AN IMPROVED MEASLES VIRUS VACCINE VECTOR BASED ON MULTIPLE TANDEM ADDITIONAL TRANSCRIPTION UNITS (ATUS)

Abstract

The application generally relates to enhanced recombinant nucleic acid constructs comprising a cDNA molecule encoding a full length antigenomic (+) RNA strand of a non-segmented negative-sense single-stranded RNA virus for expressing at least one heterologous polypeptide, protein, antigen, or antigenic fragment thereof. The application more particularly relates to constructs with multiple ATUs localized within a single intergenic region of a virus. The application also relates to the association between a construct with multiple ATUs and BAG plasmid to facilitate the introduction and expression of large inserts.

Claims

1. A nucleic acid construct which comprises a cDNA molecule encoding a full length antigenomic (+) RNA strand of a non-segmented negative-sense single-stranded RNA virus, especially of a measles virus (MV), wherein the cDNA molecule further comprises inserted therein, at least a first additional transcription unit (ATU) and a second additional transcription unit (ATU), wherein the at least first and second additional transcription units (ATUs) are localized within a single intergenic region of the cDNA encoding the antigenomic (+) RNA strand as a single expression cassette, and wherein each ATU comprises a heterologous polynucleotide operably inserted within the ATU allowing the expression of a heterologous polypeptide encoded by the heterologous polynucleotide.

2. The nucleic acid construct of claim 1, wherein the non-segmented negative-sense single-stranded RNA virus is a measles virus (MV) originating from an attenuated strain, in particular an attenuated virus strain selected from the group consisting of the Schwarz strain, the Zagreb strain, the AIK-C strain, the Moraten strain, the Philips strain, the Beckenham 4A strain, the Beckenham 16 strain, the Edmonston seed A strain, the Edmonston seed B strain, the CAM-70 strain, the TD 97 strain, the Leningrad-16 strain, the Shanghai 191 strain and the Belgrade strain, preferably the Schwarz strain, the AIK-C strain and the Zagreb strain, in particular the Schwarz strain of SEQ ID No. 62, the AIK-C strain of SEQ ID No. 58 and the Zagreb strain of SEQ ID No. 59.

3. The nucleic acid construct of claim 1, wherein the first ATU and the second ATU are localized: (i) between the P gene and the M gene of the measles virus in the cDNA molecule or (ii) between the H gene and the L gene of the measles virus in the cDNA molecule or (iii) between the N gene of the measles virus and the T7RNA polymerase promoter in the cDNA molecule, and optionally wherein the number of consecutive nucleotides in the nucleic acid construct is a multiple of six and/or wherein the number of consecutive nucleotides in the recombinant cDNA molecule is a multiple of six.

4. The nucleic acid construct according to claim 1, wherein the first ATU and/or the second ATU comprises the nucleotide sequence of SEQ ID No. 1 wherein the nucleotide sequence from position 79 to position 796 is substituted by a heterologous polynucleotide sequence encoding a heterologous polypeptide, in particular wherein said heterologous polynucleotides in the first ATU and the second ATU encode heterologous polypeptides that are different from each other and optionally wherein the first and the second heterologous polynucleotides are separated in the single intergenic region of the cDNA by a spacer sequence such as the sequence of polynucleotide of SEQ ID No. 2 or SEQ ID No. 11.

5. The nucleic acid construct according to claim 1, wherein the first ATU and/or the second ATU comprises its 5′ end towards its 3′ end of (i) the nucleotide sequence of SEQ ID No. 16 or SEQ ID No. 19 or SEQ ID No. 20 or SEQ ID No. 40 or SEQ ID No. 41 or SEQ ID No. 42 or SEQ ID No. 43 or SEQ ID No. 44 or SEQ ID No. 45, (ii) a heterologous polynucleotide sequence encoding a heterologous polypeptide, and (iii) the nucleotide sequence of SEQ ID No. 17 or SEQ ID No. 46 or SEQ ID No. 47 or SEQ ID No. 48 or SEQ ID No. 49 or SEQ ID No. 50 or SEQ ID No. 51; or wherein the first ATU and/or the second ATU comprises the nucleotide sequence of SEQ ID No. 52, SEQ ID No. 53, SEQ ID No. 54, SEQ ID No. 55, SEQ ID No. 56, SEQ ID No. 57, wherein n corresponds to a heterologous polynucleotide sequence encoding a heterologous polypeptide, and wherein the heterologous polynucleotides present within the first ATU is different from the heterologous polynucleotide presents within the second ATU, and optionally wherein the first and the second heterologous polynucleotides are separated in the single intergenic region of the cDNA by a spacer sequence such as the sequence of polynucleotide of SEQ ID No. 2 or SEQ ID No. 11.

6. The nucleic acid construct according to claim 1, wherein a third ATU is localized within the same intergenic region where the first ATU and the second ATU are localized, the third ATU comprising a heterologous polynucleotide operably linked within the third ATU allowing the expression of a heterologous polypeptide encoded by the heterologous polynucleotide wherein said heterologous polypeptide of the third ATU is different from the heterologous polypeptides encoded by the first and the second ATUs, and wherein heterologous polynucleotides within a single intergenic region of the cDNA are separated from each other by a spacer sequence comprising or consisting of the polynucleotide of SEQ ID No. 2 or SEQ ID No. 11.

7. The nucleic acid construct according to claim 5, wherein the third ATU (i) comprises or consists in the nucleotide sequence of SEQ ID No. 1 wherein the nucleotide sequence from position 79 to position 796 is substituted by a heterologous polynucleotide sequence encoding a heterologous polypeptide; in particular the third ATU comprises of consists in the same nucleotide sequence as the first ATU or the second ATU but for the coding heterologous polynucleotide that is contains, and (ii) wherein the heterologous polynucleotide of the third ATU is separated from another heterologous polynucleotide inserted within the closest ATU in the single intergenic region of the cDNA by the polynucleotide of sequence SEQ ID No. 2 or SEQ ID No. 11.

8. The nucleic acid construct according to claim 1, wherein each of the first ATU and the second ATU and when present the third ATU comprises a heterologous polynucleotide that encodes a heterologous polypeptide that is different from the heterologous polypeptide encoded by the other ATUs and optionally wherein the heterologous polynucleotide or at least one of the ATUs, in particular of at least two ATUs or of all the ATUs, encodes multiple heterologous polypeptides.

9. The nucleic acid construct according to claim 1, wherein the heterologous polypeptides encoded by the heterologous polynucleotides inserted within the ATUs are immunogenic polypeptides originating from or derived from at least one pathogen infecting human, in particular from at least one virus infecting human, in particular the Chikungunya virus, the West Nile virus, the Zika virus, the SARS virus, the coronavirus, and/or the HIV, in particular a heterologous polypeptide comprising the C, E2 and E1 proteins of the Chikungunya virus, the sE protein of the West Nile virus, the prME protein of the Zika virus, the S and M proteins of the SARS virus and/or the S and M proteins of the coronavirus, in particular the S and M proteins of the SARS-CoV-2, and optionally wherein the heterologous polynucleotides originate or derive from different virus types.

10. The nucleic acid construct according to claim 1, wherein the intergenic region localized between the P gene and the M gene of the measles virus comprises the nucleotide sequence of SEQ ID No. 4.

11. A recombinant bacterial artificial chromosome (BAC) plasmid wherein the nucleic acid construct according to claim 1 is operably cloned.

12. The recombinant BAC plasmid according to claim 11, wherein the BAC nucleotide sequence is devoid of (i) a T7RNA polymerase promoter and/or of a CMV promoter and/or (ii) cloning sites that are present in the ATU sequences.

13. The recombinant BAC plasmid according to claim 11, wherein the bacterial artificial chromosome plasmid is selected from the group consisting of the pSMART BAC plasmid and its derivatives, pEZ-BAC plasmid, pBeloBAC11 plasmid, pBACe3.6, pBAC/OriV, pBAC-RT, pHA1, pHA2, pTARBAC2 and its derivatives, and the pBAC contruct inserted in Transmissible gastroenteritis coronavirus (TGEV), in particular is a pSMAC BAC, pEZ-BAC and pBeloBAC11 plasmid, in particular is the pSMAC-BAC plasmid, in particular comprises the polynucleotide of SEQ ID No. 3.

14. The recombinant BAC plasmid according to claim 1, wherein the promoter sequences localized on the recombinant BAC plasmid are different from the promoter sequences localized on the cDNA molecule.

15. The nucleic acid construct according to claim 1, wherein the first ATU and the second ATU comprise or consist of different polynucleotides that are selected among polynucleotides encoding heterologous polypeptides comprising or consisting of amino acid sequences of to SEQ ID No. 13 and SEQ ID No. 14, or selected among polynucleotides encoding heterologous polypeptides comprising or consisting of amino acid sequences of SEQ ID No. 13 and SEQ ID No. 15, and wherein the first heterologous polynucleotide and the second heterologous polynucleotide are separated by a spacer polynucleotide comprising or consisting in the nucleotide sequence of SEQ ID No. 2 or SEQ ID No.11.

16. The nucleic acid construct according to claim 1 and comprising a third ATU, wherein the first ATU, the second ATU and the third ATU comprise(s) or consist(s) of different polynucleotides encoding heterologous polypeptides comprising or consisting of amino acid sequences that are selected among SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15, and wherein the heterologous polynucleotides are separated by a spacer polynucleotide comprising or consisting in the nucleotide sequence of SEQ ID No. 2 or SEQ ID No. 11.

17. The nucleic acid construct according to claim 1, wherein the intergenic region localized between the P gene and the M gene of the measles virus in the cDNA molecule comprises all the ATUs, and wherein the heterologous polynucleotides inserted in the intergenic region are separated by a spacer polynucleotide comprising or consisting of SEQ ID No. 2 or SEQ ID No. 11.

18. A recombinant infectious non-segmented negative-sense single-stranded RNA virus, especially a recombinant infectious Measles virus, wherein the genome of said recombinant infectious virus comprises a nucleic acid construct according to claim 1.

19. A process for rescuing recombinant infectious non-segmented negative-sense single-stranded RNA virus, especially recombinant infectious measles virus expressing at least one heterologous polypeptide expressed from a heterologous nucleotide sequence inserted within an ATU localized within a cDNA molecule encoding a full length antigenomic (+) RNA strand of a measles virus (MV); comprising: (a) In cells, in particular HEK293 helper cells, stably expressing T7 RNA polymerase and measles virus N and P proteins and/or transfected with an expression vector encoding T7 RNA polymerase and/or transfected with an expression vector encoding measles virus N and P proteins, transfecting the nucleic acid construct according to claim 1; (b) Maintaining the transfected cells of step (a) in conditions suitable for the production of recombinant infectious virus and/or virus like particles; (c) Infecting cells, in particular Vero cells, in conditions enabling the propagation of the recombinant infectious virus by co-cultivating these cells with the cells issued from step (b); in particular at 32° C.; (d) Harvesting the recombinant infectious virus and/or virus like particles, in particular at 32° C.

20. A seed preparation or a stock preparation of a recombinant infectious non-segmented negative-sense single-stranded RNA virus, especially of a recombinant infectious measles virus that consists of a single virus clone or respectively an amplified single virus clone of a recombinant infectious virus rescued by reverse genetics from the nucleic acid construct according to claim 1.

21. A vaccine which comprises a clonally selected and amplified recombinant infectious negative-sense single-stranded RNA virus, clonally selected and amplified recombinant infectious measles virus obtainable from the rescue by reverse genetics of the nucleic acid construct according to claim 1.

22. A vaccine which enables stable expression of multiple heterologous polypeptides from the nucleic acid construct according to claim 1, wherein such stable expression is characterized by being maintained over at least 12 passages of the rescued recombinant infectious negative-sense single-stranded RNA virus when amplified on Vero cells, especially of the amplified recombinant infectious measles virus.

23. A combination vaccine which comprises a recombinant measles virus which encodes at least two immunogenic polypeptides originating from or derived from distinct pathogens infecting human, in particular from at least two viruses selected from the group of Chikungunya virus, West Nile virus and Zika virus, wherein the immunogenic polypeptides are expressed as individual polypeptides by the recombinant virus.

24. (canceled)

25. Ribonucleoprotein of a recombinant measles virus strain which comprises a RNA genome assembled with the transcriptase complex proteins of the measles virus wherein the genome contains the recombinant full length antigenomic (+) RNA strand of the measles virus (MV) and inserted therein, sequences encoding at least a first additional transcription unit (ATU) and a second additional transcription unit (ATU), wherein the at least first and second additional transcription units (ATUs) are localized within a single intergenic region of the recombinant antigenomic (+) RNA strand as a single expression cassette, and wherein each ATU comprises a heterologous polynucleotide operably inserted within the ATU allowing the expression of a heterologous polypeptide encoded by the heterologous polynucleotide as disclosed in claim 1.

Description

SHORT DESCRIPTION OF THE DRAWINGS

[0189] These and further aspects of the invention will be explained in greater detail by way of examples and with reference to the accompanying drawings in which:

[0190] FIG. 1: Schematic diagram of measles virus and its non-segment negative RNA, genome, structural proteins (N, nucleoprotein; P, phosphoprotein; M, matrix protein; F, fusion protein; H, hemaglutinin; L, Large polymerase), and accessory proteins (C and V protein) in the vector (pTM-MVSchw) containing an additional transcript unit (ATU). T7, T7RNA polymerase promoter; hh, hammerhead ribozyme; δ, hepatitis delta virus (HDV) genome ribozyme; T7t, T7RNA polymerase terminator.

[0191] FIG. 2. Schematic illustration of measles virus and its non-segment negative RNA wherein several different ATUs have been incorporated. From A) to G), several embodiments are illustrated where the localization of the ATUs are different. ATU references (e.g. ATU1, ATU2 ATU3, etc.) do not involve a particular order, and/or a correspondence to the ATUs disclosed in prior art, wherein ATU1 is usually localized upstream the N gene of the MV genome, ATU2 is localized between genes P and M of the MV genome, and ATU3 is localized between the H and L genes of the MV genome. The numeric reference associated to each ATU has herein only an illustrative purpose, to clearly illustrate that a plurality of ATUs may be localized between a single intergenic region of the MV genome or between multiple intergenic regions of the MV genome, but these ATUs may have a different structure, or share the same structure as detailed in the description of the invention, and may or may not be equivalent to the ATUs disclosed in prior art.

[0192] FIG. 3. pSMART-BACv2 plasmid (Lucigen) genomic map. The vector incorporates controllable genetic elements that allow the single copy BAC to be amplified in vivo; ori2 (oriS) origin of replication, repE gene, and sopABC partition loci. The vector also carries the oriV medium-copy origin of replication for arabinose inducible promoter. The schematic also indicates the targeted features/restriction sites (underlined in red) that are modified by either removal of the region, T7 promoter, or site-directed mutagenesis to abolish the restriction sites, BssHII, SalI and FseI, allowing further insertion of targeted genes into ATU2 on MV vector.

[0193] FIG. 4. Modified pSMAC-BAC plasmid map with T7 promoter between SwaI and NotI sites removed and replaced with chimeric intron region amplified from pCI-Neo. The two sites of BssHII, position 3396 and 4540 were site-directed mutated from C3397 to A and G4542 to A while keeping the same encoding amino acid. To allow insertion of genes in the ATU2 and ATU3 simultaneously, SalI (position 6195) and FseI (position 1021) restriction sites were also site-directed mutated from T 6196 to A and G1020 to C.

[0194] FIG. 5: A) pSMART-BAC-2.0 (Lucigen) and its modifications to generate pSMAC-BAC. B) pTM-MV map. C) pSMAC-MV map.

[0195] FIG. 6. pSMAC-MV plasmid map; blue box indicates pSMAC vector backbone, grey box indicates the antigenome of Schwarz MV with each measles gene shown in light yellow boxes with translation elements in green boxes.

[0196] FIG. 7: Introduction of fluorescence genes into ATU2 of pSMAC-MV into BsiWI and BssHII restriction sites of ATU2. A) Intergenic sequence: fragment 3331-3392 of MV Schwarz genomic sequence with single nucleotide change T to A at position 3365 to mutate SalI restriction site was linked to fragment 1735-1802 of MV Schwarz genomic sequence containing the CTT start-stop signal and P promoter. Two restriction sites (6-base and 8-base respectively) were added at the 5′ and 3′ end of the intergenic sequence. The unique BstBI and FseI restriction sites were added to facilitate further insertion of additional genes. B) The encoding sequences of fluorescent GFP and mCherry proteins were added on both sides of the intergenic sequence and the whole fragment was introduced into ATU2 of pSMAC-MV to allow GFP and mCherry expression simultaneously from ATU2.

[0197] FIG. 8: pSMAC-MV-GFP-mCherry (pSMAC-MV-GM) plasmid map. The additional fluorescent genes were added at the ATU2 position between measles virus P and M genes. The GFP gene is indicated in green and the mCherry gene in red with the intergenic region (144 bp) between BstBI and FseI sites.

[0198] FIG. 9: Average syncytia counts after recovery of MV-GFP-mCherry comparing between pSMAC and pTM vectors. The experiments were performed in triplicate and 3 biological repeats.

[0199] FIG. 10: A) Intergenic sequence with possibility of any unique 6- or 8-nucleotide restriction site to facilitate the swapping of genes in the multiple ATU. B) Schematic map of pSMAC-MV with multiple ATUs inserted in ATU2 BsiWI/BssHII enabling 3 additional genes expressed separately in the same position of recombinant virus.

[0200] FIG. 11. Schematic diagram of a measles virus according of FIG. 1. The pSMAC-MV vector contains three antigenic sequences from CHIKV, WNV and ZIKV with intergenic sequences in between, and inserted between the P gene and the M gene of the MV genome, the MV being inserted within a BAC, as illustrated in FIG. 1. CHIKV: Chikungunya Virus—WNV: West Nile Virus—ZIKV: Zika Virus ZIKV with intergenic sequences in between them corresponding to SEQ ID No. 2.

[0201] FIG. 12. Cloning strategy for pSMAC-MV-CIWIZ plasmid containing 3 immunogens of CHIKV, WNV and ZIKV plus intergenic sequences inserted in ATU2. A) Cloning strategy for the multiple antigens to achieve construct 2 (CHIKV and WNV) and construct 3 (CHIKV and ZIKV). This first step was done using extension PCR. B) Cloning steps to achieve the multivalent construct to ligate the CHIKV fragment to the WNV and ZIKV fragment through Sbfl site, giving the triple antigens construct that can be inserted into ATU2 using restriction enzymes, BsiWI and BssHII.

[0202] FIG. 13. Schematic map of pSMAC-MV-CIWIZ (CHIKV-WNV-ZIKV) vector plasmid. CHIKV, WNV and ZIKV genes are represented in orange, blue and green arrows respectively. The intergenic region or ATU 2.1 and 2.2 are indicated in pink boxes. Total size of pSMAC-MV-CIWIZ is 31676 bp.

[0203] FIG. 14. Schematic representation of additional constructs with polynucleotides encoding three immunogens of CHIKV, WNV and ZIKV inserted into pSMAC-MVschw into ATU2 and/or ATU1. In construct 1) (referenced pSMAC-2CHIK-3WIZ) CHIKV antigen is encoded by a polynucleotide inserted into ATU2 and WNV and ZIKV antigens are encoded by a polynucleotide inserted into ATU3 wherein the polynucleotide comprises an intergenic region between these two antigens, the intergenic region comprising the end of a first ATU as described herein, and the beginning of a second and subsequent ATU as described herein. In construct 2) (referenced pSMAC3-CIWIZ), all three antigens are encoded by a polynucleotide inserted into ATU3 wherein the polynucleotide comprises an intergenic region between the antigens, each intergenic region comprising the end of a first ATU as described herein, and the beginning of a second and subsequent ATU as described herein.

[0204] FIG. 15. Schematic representation of cloning strategy for creating pSMAC with CHIKV gene in the ATU2 and WNV gene and ZIKV gene interspaced by an intergenic region in the ATU3 (i.e. the construct referenced pSMAC-2CHIK-3WIZ in the present description). The required fragments were amplified separately from different plasmids and then reassembled into a SalI-BssHII open pSMAC3-MV vector.

[0205] FIG. 16. Schematic representation of pSMAC-MV vector containing three antigenic sequences from CHIKV, WNV and ZIKV with intergenic sequences in between, and inserted into ATU3. This vector has the sequence of SEQ ID No. 64 and is referenced pSMAC3-CIWIZ in the present description.

[0206] FIG. 17. Schematic representation of pSMAC-MV vector containing one antigenic sequence from CHIKV inserted into ATU2 and two antigenic sequences from WNV and ZIKV inserted into ATU3. This vector has the sequence of SEQ ID No. 63 and is referenced pSMAC-2CHIK-3WIZ in the present description.

[0207] FIG. 18. Western Blot analysis of cell lysates from Vero cells infected with bivalent or trivalent recombinant measles viruses. Control cell lysates were from Vero cells infected with MV-CHIK, MV-WNV and MV-ZIKV separately. For CHIKV antigens, anti-CHIK-E1 antibody detecting the E1 envelope protein (50 KDa) was used. For WNV and ZIKV antigens, the anti-flavivirus envelope protein (clone 4G2) was used to detect WNV secreted envelope protein (50 KDa) and ZIKV surface envelope protein (60 KDa). All the clones with the red stars were positive for the antigens expression and were chosen for amplifying viral stocks and further analysis.

[0208] FIG. 19. Growth kinetics of recombinant MV constructs in Vero cells infected at an MOI of 0.1. Cell-associated virus titers are indicated in TCID.sub.50/ml. A and B represent two different set of viruses rescued comparing to MV-Schwarz and MVs with single antigen control.

[0209] FIG. 20. Homologous prime-boost immunization of IFNAR −/− mice (n=6; or n=4 when a single antigen is encoded within the MV and for MV control). Mice were immunized intraperitoneally with 1×10.sup.5 TCID50 of the indicated recombinant MV at days 0 and 30. Sera were collected 30 and 51 days after immunization.

[0210] FIG. 21. Humoral responses detected in mice sera using specific ELISA to detect antibodies to the three different antigens encoded within constructs according to the invention and listed on the right hand of the figure. Prime/boost vaccination is analysed by measuring antibody responses against A) MV antigens, B) CHIKV-E protein, C) ZIKV-protein or D) WNV-secreted E protein. The data show the reciprocal endpoint dilution titers with each data point representing an individual animal.

[0211] FIG. 22. Harvest of MV-GFP grown on Vero CCL-81 cells cultured in VP-SFM medium without serum at 32 or 37° C. Virus was harvested from cells and medium and tittered by the TCID50 method. Different conditions of cell density were tested.

[0212] FIG. 23. Harvest of MV-GFP grown on Vero CCL-81 cells cultured in VP-SFM medium without serum at 32° C. Virus was harvested from medium and tittered by the TCID50 method.

[0213] FIG. 24. Schematic representation of the MV genome, wherein the promoter sequences and the terminator sequences of the genes of MV are highlighted. Promoter sequences and terminator sequences of (i) the gene N are in red; (ii) the gene P are in green; (iii) the gene M are in orange; (iv) the gene H are in dark blue; (v) of the gene L are in black. These regulatory sequences may be used in the ATUs according to the invention; the promoter sequence of a gene of the MV may be present within an ATU according to the invention, as well as the terminator sequence.

[0214] FIG. 25. Examples of ATUs suitable for insertion into the genome of a MV genome. Different ATUs are illustrated and correspond to ATUs designed for the expression of the heterologous polypeptide encoded by the heterologous polynucleotide inserted within each ATU present within the genome of a MV. The “CTT” codons in cyan corresponds to the START/STOP codon of the ATUs; the sequences in purple correspond to the promoter sequences of the ATUs, and are issued from the promoter sequences of the genes of MV; the sequences in orange correspond to restriction sites; the green sequences consists in the START codon and the STOP codon of the heterologous polynucleotides encoding the heterologous polypeptides to be inserted within the ATUs at the “insertion site”; the sequences in red correspond to the terminator sequences of the ATUs, and are issued from the terminator sequences of the genes of MV. (A). ATU with F promoter sequence issued from the promoter region of the gene F of MV and F terminator sequence issued from the terminator region of the gene F of MV; (B) ATU with H promoter sequence issued from the promoter region of the gene H of MV and H terminator sequence issued from the terminator region of the gene H of MV; (C) ATU with L promoter sequence issued from the promoter region of the gene L of MV and L terminator sequence issued from the terminator region of the gene L of MV; (D) ATU with M promoter sequence issued from the promoter region of the gene M of MV and M terminator sequence issued from the terminator region of the gene M of MV; (E) ATU with N promoter sequence issued from the promoter region of the gene N of MV and N terminator sequence issued from the terminator region of the gene N of MV; (F) ATU with P promoter sequence issued from the promoter region of the gene P of MV and M terminator sequence issued from the terminator region of the gene P of MV.

EXAMPLES OF THE INVENTION

[0215] Modification of pSMART-BAC

[0216] Commercially available pBAC or pSMART-BAC were previously used to clone several large non-segmented RNA viruses.sup.24. We used pSMART-BAC (Lucigen pSMART-BAC v2.0) to insert the full-length MV genome into NotI restriction sites (FIG. 3). However, several modifications of the original pSMART-BAC were first needed in order to allow a successful rescue of measles virus. First, the existing T7 promoter on pSMART-BAC needed to be removed to prevent interfering with the expression from the T7 promoter already present upstream of the MV full-length genome. Second, two BssHII sites on pSMART-BAC were mutated by site directed mutagenesis to abolish BssHII enzyme recognition while maintaining the same amino acid sequence to allow the insertion of heterologous sequences in the additional transcription units (ATUs).sup.3. Similarly, the SalI restriction site was also mutated by site directed mutagenesis to allow insertion of the heterologous genes into ATU2 and ATU3 at the same time. Lastly, the FseI restriction site was also mutated to enable the multiple gene insertion into a single ATU. The detailed modification of pSMART-BAC is described in the following:

[0217] 1. Removing T7 Promoter from the Mutated pSMART-BAC Plasmid

[0218] To remove the T7 promoter from pSMART-BAC-GFP plasmid, a 348 bp linker DNA was amplified from pCI-Neo to replace between SwaI and NotI sites (primers are indicated in Table 1). The mutated pSMART-BAC-GFP bacmid and the PCR fragment were digested with SwaI and NotI (Anza restriction system Invitrogen). After ligation, the pSMART-BAC-GFP plasmid mutated in BssHII sites and deleted of its T7 promoter was generated and named pSMAC-BAC (FIG. 4).

TABLE-US-00003 TABLE 1 primers used to remove T7 promoter from the pSMART-BAC-GFP plasmid Primer name Sequence 5′-3′ SEQ ID SwaI- TGATTTAAATTCGTTTAGTGAACCGTCAGATC 25 Neo NotI- TTGCGGCCGCAGTACTCTAGCCTTAAGAGCTG 26 Neo

[0219] 2. Site-Directed Mutagenesis of Two BssHII Sites in the pSMART-BAC-GFP Plasmid

[0220] pSMART plasmid contains two BssHII restriction sites, one in the sopA gene at position 3397 and another in the sopB gene at position 4542. Site-directed mutagenesis was carried out by using GeneART Site-Directed Mutagenesis PLUS kit (ThermoFisher Scientific). The primers were designed to replace nucleotide C3397-A and G4542-A and maintain the same in-frame amino acid (Table 2). Primers were mixed in order of MIX1, 2 μl of pSopA-fwd and pSopB-rev for reaction Tube 1, and MIX2, 2 μl of pSopB-fwd and pSopA-rev for reaction Tube 2. Site-directed mutagenesis reactions were prepared according to the manual and aliquot 20 μl for each reaction using Q5 High-Fidelity 2× Master Mix (NEB). The amplification step was performed with optimum extension times for Tube1 and tube 2 at, 3:33 min and 16 sec, respectively. The PCR products were analyzed on the gel electrophoresis with 7 kb and 500 bp for Tube1 and 2, respectively. The excised and purified bands were used for a 20-μl recombination reaction by adding 2 μl of PCR product from Tube 1 and 2, plus the addition of 8 μl DNase-RNase free water and GeneArt 2× Enzyme mix for 10 μl. The recombination reaction was stopped by adding 1 μl 0.5M EDTA. The product of this reaction (3 μl) was used to transform DH5aTH-T1R competent cells according to the manual and transformants were screened onto LB plate containing Chloramphenicol. The positive clones were picked for plasmid amplification and purification. The mutated clones were confirmed by BssHII digestion and sequencing.

TABLE-US-00004 TABLE 2 Primers used for site directed mutagenesis to remove BssHII restriction sites in pSMART Primer name Sequence 5′-3′ SEQ ID pSopB- CATTACTCCTACGCGAGCAATTAACGAATCC 21 fwd pSopB- GGATTCGTTAATTGCTGCCGTAGGAGTAATG 22 rev pSopA- ACCCAGGTTAGGCGCACTGTCAATAACTATG 23 fwd pSopA- CATAGTTATTGACAGTGCGCCTAACCTGGGT 24 rev

[0221] 3. Site-Directed Mutagenesis of SalI and FseI Restriction Sites in the pSMART-BAC Plasmid

[0222] To allow cloning genes or ATU cassette in the ATU2 and ATU3 simultaneously,

[0223] SalI restriction site in pSMART-BAC needed to be abrogated. Because the SalI restriction site is located in a non-coding region of the plasmid, it could be mutated without concern for in-frame amino acid sequence. The mutation changed the T6196-A. Because the FseI site of pSMART-BAC is located inside the OriV gene, we mutated G1020-C rendering 99.8% homology to the original OriV. Similarly, the site-directed mutagenesis was carried out using GeneART Site-Directed Mutagenesis PLUS kit (ThermoFisher Scientific). The primers were designed to replace nucleotide T6196-A and G1020-C(Table 2). The protocol used was the same as above with different extension times: 1 min 20 sec for TUBE1 and 2 min 35 sec for TUBE2. The mutated clones were confirmed by SalI and FseI digestions and sequencing.

[0224] The resulting plasmid was named pSMAC-BAC.

[0225] Construction of pSMAC-BAC Containing Full-Length MV Schwarz Infectious Genome

[0226] The nucleotide sequence of the full-length antigenomic (+) RNA strand of Schwarz measles virus together with T7 RNA polymerase promoter and hammerhead ribozyme sequences in 5′ and hepatitis delta ribozyme and T7 RNA polymerase terminator sequences in 3′ was inserted into the pSMAC-BAC plasmid. This sequence was simply excised from plasmid pTM-MVSchw using NotI restriction enzyme and cloned into NotI open pSMAC plasmid after alkaline phosphatase treatment to prevent self-ligation of the vector (FIG. 5). The resulting ligation reaction was used to transform NEB10 competent bacteria using manufacturer protocol. The positive clones were screened on LB/Chloramphenicol agar plates. Isolated clones were picked for plasmid amplification and purification and then sequenced to confirm the cloning. The resulting plasmid was named pSMAC-MV (FIG. 6).

[0227] Construction of pSMAC-BAC Containing Full-Length MV Infectious Genome with ATU Containing Fluorescent Proteins GFP and mCherry

[0228] To allow an easy observation of rescued virus and comparison between pTM and pSMAC rescue efficiency, we cloned into the pSMAC-BAC plasmid a recombinant MV full-length cDNA antigenomic sequence expressing simultaneously the GFP and the mCherry fluorescent proteins in a single position from ATU2 (FIG. 7). We first generated an intergenic sequence allowing the expression of two additional sequences from a single ATU (FIG. 7A). This sequence is composed of nucleotides 3331-3392 of MV Schwarz genomic sequence with a single T to A nucleotide change at position 3365 to mutate a SalI restriction site linked to nucleotides 1735-1802 of MV Schwarz genomic sequence containing the P promoter. Two restriction sites (6-base and 8-base respectively) were added at the 5′ and 3′ end of the intergenic sequence. Unique BstBI and FseI restriction sites were added to facilitate further insertion of additional genes. The encoding sequences of fluorescent GFP and mCherry proteins were added on both sides of this intergenic sequence and the whole fragment was introduced into BsiWI and BssHII sites of pSMAC-MV ATU2 to allow the simultaneous expression of GFP and mCherry from ATU2 (FIG. 7B). The resulting plasmid was named pSMAC-MV-GM (FIG. 8).

[0229] Recovery of infectious virus from pSMAC-MV-GM and comparison with pTM-MV-GM

[0230] To assess the efficiency of recovery of infectious recombinant virus from pSMAC-BAC compared to pTM, we used the previously described reverse genetics method with the helper cell line HEK293-T7-MV (use of the helper-cell-based rescue system is for example described by Radecke (Radecke et al., EMBO J., 1995, 14:5773-5784) and modified by Parks (Parks et al., J. Virol., 1999, 73:3560-3566)). After co-transfection of HEK293-T7-MV cells with 5 μg of vector plasmids together with 20 ng of pEMC-L plasmid and calcium phosphate in 35 mm dishes and heat shock at 42° C. for three hours. After 48-hour incubation, transfected cells were overlaid onto monolayers of Vero cells (ATCC CCL-81) on 10 cm petri dishes. Cells were then gently covered with carboxy-methyl-cellulose (CMC 50% in DMEM and 5% FCS) to allow single clonal syncytia appearance and to avoid spreading and multiplication of clones. pTM-MV-GFP-mCherry (pTM-MV-GM) was used as a comparison control. Rescue experiments were done in triplicate and three separate biological repeats were performed. After three days fluorescent syncytia were counted. Fluorescent infectious recombinant virus was rescued 15-50 times more efficiently from pSMAC-MV-GM than from pTM-MV-GM (FIG. 9). This demonstrates that pSMAC strongly enhances the recovery of recombinant MV because the sole difference is the backbone vector between pSMAC-MV-GM and pTM-MV-GM emphasizing the advantage of pBAC in rescue MV more efficiently.

[0231] pSMAC Plasmid Accommodates Larger Additional Sequences with Multiple Antigens Constructions

[0232] The versatility of MV recombinant vaccine vector has demonstrated a solid proof of principle in humans. Clinical trials with a measles-chikungunya vaccine candidate (MV-CHIKV) have shown the safety and the immunogenicity of this vaccine platform in volunteers with preexisting immunity to measles. The use of pSMAC-MV plasmid as MV vector makes it possible to insert larger additional sequences into MV antigenomic sequence as BAC plasmids are known to stably accommodate large amounts of DNA. To prove this concept, we generated a single pSMAC-MV recombinant vector able to express simultaneously three large immunogens from three distinct pathogens: CHIKV, WNV, and ZIKV. We inserted antigens that we previously identified as protective when expressed individually from single MV vectors. The pSMAC-MV-CHIKV-WNV-ZIKV triple-antigen construct (FIG. 13) contains 7476 bp additional nucleotides including the intergenic sequences, i.e. more than 3000 bp longer than the largest recombinant MV described so far.

[0233] The three antigens were inserted between P and M genes of MV vector as this position allows high expression of the additional transgenes. To express the three transgenes independently from this single position of MV genome, we added between each antigenic sequence an intergenic sequence based on MV cis-acting elements allowing their expression as standard MV genes. The intergenic sequence was designed to contain the essential elements, polyA tail and measles promoter and the CTT start-stop signal for MV polymerase. This intergenic sequence is a combination of N promoter (position 1734-1784) and a copied sequence of P/M intergenic region (position 3331-3409). Several restriction sites were also added to allow easy manipulation of genes within the multiple ATUs. The detailed sequences are depicted in FIGS. 10, 11 and 12.

[0234] Construction of Triple Antigens of CHIKV, WNV, and ZIKV with MV Intergenic Region

[0235] The amplification of the triple immunogens with intergenic region (FIG. 12) was performed by extension PCR using primers in Table 3. The fragment CHIKV-intergenic-WNV (CIW) was amplified in two-step extension PCR. First, CHIKV fragment was amplified using primers BsiWI-CHIKV and inter-anti-CHIKV using pTM2-CHIKV as template, while WNV fragment was amplified using primers inter-sens-Sbf1-WNV and WNV-BssHII with pTM-WNV as template. The PCR reactions were carried out using Q5 2× mastermix (NEB) protocol recommended by the manufacturer. Both PCR products were analyzed and purified for further use in the second PCR (FIG. 12). The final product of CIW was digested with BsiWI and BssHII restriction enzymes, and then ligated into the pSMAC-MV to generate pSMAC-MV-CIW with the double antigenic fragment CIW inserted into ATU2.

TABLE-US-00005 TABLE 3 Primers used for extension PCR in the construction of a triple antigens (CHIKV, WNV and  ZIKV) construct, with intergenic region of MV for individually expression of the antigens Primer SEQ name Sequence 5′-3′ ID BsiWI- TTACGTACGATGGAGTTCATCCCAACCCAAAC 27 CHIKV inter anti- ATAATGGATTTAGGTTGTACTAGTTGGGTCGACT 28 CHIKV GGCATGGGGTTGGCAGGTAAGTTGAGCTGTAGTT CGAACTATTAGTGCCTGCTGAACGACAC inter sens- AACCTAAATCCATTATAAAAAACTTAGGAACCAG 29 Sbfl-WNV GTCCACACAGCCGCCAGCCCATCAACCATCCACT CCCACGATTGGACCTGCAGGATGAGAGTTGTGTT TGTC inter anti- ATAATGGATTTAGGTTGTACTAGTTGGGTCGACT 30 WNV GGCATGGGGTTGGCAGGTAAGTTGAGCTGTAGTT CGAATTAGACAGCCTTCCCAAC inter sens- AACCTAAACCATTATAAAAAACTTAGGAACCAGG 31 ZIKV TCCACACAGCCGCCAGCCCATCAACCATCCACTC CCACGATTGGAGGCCGGCCATGGAGAAGAAGCGG AGAG WNV- TGAGCGCGCTTAGACAGCCTTCCCAAC 32 BssHII ZIKV- TTAGCGCGCTCATCAGGCAGACACG 33 BssHII Sbfl-WNV ATTCCTGCAGGATGAGAGTTGTGTTTGTC 34 Sbfl-ZIKV TTACCTGCAGGATGGAGAAGAAGCGGAGAG 35 BsiWI- TTACGTACGATGGAGAAGAAGCGGAGAG 36 ZIKV inter anti- ATAATGGATTTAGGTTGTACTAGTTGGGTCGACT 37 ZIKV GGCATGGGGTTGGCAGGTAAGTTGAGCTGTAGTT CGAATCATCAGGCAGACACGGCGGTGGAC inter sens- AACCTAAATCCATTATAAAAAACTTAGGAACCAG 38 Sbfl- GTCCACACAGCCGCCAGCCCATCAACCATCCACT CHIKV CCCACGATTGGACCTGCAGGATGGAGTTCATCCC AACCCAAAC CHIKV- TTAGCGCGCCTATTAGTGCCTGCTGAACGAC 39 BssHII

[0236] The WNV-intergenic-ZIKV fragment (WIZ) was created in the same manner using the primers Sbf-WNV and inter-anti-WNV with pTM-WNV as template, while primers inter-sens-ZIKV and BssHII-ZIKV using pCDNA-ZIKV as template. The combined WIZ fragment was further digested with Sbfl and BssHII restriction enzymes. The purified WIZ fragment was then ligated to the CIW fragment similarly cut to generate pSMAC-MV-CIWIZ containing the triple antigenic fragment CIWIZ inserted into ATU2 (FIG. 12). We have also generated in the same way the bivalent vaccine candidates CHIKV-inter-ZIKV (CIZ) and ZIKV-inter-CHIKV (ZIC) in the same pSMAC-MV vector. Plasmids were fully sequenced to control integrity of cloning.

[0237] The triple antigenic fragment of CIWIZ (CHIKV-intergenic-WNV-intergenic-ZIKA) was also cloned into the ATU3 (FIG. 14). First, the complete MV genome with GFP inserted within ATU3 was cloned into pSMAC using the NotI restriction enzyme. Then the CIWIZ fragment was inserted into ATU3 in place of GFP using BsiWI and BssHII restriction sites. The resulting construct is pSMAC-MV3-CIWIZ (or pSMAC3-CIWIZ).

[0238] In order to prove that the additional genes can be expressed simultaneously from ATU2 and ATU3, the CHIKV fragment was also cloned individually into ATU2 while the WIZ (WNV-intergenic-ZIKV) fragment was cloned into ATU3 (FIG. 14). The resulting construct is pSMAC-MV-2CHIKV-3WIZ (or pSMAC-2CHIKV-3WIZ).

[0239] Due to limitation of restriction enzymes sites in the antigenic fragments, the In-Fusion cloning technique was used to assemble the three fragments as depicted in FIG. 15. The vector pSMAC3-MV was cut with SalI and BssHII restriction enzymes while the CHIKV fragment was amplified from pTM2-CHIKV and the WIZ fragment was amplified from pTM3-WIZ. The reaction was carried out using In-Fusion SNAP assembly (Takara) according to the manufacturer's recommendation resulting in the plasmids pSMAC-MV3-CIWIZ and pSMAC-MV-2CHIKV-3WIZ (FIGS. 16 and 17).

[0240] Rescue of Multivalent Recombinant MV

[0241] The recovery of infectious recombinant MV expressing multivalent antigens (MV-CIWIZ) from pSMAC-MV-CIWIZ, pSMAC-MV3-CIWIZ and pSMAC-MV-2CHIKV-3WIZ were performed as above.sup.3. The recombinant virus clones were picked from the coculture plates, plaque purified and amplified for stock preparation and further characterization. The targeted antigens expression was detected using western blot stained with antibodies directed to CHIKV E1 envelope protein or Flavivirus envelope (4G2) (FIG. 18).

[0242] The sequence of MV-CIWIZ rescued viruses were verified after viral RNA extraction, cDNA synthesis and RT-PCR amplification with specific primers. The sequencing result confirmed that the recombinant MV listed contains the exact sequence of the triple antigen CIWIZ.

[0243] Therefore, using pSMAC enables constructing and manipulating recombinant infectious MV carrying very large inserted additional genetic material that can still be rescued successfully.

[0244] Growth Kinetics of Multivalent Recombinant MVs.

[0245] The growth kinetics of multivalent recombinant MVs was studied on Vero cells monolayers in 6-well plates. Cells were infected with the recombinant MVs at an MOI of 0.1. One plate was used per recombinant MV construct. At various time points post-infection, infected cells were scraped into 1 ml OptiMEM, lysed by freeze-thaw, clarified by centrifugation. Viral titers were determined on Vero cells seeded in 96-well plates at 7500 cells/well, and infected with serial ten-fold dilutions of virus in DMEM with 5% FBS. After incubation for 7 days, cells were stained with crystal violet, and TCID50 values were calculated and plotted according to the collected time points. The resulting growth curves of multivalent recombinant MVs are similar to MV-Schwarz, with only a slight delay in the growth of the triple CIWIZ virus resulting in similar titers achieved (FIG. 19). Accordingly, the growth kinetic of the recombinant MV constructs according to the invention is similar to the growth kinetic of the control MV-Schwarz.

[0246] Immunogenicity of Recombinant MVs Expressing Multivalent Antigens.

[0247] In order to verify that the multivalent antigens expressed by MV are immunogenic, Groups of 6 to 8-week-old mice deficient for type-I IFN receptor (IFNAR−/−) were intraperitoneally injected with 105 TCID50 of MV-2CHIK-3WIZ (chosen according to the highest expression of the antigens) and MV-CIZ (according to the medical interests as the CHIKV and ZIKV are endemic in the same areas) or the control single antigen recombinant MVs; MV-CHIK, MV-ZIKV and MV-WNV.[8, 14, 39]. Two immunizations were administered at a four-week interval. Sera were collected before the first immunization (day −1) and then after each immunization (day 31 and day 51) (FIG. 20). All serum samples were heat-inactivated for 30 min at 56° C. and used for ELISA to detect specific IgG to the three different antigens.

[0248] To set up the ELISA, Edmonston strain-derived MV antigens (Jena Bioscience), recombinant CHIKV E protein, WNV E protein or ZIKV E protein were coated (50 μl) on NUNC MAXISORP 96-well immuno-plates (Thermo Fisher) at 1 μg/ml in 1× phosphate-buffered saline (PBS). Coated plates were incubated overnight at 4° C., washed 3 times with washing buffer (PBS, 0.05% Tween), and further blocked for 1 h at 37° C. with blocking buffer (PBS, 0.05% Tween, 5% milk). Serum samples from immunized mice were serially diluted in the binding buffer (PBS, 0.05% Tween, 2.5% milk) and incubated on plates for 1 h at 37° C. After washing steps, an HRP-conjugated goat anti-mouse IgG (H+L) antibody (Jackson ImmunoResearch) was added for 1 h at 37° C. Antibody binding was detected by addition of the TMB substrate (Eurobio) and the reaction was stopped with 100 μl of 30% H2SO4. The optical densities were recorded at 450 and 620 nm wavelengths using the EnSpire 2300 Multilabel Plate Reader (Perkin Elmer). Endpoint titers for each individual serum sample were calculated.

[0249] The results demonstrate that either triple or double antigens recombinant MVs stimulate specific IgG in mice at titer levels similar to those elicited by recombinant MVs expressing the corresponding single antigens (FIG. 21). These titers were previously demonstrated to be protective against challenge infection by CHIKV, WNV or ZIKV in this animal model.

[0250] This is a proof of concept that pSMAC can accommodate the cloning of approximately 7.5 kb of additional polynucleotide(s) encoding antigen(s) and allow the effective rescue of multivalent recombinant MVs with an immunogenicity comparable to single-antigen expressing recombinant MVs.

[0251] Culture of Recombinant MV on Vero Cells CCL-81 Approved for Human Use Cultures without Fetal Calf Serum

[0252] In order to prepare recombinant MV seeds ready for industrial manufacturing with no risk of contamination by BSE agents we developed a culture method to grow recombinant MV on Vero cells approved for human use and cultured in serum-free medium.

[0253] Vero CCL-81 (ATCC) cells seeded at a density of 4×10.sup.4 cells/cm.sup.2 (3×10.sup.6 cells/T-75 flask) are cultured as monolayers on T-75 flasks in VP-SFM medium (Gibco/Invitrogen, ref 11681-020) supplemented with 4 mM L-glutamine (Invitrogen, ref 25030024) and Penicilin streptomycin (Invitrogen, ref 15140122) by incubation at 37° C., 5% CO2 in humid incubator. Cells are passaged after TrypLE enzyme (Invitrogen, ref 12563011) treatment for 5 minutes at room temperature. Enzyme action is stopped by dilution in 20 ml of VP-SFM medium.

[0254] Sub-confluent cells (70-80% confluence) are washed with 10 ml of D-PBS without calcium and magnesium (Invitrogen, ref 14190094) and infected at 32 C with MV-GFP in 2 ml of VP-SFM medium at a multiplicity of infection of 0.01. After 2 hours of adsorption, the inoculum is replaced by 15-20 ml of VP-SFM medium. Culture is continued for 7 days. Medium or cells are regularly collected to determine the titer of produced virus by TCID50 titration on Vero cells (FIGS. 22 and 23). The results show that recombinant MV can be produced at titers up to 10.sup.8 TCID50 in medium after 7 days of production.

[0255] Protocols for the evaluation of protective immunity in mice

[0256] Any candidate vaccine, but in particular a candidate vaccine that encodes at least two antigens, preferably three antigens, originating from different species infecting human (such as the constructs pSMAC-MV3-CIWIZ and pSMAC-MV-2CHIKV-3WIZ) may be tested in mice at standard dose (104-105 TCID50/mouse) administered intraperitoneally in 6-8 week-old mice (groups of 8 mice). Control animals may receive the same dose of empty MV vector. Other groups of mice may be immunized with the same schedule with individual vaccines (MV-WNV, MV-CHIKV, MV-ZIKV). Animals may be primed at day 0 and boosted one month after. Blood samples may be collected one month after each injection for antibody analysis. ELISA specific to MV, WNV, CHIKV and ZIKV may be used. Cross reactivity of humoral response may be analyzed. To evaluate the functionality of humoral response, neutralization tests to the three viruses may be used. A vaccine candidate may lead to the neutralization of at least one virus, preferably two viruses, and most preferably the three viruses. Cell-mediated immune response may be assessed both at 7 days after priming and one month after boosting by ELISPOT assay on freshly collected splenocytes and using specific WNV, CHIKV, and ZIKV peptides.

[0257] Immunized animals may be separated in three groups to be challenged respectively by WNV, CHIKV and ZIKV. The challenges may be performed as previously published for each virus, using already determined doses. Protective efficacy will be measured by both survival and viremia analysis (RT-qPCR). A vaccine candidate may lead to immunization against one virus, two viruses or the three viruses.

[0258] Protocols for the Evaluation of Immunogenicity in Macaques

[0259] To evidence the equivalence between constructs encoding a single antigen and constructs that encodes at least two, preferably three, antigens originating from different species infecting human (such as the constructs pSMAC-MV3-CIWIZ and pSMAC-MV-2CHIKV-3WIZ), two groups of cynomolgus macaques may be immunized either with a construct vector expressing simultaneously at least 2, preferably 3, protective antigens from WNV, CHIKV and/or ZIKV, or with a mixture of the 3 independent MV vectors previously generated and expressing each of the same antigens. Ten animals may be included in both experimental groups. This number seems to be the minimum to evidence a 0.66-log difference of neutralizing activity titers with a power of 80% and an alpha risk level of 0.005.

[0260] Hematological parameters may be followed every week (blood cells counts, numeration). Blood samples may be collected for immune responses analysis at week 1, 2 and 4 after each immunization and just before boosting. Antibody titers to MV, WNV, CHIKV and ZIKV may be analyzed by using already established ELISA. Neutralizing activities may also be monitored using specific PRNT assays previously developed. A vaccine candidate may lead to the neutralization of at least one virus, preferably two viruses, and most preferably the three viruses. T cell responses may be measures by IFNg ELISPOT and intracellular cytokine staining (ICS). A vaccine candidate may lead to a T cell response against at least one virus, preferably two viruses, and most preferably the three viruses The following parameters can be analyzed: CD3, CD4, CD8, CD154, CD137, TNF-alpha, IFN-gamma, IL2. Memory response may be analyzed using the same parameters in blood samples collected at 3 months after boosting. The primary read-out may be neutralizing activity titers. These titers may be compared to the titers correlating with protection in mice challenge previously performed.

BIBLIOGRAPHY

[0261] Lund, N., et al., The Effect of Oral Polio Vaccine at Birth on Infant Mortality: A Randomized Trial. Clin Infect Dis, 2015. 61(10): p. 1504-11. [0262] Aaby, P. and C. S. Benn, Stopping live vaccines after disease eradication may increase mortality. Vaccine, 2020. 38(1): p. 10-14. [0263] Combredet, C., et al., A molecularly cloned Schwarz strain of measles virus vaccine induces strong immune responses in macaques and transgenic mice. J Virol, 2003. 77(21): p. 11546-54. [0264] Calain, P. and L. Roux, The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. J Virol, 1993. 67(8): p. 4822-30. [0265] Frantz, P. N., S. Teeravechyan, and F. Tangy, Measles-derived vaccines to prevent emerging viral diseases. Microbes Infect, 2018. 20(9-10): p. 493-500. [0266] Guerbois, M., et al., Live attenuated measles vaccine expressing HIV-1 Gag virus like particles covered with gp160DeltaV1V2 is strongly immunogenic. Virology, 2009. 388(1): p. 191-203. [0267] Lorin, C., et al., Toxicology, biodistribution and shedding profile of a recombinant measles vaccine vector expressing HIV-1 antigens, in cynomolgus macaques. Naunyn Schmiedebergs Arch Pharmacol, 2012. 385(12): p. 1211-25. [0268] Despres, P., et al., Live measles vaccine expressing the secreted form of the West Nile virus envelope glycoprotein protects against West Nile virus encephalitis. J Infect Dis, 2005. 191(2): p. 207-14. [0269] Brandler, S., et al., Measles vaccine expressing the secreted form of West Nile virus envelope glycoprotein induces protective immunity in squirrel monkeys, a new model of West Nile virus infection. J Infect Dis, 2012. 206(2): p. 212-9. [0270] 1Brandler, S., et al., Pediatric measles vaccine expressing a dengue antigen induces durable serotype-specific neutralizing antibodies to dengue virus. PLoS Negl Trop Dis, 2007. 1(3): p. e96. [0271] Brandler, S., et al., Pediatric measles vaccine expressing a dengue tetravalent antigen elicits neutralizing antibodies against all four dengue viruses. Vaccine, 2010. 28(41): p. 6730-9. [0272] del Valle, J. R., et al., A vectored measles virus induces hepatitis B surface antigen antibodies while protecting macaques against measles virus challenge. J Virol, 2007. 81(19): p. 10597-605. [0273] Cantarella, G., et al., Recombinant measles virus-HPV vaccine candidates for prevention of cervical carcinoma. Vaccine, 2009. 27(25-26): p. 3385-90. [0274] Brandler, S., et al., A recombinant measles vaccine expressing chikungunya virus-like particles is strongly immunogenic and protects mice from lethal challenge with chikungunya virus. Vaccine, 2013. 31(36): p. 3718-25. [0275] Yoneda, M., et al., Recombinant measles virus vaccine expressing the Nipah virus glycoprotein protects against lethal Nipah virus challenge. PLoS One, 2013. 8(3): p. e58414. [0276] Yamaji, Y. and T. Nakayama, Recombinant measles viruses expressing respiratory syncytial virus proteins induced virus-specific CTL responses in cotton rats. Vaccine, 2014. 32(35): p. 4529-36. [0277] Escriou, N., et al., Protection from SARS coronavirus conferred by live measles vaccine expressing the spike glycoprotein. Virology, 2014. 452-453: p. 32-41. [0278] Malczyk, A. H., et al., A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform. J Virol, 2015. 89(22): p. 11654-67. [0279] Mateo, M., et al., Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect macaques after a single shot. Sci Transl Med, 2019. 11(512). [0280] Ramsauer, K., et al., Immunogenicity, safety, and tolerability of a recombinant measles-virus-based chikungunya vaccine: a randomised, double-blind, placebo-controlled, active-comparator, first-in-man trial. Lancet Infect Dis, 2015. 15(5): p. 519-27. [0281] Reisinger, E. C., et al., Immunogenicity, safety, and tolerability of the measles-vectored chikungunya virus vaccine MV-CHIK: a double-blind, randomised, placebo-controlled and active-controlled phase 2 trial. Lancet, 2019. 392(10165): p. 2718-2727. [0282] Domingo, E., et al., The quasispecies (extremely heterogeneous) nature of viral RNA genome populations: biological relevance—a review. Gene, 1985. 40(1): p. 1-8. [0283] Shi, J. and D. P. Biek, A versatile low-copy-number cloning vector derived from plasmid F. Gene, 1995. 164(1): p. 55-8. [0284] Shizuya, H. and H. Kouros-Mehr, The development and applications of the bacterial artificial chromosome cloning system. Keio J Med, 2001. 50(1): p. 26-30. [0285] Tischer, B. K. and B. B. Kaufer, Viral bacterial artificial chromosomes: generation, mutagenesis, and removal of mini-F sequences. J Biomed Biotechnol, 2012. 2012: p. 472537. [0286] Borenstein, R. and N. Frenkel, Cloning human herpes virus 6A genome into bacterial artificial chromosomes and study of DNA replication intermediates. Proc Natl Acad Sci USA, 2009. 106(45): p. 19138-43. [0287] Cottingham, M. G., et al., Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA). PLoS One, 2008. 3(2): p. e1638. [0288] Domi, A. and B. Moss, Cloning the vaccinia virus genome as a bacterial artificial chromosome in Escherichia coli and recovery of infectious virus in mammalian cells. Proc Natl Acad Sci USA, 2002. 99(19): p. 12415-20. [0289] Meisinger-Henschel, C., et al., Introduction of the six major genomic deletions of modified vaccinia virus Ankara (MVA) into the parental vaccinia virus is not sufficient to reproduce an MVA-like phenotype in cell culture and in mice. J Virol, 2010. 84(19): p. 9907-19. [0290] Roth, S. J., et al., Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC). Vet Res, 2011. 42: p. 3. [0291] Almazan, F., et al., Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci USA, 2000. 97(10): p. 5516-21. [0292] Almazan, F., et al., Construction of a severe acute respiratory syndrome coronavirus infectious cDNA clone and a replicon to study coronavirus RNA synthesis. J Virol, 2006. 80(21): p. 10900-6. [0293] Fan, Z. C. and R. C. Bird, An improved reverse genetics system for generation of bovine viral diarrhea virus as a BAC cDNA. J Virol Methods, 2008. 149(2): p. 309-15. [0294] Rasmussen, T. B., et al., Generation of recombinant pestiviruses using a full-genome amplification strategy. Vet Microbiol, 2010. 142(1-2): p. 13-7. [0295] Jengarn, J., et al., Genetic manipulation of porcine epidemic diarrhoea virus recovered from a full-length infectious cDNA clone. J Gen Virol, 2015. 96(8): p. [0296] Pu, S. Y., et al., Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol, 2011. 85(6): p. 2927-41. [0297] Aubry, F., et al., Flavivirus reverse genetic systems, construction techniques and applications: a historical perspective. Antiviral Res, 2015. 114: p. 67-85. [0298] O'Connor, M., M. Peifer, and W. Bender, Construction of large DNA segments in Escherichia coli. Science, 1989. 244(4910): p. 1307-12.