1. Patent Search
  2. Details

SERUM-FREE INDUCTION METHOD FOR SENSORY NEURON CELL

20230235282 · 2023-07-27

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a human-derived sensory neuron induction culture system. A combination of a small molecule inhibitor LY2157299 and a growth factor is added into a serum-free basal medium. Compared with an induction method involving serum, not only is the efficiency of inducing pluripotent stem cells into sensory neurons greatly improved, but the expression of a variety of ion channel proteins is also significantly improved, thereby achieving successful induction of multiple induced pluripotent stem cells from different sources into sensory neurons.

    Claims

    1. Use of LY2157299, RepSox, SB5253334 or TEW7179 in the induction of pluripotent stem cells to differentiate into sensory nerve precursor cells and sensory neuron cells.

    2. The use of claim 1, wherein the dosage of LY2157299, RepSox, SB5253334 or TEW7179 is 55 nM-25 μM, preferably 100 nM, 300 nM, 500 nM, 700 nM, 900 nM, 1 μM, 2.5 μM, 5 μM, 7.5 μM, 10 μM, 12.5 μM, 15 μM, 17.5 μM, 20 μM or 22 μM.

    3. Use of human-NT3 or CHIR98014 in culturing sensory neurons.

    4. The use of claim 3, wherein the dosage of human-NT3 is 0.1-49 ng/ml, or the dosage of CHIR98014 is 0.5 nM-3 μM.

    5. A sensory neuron cell induction medium, characterized in that the sensory neuron cell induction medium is prepared as follows: a basal medium is formed by 50% (v/v) DMEM medium and 50% (v/v) neural basal medium, then the basal medium is supplemented with 0.5%-2% (v/v) N2 supplement (preferably 0.7%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7% (v/v)), 0.2%-3.1% (v/v) GS21 supplement or B27 supplement (preferably 0.4%, 0.6%, 0.8%, 1.0%, 1.2%, 1.4%, 1.6%, 1.8%, 2.0%, 2.2%, 2.4%, 2.6%, 2.8%, 3.0% (v/v)), 0.1-15 mM HEPES buffer (preferably 1, 5, 10 mM), 5-22 mM glycine-glutamine monohydrate (preferably 10, 15, 20 mM), 12-180 nM LDN-193189 or LDN-193189 2HCl (preferably 20, 50, 70, 80, 90, 100, 110, 120, 150, 170 nM), and 55 nM-25 μM LY2157299, RepSox, SB5253334 or TEW7179 (preferably 100 nM, 300 nM, 500 nM, 700 nM, 900 nM, 1 μM, 2.5 μM, 5 μM, 7.5 μM, 10 μM, 12.5 μM, 15 μM, 20 μM or 22 μM).

    6. The sensory neuron cell induction medium of claim 5, characterized in that the sensory neuron cell induction medium is prepared as follows: a basal medium is formed by 50% (v/v) DMEM medium and 50% (v/v) neural basal medium, then the basal medium is supplemented with 1% (v/v) N2 supplement, 2% (v/v) GS21 supplement or B27 supplement, 0.5 mM HEPES buffer, 20 mM glycine-glutamine monohydrate, 100 nM LDN-193189 or LDN-193189 2HCl, and LY2157299, RepSox, SB5253334 or TEW7179 selected from 5 μM, 7.5 μM or 12.5 μM.

    7. The sensory neuron cell induction medium of claim 5, wherein the induction medium is prepared as follows: a basal medium is formed by 50% (v/v) DMEM medium and 50% (v/v) neural basal medium, then supplemented with 1% (v/v) N2 supplement, 2% (v/v) GS21 supplement or B27 supplement, 0.5 mM HEPES buffer, 20 mM glycine-glutamine monohydrate, 100 nM LDN-193189 or LDN-193189 2HCl, and LY2157299 selected from 5 μM, 7.5 μM or 12.5 μM; preferably, the sensory neuron cell induction medium is further supplemented with serum replacement (such as serum albumin, transferrin, fatty acid), more preferably, the serum replacement is in purified form.

    8. A sensory neuron cell medium, characterized in that the sensory neuron cell medium is prepared as follows: the sensory neuron cell induction medium of claim 5 is supplemented with 3-10 μM SU5402 (preferably 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 3-10 μM DAPT (4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 1-3 μM CHIR99021 (preferably 1.3 μM, 1.5 μM, 1.7 μM, 1.9 μM, 2.0 μM, 2.2 μM, 2.5 μM, 2.7 μM) or 0.5 nM-3 μM CHIR98014 (preferably 5 nM, 50 nM, 100 nM, 200 nM, 300 mM, 500 mM, 700 mM, 900 mM, 1 μM, 1.4 μM, 1.8 μM, 2.0 μM, 2.5 μM, 2.7 μM), and 0.1-49 ng/ml human-NT3 (preferably 1, 5, 10, 15, 20, 25, 30, 35, 40, 45 ng/ml), preferably, the sensory neuron cell medium is further supplemented with serum replacement (e.g., serum albumin, transferrin, fatty acid), more preferably, the serum replacement is in purified form.

    9. A method for inducing pluripotent stem cells to differentiate into sensory neuron cells, characterized in that the pluripotent stem cells are cultured in the induction medium of claim 5 to obtain sensory nerve precursor cells, and then the sensory nerve precursor cells are cultured in a sensory neuron cell medium of claim 8 to obtain sensory neuron cells, preferably, the culture is performed in the presence of a basal membrane, more preferably, the basal membrane is composed of one or more of Matrigel (STEMCELL Technologies), Laminin and Vitronectin, wherein the sensory neuron cell medium is prepared as follows: the sensory neuron cell induction medium of claim 5 is supplemented with 3-10 μM SU5402 (preferably 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 3-10 μM DAPT (4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 1-3 μM CHIR99021 (preferably 1.3 μM, 1.5 μM, 1.7 μM, 1.9 μM, 2.0 μM, 2.2 μM, 2.5 μM, 2.7 μN) or 0.5 nM-3 μM CHIR98014 (preferably 5 nM, 50 nM, 100 nM, 200 nM, 300 mM, 500 mM, 700 mM, 900 mM, 1 μM, 1.4 μM, 1.8 μM, 2.0 μM, 2.5 μM, 2.7 μM), and 0.1-49 ng/ml human-NT3 (preferably 1, 5, 10, 15, 20, 25, 30, 35, 40, 45 ng/ml), preferably, the sensory neuron cell medium is further supplemented with serum replacement (e.g., serum albumin, transferrin, fatty acid), more preferably, the serum replacement is in purified form.

    10. Sensory nerve precursor cells, which are prepared by culturing pluripotent stem cells by using the induction medium of claim 5.

    11. Sensory neuron cells, which are prepared by culturing the sensory nerve precursor cells of claim 10 by using a sensory neuron cell medium, wherein the sensory neuron cell medium is prepared as follows: a sensory neuron cell induction medium is supplemented with 3-10 μM SU5402 (preferably 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 3-10 μM DAPT (4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 1-3 μM CHIR99021 (preferably 1.3 μM, 1.5 μM, 1.7 μM, 1.9 μM, 2.0 μM, 2.2 μM, 2.5 μM, 2.7 μM) or 0.5 nM-3 μM CHIR98014 (preferably 5 nM, 50 nM, 100 nM, 200 nM, 300 mM, 500 mM, 700 mM, 900 mM, 1 μM, 1.4 μM, 1.8 μM, 2.0 μM, 2.5 μM, 2.7 μM), and 0.1-49 ng/ml human-NT3 (preferably 1, 5, 10, 15, 20, 25, 30, 35, 40, 45 ng/ml), preferably, the sensory neuron cell medium is further supplemented with serum replacement (e.g., serum albumin, transferrin, fatty acid), more preferably, the serum replacement is in purified form; and wherein the sensory neuron cell induction medium is prepared as follows: a basal medium is formed by 50% (v/v) DMEM medium and 50% (v/v) neural basal medium, then the basal medium is supplemented with 0.5%-2% (v/v) N2 supplement (preferably 0.7%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7% (v/v)), 0.2%-3.1% (v/v) GS21 supplement or B27 supplement (preferably 0.4%, 0.6%, 0.8%, 1.0%, 1.2%, 1.4%, 1.6%, 1.8%, 2.0%, 2.2%, 2.4%, 2.6%, 2.8%, 3.0% (v/v)), 0.1-15 mM HEPES buffer (preferably 1, 5, 10 mM), 5-22 mM glycine-glutamine monohydrate (preferably 10, 15, 20 mM), 12-180 nM LDN-193189 or LDN-193189 2HCl (preferably 20, 50, 70, 80, 90, 100, 110, 120, 150, 170 nM), and 55 nM-25 μM LY2157299, RepSox, SB5253334 or TEW7179 (preferably 100 nM, 300 nM, 500 nM, 700 nM, 900 nM, 1 μM, 2.5 μM, 5 μM, 7.5 μM, 10 μM, 12.5 μM, 15 μM, 20 μM or 22 μM.

    12. A method for inducing sensory neuron cells comprising, culturing pluripotent stem cells by the sensory neuron cell induction medium of claim 5 to obtain sensory nerve precursor cells, and then culturing the sensory nerve precursor cells by a sensory neuron cell medium, wherein the sensory neuron cell medium is prepared as follows: the sensory neuron cell induction medium of claim 5 is supplemented with 3-10 μM SU5402 (preferably 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 3-10 μM DAPT (4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM), 1-3 μM CHIR99021 (preferably 1.3 μM, 1.5 μM, 1.7 μM, 1.9 μM, 2.0 μM, 2.2 μM, 2.5 μM, 2.7 μM) or 0.5 nM-3 μM CHIR98014 (preferably 5 nM, 50 nM, 100 nM, 200 nM, 300 mM, 500 mM, 700 mM, 900 mM, 1 μM, 1.4 μM, 1.8 μM, 2.0 μM, 2.5μM, 2.7 μM), and 0.1-49 ng/ml human-NT3 (preferably 1, 5, 10, 15, 20, 25, 30, 35, 40, 45 ng/ml), preferably, the sensory neuron cell medium is further supplemented with serum replacement (e.g., serum albumin, transferrin, fatty acid), more preferably, the serum replacement is in purified form.

    13. The method of claim 9 or 12, wherein the pluripotent stem cells are prepared from somatic cells by using a reprogramming medium, preferably, wherein the reprogramming medium consists of a DMEM-F12 basal medium and supplementary components, and the supplementary components include 60 μg/mL-180 μg/mL L-ascorbic acid, 5.3 μmol/L-74 μmol/L hydrocortisone, 3 ng/mL-89 ng/mL sodium selenite, 8 μmol/L-23 Optiferrin, 0.5 μmol/L-7.4 retinyl acetate, 40 ng/mL-60 ng/mL plant-derived recombinant human basic growth factor, 8 μg/mL-12 μg/mL IGF, 0.2 μmol/L-0.6 μg/mL A-83, 2 μmol/L-6 CHIR99021, and 100 μmol/L-450 μmol/L sodium butyrate.

    14. The method of claim 13, characterized in that the supplementary components include 70 μg/mL-90 μg/mL L-ascorbic acid, 40 μmol/L-60 μmol/L hydrocortisone, 10 ng/mL-30 ng/mL sodium selenite, 8 μmol/L-12 μmol/L Optiferrin, 3 μmol/L-6 retinyl acetate, 45 ng/mL-55 ng/mL plant-derived recombinant human basic growth factor, 8 μg/mL-12 μg/mL IGF, 0.3 μmol/L-0.5 μg/mL A-83, 3 μmol/L-5 CHIR99021 and 280 μmol/L-410 μmol/L sodium butyrate.

    15. The method of claim 13, characterized in that the supplementary components comprise 80 μg/mL L-ascorbic acid, 50 μmol/L hydrocortisone, 20 ng/mL sodium selenite, 10 μmol/L Optiferrin, 4 μmol/L retinyl acetate, 50 ng/mL plant-derived recombinant human basic growth factor, 10 μg/mL IGF, 0.4 μg/mL A-83, 4 μmol/L CHIR99021 and 400 μmol/L sodium butyrate.

    16. The method of claim 13, wherein the culturing is performed in the presence of a basal membrane, preferably, the basal membrane is composed of one or more of Matrigel (STEMCELL Technologies), Laminin and Vitronectin.

    17. The method of claim 13, wherein the somatic cells are human mesenchymal cells, human CD34+ cells or human fibroblasts (e.g. skin fibroblasts, lung fibroblasts, bladder fibroblasts, foreskin fibroblasts, uterine fibroblasts).

    18. Use of the sensory neuron of claim 11 in screening a medicine for treating or alleviating pain or preparing a model for screening a medicine for treating or alleviating pain.

    19. The method of claim 12, wherein the pluripotent stem cells are prepared from somatic cells by using a reprogramming medium, preferably, wherein the reprogramming medium consists of a DMEM-F12 basal medium and supplementary components, and the supplementary components include 60 μg/mL-180 μg/mL L-ascorbic acid, 5.3 μmol/L-74 μmol/L hydrocortisone, 3 ng/mL-89 ng/mL sodium selenite, 8 μmol/L-23 Optiferrin, 0.5 μmol/L-7.4 retinyl acetate, 40 ng/mL-60 ng/mL plant-derived recombinant human basic growth factor, 8 μg/mL-12 μg/mL IGF, 0.2 μmol/L-0.6 μg/mL A-83, 2 μmol/L-6 CHIR99021, and 100 μmol/L-450 μmol/L sodium butyrate.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0034] FIG. 1: Identification of induced pluripotent stem cells derived from three types of cells, and sensory neurons obtained by using the present method and a control method. FIG. 1 a-h show the results of peripheral neuron induction by using fibroblasts, wherein, FIG. 1 a shows fibroblasts (HDF) before reprogramming; FIG. 1b shows iPSC clones formed by fibroblast reprogramming; FIG. 1 c shows Oct3/4 immunofluorescence identification of iPSC cells formed by fibroblast reprogramming; FIG. 1 d shows identification of the alkaline phosphatase of iPSC clones formed by fibroblast reprogramming; FIG. 1 e shows the peripheral sensory nerve precursor cells induced from fibroblasts with N2GS212I basal medium formula 2; FIG. 1 f shows the peripheral sensory neurons formed by fibroblasts by using the induction method of the present invention; FIG. 1 g shows the peripheral sensory nerve precursor cells formed by fibroblasts by using the serum induction method as a control; FIG. 1 h shows the peripheral sensory neurons formed by fibroblasts by using the serum induction method as a control; FIG. 1 i-p show the results of peripheral neuron induction by using mesenchymal cells, wherein, FIG. 1 i shows mesenchymal cells before reprogramming; FIG. 1 j shows iPSC clones formed by reprogramming of mesenchymal cells; FIG. 1 k shows Oct3/4 immunofluorescence identification of iPSC cells formed by reprogramming of mesenchymal cells; FIG. 11 shows alkaline phosphatase identification of iPSC clones formed by reprogramming of mesenchymal cells; FIG. 1 m shows the peripheral sensory nerve precursor cells induced from mesenchymal cells with N2GS212I basal medium formula 2; FIG. 1 n shows the peripheral sensory neurons formed from mesenchymal cells by using the induction method of the present invention; FIG. 1 o shows the peripheral sensory nerve precursor cells formed from mesenchymal cells by using the serum induction method as a control; FIG. 1 p shows the peripheral sensory neurons formed from mesenchymal cells by using the serum induction method as a control; FIG. 1 q-x show data for peripheral neuron induction by using CD34+ cells, wherein, FIG. 1 q shows CD34+ cells before reprogramming; FIG. 1 r shows iPSC clones formed by reprogramming of CD34+ cells; FIG. 1 s shows Oct3/4 immunofluorescence identification of iPSC clones formed by reprogramming of CD34+ cells; FIG. 1 t shows alkaline phosphatase identification of iPSC clones formed by reprogramming of CD34+ cells; FIG. 1 u shows the peripheral sensory nerve precursor cells induced from CD34+ cells with N2GS212I basal medium formula 2; FIG. 1 v shows the peripheral sensory neurons formed from CD34+ cells by using the induction method of the present invention; FIG. 1 w shows the peripheral sensory nerve precursor cells formed from CD34+ cells by using the serum induction method as a control; FIG. 1 x shows the peripheral sensory neurons formed from CD34+ cells by using the serum induction method as a control.

    [0035] FIG. 2: Immunofluorescence identification of the expression of sensory neuron-specific molecular marker. FIG. 2 a shows the immunofluorescence staining identification of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells which sensory neurons have TRPV1/Tuj double positive expression; FIG. 2 b shows the immunofluorescence staining identification of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells which sensory neurons express sodium ion channel 1.9 and Nestin; FIG. 2 c shows the immunofluorescence staining identification of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.8/Tuj double positive expression; FIG. 2 d shows the distribution of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.8/Tuj double positive expression under a high-resolution microscope; FIG. 2 e shows the immunofluorescence staining identification of the sensory neurons formed from fibroblast-derived induced pluripotent stem cells which sensory neurons have TRPV1/Tuj double positive expression; FIG. 2 f shows the immunofluorescence staining identification of the sensory neurons formed by fibroblast-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.9/Nestin double positive expression; FIG. 2 g shows the immunofluorescence staining identification of the sensory neurons formed from fibroblast-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.8/Tuj double positive expression; FIG. 2 h shows the distribution of the sensory neurons formed by fibroblast-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.8 and Tuj expression under a high-resolution microscope; FIG. 2 i shows the immunofluorescence staining identification of the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells which sensory neurons have TRPV1/Tuj double positive expression; FIG. 2 j shows the immunofluorescence staining identification of the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.9/Nestin double positive expression; FIG. 2 k shows the immunofluorescence staining identification of the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.8/Tuj double positive expression; FIG. 21 shows the distribution of the sensory neurons formed from mesenchymal cell-derived induced pluripotent stem cells which sensory neurons have sodium ion channel 1.8 and Tuj expression under high-resolution microscopy; FIG. 2 m shows the immunofluorescence staining identification of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells by using the control method (i.e., serum induction method) which sensory neurons have TRPV1/Tuj double positive expression; FIG. 2 n shows the immunofluorescence staining identification of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells by using the control method (i.e., serum induction method) which sensory neurons have sodium ion channel 1.9 and Nestin expression; FIG. 2 o shows the immunofluorescence staining identification of the sensory neurons formed by CD34+ cell-derived induced pluripotent stem cells by using the control method (i.e., serum induction method) which sensory neurons have sodium ion channel 1.8/Tuj double positive expression; FIG. 2 p shows the distribution of the sensory neurons formed from CD34+ cell-derived induced pluripotent stem cells by using the control method (i.e., serum induction method) which sensory neurons have sodium ion channel 1.8 and Tuj expression under high-resolution microscopy.

    [0036] FIG. 3: The difference in the expression and localization of various ion channel proteins and the expression of sensory neuron ion channels and receptor markers are compared between the method of the present invention (N2GS212I) and the control method of serum induction method (CK) by immunofluorescence. Taking CD34+-derived iPSCs as an example, FIG. 3 a shows the expression and localization of potassium-calcium complex ion channel 2.2 in peripheral neurons induced by the control method; FIG. 3 b shows the expression and localization of potassium ion channel 4.2 in peripheral neurons induced by the control method; FIG. 3 c shows the expression and localization of NMDAR2A in peripheral neurons induced by the control method; FIG. 3 d shows the expression and localization of potassium-calcium complex ion channel 2.2 in peripheral neurons induced by the method of the present invention; FIG. 3 e shows the expression and localization of potassium ion channel 4.2 in peripheral neurons induced by the method of the present invention; FIG. 3 f shows the expression and localization of NMDAR2A in peripheral neurons induced by the method of the present invention.

    [0037] FIG. 4: The differences in the expression of various ion channel genes are compared between the method of the present invention (N2GS212I) and the control method of serum induction method (CK) by Q-PCR, by taking sensory neurons derived from CD34+ cells as an example. As compared with the serum control induction method, the expressions of various ion channels in the peripheral neurons obtained by the present method are significantly increased compared with the control group.

    [0038] FIG. 5: The difference in electrophysiological activity between peripheral neurons prepared by the method of the present invention and peripheral neurons prepared by the control serum induction method is compared by multi-electrode array (MEA). FIG. 5 a shows the comparison of electrophysiological activity of cells obtained from different cell sources and different induction methods. CK represents the sensory neurons prepared with the serum induction control method; wherein, CK-1 represents the sensory neurons formed by the CD34+ cell-derived induced pluripotent stem cells; CK-2 represents the sensory neurons formed by fibroblast-derived induced pluripotent stem cells; CK-3 represents the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells. N2GS212I represents the sensory neurons prepared by the method in Example 3 of the present invention; wherein, N2GS212I-1 represents the sensory neurons formed by the CD34+ cell-derived induced pluripotent stem cells; N2GS212I-2 represents the sensory neurons formed by fibroblast-derived induced pluripotent stem cells; N2GS212I-3 represents the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells. 5b represents the comparison of electrophysiological activities of cells induced by different concentrations of LY2157299, taking mesenchymal cell-derived sensory neurons as an example; 5c represents the comparison of electrophysiological activities of cells induced by different concentrations of CHIR98014, taking mesenchymal cell-derived sensory neurons as an example; 5d represents the comparison of electrophysiological activities of cells induced by different concentrations of SU5402, taking mesenchymal cell-derived sensory neurons as an example.

    [0039] FIG. 6: Inhibition of electrical signal of sensory neurons by sodium ion channel inhibitors is validated by multi-electrode array (MEA) at neuron maturation stage (20 days after induction). FIG. 6 a and c show the heat map of spontaneous discharge frequency (6a) and 30-second recording of single-hole discharge frequency (6c) of sensory neurons cultured at 37° C. and 5% carbon dioxide; FIG. 6 b and d show the heat map of spontaneous discharge frequency (6b) and 30-second recording of single-hole firing frequency (6d) of sensory neurons cultured at 37° C. and 5% carbon dioxide after adding 3 μM tetrodotoxin to culture system to block the sodium ion channel; FIG. 6 e shows the percent inhibition of peripheral neuronal potential after adding 3 μM tetrodotoxin to inhibit the sodium ion channel, as compared with that before adding 3 μM tetrodotoxin under the same conditions. CK represents the sensory neurons prepared with the serum induction method; wherein, CK-1 represents the sensory neurons formed by the CD34+ cell-derived induced pluripotent stem cells; CK-2 represents the sensory neurons formed by fibroblast-derived induced pluripotent stem cells; CK-3 represents the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells. N2GS212I represents the sensory neurons prepared by the method in Example 3; wherein, N2GS212I-1 represents the sensory neurons formed by the CD34+ cell-derived induced pluripotent stem cells; N2GS212I-2 represents the sensory neurons formed by fibroblast-derived induced pluripotent stem cells; N2GS212I-3 represents the sensory neurons formed by mesenchymal cell-derived induced pluripotent stem cells.

    [0040] FIG. 7: Verification of decline percentage in peripheral neuronal potential at neuron maturation stage (after 20 days of induction) by multi-electrode array (MEA) after addition of 1 μM PF-05089771 to specifically inhibit sodium ion channel 1.7 as compared to before addition of 1 μM PF-05089771. FIG. 7 a shows the decline percentage of potential in cells induced by various LY2157299 concentrations after using 1 μM PF-05089771, taking fibroblast-derived sensory neurons as an example; FIG. 7 b shows the decline percentage of potential in cells induced by various CHIR98014 concentrations after using 1 μM PF-05089771, taking fibroblast-derived sensory neurons as an example; FIG. 7 c shows the decline percentage of potential in cells induced by various SU5402 concentrations after using 1 μM PF-05089771, taking fibroblast-derived sensory neurons as an example.

    [0041] FIG. 8: Morphology of peripheral sensory neuron cell induced by different LY2157299 concentrations and difference in sodium ion channel expression thereof. FIG. 8 a shows cells obtained by serum induction method; FIG. 8 b-f show the neurons obtained by different concentrations of LY2157299 (50 nM-25 μM). FIG. 8 g shows comparison of expressions of different sodium ion channel proteins in peripheral neurons under different concentrations of small molecule LY2157299 via Q-PCR.

    [0042] FIG. 9: Morphology of neuron precursor cells induced by different inhibitor molecules and differences in expression of precursor cell markers. FIG. 9 a shows neuron precursor cells formed by serum induction method (10 μM SB431524); FIG. 9 b shows neuron precursor cells formed by using 5 μM LY2157299; FIG. 9 c shows neuron precursor cells formed by using 5 μM RepSox; FIG. 9 d shows neuron precursor cells formed by using 5 μM SB525334; FIG. 9 e shows neuron precursor cells formed by using 5 μM TEW-7197; FIG. 9 f shows differential expressions of neuron precursor cell markers during neuron precursor cell formation by Q-PCR between the method of using small molecule inhibitors of the present invention and the control serum induction method (CK).

    [0043] FIG. 10: Effects of different LDN concentrations on the formation of peripheral sensory neuron cells. FIG. 10 a-c show that cell types with neural axons can be induced only at low (12 nM), medium (50 nM) and high (180 nM) concentrations of LDN193189. FIG. 10 d shows the differential expressions of peripheral sensory neuron genes resulting from different concentrations of LDN193189 by Q-PCR.

    [0044] FIG. 11: Effects of different N2 concentrations on the formation of peripheral sensory cells. FIG. 11 a-c show that cell types with neural axons can be obtained only at low (0.5%), medium (1.0%) and high (1.8%) concentrations of N2. FIG. 11 d shows the differential expressions of peripheral sensory neuron cell genes resulting from different concentrations of N2 by Q-PCR.

    [0045] FIG. 12: Effects of different GS21 concentrations on the formation of peripheral sensory neuron cells. FIG. 12 a-c show that cell types with neural axons can be obtained only at low (0.2%), medium (2.0%) and high (3.1%) concentrations of GS21. FIG. 12 d shows the differential expressions of peripheral sensory neuron cell genes resulting from different concentrations of GS21 by Q-PCR.

    [0046] FIG. 13: Effects of different concentrations of glycine-glutamine monohydrate on the formation of peripheral sensory cells. FIG. 13 a-c: The induced peripheral neurons prepared by using low (5 mM), medium (12 mM) and high (22 mM) concentrations of glycine-glutamine monohydrate have a normal morphology, but have a slow axonal growth at high concentration (22 mM). FIG. 13 d represents the osmotic pressure data for the medium with different concentrations of glycine-glutamine monohydrate.

    [0047] FIG. 14: Effects of different HEPES buffer concentrations on the formation of peripheral sensory neuron cells. FIG. 14 a-c show that at low concentration (0.1 mM), medium concentration (10 mM) and high concentration (15 mM) of HEPES buffer, the cells are morphologically normal, and cell intolerance begins to appear at high concentration (15 mM). FIG. 14 d shows the osmotic pressure data for the medium with different HEPES buffer concentrations.

    [0048] FIG. 15: Effects of different CHIR98014 concentrations on the formation of peripheral sensory cells. FIG. 15 a-f show the neurons obtained by different concentrations of CHIR98014 (0.3 nM-5 μM). FIG. 15 g shows the effects of different concentrations of CHIR98014 on the expressions of peripheral sensory neuron-specific genes by using Q-PCR analysis.

    [0049] FIG. 16: Effects of different SU5402 concentrations on the formation of peripheral sensory neuron cells. FIG. 16 a-c show that cells can form axons at low concentration (3 μM), medium concentration (6 μM) and high concentration (10 μM) of SU5402; FIG. 16 d shows the effects of different concentrations of SU5402 on the expressions of peripheral sensory neuron cell-specific genes by using Q-PCR analysis.

    [0050] FIG. 17: Effects of different DAPT concentrations on the formation of peripheral sensory neuron cells. FIG. 17 a-c show that cells are able to form axons at low (3 μM), medium (6 μM) and high (10 μM) concentrations of DAPT. FIG. 17 d show the effects of different concentrations of DAPT on the expressions of peripheral sensory neuron cell-specific genes by using Q-PCR analysis.

    [0051] FIG. 18: Quantitative detection of cell viability by Cyquant assay.

    BENEFICIAL EFFECT

    [0052] The present invention provides a new combination of chemical molecules, which can significantly improve the purity of induced sensory neurons in vitro and the expression intensity of functional ion channel proteins, and the formula of the present invention can support in vitro culture of induced peripheral neuron cells, thereby establishing a sensory neuron cell induction culture system without serum and animal-derived substances. Therefore, sensory neuron cells are obtained by reprogramming and directional differentiation of somatic cells from various sources, and they have various complete biological functions. The state is stable in multiple batches, and the reproducibility is good, which can solve the problem that sensory neuron cells are not easy to obtain in medicine screening and scientific research. The invention also solves the long-standing problems involving animal-derived culture methods and feeder cell contamination, and can be used for in vitro screening of medicines for neurological diseases, especially analgesic medicines, and has great economic and social effects.

    DETAILED DESCRIPTION OF THE INVENTION

    [0053] The implementation process and beneficial effects of the present invention are described in detail below through specific examples, which are intended to help readers better understand the essence and characteristics of the present invention, and are not intended to limit the scope of the present application.

    Example 1. Preparation of Human Induced Pluripotent Stem Cells

    [0054] A 6-well culture plate was coated with Matrigel (STEMCELL Technologies), and then incubated in a 37° C. incubator for more than one hour. The following human somatic cells were reprogrammed to induced pluripotent stem cells by using a Neon Electrotransformation Kit (Thermo Fisher) when somatic cell reprogramming was performed using the Epi5 Reprogramming Kit (Invitrogen): Human Mesenchymal Cells (Lonza, PT-2501), human CD34+ cells (PromoCELL, c-12921), and human skin fibroblasts (PromoCELL, c-12302).

    [0055] The steps were as follows: after centrifugation and washing, the human somatic cells were resuspended in a resuspension buffer provided in the electrotransformation kit, and the electrotransformation was performed according to the following procedures: 1650V pulse voltage, 10 ms pulse width, 3 pulses. After electrotransformation, the cells were removed into a 6 ml tube of reprogramming medium, mixed well, and added to each well of a 6-well plate. The conditions for cell culture were 37° C., 5% CO.sub.2 (Panasonic, MCO-18AC), and the cells were cultured by standing still. Thereafter, the medium was half quantity changed a day until the tenth day after electrotransformation, and the medium was changed every other day from the tenth day until the 28th day.

    [0056] The medium and method used in the reprogramming process were implemented with reference to the patent “Reprogramming Medium and Culture Method for Reprogramming Induced Pluripotent Stem Cell” (ZL 201910050800.7). The reprogramming medium consisted of DMEM-F12 basal medium and supplementary components, wherein the supplementary components are 80 μg/ml ascorbic acid, 50 μmol/L hydrocortisone, 20 ng/ml sodium selenite, 10 μmol/L Optiferrin, 0.4 μg/ml IGF, 0.4 μg/ml A-83, 4 μmol/L CHIR9901 and 400 μmol/L sodium butyrate.

    Example 2. Counting of Induced Pluripotent Stem Cell Clones and Identification of Pluripotency

    [0057] (2.1) The counting of induced pluripotent stem cell clones and identification of pluripotency were performed by using alkaline phosphatase staining (Cat #SCR004, Millipore). Firstly, the cell culture medium in the petri dish was aspirated, and the cells were washed with PBS, fixed for 1-2 min by adding 4% paraformaldehyde, then washed with TBST for 3 times, added with staining working solution provided in the kit (taking 24-well plate as an example, 0.5 ml per well), and placed at room temperature in the dark for 15-20 min; after staining, the staining solution was aspirated, and the cells were washed with phosphate buffer for 2-3 times, and the staining results were observed by a microscope (DMi8, Leica).

    [0058] (2.2) Oct3/4 immunofluorescence identification of induced pluripotent stem cells by using immunofluorescence.

    [0059] The induced pluripotent stem cells in Example 1 were respectively taken and identified by immunofluorescence staining as follows: cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes, washed twice with DPBS buffer; then treated with 0.1% Triton X-100 for 50 minutes, washed twice with DPBS buffer; then incubated overnight at 4° C. with DPBS buffer containing 10% horse serum and 0.1% Triton X-100; added with primary antibody diluted in DPBS buffer, incubated at 37° C. for 2 hours, washed three times with DPBS buffer; then added with corresponding secondary antibody diluted in DPBS buffer, incubated at 37° C. for 2 hours, washed three times with DPBS buffer; and then being subjected to nuclear staining with 0.1 μg/ml DAPI solution for 2 minutes, washed with DPBS buffer for three times, and then photographed (DMi8, Leica). The details for the antibodies used were shown in Table 1.

    TABLE-US-00001 TABLE 1 Antibodies used for immuno- fluorescence staining of pluripotent stem cells Primary Secondary Primary Antibody Secondary Antibody Antibody Concentration Antibody Concentration Anti-Oct4 1:200 Goat anti-rabbit IgG(H + L), 1:1000 antibody Alexa Fluor 488 (CST23) (Invitrogen A11008)

    [0060] The results for alkaline phosphatase staining and immunofluorescence staining were shown in FIG. 1, which showed changes before and after induction, alkaline phosphatase staining results and Oct3/4 immunofluorescence identification results in FIG. 1 a, b, c, and d (fibroblasts), i, j, k, and l (mesenchymal cells), and q, r, s, and t (CD34+ cells).

    Example 3. Sensory Neuron Differentiation of Induced Pluripotent Stem Cells

    [0061] (3.1) Induction of Sensory Nerve Precursor Cells

    [0062] A T25 cell culture flask was coated with Matrigel (STEMCELL Technologies), and then incubated in a 37° C. incubator for more than one hour. Human induced pluripotent stem cells from various sources obtained in Example 1 were seeded in a T25 culture flask at 1×10.sup.6 cells.

    [0063] When the induced pluripotent stem cells reached 70% coverage, they were digested with 0.05% trypsin/EDTA for 5 min at 37° C., and the cell digestion was terminated by using DMEM. After the cells were washed and centrifuged, they were re-seeded in a T25 culture plate at 2×10.sup.5 per flask, and cultured in a sensory neuron induction medium at 37° C., 5% CO.sub.2 (Panasonic, MCO-18AC) for 10 days until the formation of neural plate, which confirmed the formation of sensory nerve precursor cells.

    [0064] The results of three different cells cultured in the sensory neuron induction medium were shown in FIG. 1 e, m and u.

    [0065] Formula for sensory neuron induction medium (N2GS212I-1) was as follows:

    [0066] 50% (v/v) DMEM medium and 50% (v/v) Neurobasal medium formed a basal medium, which was supplemented with 1% (v/v) N2 supplement, 2% (v/v) GS21 supplement, 0.5 mM HEPES buffer, 20 mM glycine-glutamine monohydrate, 100 nM LDN-193189, and 7.5 μM LY2157299.

    [0067] (3.2) Induction of Sensory Nerve Precursor Cells by Using a Medium Containing Serum Components (Represented by CK, Also Referred to as “Serum Induction Method” in the Present Invention)

    [0068] According to published method (Nat Biotechnol., 2013, 30(7): 715-720), three types of cells (fibroblasts, mesenchymal cells, and CD34+ cells) were induced to sensory nerve precursor cells by using a serum-containing media. The specific steps were as follows: The basal medium was prepared by 820 ml Knockout Duchenne's modified Eagle's medium (Knockout DMEM medium, Cat. No. 10829018, Thermo Fisher), 150 ml Knockout Serum Replacement (Cat. No. 10828028, Thermo Fisher), 1 mM L-Glutamine (Cat. No. 25030081, Thermo Fisher), 100 μM Minimum Essential Medium Non-Essential Amino Acids (Cat. No. 11140076, Thermo Fisher) and 0.1 mM 0-mercaptoethanol (Cat. No. 21985023, Thermo Fisher), and the basal medium was supplemented with 100 nM LDN-193189 and 10 μM SB431542 on Day 0 to Day 5. N2 medium was formed by adding 1% (v/v) N2 supplement (Cat. No. 17502045, Thermo Fisher) to neural basal medium (Neurobasal Medium, Cat. No. 21103049, Thermo Fisher). N2 medium was added every other day starting from day 4 in 25% increments (100% N2 on day 10). On day 2 to day 10, three inhibitors, 3 μM CHIR99021 (Selleck, Cat. No. S2924), 10 μM SU5402 (Tocris, Cat. No. 3300/1) and 10 μM DAPT (Selleck, Cat. No. S2215), were added to induce sensory nerve precursor cells-CK. The results were shown in FIG. 1 g (CK-fibroblasts), o (CK-mesenchymal cells) and w (CK-CD34+ cells).

    [0069] (3.3) Culture of Sensory Neuron Cells

    [0070] After obtaining the above-mentioned various sensory nerve precursor cells, the medium was removed, and cells were washed with DPBS, and then treated with 0.05% trypsin/EDTA at 37° C. for 5 minutes, and then cell digestion was terminated with DMEM. After the cells were washed and centrifuged, the cells were re-seeded in a T25 culture flask at 1-5×10.sup.5 per plate, and the sensory nerve precursor cells were induced to differentiate and expand into mature sensory neurons by using sensory neuron cell medium. The conditions for cell culture were 37° C., 5% CO.sub.2. The results were shown in FIG. 1 f (fibroblasts) and h (CK-fibroblasts), n (mesenchymal cells) and p (CK-mesenchymal cells), v (CD34+ cells) and x (CK-CD34+ cells).

    [0071] Sensory Neuron Cell Medium was prepared as follows: 10 μM SU5402 (Tocris, Cat. No. 3300/1), 10 μM DAPT (Selleck, Cat. No. S2714), 4.9 μM CHIR98014 (Selleck, Cat. No. S2745); 49 ng/ml human-NT3 (Novoprotein, Cat. No. C079) were added into Sensory Neuron Induction Medium N2GS212I-1.

    Example 4. Identification of Sensory Neuron Cells

    [0072] (4.1) Identification of Molecular Markers Specific for Sensory Neurons

    [0073] Induced sensory neurons were identified for marker expression by using immunofluorescence (immunofluorescence staining of multiple markers for different cell types). The various sensory neuron cells in Example 3 were respectively taken, and identified by immunofluorescence staining according to section (2.2) of Example 2. Details for antibodies used were shown in Table 2.

    TABLE-US-00002 TABLE 2 Antibodies used for immunofluorescence staining of peripheral sensory neuron cells Primary Secondary Antibody Antibody Primary Concen- Concen- Antibody tration Secondary Antibody tration Anti-Nav1.9 1:150 Goat anti-rabbit 1:1000 antibody IgG(H + L), Alexa Fluor 488 (ab65160) (Invitrogen A11008) Anti-NESTIN 1:200 Donkey anti-mouse 1:1000 antibody IgG(H + L), Alexa Fluor 568 (MAB5326) (Invitrogen A11008) Anti-TRPV1 1:500 Goat anti-rabbit 1:1000 antibody IgG(H + L), Alexa Fluor 488 (NHA12699) (Invitrogen A10037) Anti-Nav1.8 1:250 Goat anti-rabbit 1:1000 antibody IgG(H + L), Alexa Fluor 488 (NHA11324) (Invitrogen A11008) Anti-Tuj antibody 1:150 Donkey anti-mouse 1:1000 (MAB1637) IgG(H + L), Alexa Fluor 568 (Invitrogen A11008)

    [0074] The immunofluorescence staining results of various sensory neuron cells obtained in Example 3 were shown in FIGS. 2 and 3. The results showed that in present invention, a variety of somatic cells can be successfully induced into sensory neuron cells, expressing a series of sensory neuron-specific markers, and showing a higher level of marker expression compared with the serum induction method.

    [0075] FIG. 2 a-l illustrate sensory neurons formed by using induced pluripotent stem cells from different sources, wherein the sensory neuron cells induced by the sensory neuron induction medium of the present invention had no significant difference in ion channel expression.

    [0076] The sensory neurons produced by serum-induction of iPSCs from mesenchymal cells and fibroblasts were similar to those in FIG. 2 m-p (CD34+ cells as an example). FIG. 2 o and p showed the results of serum induction method, wherein as compared with the small molecule induction method of the present invention, the expression of sodium ion channel 1.8 produced by sensory neuron cells in serum induction method was weaker, and channel proteins were unevenly distributed in cell structure.

    [0077] (4.2) Immunofluorescence Identification of the Expression and Localization of Various Ion Channel Proteins in Sensory Neuron Cells

    [0078] Sensory neuron cells were identified for marker expression by using immunofluorescence. Taking the sensory neuron cells differentiated from iPSCs induced by CD34+ source of Example 3 as an example, immunofluorescence staining was carried out according to the description in section (2.2) of Example 2. The details for the antibodies used were shown in Table 3.

    TABLE-US-00003 TABLE 3 Antibodies used for immunofluorescence staining of peripheral neuron markers Primary Secondary Antibody Antibody Primary Concen- Secondary Concen- Antibody tration Antibody tration Anti-NESTIN  1:200 Donkey anti-mouse 1:1000 antibody IgG(H + L), Alexa Fluor (MAB5326) 568 (Invitrogen Al 1008) Anti-KCa2.2 1:50 Goat anti-rabbit 1:1000 antibody IgG(H + L), Alexa Fluor (APC-028) 488 (Invitrogen A10037) Anti-KV4.2 1:50 Goat anti-rabbit 1:1000 antibody IgG(H + L), Alexa Fluor (APC-023) 488 (Invitrogen A10037) Anti-NMDA 1:50 Goat anti-rabbit 1:1000 Receptor 2A IgG(H + L), Alexa Fluor Antibody 488 (Invitrogen A10037) (CST4205)

    [0079] The results were shown in FIG. 3. In FIG. 3, the potassium-calcium complex ion channel 2.2 and potassium ion channel 4.2 in the peripheral sensory neuron cells induced in the present invention had more uniform distribution and abundance than the control group (serum induction method), while there was no significant difference in the expression of NMDAR2A. This result was consistent with Q-PCR (FIG. 4) results. The images above could represent the results for mesenchymal and fibroblast-derived sensory neuron cells.

    [0080] The results showed that in present invention, a variety of somatic cells can be successfully induced into sensory neuron cells, expressing a series of sensory neuron-specific markers, and showing a higher level of marker expression compared with the serum induction method.

    [0081] (4.3) Transcription changes of different marker genes during induction from pluripotent stem cells to sensory neurons were detected by Q-PCR.

    [0082] Total RNA from different sensory neuron cells was extracted by RNeasy Mini or Micro Kit (QIAGEN), and cDNA was synthesized from 1 mg RNA by SuperScript III First-Strand Synthesis System (Invitrogen). SYBR Premix Ex Taq (TaKaRa) and Thermal Cycler Dice Real Time System (TaKaRa) were used for labeling and reaction of Quantitative PCR, and beta-Actin was used as internal control. All data were analyzed by delta-Ct method. Triplicates were used for each group of experiments, and statistics were performed with ANOVA. Primer sequences used to identify coding genes of different cellular markers were shown in Table 4.

    TABLE-US-00004 TABLE 4 Primers used in Q-PCR for peripheral neuron and pluripotent stem cell markers SOX10-F CCACCTATGCCACAGTGCCTAAG (SEQ ID NO: 1) SOX10-R GTGCCAACTCCTTCCTGCCTTC (SEQ ID NO: 2) SCN9A -F AAGAGGATGTGTCTGCTACTGTCA (SEQ ID NO: 3) SCN9A -R GAAGGTGGAGAGGTGGTGGATG (SEQ ID NO: 4) SCN10A-F AACTTCCAGACCTTCGCCAACAG (SEQ ID NO: 5) SCN10A -R TGGTGAAGAAGATGATGCCTACGG (SEQ ID NO: 6) SCN11A -F TGATGATGTCGCTTCCTTCTCTGT (SEQ ID NO: 7) SCN11A -R CCAACCTGCTGATGTGCTTATCTG (SEQ ID NO: 8) Nestin-F TCAAGATGTCCCTCAGCCTGGA (SEQ ID NO: 9) Nestin-R TGGCACAGGTGTCTCAAGGGTAG (SEQ ID NO: 10) CaV2.1-F1 TGGAGGACGAGGACAGTGATGAA (SEQ ID NO: 11) CaV2.1-R1 CGAGTCAGGATGCCAGAGTTCTT (SEQ ID NO: 12) Cav2.2-F1 CAGCATCAACCGCCACAACAAC (SEQ ID NO: 13) Cav2.2-R1 GGAGCACAGGAAGATGAAGGAGAC (SEQ ID NO: 14) CaV3.2-F1 GCTGGTGGTGGAGACGCTGATA(SEQ ID NO: 15) CaV3.2-R1 ACTGTGCCTTGGTGGAGATGTTC(SEQ ID NO: 16) KV4.3-F1 CCTGCTGCTCCCGTCGTAGTAA (SEQ ID NO: 17) KV4.3-R1 GATGCTGATGATGGCTGTGGTGAT (SEQ ID NO: 18) KCNIP2-F2 GCTCCAAGTTCCACAGGTCTGCTA (SEQ ID NO: 19) KCNIP2-R2 CACCACAACCACCACCAACACAT (SEQ ID NO: 20) KV7.2-F2 TGTATGTGTCCTTGTGCCGTAGTG (SEQ ID NO: 21) KV7.2-R2 GCATCAACCTGTCCGTGTGAGTAA (SEQ ID NO: 22) KV7.3-F2 GCATATTCAACCAAAGCCCGTGTA (SEQ ID NO: 23) KV7.3-R2 AAGGACCTGCTGAACAGACAAGAG (SEQ ID NO: 24) GABRA3-F1 GGACTGGTTCATAGCCGTCTGTT (SEQ ID NO: 25) GABRA3-R1 ACGATGTTGAAGGTAGTGCTGGTT (SEQ ID NO: 26) TRPV4-F1 TGCCGTGACAGCGAGACCTT (SEQ ID NO: 27) TRPV4-R1 CAGATGTGCTTGCTCTCCTTGGA (SEQ ID NO: 28) TRPM8-F1 GGCACCGTCCAGGAGAACAATG (SEQ ID NO: 29) TRPM8-R1 GCAGCAACACTTGAAGCACTTCTT (SEQ ID NO: 30) KCa2.1-F2 TGGCTGGAAGGCACTGGTGAT (SEQ ID NO: 31) KCa2.1-R2 GCTGGTACAGGTGTCCCTAGAGAG (SEQ ID NO: 32) KCa2.2-F1 GGAGTGAAGACTTCGAGAAGAGGA (SEQ ID NO: 33) KCa2.2-R1 TGGTGGTGCTGTGGAAGAGGA (SEQ ID NO: 34) NR2A-F1 GTTGGTGATGGTGAGATGGAGGAG (SEQ ID NO: 35) NR2A-R1 CCAGATGAAGGTGATGAGGCTGAG (SEQ ID NO: 36) NR2B-F1 ACTACTGCTGCTGCTGGTTCA (SEQ ID NO: 37) NR2B-R1 AAGGTATGACTGAGTTGGCTGTGA (SEQ ID NO: 38) TRPV1-F1 GCAGTGCCTTCTTCATCCTTCCTT (SEQ ID NO: 39) TRPVI-R1 AAGCATGTGCCATTGCGGAGAA (SEQ ID NO: 40) CASP3-F GGAAGCGAATCAATGGACTCTGG (SEQ ID NO: 41) CASP3-R GCATCGACATCTGTACCAGACC (SEQ ID NO: 42) ACTIN-F TCCCTGGAGAAGAGCTACGA (SEQ ID NO: 43) ACTIN-R AGCACTGTGTTGGCGTACAG (SEQ ID NO: 44)

    [0083] Taking the sensory neuron cells obtained from CD34+ source by the method of Example 3 and the sensory neuron cells CK obtained by serum induction method as examples, the results were shown in Fig. Compared with the serum induction method, the sensory neuron cells obtained by the present invention had significant increase in the expressions of various important channel genes such as potassium ion channel genes (KV4.3, KCNIP2, KV7.2, KV7.3), calcium ion channel proteins (CaV2.1, CaV2.2, CaV3.2), potassium-calcium complex ion channels (KCa2.1, KCa2.2), sodium ion channels (SCN9A, SCN11A), aminobutyric acid (ABA) receptors (GABRA3), aspartate receptors (NR2A, NR2B), TRP ion channel family (TRPV1, TRPV4, TPRM8). The results showed that in present invention, a variety of somatic cells can be successfully induced into sensory neuron cells, expressing a series of sensory neuron-specific markers, and showing a higher level of marker expression compared with the sensory neuron cells obtained by serum induction method.

    [0084] (4.4) Electrophysiological Activity Assay of Sensory Neuron Cells

    [0085] (4.4.1) Spontaneous discharge signals of induced sensory neuron cells were detected by multi-channel electrodes. A 48-well or 96-well MEA system multi-channel electrode plate (AXION Biosystem, US) was coated with 100 ng/ml polylysine (Poly-L-lysine, Sigma-Aldrich, P4707) in an incubator (Panasonic, MCO-18AC) at 37° C., 5% CO.sub.2 for 12 hours; and then the poly-lysine-coated MEA multi-channel electrode plate was taken out, with the poly-lysine being removed, and then washed three times with sterile water. After that, a PBS solution containing 3 μg/ml gelatin (laminin 521) as a nerve cell coating matrix, was added to the MEA multi-channel electrode plate, and then the plated was coated in a cell incubator (Panasonic, MCO-18AC) at 37° C., 5% CO.sub.2 for 3 hours. After the MEA multi-channel electrode plate was completely coated, the induced sensory neuron precursor cells were seeded at 5×10.sup.4 cells per well. The culture was performed by the sensory neuron cell medium of Example 3.3. The detection of spontaneous neuron electrical signals was performed after 14 days (i.e. the early stage of neuron maturation). The MEA multi-channel electrode plate for culturing induced sensory neuron cells was placed in a MEA chamber, and the cell culture conditions were adjusted in AxIS Navigator 2.0.2 software to 37° C., 5% carbon dioxide, and run for 10 minutes until the chamber environment was stable. Cell spontaneous discharge signals were recorded with AxIS Navigator 2.0.2 software (AXION Biosystem, US). The results were shown in FIG. 5 a, and the above results all showed that by using the induction method of the present invention, the three sources of somatic cells could generate electrophysiological activity earlier, with higher discharge frequency and higher spontaneous potential, as compared with those by using the serum induction method. Taking the induction of mesenchymal cells as an example, the chemical small molecule induction method used in the present invention and the serum induction method were compared, and the results showed that the combination of chemical small molecules LY2157299, CHIR98014 and SU5402 in the present invention could produce higher electrophysiological activity.

    [0086] (4.4.2) The MEA plate and cells were prepared by the method of (4.4.1), and cultured for 20 days (i.e. the neuron mature period). 3 μM tetrodotoxin (TOCRIS, 1078/1) was used as non-specific sodium ion inhibitor to verify the electrophysiological activity of sodium ion channels on cells. The MEA plate was placed in a MEA chamber, and the cell culture condition was adjusted to 37° C., 5% carbon dioxide, running for 10 minutes until the chamber environment was stable, and then the spontaneous discharge of cells was detected. The cell electrode plate was taken out, and added with 3 μM tetrodotoxin per well for 10 minutes of reaction, and then the MEA plate was placed in the MEA chamber; the cell culture conditions were adjusted to 37° C., 5% carbon dioxide, running for 10 minutes until the chamber environment was stable; the spontaneous discharge of cells under the action of 3 μM tetrodotoxin was detected. Cell spontaneous discharge signals were recorded with AxIS Navigator 2.0.2 software (AXION Biosystem, US). Data analysis was performed by AxIS Metrictool and NruralMethics software (AXION Biosystem, US). The results were shown in FIG. 6. The non-specific sodium ion inhibitor had an electrical signal inhibitory effect on the sensory neuron cells (three somatic cell sources) induced by the method of the present invention, indicating that the sensory neurons induced by the method of the present invention could express sodium ion channel proteins, and the sodium channel proteins had an electrophysiological activity and could produce corresponding electrophysiological response to the sodium ion blocker. The results showed that, as compared with the serum control method, the sensory neurons produced by the method of the present invention had higher sodium ion channel activity under the same concentration of sodium ion blockers.

    [0087] (4.4.3) The MEA plate and cells were prepared by the method of (4.4.2), and PF-05089771 (TOCRIS, 5931), a specific inhibitor of sodium ion channel 1.7, at a concentration of 1 μM was used to verify the electrophysiological activity of sodium ion channels 1.8 and 1.9 on cells. The MEA plate was placed in a MEA chamber, and the cell culture conditions were adjusted to 37° C., 5% carbon dioxide, running for 10 minutes until the chamber environment was stable, and then the spontaneous discharge of cells was detected. The cell electrode plate was taken out, and added with 1 μM PF-05089771 per well, and then the MEA plate was placed in the MEA chamber; the cell culture conditions were adjusted to 37° C., 5% carbon dioxide, running for 10 minutes until the chamber environment was stable; the spontaneous discharge of cells under the action of 1 μM PF-05089771 was detected. Cell spontaneous discharge signals were recorded with AxIS Navigator 2.0.2 software (AXION Biosystem, US). Data analysis was performed by AxIS Metrictool and NruralMethics software (AXION Biosystem, US). Taking the induction of fibroblasts as an example, the chemical small molecule induction method used in the present invention and the serum induction method were compared, and the results were shown in FIG. 7. The results showed that the concentration of LY2157299, CHIR98014 or SU5402 significantly improved the electrophysiological strength of sodium ion channels. Compared with the sensory neuron cells obtained by serum induction method, the sensory neuron cells obtained by the method of the present invention had a higher antagonistic effect on PF-05089771.

    Example 5. Effects of Different Types and Concentrations of Small Molecules on the Formation of Induced Sensory Neuron Cells

    [0088] (5.1) Morphology of Peripheral Sensory Cells Induced by Different LY2157299 Concentrations

    [0089] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of LY2157299 on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity.

    [0090] The results were shown in FIG. 8 a-g. FIG. 8 g showed that the small-molecule inhibitor LY2157299 exhibited a linear increase in concentration versus protein expression in the expression of various sodium ion channel proteins, especially at the concentration of 7.5 μM and 25 μM, the expressions of SCN9A and SCN11A were significantly increased compared with the serum induction method. At LY2157299 concentrations of below 50 nM, the ion channel protein expressions were significantly lower than normal levels. As can be seen from the figures, the small molecule LY2157299 at different concentrations in the present invention can significantly promote the expressions of specific marker sodium ion channels 1.7 and 1.9 in peripheral neurons, and the neurons induced by using LY2157299 showed more antagonism against PF-05089771 (consistent with the results in FIG. 7) (Note: The expression level of each group in the serum induction method was taken as 1, and the relative expression folds of the two groups of markers in the sensory nerve precursor cells induced by the induction medium with different component concentrations were calculated respectively. The same below). The image results above could represent induced sensory neuron cells derived from mesenchymal cells and fibroblasts.

    [0091] (5.2) Taking CD34+-derived cells as an example, different small molecules (5 μM RepSox, 5 μM SB525334 and 5 μM TEW-7197 molecules) were used to replace the LY2157299 in the sensory neuron induction medium N2GS212I-2 in Section (3.1) of Example 3; steps in Section (3.1) of Example 3 were repeated to observe the effects of different small molecules on the induced sensory nerve precursor cells. The results were shown in FIG. 9.

    [0092] (5.3) Taking CD34+-derived cells as an example, steps of Example 4 (4.3) were repeated by using the sensory nerve precursor cells obtained in (5.2), and the effects of different small molecules on the expression of neuronal precursor cell markers during the formation of sensory nerve precursor cells were observed. The results were shown in FIG. 9 f. As shown in the figures, the different inhibitor molecules were not only able to form neuron precursor cells (forming a neural plate structure shown in the figure), but also able to increase the expressions of neuron precursor cell markers.

    [0093] (5.4) Effects of Different LDN Concentrations on the Formation of Induced Sensory Neuron Cells

    [0094] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of LDN (that is, low concentration (12 nM), medium concentration (50 nM) and high concentration (180 nM)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 10 a-d. Capase3 was a marker of apoptosis. As shown in FIG. 10, when the concentration of LDN193189 increased to 180 nM or more, the expression of Caspase3 in the induced neuron cells was more than 1.5 times that of the serum control group; on the contrary, when the concentration of LDN193189 decreased to below 12 nM, the expression of peripheral neuron-specific ion channel protein sodium ion channel 1.8 (SCN10A) was lower than that in serum control. In conclusion, 12 nM-180 nM was the optimal range. The images above could represent induced sensory neuron cells derived from mesenchymal cells and fibroblasts.

    [0095] (5.5) Effects of Different N2 Concentrations on the Formation of Induced Sensory Neuron Cells

    [0096] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of N2 (that is, low concentration (0.5%), medium concentration (0.5%) and high concentration (2%)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 11 a-d. Capase3 was a marker of apoptosis. At 0.2% and 2.2% N2 concentration, the expression of Caspase3 in the induced neuron cells was more than 1.5 times that of the serum control group; on the contrary, the expression of peripheral neuron-specific ion channel protein sodium ion channel 1.8 (SCN10A) at 0.2% and 2.2% N2 concentration was lower than that of the serum control. In conclusion, the concentration range of 0.5%-2% was the optimal range; the above images could represent induced neuron cells derived from mesenchymal cells and fibroblasts.

    [0097] (5.6) Effects of Different GS21 Concentrations on the Formation of Induced Sensory Neuron Cells

    [0098] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of GS21 (that is, low concentration (0.2%), medium concentration (2.0%) and high concentration (3.1%)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 12 a-d. Capase3 was a marker of apoptosis. At the 0.05% and 4% GS21 concentration, the expression of Caspase3 in the induced neuron cells was more than 1.5 times that of the serum control group; whereas the effect of GS21 on the peripheral neuron-specific ion channel protein sodium ion channel 1.8 (SCN10A) was not significantly different from that in serum control. In conclusion, the concentration range of 0.2%-3.1% was the optimal range; the above images could represent induced neuron cells derived from mesenchymal cells and fibroblasts.

    [0099] (5.7) Effects of Different Concentrations of Glycine-Glutamine Monohydrate on the Formation of Induced Sensory Neuron Cells

    [0100] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of glycine-glutamine monohydrate (that is, low concentration (5 mM), medium concentration (12 mM) and high concentration (22 mM)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 13 a-c. The induced peripheral neurons prepared by using low (5 mM), medium (12 mM) and high (22 mM) concentrations of glycine-glutamine monohydrate had a normal morphology, but had a slow axonal growth at high concentration (22 mM).

    [0101] In order to observe the effect of different concentrations of glycine-glutamine monohydrate on osmotic pressure, the effect of different concentrations of glycine-glutamine monohydrate on the osmotic pressure of culture system was detected by using an automatic freezing point osmometer (FM-8P, Shanghai Medical University Instrument Co., Ltd.), and specific operations were performed according to the product manual (FM-8P, Shanghai Medical University Instrument Co., Ltd.). The test results were shown in FIG. 13 d. FIG. 13 d showed that with the increase of glycine-glutamine monohydrate concentration, the osmotic pressure increased linearly. When the concentration exceeded 22 mM, the osmotic pressure of the culture system exceeded the threshold osmotic pressure 320 mOsm/kg for cell culture, indicating that the concentration of glycine-glutamine monohydrate used in the present invention was the most suitable concentration for cell culture.

    [0102] (5.8) Effects of Different HEPES Buffer Concentrations on the Formation of Induced Sensory Neuron Cells

    [0103] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of HEPES buffer (that is, low concentration (5 mM), medium concentration (10 mM) and high concentration (15 mM)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 14 a-c.

    [0104] Steps in (5.7) were repeated to observe the effect of the medium with different HEPES buffer concentrations on the osmotic pressure. The results were shown in FIG. 14 d. As shown, the cells were morphologically normal, and cell intolerance began to appear at high concentration (15 mM). With the increase of the concentration, the osmotic pressure of the culture system increased linearly. When the concentration was more than 15 mM, the osmotic pressure of the culture system exceeded the threshold osmotic pressure for cell culture, 320 mOsm/kg. Therefore, the HEPES buffer concentration determined in the present invention was the optimal concentration. The images above could represent sensory neuron cells derived from mesenchymal cells and fibroblasts.

    [0105] (5.9) Effects of Different CHIR98014 Concentrations on the Formation of Peripheral Sensory Neuron Cells

    [0106] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of CHIR98014 (0.3 nM-5 μM) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells.

    [0107] The results were shown in FIG. 15 a-g. FIG. 15 a-f showed the sensory neuron cells obtained by different concentrations of CHIR98014. FIG. 15 g showed the effects of different concentrations of CHIR98014 on the expressions of peripheral sensory neuron-specific genes by using Q-PCR analysis. As compared with the serum induction method, the expression of SCN11A (Nav1.9) was significantly increased at the CHIR98014 concentration of 0.5 μM to 3 μM. However, when the CHIR98014 concentration was lower than 0.3 nM and higher than 5 μM, the expression of ion channel protein was lower than normal level; when the CHIR98014 concentration was higher than 5 μM, the expression of neuron marker Tuj was lower than that at other concentrations. wherein, the expression data of SCN11A (Nav1.9) were consistent with the data of strong antagonistic effect on PF-05089771 (FIG. 7). The images above could represent sensory neuron cells derived from mesenchymal cells and fibroblasts.

    [0108] (5.10) Effects of Different SU5402 Concentrations on the Formation of Peripheral Sensory Neuron Cells

    [0109] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of SU5402 (that is, low concentration (3 μM), medium concentration (6 μM) and high concentration (10 μM)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 16 a-d.

    [0110] FIG. 16 a-c showed that cells could form axons at low concentration (3 μM), medium concentration (6 μM) and high concentration (10 μM) of SU5402; FIG. 16 d showed the effects of different concentrations of SU5402 on the expressions of peripheral sensory neuron-specific genes by using Q-PCR analysis. As compared with that in the serum induction method, when the concentration of SU5402 was lower than 3 μM, the expression of ion channel protein was lower than the control level; when the concentration was higher than 15 μM, the cell death marker CASP3 was significantly increased. wherein, the expression data of SCN11A (Nav1.9) were consistent with the data of strong antagonistic effect on PF-05089771 (FIG. 7). The images above could represent sensory neuron cells derived from mesenchymal cells and fibroblasts.

    [0111] (5.11) Effects of Different DAPT Concentrations on the Formation of Peripheral Sensory Neuron Cells

    [0112] The steps of Examples 3-4 were repeated by taking CD34+-derived cells as an example, and the effects of different concentrations of DAPT (that is, low concentration (3 μM), medium concentration (6 μM) and high concentration (10 μM)) on sensory neuron cells were observed, including the effect on the induction of sensory nerve precursor cells, and the effect on the expression of specific markers of sensory neuron cells, and the effect on the electrophysiological activity. The results were shown in FIG. 17 a-f.

    [0113] FIG. 17 a-c showed that cells were able to form axons at low (3 μM), medium (6 μM) and high (10 μM) concentrations of DAPT. FIG. 17 d showed the effects of different concentrations of DAPT on the expressions of peripheral sensory cell-specific genes by using Q-PCR analysis. When the DAPT concentration was lower than 3 μM, the induced neuron cell markers and peripheral sensory neuron cell markers were much lower than those in the serum control group; on the contrary, when the DAPT concentration increased to more than 10 μM, the expression of peripheral sensory neuron cell-specific ion channel protein sodium ion channel 1.8 (SCN10A) was decreased, while the expression of neuron marker Tuj was increased, indicating that high concentrations of DAPT promoted the generation of non-peripheral sensory neuron cells. The above data demonstrated that the DAPT concentration range used in the present invention was the most suitable for the production of peripheral sensory neuron cells. The images above could represent induced neuron cells derived from mesenchymal cells and fibroblasts.

    [0114] In conclusion, as compared with the known methods, in the absence of serum components, the combination of small molecules and concentrations thereof in the present invention significantly promoted the expressions of various functional ion channels in peripheral neuron cells.

    Example 6. Quantitative Detection of Sensory Neuron Cell Viability

    [0115] The cell viability was quantitatively detected by Cyquant assay to compare the effects of different combinations of small molecule compounds on maintaining physiological states of cells during long-term culture of induced sensory neurons.

    [0116] Cell plate coating was performed in a 96-well opaque cell culture plate according to the method in Example 4 (4.4.1). After the coating was completed, the induced nerve precursor cells were seeded at 5×10.sup.4 cells per well, and three parallel replicates were set up (the average of the three groups was calculated as the data). The cells were cultured in the sensory neuron cell induction medium of Example 3 with different concentrations of NT3, and the culture conditions were 37° C., 5% carbon dioxide, and the medium was half quantity changed every three days. The medium in the known method was used as a control group. Samples were taken at day 1, day 3, day 5 and day 10, respectively, and the cell viability detection was carried out by using CyQuant Kit (Invitrogen, X12223) according to the instruction manual, and date were read by SpectraMax i3 Multi-Mode Microplate Reader (VWR, ID3-STD). Taking the induced sensory neurons derived from fibroblasts as an example, the results were shown in FIG. 18. The added NT3 in the present invention was able to effectively increase the in vitro viability of the induced neuron in the long-term culture process as compared with that of the sensory neuron cell CK obtained by the serum induction method.