METHODS AND PHARMACEUTICAL COMPOSITIONS FOR TREATING OCULAR DISEASES
20230235326 · 2023-07-27
Inventors
- Jean-Michel ROZET (Paris, FR)
- Lucas FARES TAIE (Paris, FR)
- Brigitte NEDELEC (Paris, FR)
- Clémentine ANGEE (Paris, FR)
- Josseline KAPLAN (Paris, FR)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a method for treating ocular disease in a subject in need thereof comprising a step of administering to said subject a therapeutically amount of an inhibitor of SOX21 gene expression and/or activity. By studying a mouse model of congenital microcoria, the inventors demonstrate that this ultra-rare and purely ocular disease is due to unanticipated complex mechanisms linked with 3D regulation of gene expression. They propose that the disease is due to the illegitimate expression of a transcription factor, SOX21, induced by the adoption of a DCT enhancer(s). They show that SOX21 binds to a regulatory region of the Tgfβ2 gene and the inventors demonstrate overexpression of this trophic factor in the iris and accumulation of its product in the aqueous humor of the mouse carrying the minimal MCOR deletion which recapitulates the observed accumulation in patients with POAG and one of our patient with MCOR.
Claims
1. A method for treating ocular disease in a subject in need thereof comprising administering to said subject a therapeutically amount of an inhibitor of SOX21 gene expression and/or activity.
2. The method according to claim 1, wherein the ocular disease is related to an increase of TGFβ2 expression and/or activity.
3. The method according to claim 1, wherein the ocular disease is selected from the group consisting of: Congenital microcoria (MCOR), glaucoma, open angle glaucoma (AOG, POAG) and myopia.
4. The method according to claim 1, wherein the inhibitor of SOX21 gene expression is siRNA, shRNA, miRNA, antisense oligonucleotide, a transcription factor decoy or a ribozyme.
5. The method according to claim 1, wherein the inhibitor of SOX21 activity is a peptide, polypeptide, peptidomimetic, small organic molecule, antibody or aptamers.
6. The method according to claim 1, wherein the inhibitor of SOX21 gene expression is delivered alone or in association with a viral vector.
7. The method of claim 6, wherein the viral vector is an adeno-associated virus (AAV) vector.
8. The method according to claim 7, wherein the viral vector is an AAV1, AAV2, AAV3, AAV4, AAV 5, AAV 6, AAV7, AAV 8 or AAV9.
9. The method according to claim 1, wherein the inhibitor of SOX21 gene expression and/or activity is delivered naked or with a viral vector and is delivered by intravitreous, subcutaneous, intravenous, ophthalmic drop or ophthalmic ointment delivery.
10. The method according to claim 1, wherein the inhibitor of SOX21 gene expression and/or activity is delivered naked or with a viral vector and is injected directly into the vitreous, aqueous humour, iris, ciliary body tissue(s) or cells and/or extra-ocular muscles, retina or suprachoridal space.
11. A pharmaceutical composition comprising an inhibitor of SOX21 expression and/or activity alone or in association with a viral vector.
12. (canceled)
13. (canceled)
14. The method according to claim 10, wherein the inhibitor of SOX21 gene expression and/or activity is delivered directly into the retina after retinal detachment.
Description
FIGURES
[0127]
[0128]
[0129]
[0130]
[0131]
EXAMPLE 1
[0132] Material & Methods
[0133] Mouse Lines Transgenics mice were generated by Imagine Transgenic Platform using a CRISPR/Cas9 system. All animal procedures were performed with approval from the Ministry of Higher Education, Research and Innovation and the ethical committee of the Paris Descartes University. Guide RNAs (sgRNAs, Table 1) were designed via the CRISPOR (http://crispor.tefor.net/) and sequences are listed in the table below. C57BL/6J female mice (4 weeks old) were superovulated by intraperitoneal injection of 5 IU PMSG (SYNCRO-PART® PMSG 600 UI, Ceva) followed by 5 IU hCG (Chorulon 1500 UI, Intervet) at an interval of 46 h-48 h and mated with C57BL/6J male mice. The next day, zygotes were collected from the oviducts and exposed to hyaluronidase (H3884, Sigma-Aldrich) to remove the cumulus cells and then placed in M2 medium (M7167, Sigma-Aldrich) into a CO2 incubator (5% CO2, 37° C.).SgRNAs were hybridized with cas9 (WT) protein and injected into the pronucleus of the C57Bl/6J zygotes. Surviving zygotes were placed in KSOM medium (MR-106-D, Merck-Millipore) and cultured overnight to two-cell stage and then transfered into the oviduct of B6CBAF1 pseudo-pregnant females. The generated transgenic mice were validated by Sanger sequencing combined with tide TIDE analysis (https://tide-calculator.nki.nl/; data not shown). All mice were backcrossed with C57BL/6j mice to remove potential off-targets. The offspring were further confirmed by PCR genotyping with appropriate primers.
TABLE-US-00004 TABLE 1 Guide RNA used to generate MCOR mice models Mouse lines 5′ Guide (5′-3′) 3′ Guide (5′-3′) cΔMCOR CTCACAGTTTGGT ATTCCCCAGCAGAG CCAGGCTGGG AGGCGCTGG (SEQ ID NO: 23) (SEQ ID NO: 29) ΔCTCF1 + Ps TCTTCAGACGCCG GCCCGCTCCGTTTG CGCTTTA CTCGCC (SEQ ID NO: 24) (SEQ ID NO: 30) ΔCTCF2 GTGTTTTATGGACG CTCGGCATAAAGTT GGCTCG TGTAAT (SEQ ID NO: 25) (SEQ ID NO: 31) ΔCTCF3 TCCATAGTAATGAT CTCGGCATAAAGTT CGCATC TGTAAT (SEQ ID NO: 26) (SEQ ID NO: 32) ΔEnh1 AACACAGGGAGGTC CAAAAATCCTTGGG GCTTTC CTAACT (SEQ ID NO: 27) (SEQ ID NO: 33) ΔEnh2 TGGGACACAAGCAC GTTCCAGTAGGGCA CGGCCT ACGCAA (SEQ ID NO: 28) (SEQ ID NO: 34)
[0134] Circular Chromosome Conformation Capture Sequencing (4C-Seq).
[0135] Potential active enhancers and silencers specific to cΔMCOR mice were assessed for gain or loss of interaction with the Sox21 promoter by using 4C-seq technology. We performed 4C-seq from the viewpoint of 2 kb surrounding the Sox21 regulating region, in embryos as well as in mice embryonic fibroblast (MEF) derived from WT and cΔMCOR mice (E9.5). Briefly, genomic interactions were captured by cross-linking and chromatin aggregates which underwent two rounds of digestions (i.e. DpnII and Csp6I; New England Biolabs), ligation-induced circularization of short digested fragments, inverse PCR amplification using primers designed to target the viewpoint fragment (5′ tgctcccctgttatgttcagatc 3′ (SEQ ID NO: 35) and 5′gtgcaaaccaattcatgtta 3′(SEQ ID NO: 36) and amplification of its ligated partners as described by van de Werken et al., 2012 and Lupiáñiez et al., 2015. A total of 1.6 mg of each library was PCR amplified and barcoded to allow 50 bp single-end read sequencing with the Illumina Nova-seq technology. High resolution contact profiles in the 2 Mb region surrounding the viewpoint were generated by using 4Cseqpipe that allow sequence extraction, mapping, normalization, and plotting of cis-contact profiles around viewpoints (van de Werken et al. 2012). In short, 4C-seq reads were demultiplexed and cleaned of the primer sequences. Trimmed reads were mapped against the human genome assembly GRCh38 (Bowtie2 2.2.3 with default setting) and filtered-out for low mapping quality and nonunique sequences (mapping scores MAPQ <30; Samtools 0.1.19). To calculate read count profiles, the viewpoint and adjacent fragments 1.5 kb up- and downstream were removed. A sliding window of 10 Kb was used to smooth the data. Data was normalized to reads per million mapped reads (RPM) to account for depth of sequencing of the 4C-seq library by scaling all reads mapped to the chromosome containing the viewpoint. To compare interaction profiles of the different samples, the log 2 fold change for each window of normalized reads were calculated. To obtain ratios, duplicated regions were excluded for calculation of the scaling parameter used in RPM normalization. Two-way ANOVA with multiple comparisons was used to compare differential contacts between B6.WT and B6.cDMCOR in embryos as well as in MEF to obtain the adjusted Pvalue. Results for each group were calculated and assessed for statistical significance using the 2-tailed unpaired Student's t-test.
[0136] Pupillometry
[0137] Two-month-old mice (8 WT and 8 cΔMCOR) were dark-adapted overnight. Pupil diameter was recorded as previously described by Kostic et al 2016. In brief, the baseline pupil diameter was set as the mean pupil diameter during the 500 ms before light onset; thereafter, all pupil sizes were converted to a relative size that was a function of the baseline value. The following light stimulus sequence was used: 50 ms (−2.2, −1 and 0.5) log W/m.sup.2 white light and 20 s 0 log W/m.sup.2 blue light. The pupil diameter was determined automatically by the Neuroptics A2000, Inc. software. One-way/two-way ANOVA analysis were used to identify significant differences.
[0138] RNAseq
[0139] Total iris RNA from WT and cΔMCOR mice were extracted using the RNeasy Mini Kit (Qiagen). RNAseq was performed at the Genomic Platform of Imagine. In brief, total RNAs (200 ng) were purified, fragmented, reverse transcribed and barcoded. cDNA libraries were prepared from 4 WT and 4 cΔMCOR samples using the TruSeq RNA Sample Preparation Kit, according to the manufacturer recommendations (Illumina). Indexed cDNA libraries were pooled and hybridized to biotin-labeled probes specific for coding RNA regions. Bound cDNAs were recovered using streptavidin-bead mediated purification and hybridized for a second enrichment reaction, prior to clonal amplification by cluster generation and sequencing on a HiSeq 2000 (Illumina). Analysis of RNA-seq data were performed at the Bioinfoimatics Platform of Imagine using a standard workflow including quality assessment (FastQC 0.11.5), quality filtering (Trimmomatic), read mapping against the human genome assembly GRCh38 (STAR aligner), read counting (HTSeq software with annotation from GENCODE v24 http://www.gencodegenes.org/). Gene expression levels were normalized and compared among samples using LimmaVoom, DESeq2 and edgeR. Mean expression values of genes displaying at least a 1.5-fold change (p<0.05) in cΔMCOR group compared to WT group were analyzed for hierarchical and functional clustering using the Partek Genomics Suite 6.6 that includes ANOVA and Ingenuity Pathway Analysis (http://www.ingenuity.com) modules.
[0140] RT-qPCR Analysis
[0141] Adult mice were sacrificed by cervical dislocation and enucleated. The eyes were carefully dissected to recover the iris and CB. Iris total RNA (200 ng) from WT and cΔMCOR mice was extracted using the RNeasy Mini Kit (Qiagen) and subjected to reverse transcription with the Reverse Transcriptor kit following the manufacturer's instructions (Roche). The abundance of Sox21 and Dct mRNA were measured using specific primers: Sox21 (5′-gatgcacaactcggagatca-3′(SEQ ID NO: 37)/5′-ggcgaacttgtcctttttga-3′(SEQ ID NO: 38) and Dct (5′-aattcttcaaccggacatgc-3′(SEQ ID NO: 39)/5′-ttgcgtggtgatcacgtagt-3′(SEQ ID NO: 40). GusB (5′-ctgcggttgtgatgtggtctgt-3′(SEQ ID NO: 41)/5′-tgtgggtgatcagcgtcttaaagt-3′(SEQ ID NO: 42) and Hprt 1 (5′-gttggatacaggccagactttgtt-3′(SEQ ID NO: 43)/5′-aaacgtgattcaaatccctgaagta-3′(SEQ ID NO: 44) were used to normalize the data and Alb (5-gggacagtgagtacccagacatcta-3′(SEQ ID NO: 45)/5′-ccagacttggtgttggatgctt-3′(SEQ ID NO: 46) was used to control the non-contamination of cDNAs by genomic DNA. The cDNA (5 μl of a solution diluted at 1:25 in RNAse-free H.sub.2O) of each sample was subjected to PCR amplification in real-time in a buffer (200 containing SYBR GREEN PCR Master Mix (Life Technologies) and 300 nM forward and reverse primers in the following conditions: activation of Taq polymerase and denaturation at 95° C. for 10 min followed by 50 cycles of 15 s at 95° C., and 1 min at 60° C. The specificity of the amplified products was determined after the analysis of the melting curve carried out at the end of each amplification using one cycle at 95° C. for 15 s, then a graded thermal increase of 60° C. to 95° C. for 20 min. The data analysis and methodology were performed as previously described by Gerard et al 2012.
[0142] Immunoblotting
[0143] Adult mice were sacrificed by cervical dislocation and enucleated. The eyes were carefully dissected to recover the iris and CB. Tissues were lysed on ice for 1 h by repeated homogenization in a low detergent lysis buffer containing phosphate buffered saline (PBS) 1×, 1% Triton, Halt™ Protease Inhibitor Cocktail 1× (ThermoScientific) and 25 U/ml Pierce Universal Nuclease (ThermoScientific). The lysates were centrifuged (20 000 g at 4° C. for 15 min), supernatants were collected and proteins quantified using the Bradford method. For western blot analysis, proteins (25 μg) were resolved by a 4-15% polyacrylamide gel (mini-PROTEAN TGX, Bio-Rad, Marnes-la-Coquette, France) according to the supplier's recommendations. All lysates were heated at 95° C. for 10 min prior to loading. Proteins were transferred to a PVDF 0.2 μM membrane (Bio-Rad) using a Trans-Blot Turbo Transfer System (Bio-Rad), and then processed for immunoblotting. Membranes were probed with Sox21 goat polyclonal (1:2000, AF3538 R&D system) and monoclonal mouse anti-β-actin (1:2000, Abcam, Paris, France) primary antibodies, and then incubated with donkey anti-goat IgG-HRP (1:2000, ThermoScientific) and donkey anti-mouse IgG-HRP secondary antibodies (1:4000, ThermoScientific), respectively. Blots were developed with the use of the Clarity Western ECL Substrate (Bio-Rad) and ChemiDoc XRS+ Imaging System (Bio-Rad). Western blot images were acquired and analyzed with Image Lab software 3.0.1 build 18 (Bio-Rad).
[0144] Immunofluorescence Labeling
[0145] For immunohistochemistry C57BL/6J cΔMCOR mice were derived on an albino background which expresses Dct (Swiss-albino, CFW). Adult mice were sacrificed by cervical dislocation and enucleated. Eyes were dissected in phosphate buffered saline (PBS), fixed in 4% paraformaldehyde overnight at 4° C. and washed three times 15 min with 1×PBS. Eyes were embedded in OCT™ Compound and stored at −80° C. Sagittal sections (10 μm) were first soaked for 30 min in a buffer solution for heat induced epitope retrieval (10 mM sodium citrate, 0.05% Tween 20, pH6) then cooled for 30 min at room temperature and blocked for 1 hour with 5% BSA/PBS 1×. Overnight primary antibody incubation (SOX21 goat polyclonal, AF3538 R&D system 1:100 and DCT rabbit anti mouse, ab74073 Abcam 1:200) was performed at 4° C. followed by Alexa Fluor secondary antibody incubation for 1 hour at room temperature (Donkey anti-goat 647 A 21447 and Donkey ant rabbit 555 A31572 at 1:1000 dilution). All sections were counterstained with Dapi (Sigma10236276001) for visualization of nuclei. Images were taken using Spinning Disk (Zeiss) fluorescent microscope and images were analyzed using the image J analysis system.
[0146] Glial Nuclei Counting in the Optic Nerve Head.
[0147] One-year-old WT and cΔMCOR mice were sacrificed by cervical dislocation and enucleated. Optic nerves (ON) were dissected from globe by using curved scissors, fixed in 4% paraformaldehyde, embedded in paraffin and cut in 4 μm thick cross sections. Sections were stained using hematoxylin-eosin to label the nuclei of glial cells which were counted on multiple sections (n=35 and 38 for WT and cΔMCOR, respectively) using ImageJ software (Wayne Rasband, NIH, USA). The means of nuclei per slice were compared using a bilateral heterodastic Student test.
[0148] ELISA Dosage of TGFβ2 Concentration in the Aqueous Humor
[0149] Adult mice were sacrificed to allow aqueous humor (AH) collection (5 μl). Human AH (approximately 100 μl) was collected in the course of senile cataract surgery in one MCOR individual and 11 controls. Mouse TGFβ2 DuoSet ELISA kit (R&D Systems) and human TGFβ2 DuoSet ELISA kit (catalogue No DB250 R&D Systems) were utilized to quantify total TGFβ2 levels in mice and human AH (10 μl and 30 μl in 100 μl final, respectively). Samples were subjected to acid activation (1N HCl) and neutralization (1.2N NaOH/0.5 M HEPES) prior to quantification of the total TGFβ2 concentration as recommended by the manufacturer (R&D Systems), using a microplate reader at a 450-nm wavelength with a 570-nm wavelength correction (reference du lecteur de plaque). Statistical significance between two groups was analyzed using the unpaired 2-tailed Student's t test. p≤0.05 was considered statistically significant.
[0150] Results
[0151] Primary mapping of the disease locus to chromosome 13q32 has been achieved in Necker Hospital, Paris at the end of the 1990s (Rouillac et al., 1998) by whole genome-linkage analysis in the 5-generation Breton family ascertained in the 1960s. Genetic analysis in other MCOR families suggests that there exist only one MCOR locus (Fares-Taie et al., 2015; Pozza et al., 2020; Ramprasad et al., 2005; Sergouniotis et al., 2017). Consistently, studying the multigenerational Breton pedigree and five other families entrusted to the inventors, one French, two Mexican and two Japanese families, the inventors were able to ascribe all the cases to submicroscopic overlapping 13q32.1 deletions (Fares-Taie et al., 2015). The Mexican families shared the same deletions, suggesting a founder effect. All other families displayed unique anomalies. The deletions were variable in size (35-85 kb) but encompassed or interrupted invariably the tail-to-tail genes, TGDS and GPR180. Recessive mutations in TGDS encoding the TDP-glucose 4,6-dehydratase cause oro-facio-digital malformations (Catel-Manzke syndrome, CMS; MIM616145). Ophthalmological examination of individuals affected with TGDS-associated CMS from our hospital revealed absence of iris anomalies, suggesting a lack of role of this gene in MCOR. GPR180 encoding a G protein-coupled receptor 180 of unknown function is involved in the regulation of smooth muscle cell growth (Iida et al., 2003). However, studying knock-out mice and individuals from a two-generation family carrying a heterozygous GPR180 nonsense mutation, the inventors observed no iris dilator muscle anomaly (Fares-Taie et al., 2015). The family members harbouring the GRP180 loss-of-function mutation, aged from 16 to 62 years displayed some minor irido-corneal angle anomalies (iris spicules) with normal IOPs (Fares-Taie et al., 2015). Another 69 Kb overlapping deletion has been reported in a 3-generation family from UK comprising five affected individuals with irido-corneal angle anomalies in at least three aged over 40, two of whom (mother and son) had juvenile GLC (Sergouniotis et al., 2017). Recently, a reciprocal 289 kb duplication encompassing 11 genes including TGDS and GPR180 has been identified in a mosaic mother and her daughter with normal anterior chamber angle (Pozza et al., 2020). Together, these observations suggest that the loss of GPR180 might contribute to angle anomalies, but is insufficient to explain the disease that is likely due to alteration of the 13q32.1 regulatory landscape.
[0152] HiC sequencing data suggest that the MCOR locus is included in a 1 Mb topologically-associated domain (TAD) comprising region from Dct encoding the dopachrome tautomerase that acts downstream of the tyrosinase in the biosynthesis pathway of eumelanin, to Uggt2 encoding the UDP-glucose glycoprotein glucosyltransferase 2 that selectively reglucosylates unfolded glycoproteins in the endoplasmic reticulum (Bonev et al., 2017). The region and its 3D structure are highly conserved in the mouse syntenic region on chromosome 14qE4. Using the CRISPR/Cas9 methodology, the inventors generated transgenic mice harbouring the critical MCOR deletion (cΔ; 35 Kb) or smaller deletions within or outside the critical region (data not shown) in order to characterize its regulatory architecture and understand its relation to iris development, OAG and high myopia.
[0153] Studying the resulting phenotypes, the inventors observed that the loss of Tgds in homozygosity caused embryonic mortality at E9.5 due to neural crest migration and differentiation anomalies (at least in part). In contrast, mice carrying the critical deletion in heterozygosity (cΔMCOR mice) are viable and present with a moderate reduction in base-line pupil size compared to WT littermates (p<0.01) (
[0154] SOX21 encodes a transcription factor of the SRY-related HMG-box (SOX) family, which only known function in the eye comes from studies in the chick and zebrafish (Lan et al., 2011; Uchikawa et al., 1999). In the chick, SOX21 is transiently activated during the early phases of optic vesicle morphogenesis and specification in the lens and retina but no longer expressed afterwards (Uchikawa et al., 1999). The ocular expression of SOX21 stops before the iris starts developing. Its loss-of-function in the chick, as in zebrafish, interferes with normal lens development (Pauls et al., 2012).
[0155] The CCCTC-containing protein also known as CTCF is a highly conserved zinc finger protein that binds chromatin and mediates its 3D organization through looping between binding sites. It can function as a transcriptional activator, a repressor or an insulator protein, blocking the communication between enhancers and promoters (Holwerda & de Laat, 2013). We identified 4 CTCF-binding sites within the 35 Kb critical MCOR region (data not shown). To assess whether the loss of one or several of them could promote the adoption by the promoter of SOX21 of a nearby active enhancer, the inventors ablated them individually or in combination in the mouse (data not shown). The iris of none of the resulting mouse lines displayed SOX21 expression, as determined by RTqPCR (data not shown). This observation supports the view that ectopic expression of SOX21 in the iris of the cΔMCOR mouse is not due to the loss of insulator. In addition, the inventors performed 4C sequencing (4Cseq) from a viewpoint of 2 kb surrounding the SOX21 promoter to investigate how the cΔMCOR influences chromatin interactions between SOX21 and active enhancers and search for new interactions. 4Cseq of nuclei isolated from WT and cΔMCOR total embryos and embryonic fibroblasts (E9.5) was in agreement with chromatin structure of the 1 Mb TAD reported at the locus (Bonev et al., 2017). Intriguingly, 4C-seq revealed that the DNA region encompassing SOX21 (2 kb) interacts throughout the TAD in both cΔMCOR and WT counterparts (data not shown) that do not express SOX21, suggesting either iris-specific interactions or a modification by the deletion of the SOX21 promotor competence for nearby enhancers. Using CHIP Seq for H3k27ac marks which indicates transcriptionally active chromatin sites (Raisner et al., 2018) in irises of newborn WT mice, the inventors identified two highly active enhancers upstream of the deletion, nearby Dct (data not shown) that is highly expressed in pigmented iris cells (data not shown). It is likely that the SOX21 promoter adopts one or the two enhancers by reducing genomic distances within the TAD by deletions or duplications.
[0156] Immunohistochemistry (IHC) analysis in cΔMCOR is hampered by the strong iris pigmentation. Depigmentation protocols did not allow preserving the integrity of iris tissues. Hence, the inventors derived the line on a tyrosinase (tyr)-negative albino background. RTqPCR analysis confirmed SOX21 ectopic expression in the iris of 2 month-old c.ΔMCOR mice (data not shown). IHC showed SOX21 expression in the iris PEL and CB the stained using an antibody specific to DCT (Dct is endogenously highly expressed in both cΔMCOR and WT) (data not shown). SOX21 was undetectable in the iris AEL that form the dilator muscle. This might suggest a remote effect of the aberrant gene expression in the iris PEL and CB on the iris AEL However, while pupilometry analysis showed reduced pupil size in cΔMCOR mice, preliminary IHC analysis have not permitted substantiating dilator muscle anomalies as there existed SMA-positive fibers in the dilator muscle region of cΔMCOR irises with no visible difference as compared to WT (not shown). The presence of SMA-positive fibers is not unexpected considering that the pupil size is only moderately reduced in the model.
[0157] Analyzing data from RNAseq of irises from new-born cΔMCOR and WT, the inventors identified 2500 deregulated genes (≥1.5 fold, p<0.05) in the cΔMCOR model. Many of them are in relation with MCOR disease symptoms and/or iris development, e.g. Des (0.49, p=0.012) encoding desmin intermediate filaments which lacks in iris AEL of patients affected with MCOR, Wtn2b (2.35 p<0.01) which expression is pivotal for the specification of iris progenitor cells to a non-neuronal (myoepithelial) fate, Bmp7 (1.47 p<0.05) that is highly expressed by cells at the site of iris smooth muscle generation and Tgfβ2 and Gdnf (1.6 and 1.7 respectively, p<0.01) encoding two closely related growth factors involved in GLC (Checa-Casalengua et al., 2011; Kasetti et al., 2017; Prendes et al., 2013) and high myopia (Jia et al., 2017). Interestingly, CHIPseq analysis of irises from new-born.cΔMCOR mice using a highly specific SOX21 antibody (Matsuda et al., 2012) showed binding of SOX21 on 26 DNA regions through-out the genome. Getting back to RNAseq dataset from cΔMCOR and WT irises, the inventors observed that 2/26 binding regions were included in genes that were deregulated (>1.5 fold at a p<0.05) in .cΔMCOR: Tgfβ2 and Gdnf. The other 24 DNA regions lie in genes that were not deregulated (11/24) in .cΔMCOR irises or genes that are not expressed (13/24) in the iris of .cΔMCOR and .WT animals. Binding of SOX21 to Tgfβ2 was unambiguous (p<0.005) and strongly supported by JASPAR analysis which searches for a consensus SOX21-binding sequence in the 252 bp intronic region identified by CHIPseq (chr1:186,698,304-186,698,555; GRCm38/mm10 Assembly; 5.9 Kb downstream from the consensus donor splice-site of the 16 kb-long intron 1) (
[0158] Many studies have reported significantly elevated levels of TGFβ2 in the aqueous humor of individuals with POAG (Agarwal et al., 2015; Wordinger et al., 2014) in cultured glaucomatous cell strains and isolated human glaucomatous TM tissues (Wordinger et al., 2014). The cause and cellular source of TGFβ2 accumulation in glaucomatous eyes is elusive, but it is clear that TM cells express an active TGFβ receptor complex and respond to exogenous TGFβ2, which increase extracellular matrix protein synthesis. Undue ECM synthesis in the TM increases resistance to aqueous outflow, leading to TOP elevation (Prendes et al., 2013). In human and mouse, high TOP initiates a cascade of events that result in a chronic and progressive deformation of the optic nerve head, a scenario that is observed as excavation or cupping of the optic disk (Quigley, 2011; Zeimer et al., 1998). The deformation of the ON head causes or contributes to the chronic degeneration of ON axons, and finally leads to apoptotic death of the retinal ganglion cells (RGC) (Munemasa & Kitaoka, 2013). Considering that (i) SOX21 is ectopically expressed in the CB where the aqueous humour is produced, (ii) SOX21 binds in a regulatory region of the Tgfβ2 gene and (iii) Tgfβ2 expression is upregulated in the iris of the MCOR mouse model, the inventors considered looking for TGFβ2 accumulation in the aqueous humor of .cΔMCOR mice. We confirmed accumulation by showing a significant increase of TGFβ2 concentration in the aqueous humor of mice carrying the critical MCOR deletion compared to WT counterparts (1.8 fold change, p<0.01;
[0159] To sum-up, by studying a mouse model of congenital microcoria, the inventors suggest that this ultra-rare and purely ocular disease is due to unanticipated complex mechanisms linked with 3D regulation of gene expression. We propose that the disease is due to the illegitimate expression of a transcription factor, SOX21, induced by the adoption of a DCT enhancer(s). We show that SOX21 binds to a regulatory region of the Tgfβ2 gene and the inventors demonstrate overexpression of this trophic factor in the iris and accumulation of its product in the aqueous humor of the mouse carrying the minimal MCOR deletion which recapitulates the observed accumulation in patients with POAG and one of our patient with MCOR. Consistent with studies which demonstrated a link between TGFβ2 accumulation in the aqueous humor and open angle GLC, our preliminary results indicate optic nerve degradation that is the hallmark of GLC, including POAG. Together, these observations further support the view that GLC in MCOR is not a consequence of the irido-corneal anomaly, but rather it seems to be a direct consequence of TGFβ2 overexpression as is POAG. Furthermore, knowing that TGFβ2 may act as a critical factor in axial elongation of the eye globe (Jia et al., 2017), its overexpression could also account for high myopia in MCOR. Finally, because SOX21 is not expressed in the iris anterior pigment epithelium, which gives rise to the dilator, the inventors propose that overexpression of TGFβ2 compromises the development of the dilator muscle by a paracrine signaling, which is consistent with the observation of high variability of histopathologic iris dilator muscle presentations reported in human individuals affected with MCOR. Thus, the inventors propose that overexpression of TGFβ2 links the iris malformation, myopia and GLC in congenital microcoria, making MCOR a highly valuable model to analyse eye development and the mechanisms of common POAG. Furthermore, our preliminary data disclose a novel pathway of TGFβ2 regulation which involves SOX21 as a potential therapeutic target for GLC both in MCOR and POAG.
EXAMPLE 2: THE CRITICAL MCOR-CAUSING DELETION INDUCES SOX21 EXPRESSION IN HUMAN POSTERIOR EPITHELIAL CELLS OF THE IRIS
[0160] CRISPR-Cas9 RNA guides specific to the 5′ and 3′ boundaries of the 35 KB-critical MCOR-causing deletion in human 5′ gaggatatactaacaaagag 3′ (SEQ ID NO:49); 5′ gggagctgggcaggtaagaa 3′ (SEQ ID NO:50) were designed and cloned into pSpCas9(BB)-2A-GFP and pSpCas9(BB)-2A-mCherry plasmids, respectively.
[0161] SV40-immortalized human iris pigment epithelial cells (HIPEpiC) were co-transfected with the pSpCas9(BB)-2A-GFP and -mCherry plasmids encoding the RNA guides and double GFP/mCherry positive cells were sorted by flow cytometry, plated in culture well chambered coverglass and maintained in EPiCM culture medium (P60106, Innoprot; SV40-HIPEpiC) for 48 h to allow protein expression. Non-edited SV40-HIPEpiC and GFP/mcherry positive SV40-HIPEpiC were analyzed by immunocytochemistry using antibodies specific to the human SOX21 and DCT proteins (CL4688, Invitrogen and ab74073, Abcam), respectively. A positive DCT staining was observed both in non-edited and GFP/mcherry positive SV40-HIPEpiC cells. In contrast, while none of the non-edited SV40-HIPEpiC cells expressed SOX21, we observed a positive nuclear staining in 2% of co-transfected cells (
[0162] Telomerase-immortalized retinal pigment epithelium cells (RPE1) and human ocm-1, mp41 and U251 cells derived from ocular choroidal melanoma, uveal melanoma and glioma were edited and double GFP/mCherry positive cells were flow-sorted using the same strategy. Unique double GFP/mCherry positive RPE1, ocm-1, mp41 and U251 cells were plated to obtain clonal populations. Clones were analyzed for the presence of the critical deletion and SOX21 and DCT expression by Sanger sequencing of genomic DNA and RT-qPCR of mRNA, respectively. Both non-edited and edited glioma cells expressed DCT and SOX21 (positive control;
[0163] Together, these data strongly support that the critical MCOR deletion cause ectopic expression of SOX21 in the posterior epithelium of the iris both in human and mouse.
REFERENCES
[0164] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0165] Agarwal, P., Daher, A. M., & Agarwal, R. (2015). Aqueous humor TGF-β2 levels in patients with open-angle. Molecular Vision, 9. [0166] Aoki, T., Miyauchi, K., Urano, E., Ichikawa, R., & Komano, J. (2011). Protein transduction by pseudotyped lentivirus-like nanoparticles. Gene Therapy, 18(9), 936-941. https://doi.org/10.1038/gt.2011.38 [0167] Beckman, R. A., Weiner, L. M., & Davis, H. M. (2007). Antibody constructs in cancer therapy. Cancer, 109(2), 170-179. https://doi.org/10.1002/cncr.22402 [0168] Bonev, B., Mendelson Cohen, N., Szabo, Q., Fritsch, L., Papadopoulos, G. L., Lubling, Y., Xu, X., Lv, X., Hugnot, J.-P., Tanay, A., & Cavalli, G. (2017). Multiscale 3D Genome Rewiring during Mouse Neural Development. Cell, 171(3), 557-572.e24. https://doi.org/10.1016/j.cell.2017.09.043 [0169] Bremner, F. D., Houlden, H., & Smith, S. E. (2004). Genotypic and phenotypic heterogeneity in familial microcoria. The British Journal of Ophthalmology, 88(4), 469-473. https://doi.org/10.1136/bjo.2003.027169 [0170] Brummelkamp, T. R., Bernards, R., & Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science (New York, N.Y.), 296(5567), 550-553. https://doi.org/10.1126/science.1068999 [0171] Carreon, T., van der Merwe, E., Fellman, R. L., Johnstone, M., & Bhattacharya, S. K. (2017). Aqueous outflow—A continuum from trabecular meshwork to episcleral veins. Progress in Retinal and Eye Research, 57, 108-133. https://doi.org/10.1016/j.preteyeres.2016.12.004 [0172] Checa-Casalengua, P., Jiang, C., Bravo-Osuna, I., Tucker, B. A., Molina-Martinez, I. T., Young, M. J., & Herrero-Vanrell, R. (2011). Retinal ganglion cells survival in a glaucoma model by GDNF/Vit E PLGA microspheres prepared according to a novel microencapsulation procedure. Journal of Controlled Release, 156(1), 92-100. https://doi.org/10.1016/j.jconrel.2011.06.023 [0173] Coulon, G., Delbosc, B., Jeffredo, Y., Viennet, G., Oppermann, A., & Royer, J. (1986). [Congenital microcoria: A case report with histopathological study]. Journal Francais D'ophtalmologie, 9(1), 35-39. [0174] Davis, N., & Ashery-Padan, R. (2008). Iris development in vertebrates; genetic and molecular considerations. Brain research, 1192, 17-28. https://doi.org/10.1016/j.brainres.2007.03.043 [0175] Elbashir, S. M., Lendeckel, W., & Tuschl, T. (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes & Development, 15(2), 188-200. [0176] Fares-Taie, L., Gerber, S., Tawara, A., Ramirez-Miranda, A., Douet, J.-Y., Verdin, H., Guilloux, A., Zenteno, J. C., Kondo, H., Moisset, H., Passet, B., Yamamoto, K., Iwai, M., Tanaka, T., Nakamura, Y., Kimura, W., Bole-Feysot, C., Vilotte, M., Odent, S., . . . Rozet, J.-M. (2015). Submicroscopic Deletions at 13q32.1 Cause Congenital Microcoria. The American Journal of Human Genetics, 96(4), 631-639. https://doi.org/10.1016/j.ajhg.2015.01.014 [0177] Gould, D. B., Smith, R. S., & John, S. W. M. (2004). Anterior segment development relevant to glaucoma. International Journal of Developmental Biology, 48(8-9), 1015-1029. https://doi.org/10.1387/ijdb.041865dg [0178] Hannon, G. J. (2002). RNA interference. Nature, 418(6894), 244-251. https://doi.org/10.1038/418244a [0179] Holliger, P., & Hudson, P. J. (2005). Engineered antibody fragments and the rise of single domains. Nature Biotechnology, 23(9), 1126-1136. https://doi.org/10.1038/nbt1142 [0180] Holwerda, S. J. B., & de Laat, W. (2013). CTCF: The protein, the binding partners, the binding sites and their chromatin loops. Philosophical Transactions of the Royal Society B: Biological Sciences, 368(1620), 20120369. https://doi.org/10.1098/rstb.2012.0369 [0181] Iida, A., Tanaka, T., & Nakamura, Y. (2003). High-density SNP map of human ITR, a gene associated with vascular remodeling. Journal of Human Genetics, 48(4), 170-172. https://doi.org/10.1007/s10038-003-0002-x [0182] Jia, Y., Yue, Y., Hu, D.-N., Chen, J.-L., & Zhou, J.-B. (2017). Human aqueous humor levels of transforming growth factor-β2: Association with matrix metalloproteinases/tissue inhibitors of matrix metalloproteinases. Biomedical Reports. https://doi.org/10.3892/br.2017.1004 [0183] Kabat, E. A., National Institutes of Health (U.S.), & Columbia University. (1991). Sequences of proteins of immunological interest. U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health. [0184] Kaczmarczyk, S. J., Sitaraman, K., Young, H. A., Hughes, S. H., & Chatterjee, D. K. (2011). Protein delivery using engineered virus-like particles. Proceedings of the National Academy of Sciences of the United States of America, 108(41), 16998-17003. https://doi.org/10.1073/pnas.1101874108 [0185] Kasetti, R. B., Maddineni, P., Millar, J. C., Clark, A. F., & Zode, G. S. (2017). Increased synthesis and deposition of extracellular matrix proteins leads to endoplasmic reticulum stress in the trabecular meshwork. Scientific Reports, 7(1). https://doi.org/10.1038/s41598-017-14938-0 [0186] Lan, X., Wen, L., Li, K., Liu, X., Luo, B., Chen, F., Xie, D., & Kung, H. (2011). Comparative analysis of duplicated sox21 genes in zebrafish. Development, Growth & Differentiation, 53(3), 347-356. https://doi.org/10.1111/j.1440-169X.2010.01239.x [0187] Le Gall, F., Reusch, U., Little, M., & Kipriyanov, S. M. (2004). Effect of linker sequences between the antibody variable domains on the formation, stability and biological activity of a bispecific tandem diabody. Protein Engineering Design and Selection, 17(4), 357-366. https://doi.org/10.1093/protein/gzh039 [0188] Matsuda, S., Kuwako, K. -i., Okano, H. J., Tsutsumi, S., Aburatani, H., Saga, Y., Matsuzaki, Y., Akaike, A., Sugimoto, H., & Okano, H. (2012). Sox21 Promotes Hippocampal Adult Neurogenesis via the Transcriptional Repression of the Hes5 Gene. Journal of Neuroscience, 32(36), 12543-12557. https://doi.org/10.1523/JNEUROSCI.5803-11.2012 [0189] Mazzeo, V., Gaiba, G., & Rossi, A. (1986). Hereditary cases of congenital microcoria and goniodysgenesis. Ophthalmic Paediatrics and Genetics, 7(2), 121-125. https://doi.org/10.3109/13816818609076120 [0190] McBurney, S. P., Young, K. R., Nwaigwe, C. I., Soloff, A. C., Cole, K. S., & Ross, T. M. (2006). Lentivirus-like particles without reverse transcriptase elicit efficient immune responses. Current HIV Research, 4(4), 475-484. https://doi.org/10.2174/157016206778560018 [0191] McManus, M. T., Petersen, C. P., Haines, B. B., Chen, J., & Sharp, P. A. (2002). Gene silencing using micro-RNA designed hairpins. RNA (New York, N.Y.), 8(6), 842-850. https://doi.org/10.1017/s1355838202024032 [0192] Munemasa, Y., & Kitaoka, Y. (2013). Molecular mechanisms of retinal ganglion cell degeneration in glaucoma and future prospects for cell body and axonal protection. Frontiers in Cellular Neuroscience, 6. https://doi.org/10.3389/fncel.2012.00060 [0193] Muratori, C., Bona, R., & Federico, M. (2010). Lentivirus-based virus-like particles as a new protein delivery tool. Methods in Molecular Biology (Clifton, N.J.), 614, 111-124. https://doi.org/10.1007/978-1-60761-533-0_7 [0194] Pauls, S., Smith, S. F., & Elgar, G. (2012). Lens development depends on a pair of highly conserved Sox21 regulatory elements. Developmental Biology, 365-248(1), 310-318. https://doi.org/10.1016/j.ydbio.2012.02.025 [0195] Pozza, E., Verdin, H., Deconinck, H., Dheedene, A., Menten, B., De Baere, E., & Balikova, I. (2020). Microcoria due to first duplication of 13q32.1 including the GPR180 gene and maternal mosaicism. European Journal of Medical Genetics, 63(5), 103918. https://doi.org/10.1016/j.ejmg.2020.103918 [0196] Prendes, M. A., Harris, A., Wirostko, B. M., Gerber, A. L., & Siesky, B. (2013). The role of transforming growth factor β in glaucoma and the therapeutic implications. British Journal of Ophthalmology, 97(6), 680-686. https://doi.org/10.1136/bjophthalmol-2011-301132 [0197] Quigley, H. A. (2011). Glaucoma. Lancet (London, England), 377(9774), 1367-1377. https://doi.org/10.1016/S0140-6736(10)61423-7 [0198] Raisner, R., Kharbanda, S., Jin, L., Jeng, E., Chan, E., Merchant, M., Haverty, P. M., Bainer, R., Cheung, T., Arnott, D., Flynn, E. M., Romero, F. A., Magnuson, S., & Gascoigne, K. E. (2018). Enhancer Activity Requires CBP/P300 Bromodomain-Dependent Histone H3K27 Acetylation. Cell Reports, 24(7), 1722-1729. https://doi.org/10.1016/j.celrep.2018.07.041 [0199] Ramirez-Miranda, A., Paulin-Huerta, J. M., Chavez-Mondragón, E., Islas-de la Vega, G., & Rodriguez-Reyes, A. (2011). Ultrabiomicroscopic-Histopathologic Correlations in Individuals with Autosomal Dominant Congenital Microcoria: Three-Generation Family Report. Case Reports in Ophthalmology, 2(2), 160-165. https://doi.org/10.1159/000328751 [0200] Ramprasad, V. L., Sripriya, S., Ronnie, G., Nancarrow, D., Saxena, S., Hemamalini, A., Kumar, D., Vijaya, L., & Kumaramanickavel, G. (2005). Genetic homogeneity for inherited congenital microcoria loci in an Asian Indian pedigree. Molecular Vision, 7. [0201] Reff, M. E., & Heard, C. (2001). A review of modifications to recombinant antibodies: Attempt to increase efficacy in oncology applications. Critical Reviews in Oncology/Hematology, 40(1), 25-35. https://doi.org/10.1016/s1040-8428(01)00132-9 [0202] Reiter, Y., Brinkmann, U., Lee, B., & Pastan, I. (1996). Engineering antibody Fv fragments for cancer detection and therapy: Bisulfide-stabilized Fv fragments. Nature Biotechnology, 14(10), 1239-1245. https://doi.org/10.1038/nbt1096-1239 [0203] Rouillac, C., Roche, O., Marchant, D., Bachner, L., Kobetz, A., Toulemont, P.-J., Orssaud, C., Urvoy, M., Odent, S., Le Marec, B., Abitbol, M., & Dufier, J.-L. (1998). Mapping of a Congenital Microcoria Locus to 13q31-q32. The American Journal of Human Genetics, 62(5), 1117-1122. https://doi.org/10.1086/301841 [0204] Sergouniotis, P. I., Ellingford, J. M., O'Sullivan, J., Fenerty, C. H., & Black, G. C. (2017). Genome sequencing identifies a large deletion at 13q32.1 as the cause of microcoria and childhood-onset glaucoma. Acta Ophthalmologica, 95(3), e249-e250. https://doi.org/10.1111/aos.13246 [0205] Simpson, W. A., & Parsons, M. A. (1989). The ultrastructural pathological features of congenital microcoria. A case report. Archives of Ophthalmology (Chicago, Ill.: 1960), 107(1), 99-102. https://doi.org/10.1001/archopht.1989.01070010101036 [0206] Tawara, A., Itou, K., Kubota, T., Harada, Y., Tou, N., & Hirose, N. (2005). Congenital Microcoria Associated With Late-Onset Developmental Glaucoma. Journal of Glaucoma, 14(5), 409-413. https://doi.org/10.1097/01.ijg.0000176931.29477.6e [0207] Tham, Y.-C., Li, X., Wong, T. Y., Quigley, H. A., Aung, T., & Cheng, C.-Y. (2014). Global prevalence of glaucoma and projections of glaucoma burden through 2040: A systematic review and meta-analysis. Ophthalmology, 121(11), 2081-2090. https://doi.org/10.1016/j.ophtha.2014.05.013 [0208] Toulemont, P. J., Urvoy, M., Coscas, G., Lecallonnec, A., & Cuvilliers, A. F. (1995). Association of Congenital Microcoria with Myopia and Glaucoma. Ophthalmology, 102(2), 193-198. https://doi.org/10.1016/S0161-6420(95)31036-6 [0209] Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P., & Sharp, P. A. (1999). Targeted mRNA degradation by double-stranded RNA in vitro. Genes & Development, 13(24), 3191-3197. https://doi.org/10.1101/gad.13.24.3191 [0210] Uchikawa, M., Kamachi, Y., & Kondoh, H. (1999). Two distinct subgroups of Group B Sox genes for transcriptional activators and repressors: Their expression during embryonic organogenesis of the chicken. Mechanisms of Development, 84(1-2), 103-120. https://doi.org/10.1016/s0925-4773(99)00083-0 [0211] Vranka, J. A., Kelley, M. J., Acott, T. S., & Keller, K. E. (2015). Extracellular matrix in the trabecular meshwork: Intraocular pressure regulation and dysregulation in glaucoma. Experimental Eye Research, 133, 112-125. https://doi.org/10.1016/j.exer.2014.07.014 [0212] Weiss, A. H. (2003). Unilateral high myopia: Optical components, associated factors, and visual outcomes. British Journal of Ophthalmology, 87(8), 1025-1031. https://doi.org/10.1136/bjo.87.8.1025 [0213] Wordinger, R. J., Sharma, T., & Clark, A. F. (2014). The Role of TGF-β2 and Bone Morphogenetic Proteins in the Trabecular Meshwork and Glaucoma. Journal of Ocular Pharmacology and Therapeutics, 30(2-3), 154-162. https://doi.org/10.1089/jop.2013.0220 [0214] Young, N. M., MacKenzie, C. R., Narang, S. A., Oomen, R. P., & Baenziger, J. E. (1995). Thermal stabilization of a single-chain Fv antibody fragment by introduction of a disulphide bond. FEBS Letters, 377(2), 135-139. https://doi.org/10.1016/0014-5793(95)01325-3 [0215] Zapata, G., Ridgway, J. B. B., Mordenti, J., Osaka, G., Wong, W. L. T., Bennett, G. L., & Carter, P. (1995). Engineering linear F(ab′)2 fragments for efficient production in Escherichia coli and enhanced antiproliferative activity. Protein Engineering, Design and Selection, 8(10), 1057-1062. https://doi.org/10.1093/protein/8.10.1057 [0216] Zeimer, R., Asrani, S., Zou, S., Quigley, H., & Jampel, H. (1998). Quantitative detection of glaucomatous damage at the posterior pole by retinal thickness mapping. A pilot study. Ophthalmology, 105(2), 224-231. https://doi.org/10.1016/s0161-6420(98)92743-9 [0217] Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., & Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR-Cas system. Cell, 163(3), 759-771. https://doi.org/10.1016/j.ce11.2015.09.038