurons can be achieved, high concentrations of CHIR99021 inhibit a broad array of kinases in addition to GSK3β.sup.17, providing another motive to consider differentiation strategies that circumvent the use of CH IR99021.sup.18.

    [0316] The isthmic organizer is a secondary signaling center established after the regionalization of the rostral neural plate into brain territories has been initiated.sup.19. Early brain patterning must consequently involve signals operating upstream of WNT1 and FGF8b, and several observations implicate that the vitamin A-derivative Retinoic Acid (RA) may contribute to this process. The role of RA in patterning of the HB and spinal cord is well-established.sup.15 and it is generally assumed that RA signaling is incompatible with derivation of neurons with a more rostral origin in the CNS. RA or vitamin A is therefore actively excluded in many hPSC-based mDA neuron protocols.sup.9. However, surprisingly in this study, we show that a 48-hour RA pulse in combination with activation of SHH signaling is sufficient to specify hPSC-derived vMB progenitors that rapidly differentiate into functional mDA neurons in vitro, and which engraft and restore motor deficits after transplantation into a rat model of PD.

    [0317] Results

    [0318] A 48-Hour RA-Pulse Promotes Rapid Conversion of hPSCs into NSCs Expressing a Midbrain-Like Identity

    [0319] To explore the activities of RA on hESCs directed to adopt a neural fate in response to dSMADi.sup.14, we treated cultures with 200 nM all-trans RA for the first 1, 2, 3 or 4 days of differentiation (RA.sup.1D, RA.sup.2D, RA.sup.3D, RA.sup.4D) (FIG. 1a) and monitored fate and identity of cells at different stages by immunoblotting, quantitative immunocytochemistry, qPCR or RNA-sequencing (RNA-seq). Consistent with previous studies.sup.14, analyses of the pluripotency marker OCT4 and neural-specific markers SOX1 and PAX6 revealed that cells grown in dSMADi-only conditions underwent a progressive transition from a OCT4.sup.+/SOX1.sup.−/PAX6.sup.− pluripotency state into a OCT4.sup.−/SOX1.sup.+/PAX6.sup.+ naïve NSC-state. OCT4 was gradually downregulated and approached undetectable levels by 5 days in differentiation condition (DDC), as revealed by quantitative immunocytochemistry (FIG. 1c). Induction of SOX1 and PAX6 at low levels occurred at 3 DDC (FIG. 1b). OCT4 and SOX1 were co-expressed by cells between 3-4 DDC (FIG. 1b, c; FIG. 7a (Supplementary FIG. 1a)) showing that the conversion of hPSCs into NSCs in response to dSMADi-treatment encompass a protracted time-window over which expression of pluripotency- and neural-specific genes overlap. In contrast, in cultures treated with dSMADi and 200 nM RA for two days or longer (dSMADi+RA.sup.2D, 3D)(FIG. 1a), induction of SOX1 and PAX6 was observed at 2 DDC (FIG. 7a (Supplementary FIG. 1a)) and expression of OCT4 had essentially been extinguished by 3 DDC (FIG. 1b, c, f; FIG. 7a (Supplementary FIG. 1a)). Expression levels of SOX1 and PAX6 in nuclei at 3-4 DDC were also notably higher in dSMADi+RA.sup.2D-cultures relative to dSMADi-only cultures (FIG. 1b, c; FIG. 7a (Supplementary FIG. 1a)). By 7 DDC, SOX1 and neural marker NESTIN were expressed at similar levels in dSMADi-only and in dSMADi+RA.sup.2D cultures (FIG. 1d). RNA-seq analysis of dSMADi+RA.sup.2D-cultures at 2 DDC suggested an overall downregulation of pluripotency genes and upregulation of neural lineage-specific genes (FIG. 1e). Endodermal or mesodermal lineage markers were not expressed (FIG. 7b (Supplementary FIG. 1b)). In dSMADi+RA.sup.2D conditions, prompt suppression of OCT4 and fast upregulation of SOX1 was attained within a concentration range of RA between 50-500 nM (FIG. 1g). Treatment of cells with 200 nM RA for one day (dSMADi+RA.sup.1D) was not sufficient to promote rapid OCT4 suppression nor fast upregulation of SOX1 (FIG. 1f), nor was treatment of cells only with RA (without dSMADi) (FIG. 7c (Supplementary FIG. 1c)). Thus, combining dSMADi treatment with exposure of hPSCs to RA for 48 hours or longer promotes a rapid and switch-like transition from pluripotency into a NSC-state.

    [0320] To determine the regional identity of hPSC-derived NSCs exposed to RA for different timeframes, we analyzed cultures at 9 DDC for the expression of transcription factors whose expression alone or in combination distinguishes between FB, MB, or HB regional identities. dSMADi treatment was included in all following experiments and will not be further highlighted when describing experimental setups. As anticipated, in hPSC-cultures not exposed to RA (RA.sup.0D), NSCs acquired a FOXG1.sup.+/OTX2.sup.+/HOXA2.sup.− FB-like identity (FIG. 1h). A similar FB-like character was observed in RAID cultures, though the number of FOXG1.sup.+ cells was somewhat reduced (FIG. 1h; FIG. 7d (Supplementary FIG. 1d)). Interestingly, in RA.sup.2D cultures, FB markers were suppressed and NSCs instead expressed a FOXG1.sup.−/OTX2.sup.+/HOXA2.sup.− MB-like character (FIG. 1h; FIG. 7d (Supplementary FIG. 1d)). In RA.sup.3D and RA.sup.4D cultures, NSCs acquired a FOXG1.sup.−/OTX2.sup.−/HOXA2.sup.+/HOXB4.sup.− rostral HB and FOXG1.sup.−/OTX2.sup.−/HOXA2.sup.+/HOXB4.sup.+ caudal HB identities, respectively (FIG. 1h). These data suggest that a 48-hour RA-pulse suppresses FB fate and imposes a MB-like identity to hPSC-derived NSCs (FIG. 1.

    [0321] Combined Activation of RA and SHH Signaling Imposes a Ventral Midbrain Identity to hPSC-Derived NSCs

    [0322] We next activated Shh signaling to impose a ventral identity to NSCs by treating cultures with the Smoothened agonist SAG.sup.25 between 0-9 DDC, and analyzed the fate of cells exposed to RA for different timeframes by immunocytochemistry or bulk RNA-seq (FIG. 2a). At 9 DDC, NSCs generated in SAG-only or RA.sup.1D+SAG conditions expressed the FB-specific markers FOXG1, SIX3, SIX6, and LHX2 (FIG. 2b) and the ventral marker NKX2.1 (FIG. 2a, b) which is a selective marker for the ventral telencephalon and diencephalon.sup.26,27. In RA.sup.2D+SAG cultures, FB markers were suppressed and NSCs adopted a LMX1A.sup.+/LMX1B.sup.+/FOXA2.sup.+/OTX2.sup.+ identity characteristic of vMB mDA neuron progenitors (FIG. 2a,b,d). In RA.sup.3D+SAG or RA.sup.4D+SAG cultures, cells expressed HOX genes and the ventral markers NKX2.2, PHOX2B, NKX6.1, and NKX6.2 typical of cranial motor neuron (MN) progenitors of the HB.sup.28 (FIG. 2a, b, d; and data not shown). Principal component and hierarchal clustering analysis of RNA-seq transcriptome data showed clear segregation and broad transcriptional changes of differentially expressed genes between cells exposed to RA for different timeframes (FIG. 2c; FIG. 8 a (Supplementary FIG. 2a)). Collectively, these data show: first, that increases in the duration of RA exposure imposes progressively more caudal regional brain identities (FB->MB->HB) of hPSC-derived NSCs (FIG. 1i), and second, when combined with activation of the SHH pathway, treatment with RA for 48 h appears sufficient to impose a LMX1A.sup.+/FOXA2.sup.+/OTX2.sup.+ vMB-like identity to NSCs (FIG. 8e (Supplementary FIG. 2e)). Effective induction of a vMB NSC identity required the 48 hour RA-pulse to be initiated between 0-2 DDC (FIG. 8b (Supplementary FIG. 2b)) and SAG treatment to start at 0 or 1 DDC at a concentration 50 nM (FIG. 8c,d (Supplementary FIG. 2c,d)).

    [0323] A LMX1A.sup.+/LMX1B.sup.+/FOXA2.sup.+/OTX2.sup.+ identity of NCSs was long considered as a molecular hallmark specific for vMB progenitors generating mDA neurons, but it was later shown that this identity is also shared by ventral progenitors in the caudal diencephalon giving rise to subthalamic nucleus (STN) neurons.sup.29,27 (FIG. 2d). BARHL1, BARHL2, PITX2, and NKX2.1 are selectively expressed by the STN-lineage and thus can be used to distinguish between diencephalic STN-progenitors and vMB progenitors.sup.27. Analyses of RA.sup.2D+SAG cultures at 14 DDC showed that the vast majority of LMX1A.sup.+ cells co-expressed FOXA2, OTX2, and LMX1B as well as the vMB marker CORIN.sup.30 (FIG. 2g). At this stage, a subset of cells had initiated expression of NURR1 (FIG. 2g), an early marker of post-mitotic mDA neurons.sup.31. RNA-seq data revealed negligible expression of BARHL1, BARHL2, PITX2, and NKX2.1 (FIG. 2e) and rare LMX1A.sup.+ or LMX1B.sup.+ NSCs co-expressed NKX2.1, PITX2 or BARHL1 (FIG. 2g). Expression of NKX2.2, PHOX2B, PHOX2A, and NKX6.1 either alone or in combination define progenitors giving rise to cranial motor neurons (MNs) and serotonergic neurons (5HTNs) in the ventral HB.sup.28,32 or oculomotor neurons.sup.33 and GABAergic neurons.sup.34 derived lateral to mDA neurons in the MB (FIG. 2d). RNA-seq data revealed low expression of these markers in RA.sup.2D+SAG cultures (FIG. 2e) and few cells expressed NKX2.2, PHOX2A, PHOX2B, and NKX6.1 at 14 DDC as determined by immunocytochemistry (FIG. 2g). Thus, the vast majority of hPSC-derived NSCs exposed to a 48-hour RA pulse and SAG express a LMX1A.sup.+/LMX1B.sup.+/FOXA2.sup.+/OTX2.sup.+ vMB identity, with little contamination of cells expressing neighboring diencephalic-, HB- or lateral MB-regional identities. Similar results were attained with two hESC-lines and two hiPSC-lines (FIG. 8e (Supplementary FIG. 2e)).

    [0324] WNT1 and FGF8 signaling emanating from the isthmic organizer impose graded expression of EN1 and EN2 to the caudal MB and the rostral H B.sup.35,36. WNT1, EN1, EN2 or FGF8 were expressed at very low or undetectable levels at 14 DDC (FIG. 2e). Also, the isthmic markers PAX2, PAX5, and PAX8 were expressed at negligible levels (FIG. 2e). Activation of canonical WNT signaling by CHIR99021 is associated with translocation of β-catenin into nuclei.sup.12,18 (FIG. 2f) and there was no accumulation of β-catenin in nuclei in response to RA treatment (FIG. 20. Together, this indicate that LMX1A.sup.+/FOXA2.sup.+/OTX2.sup.+ NSCs specified by RA and SAG acquire an identity reminiscent of the rostral MB, and that specification of vMB-fate occurs independently of WNT1 expression or induction of isthmic organizer-like cells in hPSC-cultures.

    [0325] Self-Enhanced RA Degradation Via CYP26A1 Provides Robust vMB Patterning Response

    [0326] To determine the sensitivity of the differentiation procedure to altered concentrations of RA, we cultured cells in RA.sup.2D+SAG-conditions and altered the concentration of RA in the range of 100-800 nM and analyzed the identity of NSCs at 9 DDC. In cultures exposed to 200-400 nM RA, the vast majority of NSCs expressed a LMX1A.sup.+/NKX2.1.sup.− vMB-identity and few cells expressed a diencephalic LMX1A.sup.+/NKX2.1.sup.+ identity or NKX2.2 (FIG. 3a,c). When RA concentration was reduced to 100 nM or increased to 800 nM RA, LMX1A.sup.+/NKX2.1.sup.− NSCs were generated but at lower numbers (FIG. 3c). Accordingly, effective induction of a vMB identity is achieved within a relatively broad range of RA concentrations. When we used CHIR99221 to specify vMB identity.sup.9,29, NSCs attained a LMX1A.sup.+/NKX2.1.sup.− identity in response to 1 μM CHIR99221, but the regional identity of NSCs shifted towards a diencephalic LMX1A.sup.+/NKX2.1.sup.+ character when the concentration was reduced to 0.8 and 0.6 μM, while cells progressively adopted a NKX2.2.sup.+/LMX1A.sup.− presumptive HB identity when the concentration was raised to 1.2 and 1.4 μM (FIG. 3b,c). These data show that specification of LMX1A.sup.+/NKX2.1.sup.− NSCs by RA is less concentration-sensitive relative to CHIR99021, and suggests that the timeframe of RA exposure, rather than absolute RA levels, is the key parameter for vMB specification.

    [0327] The CYP26 family of genes (CYP26A1, CYP26B1, CYP26C1) encode enzymes of the cytochrome p450 family that metabolize RA through oxidation.sup.37. CYP26A1 is expressed by the rostral-most neuroectoderm and contributes to prevent a rostral extension of HB identity at early stages of neural development.sup.21. Also, in AP-patterning of the HB, negative feedback regulation of RA signaling by self-enhanced degradation via induction of CYP26 proteins is important for shaping RA gradients and to buffer for fluctuations of RA levels.sup.38,39. There was a RA concentration-dependent activation and adaptive temporal expression of CYP26A1 in hPSC cultures (FIG. 3d, e). This provides a plausible mechanistic rational for the robust patterning response of cells to RA, as altered RA input can be buffered by a matching change in rate of RA turnover by CYP26A1. To explore this, we examined the fate of RA-treated hPSCs at 9 DDC after inhibiting CYP26 activity with the selective antagonist R115866.sup.40 between 0-3 DDC. In RA.sup.1D+SAG or RA.sup.2D+SAG cultures treated with 500 nM R115866 cells acquired a PHOX2B.sup.+ HB-identity instead of a NKX2.1.sup.+ FB-identity or LMX1A.sup.+/NKX2.1.sup.− vMB-identity, respectively (FIG. 3f). HOXA2 and HOXB4 were induced in these experiments suggesting a caudal HB identity (FIG. 3g; data not shown), which corresponds to a regional identity acquired after 4 days of RA exposure if CYP26 function is left intact (FIG. 1h). When the R115866 concentration was reduced to 100 nM, FB fate was suppressed but cultures contained a mix of LMX1A.sup.+/NKX2.1.sup.− vMB cells and PHOX2B.sup.+ HB cells (FIG. 3g; FIG. 9a (Supplementary FIG. 3a)), presumably reflecting that a partial inhibition of CYP26A1 produces an intermediate caudalizing effect. Importantly, treatment of cells only with R115866 and SAG did not suppress NKX2.1.sup.+ FB-fate (FIG. 3f), establishing that the strong caudalizing effect of R115866 is RA-dependent.

    [0328] Like all-trans RA, 9-cis RA, 13-cis RA and the xenobiotic RA-analogue tazarotenic acid (TA) are substrates for CYP26-mediated oxidation.sup.41,42. Exposure of cells to 500 nM of these analogues for 48-hours mimicked the patterning activity of all-trans RA by imposing a LMX1A.sup.+/NKX2.1.sup.− vMB identity (FIG. 3h; FIG. 9b (Supplementary FIG. 3b)), and inhibition of CYP26 activity resulted in a shift into a PHOX2B.sup.+ HB identity (FIG. 3h). The synthetic RA analogue EC23 is predicted to be resistant to CYP26 mediated oxidation.sup.43 and when all-trans-RA was replaced with 200 nM of EC23, cells grown either in EC23.sup.1D+SAG or EC23.sup.2D+SAG conditions adopted a PHOX2B.sup.+ HB-identity with or without inhibition of CYP26 (FIG. 3i; FIG. 9a (Supplementary FIG. 3a)). Titration experiments showed that EC23 could induce LMX1A.sup.+/NKX2.1.sup.− vMB cells, but this required a 20-fold reduction in concentration and treatment of cells only for 24 hours (FIG. 9c (Supplementary FIG. 3c)). Together, these data establish that the AP-patterning output in response to timed RA exposure is critically reliant on the RA concentration-dependent activation of CYP26A1 in responding hPSCs, and provides a mechanistic rationale to explain robustness and tolerance to altered RA input in the patterning process (FIG. 3j).

    [0329] Fast Derivation of mDA Neurons Exhibiting Mature and Functional Properties In Vitro

    [0330] A unique feature of mDA neurons is that they originate from initially non-neuronal floor plate (FP) cells at the ventral midline of the MB, and progenitors must acquire neuronal potential prior to differentiation into neurons.sup.30,44. Few markers distinguish between these states, but downregulation of SHH and upregulation pro-neural bHLH proteins over time correlate with this transition.sup.44. RNA-seq analyses of RA.sup.2D+SAG treated cells isolated at 9, 12, 14 and 21 DDC showed that the expression of pan-FP markers SHH, CORIN, ARX, VTN, FERD3L, SLIT2, SULF2, and ALCAM peaked at around 12 DDC and subsequently declined (FIG. 4a; FIG. 10a (Supplementary FIG. 4a)) and immunocytochemical analyses confirmed that SHH expression was higher at 14 DDC as compared to 21 DDC (FIG. 4b). Conversely, NEUROG2, NEUROD4, and ASCL1 encoding pro-neural bHLH proteins were upregulated at 21 DDC as well as mDA neuron markers NR4A2 (NURR1) and TH, and pan-neuronal markers DCX, TUBB3, STMN2, and DLK1 (FIG. 4a). Immunocytochemical analyses revealed the presence of TuJ1.sup.+ neurons at 12 DDC, indicating early initiation of neurogenesis (FIG. 10b (Supplementary FIG. 4b)), and there was a progressive accumulation of HuCD.sup.+ neurons between 14 and 21 DDC (FIG. 4c, d). In RA.sup.2D+SAG cultures at 21 DDC, ˜30% of DAPI.sup.+ cells accounted for HuCD.sup.+ neurons (FIG. 4d) and many of these had initiated expression of TH (FIG. 4c). When we instead used CHIR99021+SAG to specify LMX1A.sup.+/NKX2.1.sup.− vMB progenitors (FIG. 3b), cells initiated neurogenesis at around 17 DDC (FIG. 4c, d) which is consistent with previous studies.sup.9,13. At 21 DDC, HuCD.sup.+ neurons constituted ˜10% of total cells and few neurons expressed TH (FIG. 4c, d). Similar results were obtained when CHI R92211+SAG-treated cultures were complemented with FGF8b-treatment between 9-16 DDC.sup.9,29 (FIG. 4c). This shows that vMB progenitors specified in response to RA and SAG initiate neurogenesis at an early time and produce neurons at a high pace, indicating that cells at the population level undergo an early and relatively synchronized conversion from a FP state to a neurogenic state.

    [0331] TH.sup.+ neurons acquired a progressively more advanced neuronal morphology with a progressive outgrowth of TH.sup.+ axonal processes in RA.sup.2D+SAG cultures between 30-45 DDC (FIG. 4e, g, h; FIG. 8f (Supplementary FIG. 2f)). TH.sup.+ neurons expressed mDA neuron markers LMX1A, LMX1B, FOXA2, NURR1, and OTX2 at 30-35 DDC (FIG. 4e). A minor fraction of TH.sup.+ neurons had initiated expression of EN1 at 40 DDC (FIG. 10c (Supplementary FIG. 4c)) despite that RA did not induce EN1 at early progenitor stages (FIG. 2e). TH.sup.+ neurons also expressed the mature neuronal marker SYNAPTOPHYSIN and the monoaminergic marker VMAT2 (FIG. 40. A subset of cells expressed GIRK2 or CALBINDIN indicating the presence of both A9- and A10-like subtypes of mDA neurons.sup.45 (FIG. 4f). At 35 DDC, ˜80% of neurons expressed TH.sup.+ which corresponded to ˜65% of total DAPI.sup.+ cells (FIG. 4i, j). ˜10% of neurons expressed GABA (FIG. 4i, j), and some of these co-expressed TH (FIG. 10c (Supplementary FIG. 4c)). Only rare neurons expressing 5-HT or the MN marker PERIPHERIN were detected (FIG. 4i, j). High performance liquid chromatography (HPLC) analyses at 42 DDC established that neurons produced and released dopamine (FIG. 4k, I) but not serotonin (5-HT) or noradrenaline (NA) (FIG. 4k). This reveals a high yield of mDA neurons with little contamination of neuronal subtypes generated in close proximity to mDA neurons in the developing brainstem. Very few cells expressed Ki67 or phospho-histone H3 at 35-40 DDC indicating low mitotic activity after long-term culturing of cells (FIG. 4i). Functional maturation of mDA neurons in vitro can be monitored by determining the time when hPSC-derived mDA neurons acquire spontaneous action potentials, evoked action potentials and voltage-dependent Na.sup.+ and K.sup.+ currents, and these traits were previously reported to be attained after ˜60 days of culture of FACS-enriched mDA neurons (25+36 days: before/after sorting) using current state-of-the-art protocols.sup.7. In RA.sup.2D+SAG-treated hPSC-cultures, voltage-dependent Na+ and K+ currents were low at 35 DDC but increased notably at 38 DDC and remained thereafter at a largely constant level (FIG. 10d (Supplementary FIG. 4d)). Neurons showing both spontaneous (FIG. 4m) and evoked action potentials (FIG. 4n) could be recorded at 40 DDC. These data suggest that RA-based differentiation results in the generation of mDA neurons exhibiting mature functional features after 40 days of culture (FIG. 4o).

    [0332] RA-Specified Cells Engraft and Reverse Motor Deficits after Transplantation into a Rat Model of PD

    [0333] To determine the in vivo performance of vMB progenitors specified in response to RA.sup.2D+SAG, we transplanted vMB preparations in a long-term 6-hydroxydopamine (6-OHDA) lesioned rat model of PD.sup.46. vMB progenitors were isolated at 14 DDC (FIG. 4o) and grafted to the striata of athymic (nude) rats with prior unilateral 6-OHDA lesion to the medial forebrain bundle as previously described.sup.29 (FIG. 11a (Supplementary FIG. 5a)). Seven months after transplantation, immunohistochemistry analysis showed that all 9 rats had surviving grafts with a large number of TH.sup.+ neurons (4300±47 TH.sup.+ neurons per graft, FIG. 5a) which co-labeled with the human marker HuNu (FIG. 5b-c; FIG. 11b (Supplementary FIG. 5b)). Grafted TH.sup.+ neurons co-expressed FOXA2, LMX1A/B, PITX3, and NURR1 (FIG. 5d-f), indicating that they adopted a mDA phenotype in vivo. A subset of these also expressed GIRK2 (FIG. 5g), a marker enriched in A9-DA neurons. The A9 identity was further supported by TH.sup.+ fibers innervating the surrounding dorsolateral striatum (FIG. 11c (Supplementary FIG. 5c)). The functionality of the TH.sup.+ neurons was assessed using amphetamine-induced rotation and paw use assessment which demonstrated complete functional recovery (FIG. 5h-j). Together, these results show that hPSC-derived vMB progenitors specified in response to RA.sup.2D+SAG successfully engraft, differentiate into functional mDA neurons, and restore motor deficits in an animal model of PD to the same level and extent as cells generated via CH IR99021-based patterning.sup.13,29.

    [0334] Discussion

    [0335] A central objective in stem cell research is the development of simple and robust differentiation techniques resulting in consistent production of desired cells at high yield.sup.50. In this study, we outline a robust and fast method for high-yield derivation of human mDA neurons that utilizes RA to specify a MB-like character of hPSC-derived NSCs. This approach is conceptually different to the commonly used patterning via CHI R99021, as it is uncoupled from WNT signaling and since the level of caudilization is set by the duration of factor delivery rather than by concentration. Remarkably, we show that an initial 48 h RA-pulse promotes a switch-like transition from pluripotency into an NSC-state and concomitantly imposes a MB-like identity to NSCs. When combined with SHH pathway activation, vMB progenitors are induced which can rapidly differentiate into functional mDA neurons in vitro and restore dopamine neurotransmission and relieve motor deficits after transplantation into a rat model of PD at a level similar to what has been reported for other protocols.sup.13,29,51,52.

    [0336] The duration of RA exposure is the central parameter for vMB specification and the patterning response of cells is remarkably tolerant to altered RA concentrations, which can be attributed to a feedback mechanism termed self-enhanced decay.sup.39 whereby RA regulates its own turnover rate via a concentration-dependent activation of CYP26A1. Accordingly, the fact that RA is a natural non-protein ligand subject to endogenous negative feedback regulation conveys robustness to the differentiation procedure, and renders it less sensitive to batch variations and handling, and PSC line-to-line variations, compared to patterning agents that must be supplied in precisely defined concentrations. This should reduce the need for batch-to-batch and line-to-line adjustments, and thereby greatly facilitate differentiations where multiple patient derived iPSC-lines are used.sup.2,53, as well as scale-up efforts when a large number of cells are needed. Consistent with this, we obtained similar results with four distinct hPSC-lines without any adjustment to the differentiation procedure which would normally require re-titering of patterning agents.sup.9. It is notable that CHIR99021 is predicted to short-circuit negative feedback regulation of the WNT pathway by AXIN2.sup.54 as it prevents degradation of β-catenin through inhibition GSK3β.sup.18, which may explain the sensitivity of vMB identity to CHIR99021 concentration. In summary, using patterning factors that operate via timed exposure rather than precise concentrations as described here opens up new possibilities for robust specification of defined neuronal subtypes for disease modeling, high-throughput drug development and cell replacement therapies.

    [0337] Materials and Methods

    [0338] Human PSCs Culture

    [0339] Human ESCs (HS980 and 401, Karolinska Institutet) and iPSCs (SM55, SM56) were maintained on recombinant human Vitronectin (VTN) (Thermo Fisher Scientific) coated plates in iPS-Brew XF medium (Miltenyi Biotech). Cells were passaged with EDTA (0.5 mM) and ROCK inhibitor was added to the medium at a final 10 μM concentration for the first 24 h after plating. All cell lines tested negative for mycoplasma contamination.

    [0340] Human PSC Differentiation

    [0341] 80-90% confluent PSCs cultures were rinsed twice with PBS, treated with EDTA (0.5 mM in PBS) for 5-7 min, and resuspended into single cell suspension in PBS. Cells were spin down at 400 g and resuspended in N2B27 medium (DMEM/F12: Neurobasal (1:1), 0.5×N2 and 0.5×B27 (plus vitamin A) supplements, 1×nonessential amino acids, 1% GlutaMAX, 55 μM β-mercaptoethanol-all from Thermo Fisher Scientific) containing 5 μM SB431542 (Miltenyi Biotech) and 2.5 μM DMH1 (Santa Cruz Biotech) (dual SMAD inhibition), and 10 μM ROCK inhibitor (for the first 48 hours after seeding). Cells were seeded on VTN (2 μg/cm.sup.2) and Fibronectin (FN) (2 μg/cm.sup.2) (Sigma) coated surface at a density of 60,000-80,000 cells/cm.sup.2 for RA- and RA-analogues based experiments, and 20,000 cells/cm.sup.2 for CHIR99021 experiments. SAG1.3 (Santa Cruz Biotechnology), CHIR99021 (Miltenyi Biotech), all-trans RA, 9-cis RA, 13-cis RA, Tazarotenic acid, R115866 (all Sigma), EC23 (Amsbio) were used at concentrations and time points described in the result section. For mDA neuron differentiation (see schematic drawing FIG. 4) neural progenitors were mechanically dissociated at 9 DDC with Stem Cell Passaging Tool (Thermo Fisher Scientific) and seeded at 1:3 ratio in N2B27 medium containing 10 μM ROCK inhibitor (for first 48 hours after dissociation) on VTN and FN coated surfaces. For terminal in vitro differentiation of dopaminergic neurons, cells were dissociated at 23 or 24 DDC with accutase (Thermo Fisher Scientific) and plated on VTN+FN+Laminin (2 μg/cm.sup.2 each) (Sigma) coated surface in B27.sup.+ medium (Thermo Fisher Scientific) supplemented with BDNF (10 ng/ml) and GDNF (10 ng/ml) (Miltenyi Biotech), Ascorbic acid (0.2 mM) (Sigma), 10 μM ROCK inhibitor (Miltenyi Biotech) (for first 48 hours after dissociation), and 10 μM DAPT (Miltenyi Biotech). For electrophysiology an neurotransmitter content analysis cells were grown in B27 Electrophysiology medium (Thermo Fisher Scientific) supplemented with BDNF (10 ng/ml) and GDNF (10 ng/ml) (Miltenyi Biotech), Ascorbic acid (0.2 mM) (Sigma) and 10 μM ROCK inhibitor (for first 48 hours after dissociation) for at least 5 days before the experiment. The medium was routinely changed every 2-3 days.

    [0342] Immunocytochemistry and Immunohistochemistry

    [0343] Cells were fixed for 12 min at room temperature (RT) in 4% paraformaldehyde in PBS, rinsed 3 times in PBST (PBS with 0.1% Triton-X100), and blocked for 1 hour at RT with blocking solution (3% FCS/0.1% Triton-X100 in PBS). Cells were then incubated with primary antibodies overnight at 4° C., followed by incubation with fluorophore-conjugated secondary antibodies for 1 hour at RT. Both primary and fluorophore-conjugated secondary antibodies were diluted in blocking solution. Primary antibodies used are listed in Supplementary Table 1. Appropriate Alexa (488, 555, 647)-conjugated secondary antibodies (Molecular Probes) were used.

    [0344] Immunohistochemistry was performed as described before.sup.29 and primary antibodies used are listed in Supplementary Table 1.

    TABLE-US-00001 SUPPLEMENTARY TABLE 1 List of antibodies used to characterise the differentiation process in vitro and to validate the identity of cells after transplantation in vivo. Company Cat# Host Dilution OCT4 Santa Cruz sc-9081 rabbit 1:1,000 OCT4 Cell signaling 2750 mouse 1:2,000 SOX1 R&D Systems AF-3369 goat 1:1,000 ACTIN Seven Hills LMAB-C4 mouse 1:1,000 Bioreagents GAPDH Invitrogen PA 1-987 rabbit 1:2,000 PAX6 Sigma HPA030775 rabbit 1:4,000 OTX2 R&D Systems AF-1979 goat 1:2,000 FOXG1 Abeam ab18259 rabbit 1:500 HOXA2 Sigma HPA029774 rabbit 1:1,000 HOXB4 DSHB 112-Hoxb4 rat 1:20 LMXIB Home made guinea-pig 1:3,000 NKX2.2 DSHB 74.5A5 mouse 1:50 NKX2.1 Abeam ab220211 mouse 1:1,000 LMXIA Merck Millipore AB10533 rabbit 1:4,000 PHOX2B Home made guinea-pig 1:1,000 FOXA2 R&D Systems AF-2400 goat 1:1,000 NURRI Santa Cruz sc-991 rabbit 1:300 BARHLI Novus Biologicals NBP1-86513 rabbit 1:500 PITX2 R&D Systems AF07388 sheep 1:1,000 NKX6.1 DSHB F65A2 mouse 1:100 B-CATENIN Santa Cruz sc-7963 mouse 1:200 PHOX2A Santa Cruz sc-81978 mouse 1:500 ENI DSHB 4GII mouse 1:20 GIRK2 Alamone Labs APC006 rabbit 1:500 Tuj1 Sigma T8578 mouse 1:2,000 TH Novus Biologicals NB300-109 rabbit 1:1,000 TH Novus Biologicals NB300-110 sheep 1:500 TH Sigma T2928 mouse 1:500 TH Pel-Freeze P41301 rabbit 1:1,000 5-HT Immunostar 20080 rabbit 1:2,000 CALBINDIN Sigma HPA023099 rabbit 1:5,000 MAP2 R&D Systems MAB8304 mouse 1:1,000 VMAT2 Merck Millipore AB1598P rabbit 1:500 GABA Sigma A2052 rabbit 1:1,000 Synaptophysin Zymed 18-0130 rabbit 1:1,000 PITX3 Home made guinea-pig 1:2,000 SHH DSHB 5E1 mouse 1:10 PAX3 DSHB clone C2 mouse 1:100 Ki67 Invitrogen 14-5698-82 rat 1:1,000 LMXIA Dr. M. German, San rabbit 1:2,000 Francisco, CA PRPH Merk Millipore abl530 rabbit 1:2,000 HuCD Molecular probes A21271 mouse 1:1000 hNCAM Santa Cruz sc-106 mouse 1:100 HuNu Chemicon MAB1281 mouse 1:200

    [0345] Gene Expression Analyses

    [0346] Total RNA was isolated using Quick-RNA Mini Prep Plus kit (Zymo Research). cDNA was prepared using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific). Quantitative Real-Time PCR was performed in a 7500 Fast Real Time PCR system thermal cycler using Fast SYBR Green PCR Master Mix (Applied Biosystems). Analysis of gene expression was performed using the 2-ΔΔCt method, where relative gene expression was normalized to GAPDH transcript levels. Primers are listed in Supplementary Table 2.

    [0347] For Illumina RNA sequencing, RNA integrity was determined on an Agilent RNA 6000 Pico chip, using Agilent 2100 BioAnalyzer (Agilent Technologies). Illumina TruSeq Stranded mRNA kit with Poly-A selection was used for library construction. Clustering was done by ‘cBot’ and samples were sequenced on NovaSeq6000 (NovaSeq Control Software 1.6.0/RTA v 3.4.4) with a 2×51 setup using ‘NovaSeqXp’ workflow in ‘51’ mode flowcell. The Bcl to FastQ conversion was performed using bcl2fastq_v2.19.1.403 from the CASAVA software suite. Reads were mapped to the human genome assembly, build GRCm38 using Tophat (v 2.0.4). Gene level abundances were estimated as FPKMs using Cufflinks (v 2.1.1).sup.55. Further, we processed the read count data with RNA-Seq specific function set of R package limma. The differential expression was estimated with the functions voom, ImFit, eBayes, and topTable. The variance estimates were obtained by treating all samples as replicates (design=NULL) and obtaining library sizes from counts (lib.size=NULL) without further normalization (normalize.method=“none”). The resulting fold change values of differential expression were accompanied with p-values. The latter were then adjusted for multiple testing by calculating false discovery rate (FDR) by Benjamini and Hochberg's method.sup.56.

    [0348] Heatmap plotting and PCA visualization were performed with online tools at “https://www.evinet.org/”.sup.57 using standard parameter settings of R package heatmaply and function princomp as back end.

    TABLE-US-00002 SUPPLEMENTARY TABLE 2 Primers used for qPCR gene expression analysis at different stages of neuronal differentiation. Primer seqence Species Gene Full gene name (Fwd 5′-3′/Rev 5′-3′) Hs CYP26A1 Cytochrome P450 AGGAAATGACCCGCAATCTC Family 26  GAATGTTCTGCTCGATGCG Subfamily A Member 1 Hs F0XG1 Forkhead box G1 TGGCCCATGTCGCCCTTCCT GCCGACGTGGTGCCGTTGTA Hs GAPDH Glyceraldehyde- Prime Time qPCR primers 3-Phosphate Pre-designed IDT: Dehydrogenase exon: 2-3 Hs HOXA2 Homeobox A2 ACAGCGAAGGGAAATGTAAAAGC GGGCCCCAGAGACGCTAA Hs HOXB4 Homeobox B4 CTGGATGCGCAAAGTTCAC TTCCTTCTCCAGCTCCAAGA Hs LMX1A LIM homeobox Prime Time qPCR primers transcription  Pre-designed IDT: factor a exon: 3-4 Hs NKX2.1 NK2 homeobox 1 AGGGCGGGGCACAGATTGGA GCTGGCAGAGTGTGCCCAGA Hs OTX1 Orthodenticle  TATAAGGACCAAGCCTCATGGC homeobox 1 TTCTCCTCTTTCATTCCTGGGC Hs 0TX2 Orthodenticle  ACAAGTGGCCAATTCACTCC homeobox 2 GAGGTGGACAAGGGATCTGA Hs PHOX2B Paired Like  Prime Time qPCR primers Homeobox Pre-designed IDT: 2B exon: 2-3 Hs SIX3 SIX homeobox 3 ACCGGCCTCACTCCCACACA CGCTCGGTCCAATGGCCTGG

    [0349] Western Blot.

    [0350] Cells were lysed in RIPA buffer (Sigma) complemented with protease and phosphatase inhibitor cocktail (ThermoFisher Scientific), and incubated on ice with shaking for 30 min. Lysate was cleared by centrifugation (20 000 g for 20 min at 4° C.) and protein concentration determined by Bicinchoninic Acid (BCA) assay. Protein lysate was resuspended in LDS buffer (Thermo Fisher Scientific) containing 2.5% 2-Mercaptoethanol and denatured at 95° C. for 5 min. 15-30 μg of protein were loaded per lane of a 4-15% SDS polyacrylamide gel (Bio-Rad) and transferred onto nitrocellulose membranes (BioRad) using a Trans-Blot Turbo System (BioRad). Membranes were incubated 1 h at RT in blocking solution (TBS with 0.1% Tween-20 (TBST) and 5% nonfat dry milk), followed by overnight incubation at 4° C. with primary antibodies. After 3 washes with TBST at RT, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at RT. Detection of HRP was performed by chemiluminescent substrate SuperSignal West Dura substrate and the signal was detected on a ChemiDoc Imaging System (Bio-Rad). Primary antibodies for immunoblotting are listed in Supplementary Table 1.

    [0351] HPLC

    [0352] Concentrations of noradrenaline (NA), dopamine (DA) and serotonin (5-HT) in 42 DDC cultures were determined by high-performance liquid chromatography (HPLC) with electrochemical detection.

    [0353] Cultures at 42 DDC differentiated in dSMADi+RA.sup.2D conditions were incubated in physiological solution (140 mM NaCl; 2.5 mM KCl; 1 mM MgCl.sub.2; 1.8 mM CaCl.sub.2; buffered with HEPES (20 mM) at pH 7.4) or in high K.sup.+ solution (physiological solution with 56 mM K.sup.+, and the concentration of Na.sup.+ ions was proportionally reduced to keep the same total osmolarity). After 20 min. incubation solutions were collected and used for analysis of neurotransmitter content. To determine cellular neurotransmitter content, cells were lysed in H.sub.2O. Incubation solutions and cellular lysates were deproteinized with 0.1M perchloric acid and after 15 min. incubation on ice, samples were double centrifuged at 20 000 g for 15 min as described before.sup.58. Protein concentration was determined with BCA method. Samples were then analyzed in a HPLC system consisting of HTEC500 (Eicom, Kyoto, Japan), and a CMA/200 Refrigerated Microsampler (CMA Microdialysis, Stockholm, Sweden) equipped with a 20p1 loop and operating at +4° C. The potential of the glassy carbon working electrode was +450 mV vs. the Ag/AgCl reference electrode. Separation was achieved on a 200×2.0 mm Eicompak CAX column (Eicom). The mobile phase was a mixture of methanol and 0.1M phosphate buffer (pH6.0) (30:70, v/v) containing 40 mM potassium chloride and 0.13 mM EDTA-2Na. The chromatograms were recorded and integrated using the computerized data acquisition system Clarity (DataApex, The Czech Republic).

    [0354] Electrophysiology.

    [0355] Slides containing 35 to 60 days old neurons (n=22 slides, n=4 experiments) were placed in a recording chamber in electrophysiology medium (Neurabasal Medium, Electro; Thermo Fisher Scientific). For recording, neurons were visualized using a DIC microscope (Scientifica, Uckfield, UK) with a 60× objective (Olympus, Tokyo, Japan). Patch pipettes (resistance 3-5 MΩ for voltage clamp recordings, 5-10 MΩ for current clamp recordings), pulled on a P-87 Flaming/Brown micropipette puller (Sutter Instruments, Novato, Calif., USA), were filled with either 154 mM NaCl solution for voltage clamp recordings or 120 mM KCl solution containing 8 mM biocytin for current clamp recordings. Signals were recorded with an Axon MultiCalmp 700B amplifier and digitized at 20 kHz with an Axon Digidata 1550B digitizer (Molecular Devices, San Jose, Calif., USA). Access resistance and pipette capacitance were compensated. Cell attached voltage clamp recordings were band-pass filtered at 2 Hz low/1 kHz high and events showing an after hyperpolarization were considered spontaneous action potentials. To assess spiking patterns, neurons recorded in current clamp mode were held at a membrane potential of −60 mV. Near-threshold current steps were applied to determine the rheobase current, then 1 s current steps proportional to the rheobase current were applied. The presence of sodium currents was determined in voltage clamp mode by applying pulse with intervals of 10 mV from a holding of −60 mV. Electrical properties were extracted using a custom written Matlab (MathWorks, Natick, Mass., USA) script. After recording, slides were fixed, stained and imaged as described above. Biocytin was visualized with Streptavidin Alexa Fluor 488 (Thermo Fisher Scientific).

    [0356] Graft Placement and Behavioral Analysis.

    [0357] All animal procedures were performed in accordance with the European Union Directive (2010/63/EU) and were approved by the local ethical committee for the use of laboratory animals and the Swedish Department of Agriculture (Jordbruksverket). Adult female, athymic “nude” rats were purchased from Harlan/Envigo Laboratories (Hsd:RH-Foxn1rnu) and were housed as described before.sup.29 with ad libitum access to food and water, under a 12-hr light/dark cycle.

    [0358] All surgical procedures and lesion of the nigrostriatal pathway by unilateral injection of 6-hydroxydopamine (6-OHDA) were performed as described.sup.29. Lesion severity was measured 4 weeks after 6-OHDA injection by amphetamine-induced rotations recorded over 90 min using an automated system (Omnitech Electronics).sup.29. Amphetamine-induced rotation was induced by intraperitoneal injection of 2.5 mg/kg amphetamine hydrochloride (Sigma). 4 weeks later (8 weeks after 6-OHDA lesion), animals were grafted to the striatum with a dose of 150,000 cells of hESC-derived vMB progenitors at day 14 of differentiation as previously described.sup.29, and amphetamine-induced rotation was assessed 7 months after grafting.

    [0359] Spontaneous paw-use asymmetry was assessed as explorative behavior in a glass cylinder as described before.sup.29 4 weeks after 6-OHDA lesion and 7 months after grafting. Paw use preference was expressed as contralateral cylinder touches as percent of total (Left/(Left+Right)×100%).

    [0360] Animals were perfused after behavioral analysis and processed for immunohistochemistry.

    [0361] Statistical Analyses

    [0362] Unless stated otherwise, values are shown as mean±SD and asterisks in figures denote significance from Student's t test between two groups. For rotational and cylinder behavioral analysis, one-way ANOVA with Bonferroni correction and paired-sampled Student's t test were used, respectively. For all figures, *p<0.05, **p<0.01, ***p<0.001, ns=non-significant.

    EXAMPLE 2—SEQUENTIAL TREATMENT WITH RA AND CHIR99021 RESULTS IN THE SPECIFICATION OF CAUDAL MIDBRAIN IDENTITY

    [0363] Mesencephalic dopamine neurons constitute several distinct subtypes, and our RA-based protocol generates enough dopaminergic neurons of the therapeutic A9-subtype to reverse motor deficits in animal models of PD. Mechanisms underlying specification of midbrain dopamine neuron subtypes remains poorly resolved, but is likely to involve sub-patterning of ventral midbrain dopaminergic progenitors along the mediolateral and rostro-caudal axes of the midbrain (Brignani, S, and Pasterkamp, R. J., Front. Neuroanat. 11, 1-18 (2017)). WNT1 signaling emanating from the isthmic organizer at the midbrain-hindbrain boundary establish polarity of midbrain progenitors along the rostro-caudal axis by inducing a caudal.sup.HIGH-to-rostral.sup.LOW expression gradient of the homeodomain proteins EN1 and EN2 (Wurst, W. and Bally-Cuif, L. Nat. Rev. Neuroscience 2, 99-108 (2001)). Ventral midbrain dopaminergic progenitors specified by RA.sup.2D+SAG acquire a LMX1A.sup.+/OTX2.sup.+/EN1.sup.− identity at 14DDC indicating a rostral midbrain character of progenitors (FIG. 6A) and a small proportion of TH.sup.+ dopamine neurons expressed EN1 at 40DDC (FIG. 6B). When cells grown in RA.sup.2D+SAG conditions was complemented with treatment of 5 μM CHIR99021, a GSK3β kinase inhibitor used to activate WNT signaling, between 4-9DDC, a majority of LMX1A.sup.+/OTX2.sup.+ cells also expressed EN1 at 14DDC (FIG. 6A) and a large fraction of TH.sup.+ dopamine neurons expressed EN1 at 40DDC (FIG. 6B). This indicates that sequential treatment of differentiating hPSCs with RA and CHIR99021 can be applied to impose a more caudal LMX1A.sup.+/OTX2.sup.+/EN1.sup.+ identity of ventral midbrain dopamine progenitors, suggesting that minor adjustments to the basic RA.sup.2D protocol can be used to sub-pattern ventral midbrain dopaminergic progenitors into different regional identities which could influence the relative proportion A9-subtypes of dopaminergic neurons generated in vitro or after transplantation in vivo.

    REFERENCES FOR EXAMPLES

    [0364] 1. Rowe, R. G. & Daley, G. Q. Induced pluripotent stem cells in disease modelling and drug discovery. Nat. Rev. Genet. 20, 377-388 (2019). [0365] 2. Barker, R. A., Parmar, M., Studer, L. & Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell 21, 569-573 (2017). [0366] 3. Qi, Y. et al. Combined small-molecule inhibition accelerates the derivation of functional cortical neurons from human pluripotent stem cells. Nat. Biotechnol. 35, 154-163 (2017). [0367] 4. Björklund, A. & Lindvall, 0. Replacing Dopamine Neurons in Parkinson's Disease: How did it happen? J. Parkinsons. Dis. 7, S21-S31 (2017). [0368] 5. Marton, R. M. & loannidis, J. P. A. A Comprehensive Analysis of Protocols for Deriving Dopaminergic Neurons from Human Pluripotent Stem Cells. Stem Cells Transl. Med. 8, 366-374 (2019). [0369] 6. Niclis, J. C. et al. Efficiently Specified Ventral Midbrain Dopamine Neurons from Human Pluripotent Stem Cells Under Xeno-Free Conditions Restore Motor Deficits in Parkinsonian Rodents. Stem Cells Transl. Med. 6, 937-948 (2017). [0370] 7. Riessland, M. et al. Loss of SATB1 Induces p21-Dependent Cellular Senescence in Post-mitotic Dopaminergic Neurons. Cell Stem Cell 25, 514-530.e8 (2019). [0371] 8. La Manno, G. et al. Molecular Diversity of Midbrain Development in Mouse, Human, and Stem Cells. Cell 167, 566-580.e19 (2016). [0372] 9. Nolbrant, S., Heuer, A., Parmar, M. & Kirkeby, A. Generation of high-purity human ventral midbrain dopaminergic progenitors for in vitro maturation and intracerebral transplantation. Nat. Protoc. 12, 1962-1979 (2017). [0373] 10. Wang, S. et al. Autologous iPSC-derived dopamine neuron transplantation in a nonhuman primate Parkinson's disease model. Cell Discov. 1, 1-11 (2015). [0374] 11. Morizane, A. et al. MHC matching improves engraftment of iPSC-derived neurons in non-human primates. Nat. Commun. 8, 1-12 (2017). [0375] 12. Kirkeby, A. et al. Generation of Regionally Specified Neural Progenitors and Functional Neurons from Human Embryonic Stem Cells under Defined Conditions. Cell Rep. 1, 703-714 (2012). [0376] 13. Kriks, S. et al. Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson's disease. Nature 480, 547-551 (2011). [0377] 14. Chambers, S. M. et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat. Biotechnol. 27, 275-80 (2009). [0378] 15. Tao, Y. & Zhang, S.-C. Neural Subtype Specification from Human Pluripotent Stem Cells. Cell Stem Cell 19, 573-586 (2016). [0379] 16. Lu, J; Zhong, X; Liu, H; Hao, L; Tzu-Ling Huang, C; Amin Sherafat, M; Jones, J; Ayala, M; Li, L; & Zhang, S. Generation of serotonin neurons from human pluripotent stem cells. Nat. Biotechnol. 34, 89-95 (2015). [0380] 17. Bain, J. et al. The selectivity of protein kinase inhibitors: a further update. Biochem. J. 408, 297-315 (2007). [0381] 18. Toledo, E. M., Gyllborg, D. & Arenas, E. Translation of WNT developmental programs into stem cell replacement strategies for the treatment of Parkinson's disease. Br. J. Pharmacol. 174, 4716-4724 (2017). [0382] 19. Gibbs, H. C., Chang-Gonzalez, A., Hwang, W., Yeh, A. T. & Lekven, A. C. Midbrain-Hindbrain Boundary Morphogenesis: At the Intersection of Wnt and Fgf Signaling. Front. Neuroanat. 11, 1-17 (2017). [0383] 25. Frank-Kamenetsky, M. et al. Small-molecule modulators of Hedgehog signaling: Identification and characterization of Smoothened agonists and antagonists. J. Biol. 1, 1-19 (2002). [0384] 26. Ericson, J., Muhr, J., Jessell, T. M. & Edlund, T. Sonic hedgehog: A common signal for ventral patterning along the rostrocaudal axis of the neural tube. Int. J. Dev. Biol. 39, 809-816 (1995). [0385] 27. Kee, N. et al. Single-Cell Analysis Reveals a Close Relationship between Differentiating Dopamine and Subthalamic Nucleus Neuronal Lineages. Cell Stem Cell 20, 29-40 (2017). [0386] 28. Pattyn, A. et al. Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from a common pool of CNS progenitors. Genes Dev. 17, 729-37 (2003). [0387] 29. Kirkeby, A. et al. Predictive Markers Guide Differentiation to Improve Graft Outcome in Clinical Translation of hESC-Based Therapy for Parkinson's Disease. Cell Stem Cell 20, 135-148 (2017). [0388] 30. Ono, Y. et al. Differences in neurogenic potential in floor plate cells along an anteroposterior location: Midbrain dopaminergic neurons originate from mesencephalic floor plate cells. Development 134, 3213-3225 (2007). [0389] 31. Zetterström, R. H. et al. Dopamine neuron agenesis in Nurr1-deficient mice. Science 276, 248-50 (1997). [0390] 32. Dias, J. M., Alekseenko, Z., Applequist, J. M. & Ericson, J. Tgfβ signaling regulates temporal neurogenesis and potency of neural stem cells in the CNS. Neuron 84, 927-39 (2014). [0391] 33. Deng, Q. et al. Specific and integrated roles of Lmx1a, Lmx1b and Phox2a in ventral midbrain development. Development 138, 3399-3408 (2011). [0392] 34. Kala, K. et al. Gata2 is a tissue-specific post-mitotic selector gene for midbrain GABAergic neurons. Development 136, 253-262 (2009). [0393] 35. Liu, A. & Joyner, A. L. Early anterior/posterior patterning of the midbrain and cerebellum. Annu. Rev. Neurosci. 24, 869-96 (2001). [0394] 36. Hynes, M. & Rosenthal, A. Specification of dopaminergic and serotonergic neurons in the vertebrate CNS. Curr. Opin. Neurobiol. 9, 26-36 (1999). [0395] 37. Thatcher, J. E. & Isoherranen, N. The role of CYP26 enzymes in retinoic acid clearance. Expert Opin. Drug Metab. Toxicol. 5, 875-86 (2009). [0396] 38. White, R. J. & Schilling, T. F. How degrading: Cyp26s in hindbrain development. Dev. Dyn. 237, 2775-2790 (2008). [0397] 39. Schilling, T. F., Nie, Q. & Lander, A. D. Dynamics and precision in retinoic acid morphogen gradients. Curr. Opin. Genet. Dev. 22, 562-569 (2012). [0398] 40. Hernandez, R. E., Putzke, A. P., Myers, J. P., Margaretha, L. & Moens, C. B. Cyp26 enzymes generate the retinoic acid response pattern necessary for hindbrain development. Development 134, 177-187 (2007). [0399] 41. Foti, R. S. et al. Identification of tazarotenic acid as the first xenobiotic substrate of human retinoic acid hydroxylase CYP26A1 and CYP26B1. J. Pharmacol. Exp. Ther. 357, 281-292 (2016). [0400] 42. White, J. A. et al. Identification of the human cytochrome P450, P450RAI-2, which is predominantly expressed in the adult cerebellum and is responsible for all-trans-retinoic acid metabolism. Proc. Natl. Acad. Sci. U.S.A 97, 6403-8 (2000). [0401] 43. Lopez-Real, R. E. et al. Application of synthetic photostable retinoids induces novel limb and facial phenotypes during chick embryogenesis in vivo. J. Anat. 224, 392-411 (2014). [0402] 44. Andersson, E. et al. Identification of intrinsic determinants of midbrain dopamine neurons. Cell 124, 393-405 (2006). [0403] 45. Reyes, S. et al. GIRK2 expression in dopamine neurons of the substantia nigra and ventral tegmental area. J. Comp. Neurol. 520, 2591-2607 (2012). [0404] 46. Grealish, S. et al. Human ESC-derived dopamine neurons show similar preclinical efficacy and potency to fetal neurons when grafted in a rat model of Parkinson's disease. Cell Stem Cell 15, 653-665 (2014). [0405] 47. Marklund, U. et al. Detailed expression analysis of regulatory genes in the early developing human neural tube. Stem Cells Dev. 23, 5-15 (2014). [0406] 48. Vadodaria, K. C., Stern, S., Marchetto, M. C. & Gage, F. H. Serotonin in psychiatry: in vitro disease modeling using patient-derived neurons. Cell Tissue Res. 371, 161-170 (2018). [0407] 49. Okaty, B. W., Commons, K. G. & Dymecki, S. M. Embracing diversity in the 5-HT neuronal system. Nat. Rev. Neurosci. 20, 397-424 (2019). [0408] 50. Zeltner, N. & Studer, L. Pluripotent stem cell-based disease modeling: current hurdles and future promise. Curr. Opin. Cell Biol. 37, 102-10 (2015). [0409] 51. Chen, Y. et al. Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson's Disease. Cell Stem Cell 18, 817-26 (2016). [0410] 52. Kikuchi, T. et al. Human iPS cell-derived dopaminergic neurons function in a primate Parkinson's disease model. Nature 548, 592-596 (2017). [0411] 53. Taylor, C. J., Peacock, S., Chaudhry, A. N., Bradley, J. A. & Bolton, E. M. Generating an iPSC bank for HLA-matched tissue transplantation based on known donor and recipient hla types. Cell Stem Cell 11, 147-152 (2012). [0412] 54. Jho, E. et al. Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol. Cell. Biol. 22, 1172-83 (2002). [0413] 55. Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511-5 (2010). [0414] 56. Benjamini, Y. & Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B 57, 289-300 (1995). [0415] 57. Jeggari, A. et al. EviNet: A web platform for network enrichment analysis with flexible definition of gene sets. Nucleic Acids Res. 46, W163-W170 (2018). [0416] 58. Yang, L. & Beal, M. F. Determination of neurotransmitter levels in models of Parkinson's disease by HPLC-ECD. Methods Mol. Biol. 793, 401-15 (2011). [0417] 59. Brignani, S, and Pasterkamp, R. J., Front. Neuroanat. 11, 1-18 (2017). [0418] 60. Wurst, W. and Bally-Cuif, L. Nat. Rev. Neuroscience 2, 99-108 (2001).