ADENOVIRUS CONTROL VIRUS
20200208173 ยท 2020-07-02
Inventors
Cpc classification
C12N2710/10031
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N7/04
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed are compositions and methods related to replication deficient adenoviruses that are able to function as controls for nucleic acid diagnostic assays (e.g., nucleic acid sequencing based assays and/or nucleic acid amplification based assays).
Claims
1. A replication deficient recombinant adenovirus lacking E1 activity, comprising a genome comprising adenovirus genomic DNA sequence and a heterologous DNA sequence.
2. The replication deficient recombinant adenovirus of claim 1, wherein the adenovirus genomic DNA sequence is at least 90% identical to SEQ ID NO: 1.
3. The replication deficient recombinant adenovirus of claim 1, wherein the adenovirus genomic DNA sequence comprises a nucleic acid sequence of SEQ ID NO: 1.
4. The replication deficient recombinant adenovirus of claim 1, wherein the genome lacks a sequence encoding an E1 promotor or an E1 open reading frame.
5. The replication deficient recombinant adenovirus of claim 1, wherein the heterologous DNA sequence comprises a non-adenovirus organism or virus sequence.
6. The replication deficient recombinant adenovirus of claim 5, wherein the heterologous DNA sequecne comprises DNA from the genome of a human pathogen.
7. The replication deficient recombinant adenovirus of claim 6, wherein the human pathogen is a protozoan, a multicellular parasite or a bacterium.
8. The replication deficient recombinant adenovirus of claim 5, wherein the heterologous DNA sequence is a human DNA sequence.
9. The replication deficient recombinant adenovirus of claim 8, wherein the human DNA sequence comprises the sequence of a cancer-associated gene or mutation.
10. The replication deficient recombinant adenovirus of claim 5, wherein the heterologous DNA sequence is a non-adenovirus DNA virus sequence.
11. The replication deficient recombinant adenovirus virus of claim 10, wherein the non-adenovirus DNA virus sequence comprises one or more mutations that convey drug resistance when they occur in the non-adenovirus DNA virus.
12. The replication deficient recombinant adenovirus virus of claim 10, wherein the non-adenovirus DNA virus sequence comprises at least 5 mutations that convey drug resistance when they occur in the non-adenovirus DNA virus.
13-15. (canceled)
16. The replication deficient recombinant adenovirus virus of claim 1, wherein the heterologous DNA sequence is an internal control sequence.
17. (canceled)
18. (canceled)
19. A composition, comprising a replication deficient adenovirus of claim 1.
20-26. (canceled)
27. A nucleic acid molecule encoding the genome of the replication deficient adenovirus of claim 1.
28. The nucleic acid molecule of claim 27, wherein the nucleic acid molecule is a DNA molecule.
29. The nucleic acid molecule of claim 28, wherein the DNA molecule is a plasmid.
30. The plasmid of claim 29, wherein the plasmid is a linearized plasmid.
31. A method of making a replication deficient Adenovirus virus comprising: (a) transfecting a cell that expresses adenovirus E1 proteins with the linearized plasmid molecule of claim 30; (b) culturing the transfected cell of step (a) under conditions such that the cell produces a replication deficient adenovirus; and (c) collecting the replication deficient adenovirus.
32-34. (canceled)
35. A method of testing a diagnostic assay, comprising performing the diagnostic assay on a composition of claim 19.
Description
BRIEF DESCRIPTION OF FIGURES
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
General
[0026] Provided herein are compositions and methods related to replication deficient adenovirus that are able to function as controls for nucleic acid diagnostic assays (e.g., nucleic acid sequencing based assays and/or nucleic acid amplification based assays). In certain aspects, provided herein are adenovirus control virus useful as whole process controls, positive controls and/or internal controls in nucleic acid diagnostic assays. Such control virus can benefit diagnostics manufacturers by providing a less expensive, consistent and safe source of starting material for controls. Moreover, the adenovirus structure also confers stability to the encapsulated DNA in complex biological matrices such as plasma, blood or urine. The control virus described herein use adenovirus virus, an DNA containing virus that can be engineered to contain target DNA sequences, such as sequences from another virus and/or an internal control sequence. In some embodiments, the recombinant adenovirus system described herein results in viral particles that are packaged, so they can be used to evaluate nucleic acid extraction processes that are used before nucleic acid detection. Also provided herein are compositions comprising such viruses, nucleic acid molecules encoding the genome of such control viruses, methods of making such control viruses and methods of using such control viruses.
Definitions
[0027] For convenience, certain terms employed in the specification, examples, and appended claims are collected here.
[0028] The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.
[0029] The term biological sample, tissue sample, or simply sample each refers to a collection of cells obtained from a tissue of a subject. The source of the tissue sample may be solid tissue, as from a fresh, frozen and/or preserved organ, tissue sample, biopsy, or aspirate; blood or any blood constituents, serum, blood; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid or interstitial fluid, urine, saliva, stool, tears; or cells from any time in gestation or development of the subject.
[0030] The term control includes any portion of an experimental system designed to demonstrate that the factor being tested is responsible for the observed effect, and is therefore useful to isolate and quantify the effect of one variable on a system.
[0031] The term gene is used broadly to refer to any nucleic acid associated with a biological function. The term gene applies to a specific genomic sequence, as well as to a cDNA or an mRNA encoded by that genomic sequence.
[0032] As used herein, the term heterologous DNA refers to DNA present in a recombinant adenovirus that is not derived from wild-type adenovirus. For example, heterologous DNA in a adenovirus virus can be a DNA sequence normally found in a different virus (e.g., a different DNA virus), can be an DNA sequence normally found a non-viral organism, or can be a completely artificial DNA sequence.
[0033] The term isolated nucleic acid refers to a polynucleotide of natural or synthetic origin or some combination thereof, which (1) is not associated with the cell in which the isolated nucleic acid is found in nature, and/or (2) is operably linked to a polynucleotide to which it is not linked in nature.
[0034] The terms polynucleotide, and nucleic acid are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. A polynucleotide may be further modified, such as by conjugation with a labeling component. In all nucleic acid sequences provided herein, U nucleotides are interchangeable with T nucleotides.
[0035] As used herein, the term adenovirus includes medium-sized (90-100 nm) nonenveloped viral particles made up of an icosahedral nucleocapsid that comprises adenovirus virus capsid proteins encompassing a double-stranded DNA genome. The DNA genome can include non-adenovirus DNA (i.e., heterologous DNA) and does not need to include all parts of the wild-type adenovirus genome. For example, in some embodiments the DNA genome does not encode functional adenovirus E1 protein.
Replication Deficient Adenovirus Control Viruses
[0036] In certain embodiments, provided herein are replication deficient Adenovirus control viruses. In some embodiments, such viruses have an dsDNA genome that includes (a) sequences encoding adenovirus proteins and (b) a heterologous (i.e., non-adenovirus) DNA sequence. In some embodiments, the heterologous DNA sequence is a sequence from a different DNA virus, such as a variola virus (e.g., a variola major virus and/or a variola minor virus), a pox virus (e.g., small pox, cowpox, vaccinia virus), a herpesviridae virus (e.g., an HHV-1 virus, an HHV-2 virus, an HHV-3 virus, an HHV-4 virus, an HHV-5 virus, an HHV-6 virus, an HHV-8 virus), a papillomavirus virus (e.g., an HPV virus), a polyomavirus virus (e.g., a BK virus, a JC virus), a hepatitis B virus and/or a parovirus virus (e.g., parovirus B19). In certain embodiments, the heterologous DNA sequence is a sequence of a herpes virus modified for viral-based cancer therapy (e.g., a sequence from a genetically engineered virus called talimogene laherparepvec (T-VEC) to treat advanced melanoma).
[0037] In certain embodiments, the recombinant adenovirus control viruses described herein are replication deficient. In some embodiments, any method can be used to render the recombinant adenovirus control virus replication deficient. In some embodiments the adenovirus control virus does not encode one or more functional structural proteins. In some embodiments, the recombinant adenovirus control virus genome does not encode one or more functional nonstructural proteins. In some embodiments, the adenovirus control virus does not encode a functional E1 protein. In some embodiments, the adenovirus control virus does not encode a functional E1 promoter.
[0038] The Adenovirus control viruses described herein can be generated using any method known in the art. An exemplary method of generating the Adenovirus control viruses described herein is illustrated in
Use of Adenovirus Control Vectors in Nucleic Acid Diagnostic Assays
[0039] In certain aspects, provided herein are methods of testing a diagnostic assay by running the diagnostic assay on a composition comprising the replication deficient adenovirus described herein. In some embodiments, the diagnostic assay is an assay for the detection of a variola virus (e.g., a variola major virus and/or a variola minor virus), a herpesviridae virus (e.g., an HHV-1 virus, an HHV-2 virus, an HHV-3 virus, an HHV-4 virus, an HHV-5 virus, an HHV-6 virus, an HHV-8 virus), a papillomavirus virus (e.g., an HPV virus), a polyomavirus virus (e.g., a BK virus, a JC virus), a hepatitis B virus and/or a parovirus virus. In certain embodiments, the heterologous DNA sequence in the genome of the replication deficient adenovirus virus contains the target sequence detected in the diagnostic assay.
[0040] In some embodiments, the diagnostic assay is a nucleic acid amplification based diagnostic assay. In some embodiments, the nucleic acid amplification based diagnostic assay includes a sample lysis step, a nucleic acid extraction step (e.g., a magnetic-bead based nucleic acid extraction step), a nucleic acid amplification step and/or a nucleic acid detection step. In some embodiments, the nucleic acid amplification and detection steps are performed simultaneously (e.g., through the use of a real-time detection technology, such as TaqMan probes or molecular beacons). Examples of nucleic acid amplification processes include, but are not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), self-sustained sequence replication (3SR), Q replicase based amplification, nucleic acid sequence-based amplification (NASBA), repair chain reaction (RCR), boomerang DNA amplification (BDA) and/or rolling circle amplification (RCA).
[0041] In some embodiments, the diagnostic assay is a nucleic acid sequencing based diagnostic assay (e.g., a next-generation sequencing based diagnostic assay). In some embodiments, the nucleic acid sequencing based diagnostic assay includes a sample lysis step, a nucleic acid extraction step (e.g., a magnetic-bead based nucleic acid extraction step), a nucleic acid amplification step, and/or a nucleic acid sequencing step. Examples of nucleic acid sequencing processes include, but are not limited to chain termination sequencing, sequencing by ligation, sequencing by synthesis, pyrosequencing, ion semiconductor sequencing, single-molecule real-time sequencing, 454 sequencing, and/or Dilute-N-Go sequencing.
EXAMPLES
Example 1
Production of an Adenovirus Control Virus
[0042] Wild type Adenovirus Type 5 AY601635 (Ad5) sequence was used as the as base for construction of an adenovirus control virus. The Ad5 sequence was modified and the recombinant clone synthesized using DNA 2.0 gene construction service. So that the adenovirus grows only on complementing cell lines, E1 deleted adenovirus was generated that can be grown only in E1 complementing cell line but not in any other human or nonhuman cell lines. The following changes were made to the Ad5 sequence (vector map provided in
[0049] An adenovirus vector constructed as described above and bearing a cloned sequence of interest was grown and amplified in bacteria and the plasmid DNA was purified using the Qiagen Plasmid Maxi/Mega kit. The isolated DNA was then digested with PacI restriction enzyme, which exposes the viral inverted terminal repeats (ITRs). After PacI digestion, the DNA was purified by extraction with phenol:chloroform and then precipitated with isopropyl alcohol. The purified DNA was resuspended in molecular biology grade water.
[0050] Human Embryonic Kidney (HEK) 293 cells were obtained from ATCC (catalog #CRL-1573). One working stock vial was removed from cryostorage and grown in Eagle's Minimum Essential Medium (EMEM) with 10% fetal bovine serum. The cells were passaged two to four times prior to transfection. Cell growth and viability was monitored by hemacytometer and the viability at each passage was greater than 90%. The day before transfection, the cells were plated at 510.sup.5 cells per well in a 6-well plate in 2 mL of EMEM Complete Growth Media. On the day of transfection, DNA-Lipofectamine 2000 (Invitrogen) complexes for each transfection sample were prepared according to the Lipofectamine 2000 manufacturer's instructions (1 g of linear DNA fragment was used per transfection). The cells were monitored by light microscopy for visible regions of cytopathic effect (CPE) which were typically observed 7-10 days post-transfection. When Cytopathic effect reached 80%, the cells were harvested and a crude lysate was made by repetitive cycles of freezing and thawing the cells.
[0051] To amplify the virus, HEK 293 cells were grown in culture, using a new working stock vial if necessary to approximately 80% confluency. The day before infections, cells were seeded in a 10 cm tissue culture plate at approximately 310.sup.6 cells per plate. On the day of infection, approximately 100-200 L of crude adenoviral lysate was added to the cells, which corresponds to a multiplicity of infection (MOI) of 3-5. The cells were incubated the cells at 37 C. in a CO.sub.2 incubator and the infection was allowed to proceed until 80-90% of the cells have rounded up and were floating (typically 2-3 days post-infection). This indicated that cells are loaded with adenoviral particles. The cells were harvested and a crude lysate was made by repetitive cycles of freezing and thawing the cells.
[0052] To purify the viral particles, the amplified viral lysate was centrifuged for 5 minutes at top speed in a benchtop microcentrifuge and the clarified supernatant was collected. 1 L of 25 U/L) of benzonase enzyme was added to every 1 mL of viral supernatant. The benzonase reaction was incubated at 37 C. for 30 minutes. Purification used ViraPur Adenovirus Standard Purification Virakit following the manufacturer's instruction. 10 mL of crude lysate was mixed with an equal volume of the kit dilution buffer and passed over a single column. Elution from the column was performed using the kit elution buffer, and then the eluate was mixed with glycerol (to 10% final concentration) before aliquotting and freezing.
[0053] The final product was titered using a TaqMan Real time PCR Assay. The primers and probes for this assay are given in table 1. The PCR standards are made from a plasmid which contains adenovirus sequences and the primers and probes targets this sequence. The linearized plasmid was quantitated by PicoGreen Assay (Molecular Probes/Life Technologies), and diluted appropriately.
TABLE-US-00001 TABLE1 PrimersandprobeforTaqManbasedadenovirus quantitationassay. SEQ ID Name Sequence NO: Function Adeno 5- 2 Adenovirus Vector- TTTGGGCGTAACCGAGTAAG-3 Vector F sequence Forward primer Adeno 5- 3 Adenovirus Vector- GGCGAGTCTCCACGTAAAC-3 Vector R sequence Reverse primer Adeno 5-6FAM- 4 Adenovirus Vector AGCGCGTAATATTTGTCTAGGG Vector probe CCG-BHQ1-3 sequence probe
[0054] Purified Adenovirus lot 13110 was tested at zero months, 21 and 25 Month time points to assign 2 year dating when stored at 70 C. Except for the zero time point, the remaining two time points was tested in 3 replicates on in-house developed TaqMan assay as per SOP19162 (see Table 1). Zero Time point was tested in 5 replicates on two different runs for release testing. At each time point virus was diluted at 1:100 in PBS before testing. Data for all the time points is presented below.
TABLE-US-00002 TABLE 2 Real Time stability data indicating 2 year shelf life at 70 C. Time (months) Viral Count (copies/ml) 0 1.45 10.sup.9 0 3.12 10.sup.8 0 8.80 10.sup.8 20 5.09 10.sup.8 25 3.01 10.sup.9
[0055] Data suggests that no reduction in copies/mL of virus is observed after storing virus for 2 years at 70 V temperature. With this data two year dating can be assigned to the Purified Adenovirus lots.
[0056] To test the use of the adenovirus control vector as a control, the recombinant adenovirus that bears an internal control sequence was produced as described above (a sequence that is amplified by the pathogen detection primers, but has a unique sequence recognized by an independent probe). Ten replicates of 1:100 diluted stock were tested via TaqMan real time assay across multiple runs to demonstrate consistency of the internal control. The results of the detection assay are depicted in
INCORPORATION BY REFERENCE
[0057] All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
EQUIVALENTS
[0058] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.