NOVEL POLYPEPTIDE AND METHOD FOR PRODUCING ORNITHINE-BASED PRODUCT USING THE SAME

20200208182 ยท 2020-07-02

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to a novel polypeptide having an ability to export an ornithine-based product, and a method for producing an ornithine-based product using the same.

    Claims

    1. A polypeptide having an ability to export an ornithine-based product, wherein the glycine residue at position 77 from the N-terminus of the amino acid sequence of an ornithine-based product-exporting protein, which consists of an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, is substituted with other amino acids.

    2. The polypeptide of claim 1, wherein the glycine at position 77 is substituted with alanine or arginine.

    3. The polypeptide of claim 1, wherein the polypeptide consists of an amino acid sequence represented by any one of SEQ ID NO: 3 to SEQ ID NO: 6.

    4. A polynucleotide encoding the polypeptide having an ability to export an ornithine-based product of claim 1.

    5. A vector comprising the polynucleotide of claim 4.

    6. A microorganism of the genus Corynebacterium producing ornithine-based product, comprising the polypeptide of claim 1 or having an enhanced activity thereof.

    7. The microorganism of claim 6, wherein the microorganism is Corynebacterium glutamicum.

    8. The microorganism of claim 6, wherein an ornithine decarboxylase (ODC) activity is further introduced.

    9. The microorganism of claim 6, wherein the activity of at least one selected from the group consisting of ornithine carbamoyltransferase (ArgF), putrescine acetyltransferase, and a protein involved in glutamate export is further weakened compared to the endogenous activity thereof.

    10. The microorganism of claim 6, wherein the activity of at least one selected from the group consisting of acetyl gamma glutamyl phosphate reductase (ArgC), acetylglutamate synthase or ornithine acetyltransferase (argJ), acetylglutamate kinase (ArgB), and acetylornithine aminotransferase (ArgD) is further enhanced compared to the endogenous activity thereof.

    11.-13. (canceled)

    14. The microorganism of claim 6, wherein the activity of at least one selected from the group consisting of ornithine carbamoyltransfrase (ArgF), argininosuccinate synthase (argG), argininosuccinate lyase (argH), aspartate ammonia lyase and aspartate aminotransferase is further increased compared to the endogenous activity thereof.

    15.-20. (canceled)

    21. A method for producing an ornithine-based product, comprising: (i) culturing the microorganism of claim 6 in a medium; and (ii) recovering an ornithine-based product from the microorganism or the medium obtained above.

    22. The microorganism of claim 6, wherein the ornithine-based product is putrescine.

    23. The microorganism of claim 6, wherein the ornithine-based product is arginine.

    24. The method of claim 14, wherein the ornithine-based product is putrescine, and the ornithine decarboxylase (ODC) activity is introduced to the microorganism.

    25. The method of claim 14, wherein the ornithine-based product is putrescine, and at least one selected from the group consisting of ornithine carbamoyltransferase (ArgF), putrescine acetyltransferase, and a protein involved in glutamate export is further inactivated in the microorganism compared to the endogenous activity thereof.

    26. The method of claim 14, wherein the ornithine-based product is arginine, and the activity of at least one selected from the group consisting of ornithine carbamoyltransfrase (ArgF), argininosuccinate synthase (argG), argininosuccinate lyase (argH), aspartate ammonia lyase and aspartate aminotransferase is further increased in the microorganism compared to the endogenous activity thereof.

    Description

    DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

    [0076] The present disclosure will be described in more detail through exemplary embodiments. However, these exemplary embodiments are given for illustrative purposes only, and are not intended to limit the scope of the present disclosure.

    Example 1

    Confirmation of Ability to Export Arginine of Putrescine-Exporting Protein

    [0077] It has been found that NCgl2522, a gene of Corynebacterium glutamicum, has an ability to export putrescine (Korean Patent Application Publication No. 2014-0115244). To this end, the following experiment was conducted to confirm whether NCgl2522 can also export citrulline, proline, and arginine, which can be biosynthesized from ornithine as a starting material, in addition to putrescine.

    [0078] Specifically, it was confirmed whether NCgl2522 has an ability to export arginine as a representative example, among the products that can be biosynthesized from ornithine as a starting material.

    <1-1> Construction of Arginine-Producing Strain-Based Vectors and Strains Having Enhanced NCgl2522 Activity

    [0079] In order to enhance the NCgl2522 activity in the wild-type ATCC21831 strain and KCCM10741P (Korean Patent No. 10-0791659) having an arginine-producing ability, the CJ7 promoter (WO 2006/065095 A) was introduced to the upstream of the initiation codon of NCgl2522 within the chromosome.

    [0080] A homologous recombinant fragment, which includes the CJ7 promoter disclosed in WO 2006/065095 A and in which both ends of the promoter have the original NCgl2522 sequence on the chromosome, was obtained. Specifically, the 5-end region of the CJ7 promoter was obtained by performing PCR using a primer pair of SEQ ID NOS: 17 and 18 shown in Table 1, based on the genomic DNA of the Corynebacterium glutamicum ATCC21831 or KCCM10741P as a template. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 30 seconds. Additionally, the CJ7 promoter region was obtained by performing PCR under the same conditions using a primer pair of SEQ ID NOS: 19 and 20 shown in Table 1, and the 3-end region of the CJ7 promoter was obtained by performing PCR using a primer pair of SEQ ID NOS: 20 and 21 shown in Table 1 under the same conditions, based on the genomic DNA of the Corynebacterium glutamicum ATCC21831 or KCCM10741P as a template. The primers used in the substitution of promoters are shown in Table 1 below.

    TABLE-US-00001 TABLE1 Primers Sequence(5->3) NCg12522-L5 TGCAGGTCGACTCTAGA (SEQIDNO:17) GTTCTGCGTAGCTGTGTGCC NCg12522-L3 GATGTTTCT (SEQIDNO:18) GGATCGTAACTGTAACGAATGG CJ7-F AGAAACATCCCAGCGCTACTAATA (SEQIDNO:19) CJ7-R AGTGTTTCCTTTCGTTGGGTACG (SEQIDNO:20) NCg12522-R5 CAACGAAAGGAAACACT (SEQIDNO:21) ATGATTTCAGAAACTTTGCAGGCG NCg12522-R3 TCGGTACCCGGGGATCC (SEQIDNO:22) CACAAAAAGCGTAGCGATCAACG

    [0081] Each of the PCR products obtained above was subjected to fusion cloning into the pDZ vector treated with BamHI and XbaI. The fusion cloning was performed at 50 C. for 10 minutes using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.), and the thus-obtained plasmids were named pDZ-P(CJ7)-NCgl2522-21831 and pDZ-P(CJ7)-NCgl2522-10741P, respectively.

    [0082] The plasmids pDZ-P(CJ7)-NCgl2522-21831 and pDZ-P(CJ7)-NCgl2522-10741P prepared above were respectively introduced into ATCC21831 and KCCM10741P, which are arginine-producing strains, via electroporation to obtain transformants, and the thus-obtained transformants were plated on BHIS plate media (37 g/L of Braine heart infusion, 91 g/L of sorbitol, and 2% agar) containing kanamycin (25 g/mL) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) and cultured to form colonies. Among the thus-formed colonies, the strains introduced with the plasmid pDZ-P(CJ7)-NCgl2522-21831 or pDZ-P(CJ7)-NCgl2522-10741P were selected.

    [0083] The selected strains were cultured with shaking (30 C., 8 hours) in CM media (10 g/L of glucose, 10 g/L of polypeptone, 5 g/L of yeast extract, 5 g/L of beef extract, 2.5 g/L of NaCl, and 2 g/L of urea at pH 6.8) and sequentially diluted from 10.sup.4 to 10.sup.10, plated on solid media containing X-gal, and cultured to form colonies. Among the thus-formed colonies, white colonies which appeared at a relatively low rate were selected, thereby finally selecting the strains, in which the promoter of the NCgl2522 gene was substituted with the CJ7 promoter by a secondary crossover. The finally selected strains were subjected to PCR using a primer pair of SEQ ID NOS: 19 and 22 shown in Table 1, and the thus-obtained products were applied to sequencing. As a result, it was confirmed that the CJ7 promoter was introduced into the upstream of the initiation codon of NCgl2522 within the chromosome. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 1 minute.

    [0084] The thus-selected modified strains of Corynebacterium glutamicum were named ATCC21831_Pcj7 Ncgl2522 and KCCM10741P_Pcj7 NCgl2522, respectively.

    <1-2> Confirmation of Arginine-Producing Ability of Arginine-Producing Strain-Based Strains Having Enhanced NCgl2522 Activity

    [0085] In order to confirm the effect of the NCgl2522 gene on the ability to export arginine, one of the ornithine-based products, the arginine-producing ability was compared among the modified strains of Corynebacterium glutamicum ATCC21831_Pcj7 Ncgl2522 and KCCM10741P_Pcj7 NCgl2522 prepared in Example 1 above.

    [0086] As the control groups, Corynebacterium glutamicum ATCC21831 and KCCM10741P, which are the parent strains, were used, and one platinum loop of each strain was inoculated into a 250-mL corner-baffled flask containing 25 mLl of production media [6% glucose, 3% ammonium sulfate, 0.1% monopotassium phosphate, 0.2% magnesium sulfate heptahydrate, 1.5% corn steep liquor (CSL), 1% NaCl, 0.5% yeast extract, and 100 g/L of biotin at pH7.2] and cultured at 30 C. at a rate of 200 rpm for 48 hours to produce arginine. After completion of the culture, the arginine production was measured by HPLC. The results are shown in Table 2 below.

    TABLE-US-00002 TABLE 2 Arginine Ornithine Concen- Concen- tration tration Arginine Strains OD (g/L) (g/L) Fold (%) KCCM10741P 91 3.0 0.3 100 KCCM10741P_Pcj7 72 3.6 0.4 120 Ncgl2522 ATCC21831 102 4.2 0.3 100 ATCC21831_Pcj7 86 4.8 0.4 114 Ncgl2522

    [0087] As shown in Table 2, when the promoter of the NCgl2522 gene in KCCM10741P and ATCC21831 was enhanced by substitution with the CJ7 promoter, the modified strains of Corynebacterium glutamicum showed an increase in the arginine production by 20% and 14% as compared to the parent strains, respectively. Additionally, it was confirmed that the concentration of ornithine, a reactant before conversion to arginine, was also increased in the modified strains as compared to the parent strains.

    [0088] Based on these findings, it was confirmed that the NCgl2522 gene is not only a gene for exporting putrescine, but also has an ability to export products including ornithine which are biosynthesized from ornithine as a starting material. Additionally, it can be interpreted from the above results that the NCgl2522 gene and the variants of the present disclosure can be very useful in the production of ornithine-based products using biomass.

    Example 2

    Construction of Library of Gene Variants Encoding Putrescine-Exporting Protein and Establishment of Effective Modification

    [0089] In order to increase the activity of the ornithine-based product-exporting protein, the present inventors constructed variants for NCgl2522 (Korea Patent No. 10-1607741), a gene encoding a putrescine-exporting protein.

    [0090] Specifically, in order to construct a library of the NCgl2522 gene variants, a random mutagenesis PCR (JENA error-prone PCR) was performed using a specific primer pair of SEQ ID NOS: 7 and 8 excluding the initiation codon of ORF of the NCgl2522 gene, shown in Table 3, based on the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template.

    TABLE-US-00003 TABLE3 Primer Sequence(5->3) 13032-putE-EF-FX CCGGGGATCCTCTAGA (SEQIDNO:7) ACTTCAGAAACCTTACAGGC 13032-putE-EF-RX GCAGGTCGACTCTAGA (SEQIDNO:8) CTAGTGCGCATTATTGGCTC

    [0091] The thus-prepared mutant gene fragments were subjected to fusion cloning into the pDZ vector cleaved with XbaI. The fusion cloning was performed at 50 C. for 10 minutes using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.), thereby completing the construction of plasmid libraries of pDZ-N2522 variants.

    [0092] The thus-constructed recombinant plasmid libraries were screened via high throughput screening (HTS). In particular, the platform strain used for screening was KCCM11240P, which is a Corynebacterium glutamicum-derived recombinant microorganism capable of producing putrescine (Korean Patent No. 10-1493585).

    [0093] Specifically, in order to obtain variants with an improved activity for exporting putrescine, the thus-constructed plasmid libraries were introduced into KCCM11240P via electroporation to obtain transformants, and the thus-obtained transformants were plated on BHIS plate media (37 g/L of Braine heart infusion , 91 g/L of sorbitol, and 2% agar) containing kanamycin (25 g/mL) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) and cultured to form colonies. Among the thus-formed colonies, the strains introduced with the plasmid pDZ-N2522 variant libraries were selected.

    [0094] The selected strains were cultured by shaking in a 96 deep well plate along with titer media (2 g/L of glucose, 0.4 g/L of MgSO.sub.4.7H.sub.2O, 0.8 g/L of MgCl.sub.2, 1 g/L of KH.sub.2PO.sub.4, 4 g/L of (NH.sub.4).sub.2SO.sub.4, 0.48 g/L of soybean protein hydrolysate, 0.01 g/L of MnSO.sub.4.7H.sub.2O, 200 g/L of thiamine HCl, 200 g/L of biotin, 0.01 g/L of FeSO.sub.4.7H.sub.2O, 1 mM arginine, and 25 g/mL of kanamycin at pH 7.2), and the concentration of putrescine produced in each culture was measured, and then one transformant with the greatest increase in putrescine productivity compared to the control group was selected. Subsequently, it was confirmed as to which modification was induced in the amino acid sequence of the NCgl2522 protein for the selected transformant. The sequence of the Ncgl2522 variant was confirmed as follows: a homologous recombinant fragment was obtained by performing colony PCR using a primer pair of SEQ ID NOS: 7 and 8, based on the transformant including the corresponding variants, followed by applying the product to genome sequencing using a primer of SEQ ID NO: 7. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 1 minute.

    [0095] As a result, it was confirmed that the NCgl2522 variant selected therefrom was modified such that the glycine (Gly), which is the amino acid residue at position 77 from the N-terminus of the NCgl2522 amino acid sequence (SEQ ID NO: 1) of Corynebacterium glutamicum ATCC13032, was substituted with alanine (Ala), and was named NCgl2522_G77A (SEQ ID NO: 3).

    Example 3

    Establishment of Various Variants in which Amino Acid Residue at Position 77 of Gene Encoding Putrescine-Exporting Protein is Substituted

    [0096] Based on the NCgl2522_G77A variant prepared in Example 2, the present inventors realized that the amino acid residue at position 77 from the N-terminus is important for the activity of the NCgl2522 protein. Accordingly, various variants in which the amino acid residue at position 77 of the NCgl2522 protein was substituted with other amino acid residues were prepared.

    [0097] Specifically, a homologous recombinant fragment was obtained using a specific primer pair of SEQ ID NOS: 7 and 8 excluding the initiation codon of ORF of NCgl2522 gene, based on the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 1 minute.

    [0098] Subsequently, the PCR product obtained above was subjected to fusion cloning into the pDZ vector treated with XbaI. The fusion cloning was performed using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.), and the thus-obtained plasmid was named pDZ-NCgl2522_G77.

    [0099] Then, in order to induce a random mutagenesis on the amino acid residue at position 77 of NCgl2522, a plasmid library for the pDZ-NCgl2522_G77 variant was completed by performing PCR using a primer pair of SEQ ID NOS: 9 and 10 shown in Table 4, based on the plasmid pDZ-NCgl2522_G77 constructed above as a template. In particular, the PCR reaction was performed by repeating 25 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 5 minutes.

    TABLE-US-00004 Table4 Primer Sequence(5->3) SM_putE_G77-F TGGGGTTCCGTGNNKATTCTTGGCGCT (SEQIDNO:9) SM_putE_G77-R AGCGCCAAGAATMNNCACGGAACCCCA (SEQIDNO:10)

    [0100] The thus-constructed recombinant plasmid libraries were screened via high throughput screening (HTS). In particular, the platform strain used for screening was KCCM11240P, which is a Corynebacterium glutamicum-derived recombinant microorganism capable of producing putrescine.

    [0101] The constructed plasmid libraries were introduced into KCCM11240P via electroporation to obtain transformants, and the strains introduced with the plasmid pDZ-NCgl2522_G77 variant were selected in the same manner as in Example 2. Two transformants with the greatest increase in putrescine productivity compared to the control group were selected, and it was confirmed as to which modification was induced in the amino acid sequence of the NCgl2522 protein for each transformant, in the same manner as in Example 2.

    [0102] As a result, in addition to the NCgl2522 G77A (ATCC13032) variant (SEQ ID NO: 3), in which glycine, the amino acid residue at position 77 from the N-terminus of the amino acid sequence (SEQ ID NO: 1) of NCgl2522 of Corynebacterium glutamicum ATCC13032, was substituted with alanine, the variant in which the glycine was substituted with arginine was confirmed and was named NCgl2522_G77R (ATCC13032) (SEQ ID NO: 4).

    [0103] Additionally, in order to confirm whether the effect of increasing putrescine productivity due to the modification can be applied to NCgl2522 proteins derived from different strains, various variants, in which the amino acid residue at position 77 of the NCgl2522 protein derived from Corynebacterium glutamicum ATCC13869 was substituted with other amino acid residues, were constructed.

    [0104] Specifically, a homologous recombinant fragment was obtained using a specific primer pair of SEQ ID NOS: 7 and 8 excluding the initiation codon of ORF of NCgl2522 gene, based on the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 30 seconds.

    [0105] The PCR product obtained above was subjected to fusion cloning into the pDZ vector treated with XbaI. The fusion cloning was performed using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.), and the thus-obtained plasmid was named pDZ-13869-NCgl2522_G77.

    [0106] Then, in order to induce a random mutagenesis on the amino acid residue at position 77 of NCgl2522, a plasmid library for the pDZ-13869-NCgl2522_G77 variant was completed by performing PCR using a primer pair of SEQ ID NOS: 9 and 10 shown in Table 4, based on the plasmid pDZ-13869-NCgl2522_G77 constructed above as a template. In particular, the PCR reaction was performed by repeating 25 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 5 minutes.

    [0107] Subsequently, the thus-constructed recombinant plasmid libraries were screened via high throughput screening (HTS). In particular, the platform strain used for screening was DAB12-b, which is a Corynebacterium glutamicum-derived recombinant microorganism capable of producing putrescine. Then, the constructed plasmid libraries were introduced into DAB12-b via electroporation to obtain transformants, and the strains introduced with the plasmid pDZ-13869-NCgl2522_G77 variant were selected in the same manner as in Example 2.

    [0108] As a result, two variants, in which the amino acid residue at position 77 from the N-terminus of the NCgl2522 amino acid sequence (SEQ ID NO: 2) of Corynebacterium glutamicum ATCC13869 was substituted, were selected as the strains with the greatest putrescine production, as the NCgl2522 variants of Corynebacterium glutamicum ATCC13032. Among them, the variant in which glycine, the amino acid residue at position 77, was substituted with alanine was named NCgl2522_G77A (ATCC13869) (SEQ ID NO: 5), and the variant in which glycine, the amino acid residue at position 77, was substituted with arginine was named NCgl2522_G77R (ATCC13869) (SEQ ID NO: 6).

    Example 4

    Construction of NCgl2522 Variant Strains and Confirmation of Putrescine-Producing Ability Thereof

    [0109] <4-1> Construction of NCgl2522 Variant Strains from ATCC13032-based Putrescine-Producing Strain

    [0110] In order to increase the ability to export putrescine of the putrescine-producing strain, NCgl2522_G77A and NCgl2522_G77R, which are variants of the NCgl2522 gene, were respectively introduced into the chromosome of the Corynebacterium glutamicum ATCC13032-based putrescine-producing strain.

    [0111] Specifically, a homologous recombinant fragment having a modified sequence of NCgl2522_G77A was obtained by performing PCR using primer pairs of SEQ ID NOS: 11 and 14, and SEQ ID NOS: 12 and 13, based on the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, and a homologous recombinant fragment having a modified sequence of NCgl2522_G77R was obtained using primer pairs of SEQ ID NOS: 11 and 16, and SEQ ID NOS: 12 and 15, based on the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 30 seconds.

    TABLE-US-00005 TABLE5 Primer Sequence(5->3) pDC-Pself-putE-up-FX CCGGGGATCCTCTAGA (SEQIDNO:11) CCTCTAAGCGCCTCAAAG pDC-putE-up-RX GCAGGTCGACTCTAGA (SEQIDNO:12) GATTCGCGATATTGGCCG putE_G77A-F CCGGCACTTTGGCTGACAAAATCG (SEQIDNO:13) putE_G77A-R CGATTTTGTCAGCCAAAGTGCCGG (SEQIDNO:14) putE_G77R-F CCGGCACTTTGCGTGACAAAATCG (SEQIDNO:15) putE_G77R-R CGATTTTGTCACGCAAAGTGCCGG (SEQIDNO:16)

    [0112] Each of the PCR products obtained above was subjected to fusion cloning into the pDZ vector treated with XbaI. The fusion cloning was performed using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.), and the thus-obtained plasmids were named pDZ-NCgl2522_G77A and pDZ-NCgl2522_G77R, respectively.

    [0113] The plasmids pDZ-NCgl2522_G77A and pDZ-NCgl2522_G77R prepared above were respectively introduced into KCCM11240P (Korean Patent Application Publication No. 2013-0082478), which is a Corynebacterium glutamicum ATCC13032-based putrescine-producing strain, via electroporation to obtain transformants, and the thus-obtained transformants were plated on BHIS plate media (37 g/L of Braine heart infusion , 91 g/L of sorbitol, and 2% agar) containing kanamycin (25 g/mL) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) and cultured to form colonies. Among the thus-formed colonies, the strains introduced with the plasmids pDZpDZ-NCgl2522_G77A or pDZ-NCgl2522_G77R were selected.

    [0114] The selected strains were cultured with shaking (30 C., 8 hours) in CM media (10 g/L of glucose, 10 g/L of polypeptone, 5 g/L of yeast extract, 5 g/L of beef extract, 2.5 g/L of NaCl, and 2 g/L of urea at pH 6.8) and sequentially diluted from 10.sup.4 to 10.sup.10, plated on solid media containing X-gal, and cultured to form colonies. Among the thus-formed colonies, white colonies which appeared at a relatively low rate were selected, thereby finally selecting the strains, in which the NCgl2522 gene was substituted with the NCgl2522_G77A or NCgl2522_G77R variant by a secondary crossover. The finally selected strains were subjected to PCR using a primer pair of SEQ ID NOS: 11 and 12, and the thus-obtained products were applied to sequencing to confirm the substitution with the variants. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 1 minute.

    [0115] The thus-selected modified strains of Corynebacterium glutamicum were named KCCM11240P NCgl2522_G77A and KCCM11240P NCgl2522_G77R, respectively.

    <4-2> Construction of NCgl2522 Variant Strains from ATCC13869-based Putrescine-Producing Strain

    [0116] DAB12-a NCgl1469 (Korean Patent Application Publication No. 2013-0082478), which is a Corynebacterium glutamicum ATCC13869-based putrescine-producing strain, was named DAB12-b. To this end, in order to increase the ability to export putrescine of the putrescine-producing strain, NCgl2522_G77A and NCgl2522_G77R, which are variants of NCgl2522 gene, were respectively introduced into the chromosome of the DAB12-b strain.

    [0117] Specifically, a homologous recombinant fragment having a modified sequence of NCgl2522_G77A was obtained by performing PCR using primer pairs of SEQ ID NOS: 11 and 14, and SEQ ID NOS: 12 and 13 shown in Table 5, based on the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, and a homologous recombinant fragment having a modified sequence of NCgl2522_G77R was obtained by performing PCR using primer pairs of SEQ ID NOS: 11 and 16, and SEQ ID NOS: 12 and 15 shown in Table 5, based on the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 30 seconds.

    [0118] Each of the PCR products obtained above was subjected to fusion cloning into the pDZ vector treated with XbaI. The fusion cloning was performed using the In-Fusion HD Cloning Kit (Clontech Laboratories, Inc.), and the thus-obtained plasmids were named pDZ-NCgl2522_G77A-2 and pDZ-NCgl2522_G77R-2, respectively.

    [0119] The plasmids pDZ-NCgl2522_G77A-2 and pDZ-NCgl2522_G77R-2 prepared above were respectively introduced into DAB12-b via electroporation to obtain transformants, and the thus-obtained transformants were plated on BHIS plate media (37 g/L of Braine heart infusion, 91 g/L of sorbitol, and 2% agar) containing kanamycin (25 g/mL) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) and cultured to form colonies. Among the thus-formed colonies, the strains introduced with the plasmid pDZ-NCgl2522_G77A-2 or pDZ-NCgl2522_G77R-2 were selected.

    [0120] The selected strains were cultured with shaking (30 C., 8 hours) in CM media (10 g/L of glucose, 10 g/L of polypeptone, 5 g/L of yeast extract, 5 g/L of beef extract, 2.5 g/L of NaCl, and 2 g/L of urea at pH 6.8) and sequentially diluted from 10.sup.4 to 10.sup.10, plated on solid media containing X-gal, and cultured to form colonies. Among the thus-formed colonies, white colonies which appeared at a relatively low rate were selected, thereby finally selecting the strains, in which the NCgl2522 gene was substituted with the NCgl2522_G77A or NCgl2522_G77R variant by a secondary crossover. The finally selected strains were subjected to PCR using a primer pair of SEQ ID NOS: 11 and 12, and the thus-obtained products were applied to sequencing to confirm the substitution with the variants. In particular, the PCR reaction was performed by repeating 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and extension at 72 C. for 1 minute.

    [0121] The thus-selected modified strains of Corynebacterium glutamicum were named DAB12-b NCgl2522_G77A and DAB12-b NCgl2522_G77R, respectively.

    <4-3> Evaluation of Putrescine-Producing Ability of Strains Introduced with NCgl2522 Variants

    [0122] In order to confirm the effect of NCgl2522 variants on putrescine production when the variants of the NCgl2522 gene, which increases the ability to export putrescine, were introduced into the putrescine-producing strains, the putrescine-producing ability was compared among the modified strains of Corynebacterium glutamicum prepared in Examples 4-1 and 4-2.

    [0123] Specifically, the modified strains of Corynebacterium glutamicum (KCCM11240P NCgl2522_G77A and DAB12-b NCgl2522_G77R) and two kinds of parent strains (KCCM11240P and DAB12-b) were respectively plated on 1 mM arginine-containing CM plate media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 L of 50% NaOH, and 2% agar at pH 6.8, based on 1 L), and cultured at 30 C. for 24 hours. About one platinum loop of each strain cultured therefrom was inoculated into 25 mL of titer media (8% glucose, 0.25% soybean protein, 0.50% corn steep solids, 4% (NH.sub.4).sub.2SO.sub.4, 0.1% KH.sub.2PO.sub.4, 0.05% MgSO.sub.4.7H.sub.2O, 0.15% urea, 100 g of biotin, 3 mg of thiamine HCl, 3 mg of calcium-pantothenic acid, 3 mg of nicotinamide, and 5% CaCO.sub.3, based on 1 L), and cultured with shaking at 30 C. at a rate of 200 rpm for 50 hours. During culturing of all strains, 1 mM arginine was added to the media. After completion of the culture, the concentration of putrescine produced in each culture was measured, and the results are shown in Table 6 below.

    TABLE-US-00006 TABLE 6 Produc- Putrescine tivity Fold Name of Strains (g/L) (g/L/h) (%) KCCM11240P 5.8 0.116 100 KCCM11240P NCgl2522_G77A 6.8 0.136 117 KCCM11240P NCgl2522_G77R 6.3 0.126 109 DAB12-b 6.5 0.129 100 DAB12-b NCgl2522_G77A 7.3 0.146 113 DAB12-b NCgl2522_G77R 7.1 0.142 110

    [0124] As shown in Table 6 above, when the NCgl2522_G77A and NCgl2522_G77R variants were respectively introduced into KCCM11240P and DAB12-b, the modified strains of Corynebacterium glutamicum introduced with the variants showed an increase in the putrescine production and productivity by 7% to 13% as compared to the parent strains, respectively. In particular, the productivity represents the putrescine production per hour for each transformant, and was expressed in g/L/h.

    Example 5

    Introduction of NCgl2522 Variants into Putrescine-Producing Strains with Improved Ability to Export Putrescine and Confirmation of Putrescine-Producing Ability Thereof

    [0125] <5-1> Construction of Strains by Introducing NCgl2522 Variants into Strains with Improved Ability to Export Putrescine

    [0126] In order to confirm the effect of the variants of the NCgl2522 gene, NCgl2522_G77A and NCgl2522_G77R were respectively introduced into the chromosome of KCCM11240P P(CJ7)-NCgl2522 (Korean Patent Application Publication No. 2014-0115244), which is a Corynebacterium glutamicum ATCC13032-based putrescine-producing strain with an increased ability to export putrescine.

    [0127] Specifically, pDZ-NCgl2522_G77A and pDZ-NCgl2522_G77R prepared in Example 4-1 were respectively transformed into KCCM11240P P(CJ7)-NCgl2522 in the same manner as in Example 4-1, and thus it was confirmed that the NCgl2522 gene was substituted with the variants within the chromosome thereof. The selected modified strains of Corynebacterium glutamicum were named KCCM11240P P(CJ7)-NCgl2522 NCgl2522_G77A and KCCM11240P P(CJ7)-NCgl2522 NCgl2522_G77R, respectively.

    <5-2> Evaluation of Putrescine-Producing Ability of Strains Prepared by Introducing NCgl2522 Variants into Strain with Improved Ability to Export Putrescine

    [0128] In order to confirm the effect of the NCgl2522 variants on the Corynebacterium glutamicum producing strains with an improved ability to export putrescine, the putrescine-producing ability was compared among the modified strains of Corynebacterium glutamicum prepared in Example 5-1 and the parent strain.

    [0129] Specifically, the modified strains of Corynebacterium glutamicum (KCCM11240P P(CJ7)-NCgl2522 NCgl2522_G77A and KCCM11240P P(CJ7)-NCgl2522 NCgl2522_G77R) and the parent strain (KCCM11240P P(CJ7)-NCgl2522) were respectively plated on 1 mM arginine-containing CM plate media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 L of 50% NaOH, and 2% agar at pH 6.8, based on 1 L), and cultured at 30 C. for 24 hours. About one platinum loop of each strain cultured therefrom was inoculated into 25 mL of titer media (8% glucose, 0.25% soybean protein, 0.50% corn steep solids, 4% (NH.sub.4).sub.2SO.sub.4, 0.1% KH.sub.2PO.sub.4, 0.05% MgSO.sub.4.7H.sub.2O, 0.15% urea, 100 g of biotin, 3 mg of thiamine HCl, 3 mg of calcium-pantothenic acid, 3 mg of nicotinamide, and 5% CaCO.sub.3, based on 1 L), and cultured with shaking at 30 C. at a rate of 200 rpm for 50 hours. During culturing of all strains, 1 mM arginine was added to the media. After completion of the culture, the concentration of putrescine produced in each culture was measured, and the results are shown in Table 7 below

    TABLE-US-00007 TABLE 7 Produc- Putrescine tivity Fold Name of Strains (g/L) (g/L/h) (%) KCCM11240P P(CJ7)-NCgl2522 6.9 0.138 100 KCCM11240P P(CJ7)-NCgl2522 7.6 0.152 110 NCgl2522_G77A KCCM11240P P(CJ7)-NCgl2522 7.5 0.150 109 NCgl2522_G77R

    [0130] As shown in Table 7 above, when the NCgl2522_G77A and NCgl2522_G77R variants were respectively introduced into KCCM11240P P(CJ7)-NCgl2522 with an improved ability to export putrescine, the modified strains of Corynebacterium glutamicum showed an increase in the putrescine production and productivity by 9% to 10% as compared to the parent strain, which already showed an improved ability to export putrescine. In particular, the productivity represents the putrescine production per hour for each transformant, and was expressed in g/L/h.

    Example 6

    Introduction of NCgl2522 Variants into Arginine-Producing Strains and Confirmation of Arginine-Producing Ability Thereof

    [0131] <6-1> Construction of Strains by Introducing NCgl2522 Variants into Arginine-Producing Strains

    [0132] In order to increase the ability to export L-arginine of the L-arginine-producing strains, NCgl2522_G77A and NCgl2522_G77R, which are variants of the NCgl2522 gene, were respectively introduced into the chromosomes of Corynebacterium glutamicum ATCC21831 and KCCM10741P (Korean Patent No. 10-0791659).

    [0133] Specifically, the strains, in which the NCgl2522 gene was substituted with NCgl2522_G77A and NCgl2522_G77R variants, were finally selected in the same manner as in Example 4-2. The modified strains of Corynebacterium glutamicum selected therefrom were named KCCM10741P NCgl2522_G77A, KCCM10741P NCgl2522_G77R, ATCC21831_Pcj7 Ncgl2522_G77A, and ATCC21831_Pcj7 Ncgl2522_G77R, respectively.

    <6-2> Evaluation of L-arginine-Producing Ability of Strains Introduced with NCgl2522 Variants

    [0134] In order to confirm the effect of the NCgl2522 variants on L-arginine production when the variants of the NCgl2522 gene, which increases the ability to export L-arginine, were introduced into the L-arginine-producing strains, the L-arginine-producing ability was compared among the modified strains of Corynebacterium glutamicum prepared in Example 6-1.

    [0135] In particular, as the control groups, the Corynebacterium glutamicum KCCM10741P and ATCC21831, which are the parent strains, and KCCM10741P_Pcj7 Ncgl2522 and ATCC21831_Pcj7 Ncgl2522, which were prepared in Example 1, were used. One platinum loop of each strain was inoculated into a 250 mL corner-baffled flask containing 25 mL of production media [6% glucose, 3% ammonium sulfate, 0.1% monopotassium phosphate, 0.2% magnesium sulfate heptahydrate, 1.5% corn steep liquor (CSL), 1% NaCl, 0.5% yeast extract, and 100 g/L of biotin at pH7.2] and cultured with shaking at 30 C. at a rate of 200 rpm for 48 hours to produce L-arginine. After completion of the culture, the L-arginine production was measured by HPLC. The results are shown in Table 8 below.

    TABLE-US-00008 TABLE 8 Arginine Ornithine Concen- Concen- tration tration Arginine Strains OD (g/L) (g/L) Fold (%) KCCM10741P 91 3.0 0.3 100 KCCM10741P_Pcj7 72 3.6 0.4 120 Ncgl2522 KCCM10741P_Pcj7 69 4.1 0.5 136.7 Ncgl2522_G77A KCCM10741P_Pcj7 70 4.2 0.5 140 Ncgl2522_G77R ATCC21831 102 4.2 0.3 100 ATCC21831_Pcj7 86 4.8 0.4 114 Ncgl2522 ATCC21831_Pcj7 86 5.4 0.5 128.6 Ncgl2522_G77A ATCC21831_Pcj7 88 5.3 0.6 126.2 Ncgl2522_G77R

    [0136] As shown in Table 8, when the pNCgl2522_G77A and NCgl2522_G77R variants were respectively introduced into KCCM10741P and ATCC21831, all of the modified strains of Corynebacterium glutamicum introduced with the variants showed an increase in the L-arginine production by 26% and 40% as compared to the parent strains.

    [0137] Additionally, it was confirmed that the concentration of L-ornithine, which was exported after conversion into L-arginine, also increased when the variants were introduced. Based on these findings, it can be interpreted that the modified strains of Corynebacterium glutamicum may also export products biosynthesized from ornithine as a starting material.

    [0138] In conclusion, the present inventors have confirmed that the amino acid residue at position 77 from the N-terminus plays a key role in the ability to export ornithine-based products in NCgl2522, a putrescine-exporting protein. In particular, when the amino acid at position 77 was substituted with other amino acid residues, it was found that the production of the ornithine-based products was increased in the strains introduced with the variants. Accordingly, the variants of the present disclosure can be applied to a method for producing ornithine-based products using microorganisms to further improve the production thereof, and thus can be very useful for the production of ornithine-based products using biomass.

    [0139] In the present disclosure, NCgl2522_G77A, a variant of NCgl2522 gene, was introduced into the chromosome of the Corynebacterium glutamicum ATCC13032-based putrescine-producing strain, and as a result, it was confirmed that putrescine could be produced with high yield and high productivity in the Corynebacterium glutamicum strain introduced with the variant. Accordingly, the strain was named KCCM11240P NCgl2522_G77A and deposited at the Korean Culture Center of Microorganisms (KCCM), an International Depositary Authority, under Budapest Treaty on Sep. 1, 2016 with Accession No. KCCM11886P.

    [0140] One of ordinary skill in the art will recognize that the present disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the present disclosure is therefore indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within the scope of the present disclosure.