CD19CART CELLS ELIMINATE MYELOMA CELLS THAT EXPRESS VERY LOW LEVELS OF CD19
20200209240 · 2020-07-02
Inventors
- Hermann EINSELE (Würzburg, DE)
- Michael HUDECEK (Höchberg, DE)
- Sebastian LETSCHERT (München, DE)
- Thomas NERRETER (Würzburg, DE)
- Markus Sauer (Heidelberg, DE)
Cpc classification
C12Q2565/601
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C07K14/70596
CHEMISTRY; METALLURGY
International classification
Abstract
The invention generally relates to immunotherapy with chimeric antigen receptor (CAR}- engineered T-cells. In particular, the invention relates immunotherapy with chimeric antigen receptor (CAR)-engineered T-cells to target sub-populations of cancer cells that are characterized by low expression of a cancer cell surface antigen, more particular the invention relates to immunotherapy with chimeric antigen receptor (CAR)-engineered T-cells targeting CD19 (CD19CART) in multiple myeloma, a clonal proliferation of plasma cells.
Claims
1. A method, comprising steps of: (A) Analyzing a cancer cell-containing sample from a cancer patient to obtain information about a cell surface antigen of the cancer cell; and (B) Classifying said cancer cell-containing sample based on the information obtained in step (A).
2. The method of claim 1, wherein said cancer is a hematologic or solid tumor.
3. The method of claim 1 or 2, wherein said cancer is leukemia, lymphoma, or myeloma, preferably wherein said cancer is multiple myeloma.
4. The method of any one of claims 1 to 3, wherein step (A) comprises analyzing the cancer cell-containing sample using super-resolution microscopy.
5. The method of any one of claims 1 to 4, wherein step (A) comprises determining the number of molecules of said cell surface antigen on said cancer cell.
6. The method of claim 4 or 5, wherein said super-resolution microscopy is single-molecule localization microscopy.
7. The method of claims 4 to 6, wherein said super-resolution microscopy is dSTORM, STORM, PALM, or FPALM.
8. The method of claim 7, wherein said super-resolution microscopy is dSTORM.
9. The method of any one of claims 1 to 8, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express a cell surface antigen.
10. The method of any one of claims 6 to 9, wherein the cell surface antigen is the antigen according to claim 5.
11. The method of any one of claims 5 to 10, wherein the cell surface antigen is a cancer antigen.
12. The method of any one of claims 5 to 11, wherein said cell surface antigen is not detectable by flow cytometry.
13. The method of any one of claims 5 to 12, wherein said cell surface antigen is detectable by super-resolution microscopy.
14. The method of any one of claims 5 to 13, wherein said cell surface antigen is detectable by single-molecule localization microscopy.
15. The method of any one of claims 5 to 14, wherein said cell surface antigen is detectable by dSTORM, STORM, PALM, or FPALM.
16. The method of claim 15, wherein said cell surface antigen is detectable by dSTORM.
17. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 4 cell surface antigen molecules per cell.
18. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 8 cell surface antigen molecules per cell.
19. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 16 cell surface antigen molecules per cell.
20. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 32 cell surface antigen molecules per cell.
21. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 64 cell surface antigen molecules per cell.
22. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 100 cell surface antigen molecules per cell.
23. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 200 cell surface antigen molecules per cell.
24. The method of any one of claims 5 to 16, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of more than 300 cell surface antigen molecules per cell.
25. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 10,000 cell surface antigen molecules per cell.
26. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 5,000 cell surface antigen molecules per cell.
27. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 2,500 cell surface antigen molecules per cell.
28. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 1,500 cell surface antigen molecules per cell.
29. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 1,350 cell surface antigen molecules per cell.
30. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 1,300 cell surface antigen molecules per cell.
31. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 1,000 cell surface antigen molecules per cell.
32. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 800 cell surface antigen molecules per cell.
33. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 500 cell surface antigen molecules per cell.
34. The method of any one of claims 5 to 24, wherein in step (A) of the method, said cancer cell-containing sample is analyzed as to whether it comprises a fraction of cancer cells which express said cell surface antigen at a number of no more than 400 cell surface antigen molecules per cell.
35. The method of any one of claims 5 to 34, wherein said number of molecules of said cell surface antigen per cell is determined by microscopy.
36. The method of any one of claims 5 to 35, wherein said number of molecules of said cell surface antigen per cell is determined by super-resolution microscopy.
37. The method of any one of claims 5 to 36, wherein said number of molecules of said cell surface antigen per cell is determined by single-molecule localization microscopy.
38. The method of any one of claims 35 to 37, wherein said microscopy is dSTORM, STORM, PALM, or FPALM.
39. The method of any one of claims 35 to 38, wherein said microscopy is dSTORM.
40. The method of any one of claims 1 to 39, wherein said cell surface antigen is selected from the group consisting of CD19, CD20, CD22, CD27, CD30, CD33, CD38, CD44v6, CD52, CD64, CD70, CD72, CD123, CD135, CD138, CD220, CD269, CD319, ROR1, ROR2, SLAMF7, BCMA, v3-Integrin, 41-Integrin, EpCAM-1, MUC-1, MUC-16, L1-CAM, c-kit, NKG2D, NKG2D-Ligand, PD-L1, PD-L2, Lewis-Y, CAIX, CEA, c-MET, EGFR, EGFRvIII, ErbB2, Her2, FAP, FR-a, EphA2, GD2, GD3, GPC3, IL-13Ra, Mesothelin, PSMA, PSCA, and VEGFR, preferably CD19 and/or CD20.
41. The method of any one of claims 5 to 40, wherein said cell surface antigen is CD19.
42. The method of any one of claims 5 to 41, wherein said cell surface antigen is CD20.
43. The method of any one of claims 4 to 42, wherein step (A) comprises sub-steps of: (A-I) Labeling said cell surface antigen on said cancer cells; (A-II) Detecting said labelled cell surface antigen on said cancer cells by super-resolution microscopy; and (A-III) Counting the number of labelled cell surface antigen molecules per cancer cell.
44. The method of any one of claims 5 to 43, wherein said cell surface antigen is labelled in step (A) and step (A-I), respectively, by immunostaining.
45. The method of any one of claims 1 to 44, wherein step (B) further comprises steps of: (B-I) Classifying said cancer cell containing sample as positive for said cell surface antigen if the number of cell surface antigen molecules per cell obtained in step (A-III) is above a minimum threshold; and/or (B-II) Classifying said cancer cell containing sample as negative for said cell surface antigen if the number of cell surface antigen molecules per cell obtained in step (A-III) is below a minimum threshold.
46. The method of claim 45, wherein said minimum threshold is in the range of 4 to 300.
47. The method of claim 45 or 46, wherein said minimum threshold is 4.
48. The method of claim 45 or 46, wherein said minimum threshold is 8.
49. The method of claim 45 or 46, wherein said minimum threshold is 16.
50. The method of claim 45 or 46, wherein said minimum threshold is 32.
51. The method of claim 45 or 46, wherein said minimum threshold is 64.
52. The method of claim 45 or 46, wherein said minimum threshold is 100.
53. The method of claim 45 or 46, wherein said minimum threshold is 200.
54. The method of claim 45 or 46, wherein said minimum threshold is 300.
55. The method of any one of claims 1 to 54, wherein based on the classification of said cancer cell-containing sample in step (B), a prediction on the eligibility of said patient for cancer therapy is made.
56. The method of claim 55, wherein said patient is predicted to be eligible for cancer therapy if said classification of said cancer cell containing sample in step (B) for said cell surface antigen is positive.
57. The method of any one of claims 1 to 56, wherein the method is a method for selecting a target antigen for cancer therapy.
58. The method of any one of claims 1 to 57, wherein the method is a method for selecting a patient for cancer therapy.
59. The method of claim 58, wherein said cancer therapy is cancer immunotherapy against said cell surface antigen.
60. The method of claim 59, wherein said cancer immunotherapy is a targeted cancer immunotherapy against said cell surface antigen.
61. The method of claim 60, wherein said targeted cancer immunotherapy is a cell-based targeted cancer immunotherapy against said cell surface antigen.
62. The method of claim 61, wherein said cell-based targeted cancer immunotherapy is an immunotherapy against said cell surface antigen with chimeric antigen receptor (CAR)-engineered T-cells.
63. The method of any one of claims 59 to 62, wherein said immunotherapy is an immunotherapy targeting a cell surface antigen selected from the group consisting of CD19, CD20, CD22, CD27, CD30, CD33, CD38, CD44v6, CD52, CD64, CD70, CD72, CD123, CD135, CD138, CD220, CD269, CD319, ROR1, ROR2, SLAMF7, BCMA, v3-Integrin, 41-Integrin, EpCAM-1, MUC-1, MUC-16, L1-CAM, c-kit, NKG2D, NKG2D-Ligand, PD-L1, PD-L2, Lewis-Y, CAIX, CEA, c-MET, EGFR, EGFRvIII, ErbB2, Her2, FAP, FR-a, EphA2, GD2, GD3, GPC3, IL-13Ra, Mesothelin, PSMA, PSCA, VEGFR, preferably wherein said immunotherapy is an immunotherapy targeting CD19 and/or CD20.
64. The method of claim 63, wherein said immunotherapy is an immunotherapy targeting CD19 and/or CD20.
65. The method of claim 63, wherein said immunotherapy is an immunotherapy targeting CD19.
66. The method of claim 63, wherein said immunotherapy is an immunotherapy targeting CD20.
67. The method of any one of claims 1 to 66, wherein all the steps are of the method are carried out in vitro.
68. The method of any one of claims 1 to 67, wherein the method does not comprise treatment of the human or animal body by surgery or therapy.
69. The method of any one of claims 1 to 68, wherein the method is not a diagnostic method practiced on the human or animal body.
70. The method of any one of claims 1 to 69, wherein said cancer cell-containing sample is a bone marrow aspirate.
71. The method of any one of claims 1 to 70, wherein said cancer cell-containing sample comprises primary myeloma cells and the patient is a myeloma patient.
72. The method of any one of claims 1 to 71, wherein said cancer cell-containing sample comprises primary myeloma cells expressing CD138 and the patient is a myeloma patient.
73. The method of any one of claims 1 to 72, wherein said cancer cell containing sample is obtainable by positive selection of primary myeloblasts from bone marrow aspirate for CD138.
74. The method of claim 73, wherein said selection is selection using magnetic beads.
75. An immune cell capable of targeting a cell surface antigen of a cell of a cancer, for use in a method for the treatment of said cancer in a patient, wherein in the method, the immune cell is to be administered to the patient.
76. The immune cell of claim 75 for use of claim 75, wherein said cancer is myeloma.
77. The immune cell of claim 75 or 76 for use of claim 75 or 76, wherein said cancer contains a fraction of cells positive for said cell surface antigen as determined according to any one of claims 5 to 74.
78. The immune cell of any one of claims 75 to 77 for the use of any one of claims 75 to 77, wherein the method comprises cancer immunotherapy.
79. The immune cell of claim 78 for the use of claim 78, wherein said cancer immunotherapy is a targeted cancer immunotherapy.
80. The immune cell of claim 79 for the use of claim 79, wherein said targeted cancer immunotherapy is a cell-based targeted cancer immunotherapy.
81. The immune cell of claim 79 or 80 for the use of claim 79 or 80, wherein said targeted cancer immunotherapy is a targeted cancer immunotherapy targeting a cell surface antigen as defined in any one of claims 63 to 66.
82. The immune cell of claim 81 for the use of claim 81, wherein the immune cell is capable of binding to said cell surface antigen.
83. The immune cell of any one of claims 75 to 82 for the use of claims 75 to 82, wherein the immune cell is capable of binding to CD19 and/or CD20.
84. The immune cell of any one of claims 75 to 83 for the use of claims 75 to 83, wherein the immune cell is capable of binding to CD20.
85. The immune cell of claim 84 for the use of claim 84, wherein the immune cell is capable of binding to the extracellular domain of CD20.
86. The immune cell of any one of claims 75 to 85 for the use of claims 75 to 85, wherein the immune cell is capable of binding to CD19.
87. The immune cell of claim 86 for the use of claim 86, wherein the immune cell is capable of binding to the extracellular domain of CD19.
88. The immune cell of any one of claims 75 to 87 for use of claims 75 to 87, wherein the cell is a cell expressing a chimeric antigen receptor.
89. The immune cell of claim 88 for use of claim 88, wherein the chimeric antigen receptor is capable of binding to said cell surface antigen.
90. The immune cell of claim 88 or 89 for use of claim 88 or 89, wherein the chimeric antigen receptor is capable of binding to CD19 and/or CD20.
91. The immune cell of any one of claims 88 to 90 for use of claims 88 to 90, wherein the chimeric antigen receptor is capable of binding to CD20.
92. The immune cell of any one of claims 88 to 91 for use of claims 88 to 91, wherein the chimeric antigen receptor is capable of binding to CD19.
93. The immune cell of any one of claims 75 to 92 for use of any one of claims 75 to 92, wherein the cell is a cell selected from the group of T cells, NK cells, and B cells.
94. The immune cell of any one of claims 75 to 93 for use of any one of claims 75 to 93, wherein the cell is a T cell.
95. The immune cell of any one of claims 75 to 94 for the use of any one of claims 75 to 94, wherein said cell-based targeted cancer immunotherapy is an immunotherapy with chimeric antigen receptor (CAR)-engineered T-cells.
96. The immune cell of any one of claims 75 to 95 for the use of any one of claims 75 to 95, wherein said patient is a patient eligible for said treatment as predictable by the method of any one of claims 55 to 74.
97. The immune cell of any one of claims 75 to 96 for the use of any one of claims 75 to 96, wherein the cancer is negative for expression of said cell surface antigen as determined by flow cytometry.
98. The immune cell of claim 97 for the use of claim 97, wherein the cancer is positive for expression of said cell surface antigen as determined by super-resolution microscopy.
99. The immune cell of claim 98 for the use of claim 98, wherein the cancer is positive for expression of said cell surface antigen as determined by single-molecule localization microscopy.
100. The immune cell of claim 98 or 99 for the use of claim 98 or 99, wherein the cancer is positive for expression of said cell surface antigen as determined by dSTORM, STORM, PALM, or FPALM.
101. The immune cell of claim 100 for the use of claim 100, wherein the cancer is positive for expression of said cell surface antigen as determined by dSTORM.
102. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 4 cell surface antigen molecules per cell.
103. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 8 cell surface antigen molecules per cell.
104. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 16 cell surface antigen molecules per cell.
105. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 32 cell surface antigen molecules per cell.
106. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 64 cell surface antigen molecules per cell.
107. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 100 cell surface antigen molecules per cell.
108. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 200 cell surface antigen molecules per cell.
109. The immune cell of any one of claims 75 to 101 for the use of any one of claims 75 to 101, wherein a fraction of the cancer cells expresses said cell surface antigen at a number of at least 300 cell surface antigen molecules per cell.
110. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 10,000 cell surface antigen molecules per cell.
111. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 5,000 cell surface antigen molecules per cell.
112. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 2,500 cell surface antigen molecules per cell.
113. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 1,500 cell surface antigen molecules per cell.
114. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 1,350 cell surface antigen molecules per cell.
115. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 1,300 cell surface antigen molecules per cell.
116. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 1,000 cell surface antigen molecules per cell.
117. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 800 cell surface antigen molecules per cell.
118. The immune cell of any one of claims 75 to 109 for the use of any one of claims 75 to 109, wherein the cancer cells do not express said cell surface antigen at a number of more than 500 cell surface antigen molecules per cell.
119. The immune cell of any one of claims 75 to 118 for the use of any one of claims 75 to 118, wherein the treatment is a treatment in combination with myeloablative chemotherapy.
120. The immune cell of claim 119 for the use of claim 119, wherein the myeloablative chemotherapy comprises treatment with melphalan.
121. The immune cell of claim 120 for the use of claim 120, wherein melphalan at a dose between 100 mg per square meter and 200 mg per square meter, preferably wherein melphalan is to be administered at a dose of 140 mg per square meter.
122. The immune cell of any one of claims 75 to 121 for the use of any one of claims 75 to 121, wherein the treatment is a treatment in combination with autologous hematopoietic stem cell transplantation and/or wherein the treatment is a treatment in combination with allogeneic hematopoietic stem cell transplantation.
123. The immune cell of any one of claims 88 to 122 for the use of claims 88 to 122, wherein the chimeric antigen receptor is a chimeric antigen receptor having the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1 and/or SEQ ID NO: 3.
124. The immune cell of any one of claims 88 to 122 for the use of claims 88 to 122, wherein the chimeric antigen receptor is a chimeric antigen receptor having the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1.
125. The immune cell of any one of claims 88 to 122 for the use of claims 88 to 122, wherein the chimeric antigen receptor is a chimeric antigen receptor having the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 3.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0139]
[0140] Data for all patients are shown in Table 1 and
[0141]
[0142] CD19 was detected on primary myeloma cells using conventional wide-field fluorescence (A) and dSTORM (B). Images depict CD19 molecules in the bottom plasma membrane (attached to glass surface) of a CD19.sup.+ (top row) and a CD19.sup. myeloma cell (bottom row). Small panels (C) display magnification of boxed regions revealing the markedly enhanced sensitivity of dSTORM. Fluorescence images of CD38 (D), CD138 (E) and the corresponding transmitted light image (F) for identification of the cells. Scale bars, 10 m and 1 m (C).
[0143]
[0144] CD138-purified bone marrow aspirates from multiple myeloma patients were stained with antibodies against CD138 and CD38 to detect myeloma cells and a CD19-specific antibody or corresponding isotype control as indicated. The same patients as shown in
[0145]
[0146]
[0147]
[0148] The CD38.sup.+/CD138.sup.+/CD19.sup.+ ALL cell line NALM-6 was stained with antibodies against CD138, CD38 and CD19 or the corresponding isotype control. (A) Flow cytornetric detection of CD19 on NALM-6 cells with decreasing dilutions of CD19-specific antibody (lower row) or corresponding isotype control (upper row). (B) Detection of CD19 antibody (black squares) and isotype control (red circles) by dSTORM. At a CD19 antibody concentration of 2.5 g/ml (1:20 dilution), the CD19 density saturated at 3.40.2 CD19 antibodies/m.sup.2 (filled arrow). The lowest detectable density was 0.0060.002 CD19 antibodies/m.sup.2, which was at 510.sup.5 g/ml (1:10.sup.6 dilution, open arrow). At an isotype antibody concentration of 510.sup.5 g/ml, it was not possible to detect any molecules (0 molecules/m.sup.2), which is represented as a red open circle in the graph. The corresponding dSTORM images are depicted in (C), 2.5 g/ml, and (D), 510.sup.4 g/ml CD19 antibody. Scale bars, 2 m.
[0149]
[0150]
[0151] CD138-purified bone marrow aspirates from multiple myeloma patients were stained with antibodies against CD138 and CD38 to detect myeloma cells and a CD19-specific antibody or corresponding isotype control as indicated. Shown are distributions of all CD19-positive patients and one representative negative patient (D). Left panels: Logarithmic number of isotype and CD19 antibodies per m.sup.2 of untreated MM cells. Right panels: Logarithmic CD19 densities of control T-cell- and CAR T-cell-treated MM cells. Density distributions were subsequently divided into a CD19-positive subpopulation (CD19-positive cells) and a CD19-negative subpopulation (CD19-negative cells). The latter group was defined by the density distribution pattern of the isotype control antibody (non-specific binding of the control antibody to the plasma membrane and glass surface). Distributions were fitted with a one or two log-normal function that was dependent on the fit accuracy calculated with an Anderson-Darling test (rejected at a p-value<0.05. Effect of control T-cells was not evaluated for patient M008 (A). M014 (D) is an example of a completely CD19.sup. patient. PDF: probability density function. Data are also summarized in Table 1.
[0152]
[0153]
[0154]
[0155] The used anti-CD19 antibody was tested for binding specificity by conventional wide-field microscopy (upper rows: normalized fluorescence, bottom rows: transmitted light). NALM-6 (A, B), MM.1S (C, D), K562 (E, F) and CD19 expressing K562_CD19 cells (G, H) were stained with Anti-CD19-AF647 antibody (column label: CD19) and its corresponding isotype-AF647 antibody (column label: Isotype). Scale bars, 7 m.
[0156]
[0157] Flow cytometric analysis of CD20-expression on primary myeloma cells purified from bone marrow aspirates. Gating strategy for dot plots shown: FSC/SSC plasma cell gate.fwdarw.7-AAD.sup..fwdarw.CD138.sup.+/CD38.sup.+.fwdarw.lsotype control or CD20.sup.+.
[0158]
[0159] (A) CD20 was detected on primary myeloma cells using conventional wide-field fluorescence and dSTORM. Images depict the bottom plasma membrane (attached to glass surface) of a CD20.sup.+ (upper row) or CD20.sup. myeloma cell (lower row). Shown are the transmitted light image, fluorescence images of CD38, CD138 for identification of the cells and CD20 molecules as detected by conventional fluorescence microsopy and dSTORM. Small panels display magnification of boxed regions revealing the markedly enhanced sensitivity of dSTORM. Scale bars, 1 m and 0.2 m.
[0160] (B) Quantification of CD20 using dSTORM.
[0161] CD138-purified bone marrow aspirates from 4 multiple myeloma patients were stained with antibodies against CD138 and CD38 to detect myeloma cells and a CD20-specific antibody or corresponding isotype control as indicated. Left panels: Logarithmic number of isotype and CD20 antibodies per m.sup.2 of untreated MM cells. Right panels: Logarithmic CD20 densities of control T-cell- and CAR T-cell-treated MM cells. Density distributions were subsequently divided into a CD20-positive subpopulation (CD20-positive cells) and a CD20-negative subpopulation (CD20-negative cells). The latter group was defined by the density distribution pattern of the isotype control antibody (non-specific binding of the control antibody to the plasma membrane and glass surface). Distributions were fitted with a one or two log-normal function that was dependent on the fit accuracy calculated with an Anderson-Darling test (rejected at a p-value<0.05). Panels depict merged data from 4 multiple myeloma patients. Fit of the isotype control is shown in all graphs for better comparisation (dotted line). Data for single patients are also summarized in Table 2 and depicted in
[0162] (C) Representative 44 m sections of reconstructed dSTORM images showing single CD20 molecules in the surface-attached plasma membrane of immobilized MM cells from 4 MM paptients. Scale bars, 1 m.
[0163]
[0164] (A-D) CD138-purified bone marrow aspirates from 4 multiple myeloma patients were stained with antibodies against CD138 and CD38 to detect myeloma cells and a CD20-specific antibody or corresponding isotype control as indicated. Left panels: Logarithmic number of isotype and CD20 antibodies per m.sup.2 of untreated MM cells. Right panels: Logarithmic CD20 densities of control T-cell- and CAR T-cell-treated MM cells. Density distributions were subsequently divided into a CD20-positive subpopulation (CD20-positive cells) and a CD20-negative subpopulation (CD20-negative cells). The latter group was defined by the density distribution pattern of the isotype control antibody (non-specific binding of the control antibody to the plasma membrane and glass surface). Distributions were fitted with a one or two log-normal function that was dependent on the fit accuracy calculated with an Anderson-Darling test (rejected at a p-value<0.05). Effect of T-cells was not evaluated for patient M026 (B). Data are also summarized in Table 2.
DETAILED DESCRIPTION OF THE INVENTION
[0165] CD19 is pursued as a target for CAR T-cell immunotherapy in MM. A recent study by Garfall et al reported complete remission in a myeloma patient who received CD19CART after myeloablative chemotherapy and autologous HSCT, even though only 0.05% of myeloma cells were CD19-positive as assessed by FC.sup.2, but Garfall et al did not demonstrate any mechanism for this observation. The present inventors set out to test if CD19 is expressed on a higher proportion of myeloma cells than had been identified by FC in the study by Garfall et al, including whether there are myeloma cells that express CD19 at very low levels, which may, however, be sufficient for recognition by CD19CART.sup.2,13,14. An obstacle to testing this hypothesis was the relatively high detection limit of FC, the prevailing detection method in clinical routine, with a detection limit in the order of few a thousands of molecules per Cell.sup.7,15,16. In addition, the precise antigen threshold on tumor cells required to trigger and subsequently activate CART-cells has thus far been unknown. Several studies have attempted to extrapolate the lower detection limit of CARs with model cell lines, providing estimates in the range of hundreds of target molecules per Cell.sup.17,18. However, these estimates have not been rigorously verified owing again to the lacking ability of FC to detect such low antigen levels on target cells.
[0166] Here, the inventors applied single-molecule sensitive super-resolution microscopy by dSTORM and show that in 10 out of 14 myeloma patients, CD19 is expressed on a large fraction of myeloma cells comprising up to 80% of the entire myeloma cell population. However, on the majority of myeloma cells, the expression level of CD19 is below the detection limit of FC and could only be visualized by dSTORM. The inventors also show that very low level expression of CD19 is sufficient for recognition and elimination by CD19CART and establish that the sensitivity threshold of CD19CART is far below 100 CD19 molecules per myeloma cell.
[0167] The inventors' data show that FC dramatically underestimates the percentage of myeloma cells that express CD19 and falsely classifies myeloma cells in 8 out of 10 patients as CD19-negative, even though CD19 is expressed on a fraction of myeloma cells at low levels as revealed by dSTORM imaging. The inventors' data suggest that myeloma cells that express less than 1,350 CD19 molecules are not detected by FC, which is consistent with previous reports on the sensitivity of this method in clinical routine.sup.15-18. The inventors show that in each of the 10 myeloma patients, where a proportion of CD19-expressing myeloma cells was detected (either at high or low density), these myeloma cells were readily eliminated after a short treatment with CD19CART in vitro. These data suggest that CD19CART might be effective against CD19-expressing myeloma cells in vivo. The CD19-CAR employed in the inventors' study has been validated in clinical trials in ALL and NHL.sup.3,4. However, the inventors' data also show that in each of the 10 patients, there was a fraction of CD19-negative myeloma cells that were not eliminated by CDI9CART. These data suggest that complete responses of MM after CD19CART therapy may only be accomplished in conjunction with another effective antimyeloma treatment, e.g. melphalan (140 mg per square meter) as in the Garfall et al study. Indeed, recent studies with CD19CART in ALL and with B-cell maturation antigen (BCMA)-CART-cells in myeloma have shown that the presence of antigen-negative leukemia or myeloma cells leads to outgrowth of these cells and rapid relapse.sup.19,20.
[0168] CARs are synthetic receptors and even though CD19CART have accomplished clinical approval in ALL and NHL, their mechanism of action is still a black box at the molecular level. A particular interest has been to determine the antigen sensitivity of CART-cells, both for predicting efficacy and for assessing safety. Here, the inventors provide for the first time direct evidence that CD19CART are able to recognize and eliminate myeloma cells that express less than 100 CD19 molecules on their surface. These data establish the sensitivity threshold for CART-cells and surpass predictions that have been made in previous studies with model tumor cell lines.sup.17,18, but were limited by the inability of FC to enumerate antigens with single-molecule resolution. The inventors' data support the prior notion that CART-cells are more sensitive than conventional antibodies and bi-specific antibodies in detecting surface molecules on tumor cells.sup.17. Moreover, the inventors show that their findings of previously undetectable expression that is sufficient to trigger CART function are not limited to CD19 but also apply for additional antigens including CD20. Further, this study illustrates the challenge that CART-cells are more sensitive in detecting antigens on tumor cells than established analytical tools in clinical practice. Consequently, more sensitive detection methods than FC (and immunohistochemistry) need to be implemented into clinical routine in order to guide patient and antigen selection for CART-cells, and to detect low-level expression in healthy tissues to prevent toxicity. Efforts to implement dSTORM-analysis into clinical pathology are ongoing at the inventors' institution, but require further methodological simplification to become broadly applicable.
[0169] In summary, the inventors' data encourage the continued evaluation of CD19 as a target for CART-cells in MM. The inventors show that single-molecule sensitive fluorescence imaging methods such as dSTORM can aid in stratifying myeloma patients according to CD19 expression to identify patients who have the highest chance to benefit from this novel, highly innovative treatment. These insights are relevant not only for CD19CART in MM, but also for CART approaches targeting alternative antigens in other hematologic and solid tumor malignancies to exploit their full therapeutic potential and to ensure patient safety.
Definitions and Embodiments
[0170] Unless otherwise defined below, the terms used in the present invention shall be understood in accordance with the common meaning known to the person skilled in the art.
[0171] Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety to the extent that it is not inconsistent with the present invention. References are indicated by their reference numbers and their corresponding reference details which are provided in the references section.
[0172] A targeting agent as described herein is an agent that, contrary to common medical agents, is capable of binding specifically to its target. A preferred targeting agent in accordance with the invention is capable of binding to CD19 on the cell surface, typically to the extracellular domain of CD19. Another preferred targeting agent in accordance with the invention is capable of binding to CD20 on the cell surface, typically to the extracellular domain of CD20.
[0173] In one embodiment of the invention, the targeting agent is capable of binding specifically to cancer cells expressing CD19 and/or CD20. In one embodiment of the invention, the targeting agent is capable of binding specifically to cancer cells expressing CD19. In one embodiment of the invention, the targeting agent is capable of binding specifically to cancer cells expressing CD20. In another embodiment of the invention, the targeting agent is capable of binding specifically to hematopoietic cells expressing CD19 and/or CD20. In another embodiment of the invention, the targeting agent is capable of binding specifically to hematopoietic cells expressing CD19. In another embodiment of the invention, the targeting agent is capable of binding specifically to hematopoietic cells expressing CD20. In another embodiment of the invention, the targeting agent is capable of binding specifically to hematopoietic cancer cells expressing CD19 and/or CD20. In another embodiment of the invention, the targeting agent is capable of binding specifically to hematopoietic cancer cells expressing CD19. In another embodiment of the invention, the targeting agent is capable of binding specifically to hematopoietic cancer cells expressing CD20. In a preferred embodiment of the invention, the targeting agent is capable of binding to primary myeloma cells expressing CD19 and/or CD20. In a preferred embodiment of the invention, the targeting agent is capable of binding to primary myeloma cells expressing CD19. In a preferred embodiment of the invention, the targeting agent is capable of binding to primary myeloma cells expressing CD20. In a preferred embodiment of the invention, the targeting agent is capable of binding to primary myeloma cells which express low levels of CD19 and/or CD20, preferably levels of CD19 and/or CD20 that cannot be detected by flow cytometry, more preferably low levels of CD19 and/or CD20 that cannot be detected by flow cytometry but can be detected by super-resolution microscopy, in particular single molecule localization microscopy (e.g. dSTORM). In another preferred embodiment of the invention, the targeting agent is capable of binding to primary myeloma cells which express low levels of CD20, preferably levels of CD20 that cannot be detected by flow cytometry, more preferably low levels of CD20 that cannot be detected by flow cytometry but can be detected by super-resolution microscopy, in particular single molecule localization microscopy (e.g. dSTORM). In a very preferred embodiment of the invention, the targeting agent is capable of binding to primary myeloma cells which express low levels of CD19, preferably levels of CD19 that cannot be detected by flow cytometry, more preferably low levels of CD19 that cannot be detected by flow cytometry but can be detected by super-resolution microscopy, in particular single molecule localization microscopy (e.g. dSTORM).
[0174] Preferably the immune cells and targeting agents as used herein are capable of causing a decrease in cancer cell number of the cancer cells expressing the target antigen. Preferably, this can be caused by cytotoxicity through necrosis or apoptosis, or this can be caused by inhibiting or stopping proliferation, i.e. inhibiting growth. This can be measured by various common methods and assays known in the art.
[0175] In one embodiment, the chimeric antigen receptor is capable of binding to CD19 and/or CD20. In one embodiment, the chimeric antigen receptor is capable of binding to CD19. In one embodiment, the chimeric antigen receptor is capable of binding to CD20. In a preferred embodiment, the chimeric antigen receptor is capable of binding to the extracellular domain of CD19 and/or CD20. In a preferred embodiment, the chimeric antigen receptor is capable of binding to the extracellular domain of CD19. In a preferred embodiment, the chimeric antigen receptor is capable of binding to the extracellular domain of CD20. In a preferred embodiment, the chimeric antigen receptor is expressed in immune cells, preferably T cells. In a preferred embodiment of the invention, the chimeric antigen receptor is expressed in T cells and allows said T cells to bind specifically to CD20- and/or CD19-expressing myeloma cells with high specificity to exert a growth inhibiting effect, preferably a cytotoxic effect, on said acute myeloid leukemia cells. In a preferred embodiment of the invention, the chimeric antigen receptor is expressed in T cells and allows said T cells to bind specifically to CD19-expressing myeloma cells with high specificity to exert a growth inhibiting effect, preferably a cytotoxic effect, on said acute myeloid leukemia cells. In a preferred embodiment of the invention, the chimeric antigen receptor is expressed in T cells and allows said T cells to bind specifically to CD20-expressing myeloma cells with high specificity to exert a growth inhibiting effect, preferably a cytotoxic effect, on said acute myeloid leukemia cells.
[0176] Immunotherapy as described herein refers to the transfer of immune cells into a patient for targeted treatment of cancer. The cells may have originated from the patient or from another individual. In immunotherapy, immune cells, preferably T cells, are typically extracted from an individual, preferably from the patient, genetically modified and cultured in vitro and administered to the patient. Immunotherapy is advantageous in that it allows targeted growth inhibiting, preferably cytotoxic, treatment of tumor cells without the non-targeted toxicity to non-tumor cells that occurs with conventional treatments.
[0177] In a preferred embodiment in accordance with the invention, T cells are isolated from a patient having multiple myeloma, transduced with a gene transfer vector encoding a chimeric antigen receptor capable of binding to CD19, and administered to the patient to treat multiple myeloma, preferably wherein the myeloma cells express CD19, more preferably low levels of CD19, more preferably low levels of CD19 that cannot be detected by flow cytometry, most preferably low levels of CD19 that cannot be detected by flow cytometry but can be detected by super-resolution microscopy, in particular single molecule localization microscopy (e.g. dSTORM). In a preferred embodiment, the T cells are CD8.sup.+ T cells or CD4.sup.+ T cells.
[0178] In another preferred embodiment in accordance with the invention, T cells are isolated from a patient having multiple myeloma, transduced with a gene transfer vector encoding a chimeric antigen receptor capable of binding to CD20, and administered to the patient to treat multiple myeloma, preferably wherein the myeloma cells express CD20, more preferably low levels of CD20, more preferably low levels of CD20 that cannot be detected by flow cytometry, most preferably low levels of CD20 that cannot be detected by flow cytometry but can be detected by super-resolution microscopy, in particular single molecule localization microscopy (e.g. dSTORM). In a preferred embodiment, the T cells are CD8.sup.+ T cells or CD4.sup.+ T cells.
[0179] In another preferred embodiment in accordance with the invention, T cells are isolated from a patient having multiple myeloma, transduced with a gene transfer vector encoding a chimeric antigen receptor capable of binding to CD19 and/or CD20, and administered to the patient to treat multiple myeloma, preferably wherein the myeloma cells express CD19 and/or CD20, more preferably low levels of CD19 and/or CD20, more preferably low levels of CD19 and/or CD20 that cannot be detected by flow cytometry, most preferably low levels of CD19 and/or CD20 that cannot be detected by flow cytometry but can be detected by super-resolution microscopy, in particular single molecule localization microscopy (e.g. dSTORM). In a preferred embodiment, the T cells are CD8.sup.+ T cells or CD4.sup.+ T cells.
[0180] Terms such as treatment of cancer or treating cancer according to the present invention refer to a therapeutic treatment. An assessment of whether or not a therapeutic treatment works can, for instance, be made by assessing whether the treatment inhibits cancer growth in the treated patient or patients. Preferably, the inhibition is statistically significant as assessed by appropriate statistical tests which are known in the art. Inhibition of cancer growth may be assessed by comparing cancer growth in a group of patients treated in accordance with the present invention to a control group of untreated patients, or by comparing a group of patients that receive a standard cancer treatment of the art plus a treatment according to the invention with a control group of patients that only receive a standard cancer treatment of the art. Such studies for assessing the inhibition of cancer growth are designed in accordance with accepted standards for clinical studies, e.g. double-blinded, randomized studies with sufficient statistical power. The term treating cancer includes an inhibition of cancer growth where the cancer growth is inhibited partially (i.e. where the cancer growth in the patient is delayed compared to the control group of patients), an inhibition where the cancer growth is inhibited completely (i.e. where the cancer growth in the patient is stopped), and an inhibition where cancer growth is reversed (i.e. the cancer shrinks). An assessment of whether or not a therapeutic treatment works can be made based on known clinical indicators of cancer progression.
[0181] A treatment of cancer according to the present invention does not exclude that additional or secondary therapeutic benefits also occur in patients. However, it is understood that the primary treatment for which protection is sought is for treating the cancer itself, and any secondary or additional effects only reflect optional, additional advantages of the treatment of cancer growth.
[0182] The treatment of cancer according to the invention can be a first-line therapy, a second-line therapy, a third-line therapy, or a fourth-line therapy. The treatment can also be a therapy that is beyond is beyond fourth-line therapy. The meaning of these terms is known in the art and in accordance with the terminology that is commonly used by the US National Cancer Institute.
[0183] The term capable of binding as used herein refers to the capability to form a complex with a molecule that is to be bound (e.g. CD19 and/or CD20). Binding typically occurs non-covalently by intermolecular forces, such as ionic bonds, hydrogen bonds and Van der Waals forces and is typically reversible. Various methods and assays to determine binding capability are known in the art. Binding is usually a binding with high affinity, wherein the affinity as measured in K.sub.D values is preferably is less than 1 M, more preferably less than 100 nM, even more preferably less than 10 nM, even more preferably less than 1 nM, even more preferably less than 100 pM, even more preferably less than 10 pM, even more preferably less than 1 pM.
[0184] As used herein, each occurrence of terms such as comprising or comprises may optionally be substituted with consisting of or consists of.
[0185] A pharmaceutically acceptable carrier, including any suitable diluent or, can be used herein as known in the art. As used herein, the term pharmaceutically acceptable means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans. Pharmaceutically acceptable carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, and combinations thereof. It will be understood that the formulation will be appropriately adapted to suit the mode of administration.
[0186] Compositions and formulations in accordance with the present invention are prepared in accordance with known standards for the preparation of pharmaceutical compositions and formulations. For instance, the compositions and formulations are prepared in a way that they can be stored and administered appropriately, e.g. by using pharmaceutically acceptable components such as carriers, excipients or stabilizers. Such pharmaceutically acceptable components are not toxic in the amounts used when administering the pharmaceutical composition or formulation to a patient. The pharmaceutical acceptable components added to the pharmaceutical compositions or formulations may depend on the chemical nature of the inhibitor and targeting agent present in the composition or formulation (depend on whether the targeting agent is e.g. an antibody or fragment thereof or a cell expressing a chimeric antigen receptor), the particular intended use of the pharmaceutical compositions and the route of administration.
[0187] The number of cell surface antigen molecules per cell as referred to herein can be any such number in accordance with the meaning of the term that is known in the art. In a non-limiting preferred embodiment, the number of cell surface antigen molecules per cell is an average number of molecules per cell with respect to the cells or the fraction of cells expressing said cell surface antigen. In a more preferred non-limiting embodiment, the number of cell surface antigen molecules per cell is the mean value of the number of molecules per cell with respect to the cells or the fraction of cells expressing said cell surface antigen. In another non-limiting embodiment, the number of cell surface antigen molecules per cell is the median number of molecules per cell with respect to the cells or the fraction of cells expressing said cell surface antigen.
[0188] Any numbers of molecules of cell surface antigens as referred to herein can be determined by suitable methods. Preferably, these numbers can be determined by super-resolution microscopy, more preferably by single-molecule localization microscopy such as dSTORM, STORM, PALM, or PALM, and most preferably by dSTORM.
[0189] It is understood that for any methods of the invention using immunostaining, including the above-mentioned super-resolution microscopy methods such as dSTORM which can use immunostaining, any antibodies used therein are used at a suitable concentration. In a preferred embodiment, the antibodies used in the invention are used at saturating conditions. In another preferred embodiment, the methods of the invention are performed under conditions that have been clinically validated.
[0190] In a preferred embodiment in accordance with the invention, the composition or formulation is suitable for administration to humans, preferably the formulation is sterile and/or non-pyrogenic.
EXAMPLES
[0191] Additional aspects and details of the invention are exemplified by the following non-limiting examples.
[0192] Immunotherapy with chimeric antigen receptor (CAR)-engineered T-cells targeting CD19 (CD19CART) was investigated in multiple myeloma, a clonal proliferation of plasma cells. A recent study by Garfall et al reported complete remission in a myeloma patient who received CD19CART after myeloablative chemotherapy and autologous stem cell transplantation, even though only 0.05% of myeloma cells expressed CD19 by flow cytometry (FC), the routine clinical detection method. The study sparked controversy over the role of CDI9CART for treating myeloma.
[0193] The inventors generated expression profiles of CD19 on myeloma cells from n=14 patients by single-molecule sensitive direct stochastic optical reconstruction microscopy (dSTORM), and compared them to profiles obtained by FC. In parallel, myeloma cells were treated with CD19CART in vitro.
[0194] In 10 out of 14 patients, the inventors detected CD19 on a fraction of myeloma cells (range: 10.3%-80%) by dSTORM. The majority of myeloma cells expressed CD19 at very low levels, below the detection limit of FC. FC detected CD19 only in 2 of these 10 patients on a smaller fraction of cells (range: 4.9%-30.4%). Four patients were CD19-negative by dSTORM. Treatment with CD19CART led to elimination of myeloma cells, even when CD19 was undetectable by FC. In a subset of patients, CD19 is expressed on a large fraction of myeloma cells, but remains undetected by FC. These patients are candidates for CD19CART cell therapy. The inventors demonstrate that that the threshold for CDI9CART recognition is far below 100 CD19 molecules per target cell, surpassing previous assumptions on the sensitivity of this novel treatment.
[0195] In particular, the Examples were carried out as follows:
Human Subjects
[0196] Bone marrow aspirates were obtained from patients with multiple myeloma, and T-cells for CAR-modification were isolated from the peripheral blood of healthy donors. All participants provided written informed consent to participate in research protocols approved by the institutional review board of the University of Wrzburg.
Flow Cytometry Analyses
[0197] Primary myeloma cells were isolated from bone marrow using positive selection with anti-CD138 magnetic beads (Miltenyi, Bergisch-Gladbach, Germany) and stained with anti-CD19AF647 (clone: HIB19), CD20AF647 (clone: 2H7) or AF647 isotype control and anti-CD38-AF488, anti-CD138-PE antibodies, and 7-AAD to exclude dead cells from analysis.
CAR T-Cell Treatment
[0198] Myeloma cells (2.510.sup.4) were co-cultured with CD19CART, CD2OCART (110.sup.5) or control untransduced T-cells (110.sup.5) for 4 hours in 96-well round-bottom plates prior to dSTORM-analysis. The CD19-CAR has been described.sup.21.
dSTORM-Analyses
[0199] Myeloma cells were stained with anti-CD19-AF647, anti-CD20-AF647, anti-CD38-AF488 and anti-CD138-AF555 antibodies or AF647 isotype control antibodies (BioLegend, London, United Kingdom). Images were acquired on an Olympus IX-71 inverted microscope, dSTORM images were reconstructed using the single-molecule localization software rapidSTORM3.3.sup.22 and quantification of CD19 was performed using a custom script written with Mathematica (WolframResearch, Inc., Mathematica, Version 11.2, Champaign, Ill.).
Primary Myeloma Cells
[0200] Bone marrow aspirate was diluted 1:10 in phosphate-buffered saline (PBS), and leukocytes were isolated using Ficoll-hypaque density centrifugation in 50 mL LeukoSep tubes (Greiner Bio One, Frickenhausen, Germany). CD138.sup.+ myeloma cells were isolated using positive selection with CD138-MicroBeads (Miltenyi, Bergisch-Gladbach, Germany).
Cell Lines and Cell Culture Media
[0201] NALM-6 (DSMZ, Heidelberg, Germany), MM.1S and K562 (both ATCC, Manassas, Va., USA) cells were maintained in RPMI-1640 medium containing 8% fetal calf serum (FCS), 2 mM L-glutamine, and 100 U/mL penicillin/streptomycin (all components from Gibco, Thermo Scientific, Schwerte, Germany). K562_CD19 cells were generated by lentiviral transduction with human CD19. Primary myeloma cells and T-cells were maintained in RPMI-1640 medium containing 8% human serum, 2 mM Glutamax, 0,.% -mercaptoethanol and 100 U/mL penicillin/streptomycin (T-cell medium; all other components from Gibco). T-cell cultures were supplemented with 50 U/mI IL-2 (Proleukin, Novartis, Basel, Switzerland).
Generation of CD19CART and CD20CART
[0202] The vector design and experimental procedure has been described in a previous study.sup.21. In brief, peripheral blood mononuclear cells (PBMCs) of healthy donors were purified using Ficoll-hypaque density centrifugation in 50 mL LeukoSep tubes (Greiner Bio One), and CD8.sup.+ T-cells were isolated using negative magnetic sorting (CD8.sup.+ T-cell Isolation Kit, human, Miltenyi). T-cells were stimulated with anti-CD3/CD28 magnetic beads (Dynabeads Human T-Activator CD3/CD28, ThermoScientific) and transduced with an epHIV7 lentivirus encoding a CAR construct comprising the following: an anti-CD19 or -CD20 single chain variable fragment derived from FMC63 and Leu16, respectively; an IgG4-Fc hinge spacer; a CD28 transmembrane region; a 4-1BB_CD3 signaling module; and a truncated epidermal growth factor receptor (EGFR) transduction marker.sup.23. T-cells were enriched for EGFRt.sup.+ using the biotinylated anti-EGFR monoclonal antibody (mAb) Cetuximab (Merck, Darmstadt, Germany) and anti-Biotin Microbeads (Miltenyi). Purified CD19CART, CD2OCART and non-transduced control T-cells were expanded with irradiated CD19.sup.+/CD20.sup.+ feeder cells as previously described.sup.24 and stored in aliquots in liquid nitrogen until functional testing.
[0203] Methods to generate chimeric antigen receptors, chimeric antigen receptor-expressing vectors, and methods for transducing said vectors are known in the art. Non-limiting exemplary methods include those described previously.sup.25,26, which are incorporated herein by reference in their entirety for all purposes.
[0204] In a preferred embodiment of the invention, the chimeric antigen receptor is a CD19 CAR having the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1. In a more preferred embodiment, the CD19 CAR having the amino acid sequence encoded by SEQ ID NO: 1. can be expressed using the lentiviral vector having the nucleotide sequence of SEQ ID NO: 2.
[0205] In a preferred embodiment of the invention, the chimeric antigen receptor is a CD20 CAR having the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 3. In a more preferred embodiment, the CD20 CAR having the amino acid sequence encoded by SEQ ID NO: 3 can be expressed using the lentiviral vector having the nucleotide sequence of SEQ ID NO: 4.
TABLE-US-00001 (nucleotidesequenceencodingtheCD19CAR) SEQIDNO:1 atgctgctgctggtgaccagcctgctgctgtgcgagctgccccaccccgcctttctgctgatccccgacatccagatgacccaga ccacctccagcctgagcgccagcctgggcgaccgggtgaccatcagctgccgggccagccaggacatcagcaagtacctgaactg gtatcagcagaagcccgacggcaccgtcaagctgctgatctaccacaccagccggctgcacagcggcgtgcccagccggtttagc ggcagcggctccggcaccgactacagcctgaccatctccaacctggaacaggaagatatcgccacctacttttgccagcagggca acacactgccctacacctttggcggcggaacaaagctggaaatcaccggcagcacctccggcagcggcaagcctggcagcggcga gggcagcaccaagggcgaggtgaagctgcaggaaagcggccctggcctggtggcccccagccagagcctgagcgtgacctgcacc gtgagcggcgtgagcctgcccgactacggcgtgagctggatccggcagccccccaggaagggcctggaatggctgggcgtgatct ggggcagcgagaccacctactacaacagcgccctgaagagccggctgaccatcatcaaggacaacagcaagagccaggtgttcct gaagatgaacagcctgcagaccgacgacaccgccatctactactgcgccaagcactactactacggcggcagctacgccatggac tactggggccagggcaccagcgtgaccgtgagcagcgaatctaagtacggaccgccctgccccccttgccctatgttctgggtgc tggtggtggtcggaggcgtgctggcctgctacagcctgctggtcaccgtggccttcatcatcttttgggtgaaacggggcagaaa gaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttcca gaagaagaagaaggaggatgtgaactgcgggtgaaggttcagcagaagcgccgacgcccctgcctaccagcagggccagaatcag ctgtacaacgagctgaacctgggcagaagggaagagtacgacgtcctggataagcggagaggccgggaccctgagatgggcggca agcctcggcggaagaacccccaggaaggcctgtataacgaactgcagaaagacaagatggccgaggcctacagcgagatcggcat gaagggcgagcggaggcggggcaagggccacgacggcctgtatcagggcctgtccaccgccaccaaggatacctacgacgccctg cacatgcaggccctgcccccaaggctcgagggcggcggagagggcagaggaagtcttctaacatgcggtgacgtggaggagaatc ccggccctaggatgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccacgcaaagt gtgtaacggaataggtattggtgaatttaaagactcactctccataaatgctacgaatattaaacacttcaaaaactgcacctcc atcagtggcgatctccacatcctgccggtggcatttaggggtgactccttcacacatactcctcctctggatccacaggaactgg atattctgaaaaccgtaaaggaaatcacagggtttttgctgattcaggcttggcctgaaaacaggacggacctccatgcctttga gaacctagaaatcatacgcggcaggaccaagcaacatggtcagttttctcttgcagtcgtcagcctgaacataacatccttggga ttacgctccctcaaggagataagtgatggagatgtgataatttcaggaaacaaaaatttgtgctatgcaaatacaataaactgga aaaaactgtttgggacctccggtcagaaaaccaaaattataagcaacagaggtgaaaacagctgcaaggccacaggccaggtctg ccatgccttgtgctcccccgagggctgctggggcccggagcccagggactgcgtctcttgccggaatgtcagccgaggcagggaa tgcgtggacaagtgcaaccttctggagggtgagccaagggagtttgtggagaactctgagtgcatacagtgccacccagagtgcc tgcctcaggccatgaacatcacctgcacaggacggggaccagacaactgtatccagtgtgcccactacattgacggcccccactg cgtcaagacctgcccggcaggagtcatgggagaaaacaacaccctggtctggaagtacgcagacgccggccatgtgtgccacctg tgccatccaaactgcacctacggatgcactgggccaggtcttgaaggctgtccaacgaatgggcctaagatcccgtccatcgcca ctgggatggtgggggccctcctcttgctgctggtggtggccctggggatcggcctcttcatgtga (nucleotidesequencerepresentingtheexpressionvectorencodingtheCD19CAR) SEQIDNO:2 gttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgctt caagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca tggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacgg caagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgt cagtattaagcgggggagaattagatcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatat agtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactggga cagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaa ggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagc agctgacacaggacacagcaatcaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccata tcacctagaactttaaatgcatgggtaaaagtagtagaagagaaggctttcagcccagaagtgatacccatgttttcagcattat cagaaggagccaccccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatgttaaaagagac catcaatgaggaagctgcaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggtt cttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcag cagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaa gaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgc tgtgccttggatctacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaa tagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacag ggacagcagagatccagtttggggatcaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgaggatctgc gatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccg gtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaacc gtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgc atctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtg cctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacc tagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttac agatccaagctgtgaccggcgcctacggctagcgccgccaccatgctgctgctggtgaccagcctgctgctgtgcgagctgcccc accccgcctttctgctgatccccgacatccagatgacccagaccacctccagcctgagcgccagcctgggcgaccgggtgaccat cagctgccgggccagccaggacatcagcaagtacctgaactggtatcagcagaagcccgacggcaccgtcaagctgctgatctac cacaccagccggctgcacagcggcgtgcccagccggtttagcggcagcggctccggcaccgactacagcctgaccatctccaacc tggaacaggaagatatcgccacctacttttgccagcagggcaacacactgccctacacctttggcggcggaacaaagctggaaat caccggcagcacctccggcagcggcaagcctggcagcggcgagggcagcaccaagggcgaggtgaagctgcaggaaagcggccct ggcctggtggcccccagccagagcctgagcgtgacctgcaccgtgagcggcgtgagcctgcccgactacggcgtgagctggatcc ggcagccccccaggaagggcctggaatggctgggcgtgatctggggcagcgagaccacctactacaacagcgccctgaagagccg gctgaccatcatcaaggacaacagcaagagccaggtgttcctgaagatgaacagcctgcagaccgacgacaccgccatctactac tgcgccaagcactactactacggcggcagctacgccatggactactggggccagggcaccagcgtgaccgtgagcagcgaatcta agtacggaccgccctgccccccttgccctatgttctgggtgctggtggtggtcggaggcgtgctggcctgctacagcctgctggt caccgtggccttcatcatcttttgggtgaaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagta caaactactcaagaggaagatggctgtagctgccgatttccagaagaagaagaaggaggatgtgaactgcgggtgaagttcagca gaagcgccgacgcccctgcctaccagcagggccagaatcagctgtacaacgagctgaacctgggcagaagggaagagtacgacgt cctggataagcggagaggccgggaccctgagatgggcggcaagcctcggcggaagaacccccaggaaggcctgtataacgaactg cagaaagacaagatggccgaggcctacagcgagatcggcatgaagggcgagcggaggcggggcaagggccacgacggcctgtatc agggcctgtccaccgccaccaaggatacctacgacgccctgcacatgcaggccctgcccccaaggctcgagggcggcggagaggg cagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctaggatgcttctcctggtgacaagccttctgctctgt gagttaccacacccagcattcctcctgatcccacgcaaagtgtgtaacggaataggtattggtgaatttaaagactcactctcca taaatgctacgaatattaaacacttcaaaaactgcacctccatcagtggcgatctccacatcctgccggtggcatttaggggtga ctccttcacacatactcctcctctggatccacaggaactggatattctgaaaaccgtaaaggaaatcacagggtttttgctgatt caggcttggcctgaaaacaggacggacctccatgcctttgagaacctagaaatcatacgcggcaggaccaagcaacatggtcagt tttctcttgcagtcgtcagcctgaacataacatccttgggattacgctccctcaaggagataagtgatggagatgtgataatttc aggaaacaaaaatttgtgctatgcaaatacaataaactggaaaaaactgtttgggacctccggtcagaaaaccaaaattataagc aacagaggtgaaaacagctgcaaggccacaggccaggtctgccatgccttgtgctcccccgagggctgctggggcccggagccca gggactgcgtctcttgccggaatgtcagccgaggcagggaatgcgtggacaagtgcaaccttctggagggtgagccaagggagtt tgtggagaactctgagtgcatacagtgccacccagagtgcctgcctcaggccatgaacatcacctcacaggacggggaccagaca actgtatccagtgtgcccactacattgacggcccccactgcgtcaagacctgcccggcaggagtcatgggagaaaacaacaccct ggtctggaagtacgcagacgccggccatgtgtgccacctgtgccatccaaactgcacctacggatgcactgggccaggtcttgaa ggctgtccaacgaatgggcctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctggtggtggccctgg ggatcggcctcttcatgtgagcggccgctctagacccgggctgcaggaattcgatatcaagcttatcgataatcaacctctggat tacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgt atcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcc cgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctc ctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctc ggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggat tctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcgg cctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgataccgtcgactagccg tacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattca ctcccaaagaagacaagatctgctttttgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaa ctagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggta actagagatccctcagacccttttagtcagtgtggaaaatctctagcagaattcgatatcaagcttatcgataccgtcgacctcg agggggggcccggtacccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaa accctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcg cccttcccaacagttgcgcagcctgaatggcgaatggaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgtt aaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgt tgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggc ccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagccccc gatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggc aagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtggcacttttcgg ggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaa tgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgcct tcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactg gatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtg gcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactc accagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcg gccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttg atcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcg caaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacca cttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcag cactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagaca gatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaa cttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcc actgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaa aaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcg cagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctc tgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataa ggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacag cgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagc gcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt gtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcctttt gctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgca gccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggcc gattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcact cattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaa acagctatgaccatgattacgccaagctcgaaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcct cgaggtcgagatccggtcgaccagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgccca ttctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtga ggaggcttttttggaggcctaggcttttgcaaaaagcttcgacggtatcgattggctcatgtccaacattaccgccatgttgaca ttgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactt acggtaaatggcccgcctggctgaccgcccaacgacccccgcccaatgacgtcaataatgacgtatgttcccatagtaacgccaa tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaag tacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttgg cagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgact cacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcg taacaactccgccccattgacgcaaatgggcggtaggcgtgtacggaattcggagtggcgagccctcagatcctgcatataagca gctgctttttgcctgtactgggtctctctg (nucleotidesequenceencodingtheCD20CAR) SEQIDNO:3 atgttgctgctggttacatctctgctgctgtgcgagctgccccatcctgcctttctgctgatccccgacatcgtgctgacacaga gccctgccatcctgagtgcttccccaggcgagaaagtgaccatgacctgtagagccagcagcagcgtgaactacatggactggta tcagaagaagcccggcagcagccccaagccttggatctacgccacaagcaatctggccagcggagtgcctgccagattttctggc tctggcagcggcacaagctacagcctgacaatcagcagagtggaagccgaggatgccgccacctactactgtcagcagtggtcct tcaatcctcctaccttcggcggaggcaccaagctggaaatcaagggctctacaagcggcggaggatctggcggtggaagtggcgg aggcggatcttctgaagttcagctgcaacagtctggcgccgagctggttaagcctggcgcctctgtgaagatgagctgcaaggcc agcggctacaccttcaccagctacaacatgcactgggtcaagcagacccctggacagggactcgagtggatcggagccatctatc ccggcaatggcgacacctcctacaaccagaagttcaagggcaaagccacactgaccgccgacaagagcagcagcacagcctacat gcagctgagcagcctgaccagcgaggacagcgccgattactactgcgccagaagcaactactacggcagctcctactggttcttc gacgtgtggggagccggcaccacagtgacagtgtctagcgagtctaagtacggaccgccttgtcctccttgtccagctcctcctg tggccggacctagcgtgttcctgttccccccaaagcccaaggacaccctgatgatcagccggacccccgaagtgacctgcgtggt ggtggatgtgtcccaggaagatcccgaggtgcagttcaattggtacgtggacggcgtggaagtgcacaacgccaagaccaagccc agagaggaacagttccagagcacctaccgggtggtgtccgtgctgacagtgctgcaccaggactggctgaacggcaaagagtaca agtgcaaggtgtccaacaagggcctgcccagcagcatcgagaaaaccatcagcaaggccaagggccagcctcgcgagccccaggt gtacacactgcctccaagccaggaagagatgaccaagaaccaggtgtccctgacctgtctcgtgaagggcttctaccccagcgac attgccgtggaatgggagagcaacggccagcccgagaacaactacaagaccaccccccctgtgctggacagcgacggctcattct tcctgtacagcagactgaccgtggacaagagccggtggcaggaaggcaacgtgttcagctgcagcgtgatgcacgaggccctgca caaccactacacccagaagtccctgtctctgagcctgggcaagatgttctgggtgctggtggtcgtgggcggagtgctggcctgt tacagcctgctcgtgaccgtggccttcatcatcttttgggtcaagcggggcagaaagaagctgctgtatatcttcaagcagccct tcatgcggcccgtgcagaccacacaggaagaggacggctgctcctgccggttccccgaggaagaagaaggcggctgcgagctgag agtgaagttcagcagaagcgccgacgcccctgcctatcagcagggccagaaccagctgtacaacgagctgaacctgggcagacgg gaagagtacgacgtgctggataagcggagaggccgggaccctgagatgggcggcaagcctagaagaaagaacccccaggaaggcc tgtataacgaactgcagaaagacaagatggccgaggcctacagcgagatcggaatgaagggcgagcggagaagaggcaagggcca cgatggcctgtaccagggactgagcaccgccaccaaggatacctatgacgcactgcacatgcaggccctgccccccagactcgag ggcggaggcgaaggcagaggatctctgctgacatgcggcgacgtggaagagaaccctggccccagaatgctgctgctcgtgacaa gcctgctgctgtgcgagctgccccaccctgcctttctgctgatcccccggaaagtgtgcaacggcatcggcatcggagagttcaa ggacagcctgtccatcaacgccaccaacatcaagcacttcaagaattgcaccagcatcagcggcgacctgcacatcctgccagtg gcctttagaggcgacagcttcacccacacccccccactggatccacaggaactggatattctgaaaaccgtaaaggaaatcacag ggtttttgctgattcaggcttggcctgaaaacaggacggacctccatgcctttgagaacctagaaatcatacgcggcaggaccaa gcaacatggtcagttttctcttgcagtcgtcagcctgaacataacatccttgggattacgctccctcaaggagataagtgatgga gatgtgataatttcaggaaacaaaaatttgtgctatgcaaatacaataaactggaaaaaactgtttgggacctccggtcagaaaa ccaaaattataagcaacagaggtgaaaacagctgcaaggccacaggccaggtctgccatgccttgtgctcccccgagggctgctg gggcccggagcccagggactgcgtctcttgccggaatgtcagccgaggcagggaatgcgtggacaagtgcaaccttctggagggt gagccaagggagtttgtggagaactctgagtgcatacagtgccacccagagtgcctgcctcaggccatgaacatcacctgcacag gacggggaccagacaactgtatccagtgtgcccactacattgacggcccccactgcgtcaagacctgcccggcaggagtcatggg agaaaacaacaccctggtctggaagtacgcagacgccggccatgtgtgccacctgtgccatccaaactgcacctacggatgcact gggccaggtcttgaaggctgtccaacgaatgggcctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgc tggtggtggccctggggatcggcctcttcatgtga (nucleotidesequencerepresentingtheexpressionvectorencodingtheCD20CAR) SEQIDNO:4 gttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgctt caagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca gtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacg gcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcg tcagtattaagcgggggagaattagatcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacata tagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactggg acagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaa aggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcag cagctgacacaggacacagcaatcaggtcagccaaaattaccctatagtgcagaacatccaggggcaaatggtacatcaggccat atcacctagaactttaaatgcatgggtaaaagtagtagaagagaaggctttcagcccagaagtgatacccatgttttcagcatta tcagaaggagccaccccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatgttaaaagaga ccatcaatgaggaagctgcaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggt tcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtatagtgca gcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggca agaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactg ctgtgccttggatctacaaatggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaaga atagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattaca gggacagcagagatccagtttggggatcaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgaggatctg cgatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacc ggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaac cgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcg catctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggt gcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctac ctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgtta cagatccaagctgtgaccggcgcctacggctagcgccgccaccatgttgctgctggttacatctctgctgctgtgcgagctgccc catcctgcctttctgctgatccccgacatcgtgctgacacagagccctgccatcctgagtgcttccccaggcgagaaagtgacca tgacctgtagagccagcagcagcgtgaactacatggactggtatcagaagaagcccggcagcagccccaagccttggatctacgc cacaagcaatctggccagcggagtgcctgccagattttctggctctggcagcggcacaagctacagcctgacaatcagcagagtg gaagccgaggatgccgccacctactactgtcagcagtggtccttcaatcctcctaccttcggcggaggcaccaagctggaaatca agggctctacaagcggcggaggatctggcggtggaagtggcggaggcggatcttctgaagttcagctgcaacagtctggcgccga gctggttaagcctggcgcctctgtgaagatgagctgcaaggccagcggctacaccttcaccagctacaacatgcactgggtcaag cagacccctggacagggactcgagtggatcggagccatctatcccggcaatggcgacacctcctacaaccagaagttcaagggca aagccacactgaccgccgacaagagcagcagcacagcctacatgcagctgagcagcctgaccagcgaggacagcgccgattacta ctgcgccagaagcaactactacggcagctcctactggttcttcgacgtgtggggagccggcaccacagtgacagtgtctagcgag tctaagtacggaccgccttgtcctccttgtccagctcctcctgtggccggacctagcgtgttcctgttccccccaaagcccaagg acaccctgatgatcagccggacccccgaagtgacctgcgtggtggtggatgtgtcccaggaagatcccgaggtgcagttcaattg gtacgtggacggcgtggaagtgcacaacgccaagaccaagcccagagaggaacagttccagagcacctaccgggtggtgtccgtg ctgacagtgctgcaccaggactggctgaacggcaaagagtacaagtgcaaggtgtccaacaagggcctgcccagcagcatcgaga aaaccatcagcaaggccaagggccagcctcgcgagccccaggtgtacacactgcctccaagccaggaagagatgaccaagaacca ggtgtccctgacctgtctcgtgaagggcttctaccccagcgacattgccgtggaatgggagagcaacggccagcccgagaacaac tacaagaccaccccccctgtgctggacagcgacggctcattcttcctgtacagcagactgaccgtggacaagagccggtggcagg aaggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagtccctgtctctgagcctgggcaa gatgttctgggtgctggtggtcgtgggcggagtgctggcctgttacagcctgctcgtgaccgtggccttcatcatcttttgggtc aagcggggcagaaagaagctgctgtatatcttcaagcagcccttcatgcggcccgtgcagaccacacaggaagaggacggctgct cctgccggttccccgaggaagaagaaggcggctgcgagctgagagtgaagttcagcagaagcgccgacgcccctgcctatcagca gggccagaaccagctgtacaacgagctgaacctgggcagacgggaagagtacgacgtgctggataagcggagaggccgggaccct gagatgggcggcaagcctagaagaaagaacccccaggaaggcctgtataacgaactgcagaaagacaagatggccgaggcctaca gcgagatcggaatgaagggcgagcggagaagaggcaagggccacgatggcctgtaccagggactgagcaccgccaccaaggatac ctatgacgcactgcacatgcaggccctgccccccagactcgagggcggaggcgaaggcagaggatctctgctgacatgcggcgac gtggaagagaaccctggccccagaatgctgctgctcgtgacaagcctgctgctgtgcgagctgccccaccctgcctttctgctga tcccccggaaagtgtgcaacggcatcggcatcggagagttcaaggacagcctgtccatcaacgccaccaacatcaagcacttcaa gaattgcaccagcatcagcggcgacctgcacatcctgccagtggcctttagaggcgacagcttcacccacacccccccactggat ccacaggaactggatattctgaaaaccgtaaaggaaatcacagggtttttgctgattcaggcttggcctgaaaacaggacggacc tccatgcctttgagaacctagaaatcatacgcggcaggaccaagcaacatggtcagttttctcttgcagtcgtcagcctgaacat aacatccttgggattacgctccctcaaggagataagtgatggagatgtgataatttcaggaaacaaaaatttgtgctatgcaaat acaataaactggaaaaaactgtttgggacctccggtcagaaaaccaaaattataagcaacagaggtgaaaacagctgcaaggcca caggccaggtctgccatgccttgtgctcccccgagggctgctggggcccggagcccaggggactgcgtctcttgccggaatgtca gccgaggcagggaatgcgtggacaagtgcaaccttctggagggtgagccaagggagtttgtggagaactctgagtgcatacagtg ccacccagagtgcctgcctcaggccatgaacatcacctgcacaggacggggaccagacaactgtatccagtgtgcccactacatt gacggcccccactgcgtcaagacctgcccggcaggagtcatgggagaaaacaacaccctggtctggaagtacgcagacgccggcc atgtgtgccacctgtgccatccaaactgcacctacggatgcactgggccaggtcttgaaggctgtccaacgaatgggcctaagat cccgtccatcgccactgggatggtgggggccctcctcttgctgctggtggtggccctggggatcggcctcttcatgtgagcggcc gctctagacccgggctgcaggaattcgatatcaagcttatcgataatcaacctctggattacaaaatttgtgaaagattgactgg tattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggct ttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgt gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccct ccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtg gtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacg tcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccc tcagacgagtcggatctccctttgggccgcctccccgcatcgataccgtcgactagccgtacctttaagaccaatgacttacaag gcagctgtagatcttagccatttttaaaagaaaaggggggactggaagggctaattcactcccaaagaagacaagatctgctttt tgcctgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaa taaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagt cagtgtggaaaatctctagcagaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccc tatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgcc ttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaa tggcgaatggaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaatagg ccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccact attaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatca agttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaac caccacacccgccgcgcttaatgcgccgctacagggcgcgcgtcaggtggcacttttcggggaaatgtgcgcggaacccctattt gtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaa gagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacg ctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttg agagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgc cgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacg gatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcg gaggaccgaaggagctaaccgcttttttgcacacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaat gaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactac ttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggc tggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccc tcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcac tgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggat ctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaa aagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtgg tttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttct agtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggct gctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccac gcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccaggggga aacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgga gcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgtt atcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgag tcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacg acaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttaca ctttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgcc aagctcgaaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcctcgaggtcgagatccggtcgacca gcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaa ttttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagg cttttgcaaaaagcttcgacggtatcgattggctcatgtccaacattaccgccatgttgacattgattattgactagttattaat agtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctg accgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaa tgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatg acggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcat cgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccac cccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgc aaatgggcggtaggcgtgtacggaattcggagtggcgagccctcagatcctgcatataagcagctgctttttgcctgtactgggt ctctg
[0206] The above-indicated nucleotide sequences of SEQ ID NO: 1 encoding the CD19 CAR and the above indicated expression vector of SEQ ID NO: 2 have been used in all of the present non-limiting experimental examples.
[0207] The above-indicated nucleotide sequences of SEQ ID NO: 3 encoding the CD20 CAR and the above indicated expression vector of SEQ ID NO: 4 have been used in all of the present non-limiting experimental examples.
Antibodies and Flow Cytometry
[0208] Antibodies against CD19 (clone HIB19, AF647), CD20 (clone 2H7, AF647), CD38 (clone HIT2, AF488), CD138 (clone MI15, PE and unconjugated) from BioLegend (London, United Kingdom); IFN- (clone B27, FITC) from BD Biosciences (Heidelberg, Germany), and CD8 (clone BW135/80, VioBlue) from Miltenyi were used. For dSTORM-microscopy, an anti-CD138 antibody was conjugated to AF555 (ThermoFisher Scientific). Flow analyses were performed with a FACS Canto II (BD) machine and analyzed using Flowio software (TreeStar, Ashland, Oreg.).
Experimental Procedures
[0209] CD19CART, CD20 CART and non-transduced control T-cells were thawed, washed and maintained overnight in T-cell medium with low-dose IL-2 (10 IU/mL). Then, 110.sup.5 T-cells were co-cultured with 2.510.sup.4 primary myeloma cells or control tumor cell lines for 4 h in the absence (for microscopy measurements) or presence of GolgiStop (BD). GolgiStop-treated cells were permeabilized using the Cytofix/Cytoperm Kit (BD) and stained for intracellular IFN-. For flow cytometric analysis of CD19 expression, untouched primary myeloma cells were washed and stained with anti-CD38-AF488, anti-CD138-PE and anti-CD19-AF647 or AF647 isotype control according to the manufacturer's instructions and subsequently washed and analyzed. For microscopy measurements, LabTek chamber slides (Nunc Lab-Tek II Chamber Slide System, ThermoFisher Scientific) were coated with poly-D-lysine and primary myeloma cells (or cell lines/co-cultures) and allowed to adhere for 90 min at 37 C. Afterwards, cells were washed with PBS and stained with anti-CD38-AF488, anti-CD138-AF555 and anti-CD19-AF647, anti-CD20-AF6647 or AF647 isotype control. Cells were washed and fixed with 4% paraformaldehyde and used for dSTORM-analyses.
Super-Resolution Imaging
[0210] For reversible photoswitching of Alexa Fluor 647, a PBS-based imaging buffer (pH 7.4) was used that contained 80 mM -mercaptoethylamine (Sigma-Aldrich, Taufkirchen, Germany) and an oxygen scavenger system containing 3% (w/v) glucose, 4 U/mL glucose oxidase and 80 U/mL catalase. dSTORM measurements were performed as previously described.sup.11,12. An Olympus IX-71 inverted microscope was used (Olympus, Hamburg, Germany) equipped with an oil-immersion objective (APON 60XOTIRF, Olympus) and a nosepiece stage (IX2-NPS, Olympus). AF647, AF555 and AF488 were excited with the appropriate laser systems (Genesis MX 639 and MX 561 from Coherent, Gttingen, Germany; iBeam smart 488 nm, Toptica, Grfelfing, Germany). The excitation light was spectrally cleaned by appropriate bandpass filters and then focused onto the backfocal plane of the objective. To switch between different illumination modes (epi and TIRE illumination), the lens system and mirror were arranged on a linear translation stage. A polychromatic mirror (HC 410/504/582/669, Semrock, Rochester, N.Y., USA) was used to separate excitation (laser) and emitted (fluorescent) light. The fluorescence emission was collected by the same objective and transmitted by the dichroic beam splitter and several detection filters (HC 440/521/607/700, Semrock; HC 679/41, Semrock, for Alexa 647; HQ 610/75, Chroma (Bellows Falls, Vt., USA), for Alexa 555; ET 525/50, Chroma, for Alexa 488), before being projected onto two electron-multiplying CCD cameras (both iXon Ultra 897, Andor, Belfast, UK; beam splitter 635 LP, Semrock). A final pixel size of 128 nm was generated by placing additional lenses in the detection path. Excitation intensity was approximately 3.3 kW/cm.sup.2. Typically, 15,000 frames were recorded with a frame rate of .sup.67 Hz (15 ms exposure time).
Image Reconstruction and Data Analysis
[0211] From the recorded image stack, a table with all localizations as well as a reconstructed dSTORM image was generated using the localization software rapidSTORM 3.3.sup.22. Only CD38/CD138 double-positive cells (i.e., myeloma cells) were further analyzed for CD19 expression. Quantification of CD19 and CD20 was performed with a custom-written Mathematica (Wolfram Research, Inc., Mathematica, Version 11.2, Champaign, Ill., USA) script. The analysis routine included the following steps: fluorescent spots containing less than 800 photons per frame were discarded. Repeated localizations coming from one antibody were grouped using an alpha-shape algorithm with an alpha value of 30. It was confirmed that the overall density of detected antibodies was small enough to yield well-separated alpha-shapes. Antibody densities (CD19, CD20 or isotype) were calculated from the number of grouped localizations divided by the area of the bottom plasma membrane of each cell, as determined with a region of interest (ROI)-selector. A total of 10-80 cells per patient and condition were analyzed to obtain CD19, CD20 and isotype antibody density distributions. To distinguish between non-specific (negative subpopulation) and specific (positive subpopulation) binding of CD19 and CD20 antibodies, detected antibody density distributions were fitted to a one- or two-component log-normal distribution. Relative contributions of non-specifically and specifically bound antibodies were estimated, together with the average density (localizations m.sup.2) of specifically bound antibodies. The significance of all distribution estimates was statistically tested using an Anderson-Darling test (rejected for p-values<0.05).
Example 1: Patient Characteristics and CD19-Expression by FC
[0212] To generate expression profiles of CD19 on primary myeloma cells by FC and dSTORM, bone marrow was obtained from 14 consecutive patients with MM that had measurable disease by histopathology. In this patient series, 4 patients had newly diagnosed myeloma, and 10 patients had been previously treated and were either in a state of partial remission (n=2) or had progressing disease (n=8) (Table S1). First, the inventors performed FC to detect CD19 on myeloma cells (
Example 2: dSTORM is More Sensitive Than FC in Detecting CD19 on Myeloma Cells
[0213] dSTORM was applied on the same sample of myeloma cells from the two patients who were clearly CD19-positive by FC. In both patients, the percentage of myeloma cells on which the inventors detected CD19 by dSTORM was higher compared to FC: in patient M012 68% (vs. 30.4% by FC); and in patient M016 32% (vs. 4.9% by FC) (Table 1). This discrepancy suggested that dSTORM is more sensitive than FC in detecting CD19. To test this, antibody titration experiments were performed on the human leukemia cell line NALM-6, which uniformly expresses CD19 (
Example 3: CD19.SUP.low .Myeloma Cells Identified by dSTORM are Not Detected by FC
[0214] Based on the higher detection sensitivity of dSTORM compared to FC, the inventors hypothesized that, in addition to CD19.sup.high myeloma cells that are detected by FC, there is an as-yet undetected population of CD19.sup.low myeloma cells that is invisible to FC. To test this, flow cytometry-based cell sorting was attempted to separate CD19-positive and CD19-negative myeloma cells but it was found that the number of cells that survived this procedure was insufficient to perform subsequent dSTORM-analyses. Therefore, CD19 density plots were generated based on the dSTORM data obtained from myeloma cells of patient M012. A schematic density plot and classification is provided in
Example 4: dSTORM Detects CD19.SUP.low .Myeloma Cells in Patients That are Classified as CD19-Negative by FC
[0215] Next, the inventors examined CD19-expression by dSTORM on myeloma cells from the 12 patients who were classified as CD19-negative or ambiguous by FC. CD19-positive myeloma cells were detected in 8 out of these 12 patients by dSTORM (
Example 5: CD19.SUP.low .(and CD19.SUP.high.) Myeloma Cells are Eliminated by CD19CART
[0216] To investigate whether CD19-expression on CD19.sup.high and CD19.sup.low myeloma cells is sufficient for CART recognition, the inventors treated them with CD19CART for 4 hours in vitro and then repeated the dSTORM-analysis. In all patients that contained CD19.sup.high and CD19.sup.low myeloma cells, it was found that CD19-expressing myeloma cells as detected by dSTORM were completely eliminated and only CD19-negative myeloma cells were present after the treatment (
Example 6: IFN-Secretion by CD19CART Does Not Predict the Presence of CD19.SUP.low .Myeloma Cells
[0217] The inventors sought to determine whether intracellular staining for IFN production in CD19CART after co-culture with myeloma cells could be used as a simple surrogate assay to test for the presence of CD19.sup.low myeloma cells instead of using single-molecule sensitive fluorescence imaging. However, the IFN assay worked in only two of ten patients that had been shown to contain CD19-positive myeloma cells by FC and dSTORM (
Example 7: dSTORM Detects CD19 on Primary Myeloma Cells with Single-Molecule Sensitivity
[0218] To perform dSTORM-imaging of CD19, the inventors used the B-cell acute lymphoblastic leukemia cell line NALM-6, which is uniformly positive for CD19 by flow cytometry (phenotype: CD19.sup.+CD38.sup.+CD138.sup.+). The K562 served as a negative control (CD19.sup.,
Example 8: CD20.SUP.low .(and CD20.SUP.high.) Myeloma Cells are Eliminated by CD20CART
[0219] To extend the applicability of the invention beyond CD19, the inventors investigated the expression of CD20, another molecule usually considered to be absent on myeloma cells in the majority of patients.sup.27 on primary samples of myeloma patients using dSTORM and FC. As for CD19, CD20 was found to be infrequently expressed in 4 additional patients as judged by flow cytometry with 2/4 patients classified as uniformly CD20. In 2/4 patients, FC detected a CD20.sup.30 population accounting for 33% (M025) and 16.8% (M027) of the myeloma cells. (
[0220] In contrast, dSTORM revealed the existence of a CD20.sup.+ population in 3/4 patients accounting for 17.4-76.7% of the myeloma cells revealing the existence of a CD20.sup.dim population in all patients as the size of the CD20-expressing population was found to be much higher than estimated by flow cytometry (76.7% vs. 33%, M025 and 64.7% vs. 16.8%, M027; Table 2). Calculation of the antigen density on the surface resulted in median values of 650-1,911 CD20 molecules per cell. The inventors found that, as for CD19, 4 hour cocultivation with CD2OCART led to eradication of CD20-expressing cells in 2/2 patients (
TABLE-US-00002 TABLE S1 Patient characteristics. Characteristic all patients (n = 14) Median age (range) - yr 62.3 (52-81) Male - no. (%) 7 (50) Salmon & Durie* stage at diagnosis - no. (%) I 3 (21) II 1 (7) IIIA 8 (57) IIIB 2 (14) Myeloma subtype - no. (%) IgG 8 (57) IgA 1 (7) IgD 1 (7) LC 4 (29) Cytogenetic profile** - no. (%) High-risk 5 (36) Standard risk 9 (64) Time from diagnosis (range) - months 16 (0-69) Remission state*** - no. (%) Primary diagnosis 4 (29) VGPR 2 (14) Progressive disease 8 (57) Bone marrow infiltration - % (range) 25 (10-99) Previous therapy regimens Median no. (range) 1 (0-3) Previous therapies - no. (%) Hematopoietic stem-cell 9 (64) transplantation (autologous) Lenalidomide 6 (43) Proteasome inhibitor 10 (71) *A clinical staging system for MM based on the correlation of the measured myeloma cell mass with presenting clinical features, response to treatment, and survival..sup.28 **Cytogenetic analysis: a high-risk cytogenetic profile refers to adverse FISH including IgH translocations (t(4; 14) or t(14; 16) or t(14; 20)), 17p13 del and/or 1q21 gain..sup.29 ***International Myeloma Working Group consensus criteria for response and minimal residual disease assessment in multiple myeloma..sup.30
TABLE-US-00003 TABLE S2 Antibody titration on NALM-6 cells Antibody Molecules per cell conc. (g/ml) Anti-CD19 Isotype 10 1880 220 72 20 5 1860 180 85 25 2.5 1780 210 50 30 0.5 710 110 44 28 0.05 182 29 7.1 6.4 5 10.sup.3 67 10 1.3 1.4 5 10.sup.4 12.0 2.9 0.8 0.6 5 10.sup.5 3.1 1.3 0 0 0 0 0 0 0
TABLE-US-00004 TABLE 1 Summary of data obtained by dSTORM and flow cytometry for CD19 Flow Cytometry dSTORM IFN % CD19.sup.+ Elimination production Patients (% CD19.sup.+ % CD19 molecules/cell* by by # Identifier % isotype.sup.+) CD19.sup.+ CD19.sup.+ (range) CD19.sup.low CD19.sup.high CD19CART CD19CART 1 M007 0 0 0 0 0 0 0 (0.1%-0.1%) 2 M008 0 69.2% 110 110 0 + 4.9% (1.2%-0.9%) (22-340) 3 M011 (s) 0 0 0 0 0 0 (0.8%-0.6%) 4 M012 29% 67.6% 1,200 750 2,240 + 8.9% (30.4%-1.6%) (250-3,700) (30%) 5 M013 0.9% 75.1% 93 93 0 + 0.3% (1.2%-0.3%) (19-290) 6 M014 1.7% 0 0 0 0 0 0 (4.0%-2.3%) 7 M015 (s) 0 0 0 0 0 0 (1.1%-1.3%) 8 M016 3.7% 32.1% 530 470 1,850 + 1.2% (4.9%-1.2%) (110-1,650) (4%) 9 M017 0 66.0% 64 64 0 + 0.8% (0.7%-1.4%) (13-200) 10 M018 0 60.4% 270 270 0 + 0 (0.4%-1.7%) (55-830) 11 M019 0 80.3% 140 140 0 + 0.4% (1.9%-2.3%) (28-420) 12 M020 2.4% 46.0% 950 680 2,090 + ndt (5.7%-2.3%) (200-3,000) (19%) 13 M021 1.3% 30.2% 630 530 1,900 + 0 (3.1%-1.8%) (130-2,000) (7%) 14 M022 0.8% 10.3% 1,600 830 2,500 + 0 (1.5%-0.7%) (330-5,000) (47%) (s): single events ndt: cytokine production was not assessed for patient M020 *Mean values are indicated in bold. In brackets: Calculated data ranging from small (median 2) to high (median + 2) values (95.45% of all values lie within this range). CD19.sup.+ cells with more than 1,350 molecules per cell were classified as CD19.sup.high and were otherwise classified as CD19.sup.low (simulated data). % CD19.sup.+: the percentage of the cells in the CD19.sup.+ gate for the isotype control was subtracted from the percentage of cells in the CD19.sup.+ gate for the respective CD19 staining.
TABLE-US-00005 TABLE 2 Summary of data obtained by dSTORM and flow cytometry for CD20 Flow Cytometry % CD20.sup.+ dSTORM Patients (% anti-CD20- CD20 molecules/ Elimination by # Identifier % isotype) % CD20.sup.+ cell* (range) CD20CART 15 M025 33 76.7 650 (35.7-2.7) (55-7, 724) 16 M026 0 17.4 1,911 ndt (0-5.7) (160-22, 719) 17 M027 16.8 64.7 1,770 + (17.9-1.1) (149-21, 045) 18 M029 0 0 0 0 (0.42-0.44) ndt: cytoxicity was not assessed for patient M026 *Mean values are indicated in bold. In brackets: Calculated data ranging from small (median 2) to high (median + 2) values (95.45% of all values lie within this range). % CD20.sup.+: the percentage of the cells in the CD20.sup.+ gate for the isotype control was subtracted from the percentage of cells in the CD20.sup.+ gate for the respective CD20 staining.
INDUSTRIAL APPLICABILITY
[0221] The immune cells for the uses according to the invention, as well as materials used for the methods of the invention, may be industrially manufactured and sold as products for the claimed methods and uses (e.g. for treating a cancer as defined herein), in accordance with known standards for the manufacture of pharmaceutical and diagnostic products. Accordingly, the present invention is industrially applicable.
REFERENCES
[0222] 1. Kumar S K, Dispenzieri A, Lacy M Q, et al. Continued improvement in survival in multiple myeloma: changes in early mortality and outcomes in older patients. Leukemia 2014;28:1122-8.
[0223] 2. Garfall A L, Maus M V, Hwang W T, et al. Chimeric Antigen Receptor T Cells against CD19 for Multiple Myeloma. The New England journal of medicine 2015;373:1040-7.
[0224] 3. Turtle C J , Hanafi L A, Berger C, et al. Immunotherapy of non-Hodgkin's lymphoma with a defined ratio of CD8+ and CD4+ CD19-specific chimeric antigen receptor-modified T cells. Science translational medicine 2016;8:355ra116.
[0225] 4. Turtle C I, Hanafi L A, Berger C, et al. CD19 CAR-T cells of defined CD4+:CD8+ composition in adult B cell ALL patients. J Clin Invest 2016;126:2123-38.
[0226] 5. Bach P B, Giralt S A, Saltz L B. FDA Approval of Tisagenlecleucel: Promise and Complexities of a $475000 Cancer Drug. JAMA: the journal of the American Medical Association 2017.
[0227] 6. Roberts L I, Better M, Bot A, Roberts M R, Ribas A. Axicabtagene ciloleucel, a first-in-class CAR T cell therapy for aggressive NHL. Leukemia & lymphoma 2017:1-12.
[0228] 7. Uckun F M, Qazi S, Dibirdik I, Myers D E. Rational design of an immunoconjugate for selective knock-down of leukemia-specific E2A-PBX1 fusion gene expression in human Pre-B leukemia. Integr Biol (Camb) 2013;5:122-32.
[0229] 8. Tembhare P R, Yuan C M, Venzon D, et al. Flow cytometric differentiation of abnormal and normal plasma cells in the bone marrow in patients with multiple myeloma and its precursor diseases. Leukemia research 2014;38:371-6.
[0230] 9. Ehmann N, van de Linde 5, Alon A, et al. Quantitative super-resolution imaging of Bruchpilot distinguishes active zone states. Nat Commun 2014;5:4650.
[0231] 10. Letschert S, Ghler A, Franke C, et al. Super-resolution imaging of plasma membrane glycans. Angewandte Chemie 2014;53:10921-4.
[0232] 11. Heilemann M, van de Linde S, Schttpelz M, et al. Subdiffraction-resolution fluorescence imaging with conventional fluorescent probes. Angewandte Chemie 2008;47:6172-6.
[0233] 12. van de Linde S, Lschberger A, Klein T, et al. Direct stochastic optical reconstruction microscopy with standard fluorescent probes. Nature protocols 2011;6:991-1009.
[0234] 13. Hajek R, Okubote S A, Svachova H. Myeloma stem cell concepts, heterogeneity and plasticity of multiple myeloma. British journal of haematology 2013;163:551-64.
[0235] 14. Paiva B, Puig N, Cedena M T, et al. Differentiation stage of myeloma plasma cells: biological and clinical significance. Leukemia 2016.
[0236] 15. Zola H. High-sensitivity immunofluorescence/flaw cytometry: detection of cytokine receptors and other low-abundance membrane molecules2004.
[0237] 16. Truneh A, Machy P. Detection of very low receptor numbers on cells by flow cytometry using a sensitive staining method. Cytometry 1987;8:562-7.
[0238] 17. Stone J D, Aggen D H, Schietinger A, Schreiber H, Kranz D M. A sensitivity scale for targeting T cells with chimeric antigen receptors (CARs) and bispecific T-cell Engagers (BiTEs). Oncoimmunology 2012;1:863-73.
[0239] 18. Watanabe K, Terakura S, Martens A C, et al. Target antigen density governs the efficacy of anti-CD20-CD28-CD3 zeta chimeric antigen receptor-modified effector CD8+ T cells. Journal of immunology 2015;194:911-20.
[0240] 19. Ali S A, Shi V, Maric I, et al. T cells expressing an anti-B-cell maturation antigen chimeric antigen receptor cause remissions of multiple myeloma. Blood 2016;128:1688-700.
[0241] 20. Ruella M, Maus M V. Catch me if you can: Leukemia Escape after CD19-Directed T Cell Immunotherapies. Comput Struct Biotechnol J 2016;14:357-62.
[0242] 21. Sommermeyer D, Hudecek M, Kosasih P L, et al. Chimeric antigen receptor-modified T cells derived from defined CD8(+) and CD4(+) subsets confer superior antitumor reactivity in vivo. Leukemia 2016;30:492-500.
[0243] 22. Wolter S, Lschberger A, Holm T, et al. rapidSTORM: accurate, fast open-source software for localization microscopy. Nat Methods 2012;9:1040-1.
[0244] 23. Wang X, Chang W C, Wong C W, et al. A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and ablation of engineered cells. Blood 2011;118:1255-63.
[0245] 24. Terakura 5, Yamamoto T N, Gardner R A, Turtle C J, Jensen M C, Riddell S R. Generation of CD19-chimeric antigen receptor modified CD8+ T cells derived from virus-specific central memory T cells. Blood 2012;119:72-82.
[0246] 25. Hudecek M, Lupo-Stanghellini M T, Kosasih P L, et al. Receptor affinity and extracellular domain modifications affect tumor recognition by ROR1-specific chimeric antigen receptor T cells. Clinical cancer research : an official journal of the American Association for Cancer Research 2013;19:3153-64.
[0247] 26. Hudecek M, Sommermeyer D, Kosasih P L, et al. The nonsignaling extracellular spacer domain of chimeric antigen receptors is decisive for in vivo antitumor activity. Cancer immunology research 2015;3:125-35.
[0248] 27. Huang B, Li I, Liu J, Gu J. CD20-positive multiple myeloma: can conventional chemotherapy still be used to achieve ideal outcome for these patients? Leukemia & lymphoma 2016;57:335-40.
[0249] 28. Durie B G, Salmon S E. A clinical staging system for multiple myeloma. Correlation of measured myeloma cell mass with presenting clinical features, response to treatment, and survival. Cancer 1975;36:842-54.
[0250] 29. Chng W J, Dispenzieri A, Chim C S, et al. IMWG consensus on risk stratification in multiple myeloma. Leukemia 2014;28:269-77.
[0251] 30. Kumar S, Paiva B, Anderson K C, et al. International Myeloma Working Group consensus criteria for response and minimal residual disease assessment in multiple myeloma. Lancet Oncol 2016;17:e328-e46.