MEANS AND METHODS FOR PRODUCING PHOSPHATE CONTAINING CAPSULAR POLYSACCHARIDES
20200208134 ยท 2020-07-02
Inventors
- Timm Fiebig (Hannover, DE)
- Christa Litschko (Hannover, DE)
- Rita Gerardy-Schahn (Hiddenhausen, DE)
- Andrea Bethe (Hildesheim, DE)
- Monika Berger (Sehnde, DE)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a host cell, which comprises under the control of a heterologous promoter a polynucleotide comprising a nucleotide sequence encoding a polypeptide capable of synthesizing a polysaccharide consisting of a dimeric repeating unit as well as to a vaccine composition comprising such host cell. Furthermore, either such host cell or a polypeptide expressed by such host cell is used for the production of a polysaccharide consisting of a dimeric repeating unit which may be used as a glycoconjugate vaccine.
Claims
1. A host cell, which comprises under the control of a heterologous promoter a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is selected from the group consisting of: a) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-B domain having the amino acid sequences shown in SEQ ID NO. 1 and 17, SEQ ID NO. 2 and 18, SEQ ID NO. 3 and 19, SEQ ID NO. 4 and 20, SEQ ID NO. 5 and 21, SEQ ID NO. 6 and 22, SEQ ID NO. 7 and 23, SEQ ID NO. 8 and 24, SEQ ID NO. 9 and 25, SEQ ID NO. 10 and 26, SEQ ID NO. 11 and 27, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; b) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-A domain having the amino acid sequences shown in SEQ ID NO. 12 and 28, SEQ ID NO. 13 and 29, SEQ ID NO. 14 and 30, SEQ ID NO. 15 and 31, SEQ ID NO. 16 and 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; c) a nucleotide sequence encoding a pair of fragments of the polypeptide as defined in (a) and in (b), wherein each fragment is at least 15 amino acid residues in length and wherein the pair of fragments synthesizes a polysaccharide consisting of a dimeric repeating unit; d) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 40% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; e) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 30% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit, and wherein the nucleotide sequence of (a) to (e) encodes a polypeptide having a conserved tyrosine at a position corresponding to position 49 of SEQ ID NO. 3 or having a conserved aspartic acid at a position corresponding to position 49 of SEQ ID NO. 3.
2. The host cell of claim 1, wherein the host cell is a prokaryotic host cell or a eukaryotic host cell.
3. The host cell of claim 2, wherein the prokaryotic host cell is selected from the group consisting of Escherichia coli, Actinobacillus pleuropneumoniae, Bibersteinia trehalosi, Actinobacillus suis, Haemophilus influenzae, Campylobacter jejuni, Campylobacter coli, Neisseria meningitidis, Mannheimia varigena, Neisseria mucosa, Moraxella lacunata, Neisseria elongate, Klebsiella sp G5, Cronobacter universalis, Cronobacter turicensis, Aeromonas veronii, Cronobacter sakazakii, Yersinia enterocolitica, Helicobacter pullorum and Bacillus cereus.
4. The host cell of any one of the preceding claims, wherein the host cell is cultured and the polynucleotide comprising the nucleotide sequence encoding the polypeptide is expressed.
5. The host cell of any one of the preceding claims, wherein the heterologous promoter is a prokaryotic promoter.
6. The host cell of claim 5, wherein the prokaryotic promoter is a tac promoter, lacUV5 promoter, T4 promoter, T7 promoter, araBAD (P.sub.BAD) promoter, tet promoter or a T5 promoter.
7. The host cell of any one of the preceding claims, wherein the nucleotide sequence encodes a polypeptide having a conserved aspartic acid at a position corresponding to position 364 of SEQ ID NO. 3
8. The host cell of any one of the preceding claims, wherein the polypeptide is a polymerase, preferably a capsule polymerase (CPs), more preferably a glycosyltransferase and a hexose-phosphate transferase or glycosyltransferase and alditol-phosphate transferase.
9. The host cell of any one of the preceding claims, wherein the polypeptide is fused to a N- and/or C-terminal tag.
10. The host cell of claim 9, wherein the N- and/or C-terminal tag is selected from the group consisting of a His tag, MBP tag, GFP tag, FLAG tag, Strep tag, Strepll tag, NusA tag, GST tag, thioredoxin and intein.
11. The host cell of any one of the preceding claims, wherein the polysaccharide comprises a repeating unit of two different monosaccharides or one monosaccharide and one alditol.
12. The host cell of claim 11, wherein the repeating unit comprises one or more glycosidic and one or more phosphodiester linkage(s).
13. The host cell of claim 11, wherein the two different monosaccharides of the repeating unit are connected by a 3-glycosidic linkage or wherein the monosaccharide and the alditol of the repeating unit are connected by an -glycosidic linkage.
14. The host cell of any one of the preceding claims, wherein the polysaccharide is a phosphate containing polysaccharide.
15. A method of producing a host cell of any one of the preceding claims, the method comprising: a) cloning a nucleotide sequence encoding a polypeptide expressed by the host cell of any one of claims 1-14 into a vector; b) transforming cells with said vector of (a) and growing the cells in medium.
16. A method of expressing a polypeptide in a host cell comprising: a) culturing the host cell of any one of claims 1 to 14; b) expressing the polypeptide in the host cell.
17. A vaccine composition comprising the host cell of any one of claims 1-14.
18. A composition comprising a polypeptide expressed by the host cell of any one of claims 1-14.
19. The composition of claim 18 further comprising one or more polypeptide(s) having an amino acid sequence selected from the group consisting of: a) SEQ ID NO. 33 and 41 b) SEQ ID NO. 34 and 42 c) SEQ ID NO. 35 and 43 d) SEQ ID NO. 36 and 44 e) SEQ ID NO. 37 and 45 f) SEQ ID NO. 38 and 46 g) SEQ ID NO. 39 and 47 h) SEQ ID NO. 40 and 48, or fragments thereof.
20. A method for synthesizing a polysaccharide consisting of a dimeric repeating unit comprising bringing the composition of claim 19 into contact with two donor substrates.
21. The method of claim 20, wherein the two donor substrates are nucleotide monosaccharides or wherein the two donor substrates are a nucleotide monosaccharide and a nucleotide alditol.
22. A polysaccharide consisting of a dimeric repeating unit obtainable by the method of any one of claims 20 to 21 for use as a glycoconjugate vaccine.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0019]
[0020] A) List of the characterized capsule polymerases that generate CPS backbones consisting of hexoses (red, violet) and hexose-phosphate or glycerol-phosphate units (green). Some capsules are additionally modified by O-acetylation or glycosylation (white boxes). B) Scheme of the serogroup-specific regions of the capsule gene clusters that are associated with the capsule synthesis. Genes encoding capsule polymerases are colored in red. Schematic domain organization of C) GT-A/TagF-like and D) TagF-like/GT-B-folded CPs. The coloring of each domain refers to the coloring of the moiety it putatively transfers during CPS assembly (see A). E) Excerpt of multiple sequence alignments highlighting conserved positions from each domain. F) Red: Homology model of the GT-A domain of Cps1B modeled on K4CP showing the aspartates of the DD motif. Green: Homology model of the TagF-like domain of Cps7D modelled on TagF of S. epidermidis depicting the two catalytically important histidines. Violet: Homology model of the GT-B domain modeled on TarM of S. aureus showing the conserved lysine and arginine positions. All protein models were generated by PHYRE.sup.2.
[0021]
[0022] A) CslB.sub.38-877-His.sub.6 of NmL B) MBP-Cps12B-His.sub.6 of App12 C) MBP-Cps1B-His.sub.6 of App1 D) Ccs2-His.sub.6 of Hic E) MBP-Cps3D-His.sub.6 of App3 and F) MBP-Cps7D-His.sub.6 of App7. The HPLC-AEC assay allows the separation and detection of nucleotide activated donor substrates and released nucleotide products in the 280 nm channel (left panels). UV-active polymers carrying GlcNAc moieties are detected in the 214 nm channel (see A, B, C, D). UV-inactive polymers are detected using an alcian blue/silver stained PAGE (see E, F).
[0023]
[0024] A) Elution profiles of preparative size exclusion chromatography experiments of full-length and truncated Cps1B constructs. M.sub.W represents the theoretical molecular weight of the proteins in a monomeric state. M.sub.obs represents the observed molecular weight obtained from the elution profile in preparative SEC based on the calibration of the column with standard proteins. The oligomerization states were determined by subdividing M.sub.W by M.sub.obs. B) Chemical composition of the unmodified repeating unit of the App1 capsule polysaccharide characterized by Altman et al. (1986) (24). C) Identical .sup.1H-NMR spectra of both polysaccharides synthesized by full-length (MBP-Cps1B-His.sub.6) and truncated Cps1B (Cps1B.sub.32-858-HiS.sub.6) demonstrating that the absence of the TPR domain in Cps1B32-858-His does not alter the chemical composition of the synthesized polysaccharide structure.
[0025]
[0026] A) Schematic representation of Cps1B.sub.32_858-His6 showing conserved positions in each domain and the single domain mutants. B) Cps1B reaction scheme. C) HPLC-AEC analyses (left panel: 280 nm and right panel: 214 nm) show that all single domain mutants (2-4) are unable to produce polymer. Small amounts of UMP detected in the reactions are found in the controls as well, indicating that they result from spontaneous, enzyme-independent hydrolysis. However, combining two single domain mutants in trans restores donor sugar uptake and polymer synthesis, as documented by HPLC-AEC and D) alcian blue/silver stained PAGE.
[0027]
[0028] A) Schematic representation of Csp7D demonstrating conserved positions in each domain and the single domain mutants. B) Cps7D reaction scheme. C) HPLC-AEC analysis (left panel: 280 nm and right panel: 214 nm) show that all single domain mutants (2-5) are unable to produce polymer. Small amounts of CMP and UMP detected in the reactions are found in the controls as well, indicating that they result from spontaneous, enzyme-independent hydrolysis. Combining two single domain mutants in trans restores donor sugar uptake and polymer synthesis, depicted by HPLC-AEC and D) alcian blue/silver stained PAGE.
[0029]
[0030]
[0031] The given capsule structures assemble the typical CPS structure synthesized by TagF-like capsule polymerases consisting of oligosaccharides connected through phosphodiester bonds or monosaccharides connected through glycerol-phosphate units. Identical structures are highlighted with colored boxes. The occurrence of the typical CPS structures and genes that encode putative TagF-like capsule polymerases demonstrates the conservation and abundance of the TagF-like polymerases among a variety of group II capsule expressing bacteria.
[0032]
[0033]
[0034] Separated samples contain the protein fractions that were obtained after the purification of each construct. 1.5 to 3 g protein were loaded per lane. Expression cultures were transformed with the constructs indicated on top of each lane. Only full-length proteins of MBP-Cps3D-His6 (177 kDa) and MBP-Cps7D-His6 (192 kDa) could be enriched additionally to degradation products. However, for the constructs MBP-Cps1B-His6 (190 kDa), MBP-Cps12B-His6 (146 kDa) and Ccs2-His6 (144 kDa) only soluble degradation products (indicated by arrows) could be purified. This phenomenon has also been shown for CslB (10). The full-length proteins are generally insoluble. The degradation constructs seem to lack the MBP-tag and an N-terminal part of the protein sequence. The main protein band resulting from the MBP-Cps1BHis6 purification was sequenced N-terminally and could be identified as a N31 truncation (MBP-Cps1B32-1246-His6) with a theoretical molar masse of 144 kDa. The N-terminal and C-terminal truncation construct that lacking the TPR domain (MBP-Cps1B32-858-His6) has a theoretical molar mass of 99 kDa.
[0035]
[0036] Database references for all TagF-like polymerase sequences are indicated in the figure legend of
[0037]
[0038] A) Conserved histidine (H) at a position corresponding to position 122 of SEQ ID NO. 3. B) Conserved histidine (H) at a position corresponding to position 251 of SEQ ID NO. 3. Database references for all TagF-like polymerase sequences are indicated in the figure legend of
[0039]
[0040] Conserved arginine (R) at a position corresponding to position 234 of SEQ ID NO. 23 and a conserved lysine (K) at a position corresponding to position 239 of SEQ ID NO. 23. Database references for all TagF-like polymerase sequences are indicated in the figure legend of
[0041]
[0042] A) Polymerases adopting GT-A/TagF-like architecture depend on magnesium chloride to catalyze the conversion of their nucleotide activated substrates into the polymer. This finding corroborates the PHRYRE2 prediction since GT-A folded proteins are known to require a divalent cation for activity. B) Consistent with the fact that there is no evidence of a bound metal ion associated with catalysis in GT-B folded enzymes, the polymerases adopting the TagF-like/GT-B architecture also work in the presence of the chelate reagent EDTA.
[0043]
[0044] Conserved tyrosine (Y) at a position corresponding to position 49 in SEQ ID NO. 3 in SEQ ID NO. 1 (CshC), SEQ ID NO. 2 (Bt189), SEQ ID NO. 4 (Bt192), SEQ ID NO. 5 (Cps3D), SEQ ID NO. 6 (Cps9D), SEQ ID NO. 7 (Cps11D), SEQ ID NO. 9 (CszC), SEQ ID NO. 10 (Cps7D), SEQ ID NO. 11 (Cps2D), SEQ ID NO. 12 (Fcs2), SEQ ID NO. 13 (Cps1B), SEQ ID NO. 14 (BtY31), SEQ ID NO. 15 (Ccs2), SEQ ID NO. 16 (Cps4B), or conserved aspartic acid (D) at a position corresponding to position 49 of SEQ ID NO. 3 for SEQ ID NO. 8 (c3694).
[0045]
[0046] A) Amino acid stretch in TagF-like domain from positions 231 to 300 in SEQ ID NO. 35 (Cps6D) and from positions 297 to 366 in SEQ ID NO. 36 (Cps8D). (B) Amino acid stretch in TagF-like domain from positions 301 to 334 in SEQ ID NO. 35 (Cps6D) and from positions 367 to 400 in SEQ ID NO. 36 (Cps8D).
[0047]
[0048] Conserved aspartic acid (D) at a position corresponding to position 364 of SEQ ID NO. 3 in SEQ ID NO. 1 (CshC), SEQ ID NO. 2 (Bt189), SEQ ID NO. 4 (Bt192), SEQ ID NO. 5 (Cps3D), SEQ ID NO. 6 (Cps9D), SEQ ID NO. 7 (Cps11D), SEQ ID NO. 8 (c3694). SEQ ID NO. 9 (CszC), SEQ ID NO. 10 (Cps7D), SEQ ID NO. 11 (Cps2D), SEQ ID No. 12 (Fcs2), SEQ ID NO. 13 (Cps1B), SEQ ID NO. 14 (BtY31), SEQ ID NO. 15 (Ccs2) and SEQ ID NO. 16 (Cps4B).
[0049]
[0050] A) Conserved asparagine (N) and leucine (L) at positions corresponding to positions 20 and 21 of SEQ ID NO. 23 in SEQ ID NO. 17 (CshC), SEQ ID NO. 18 (Bt189), SEQ ID NO. 19 (Bt188), SEQ ID NO. 20 (Bt192), SEQ ID NO. 21 (Cps3D), SEQ ID NO. 22 (Cps9D), SEQ ID NO. 24 (c3694), SEQ ID NO. 25 (CszC), SEQ ID NO. 26 (Cps7D), SEQ ID NO. 27 (Cps2D). B) Conserved valine (V) at a position corresponding to position 60 of SEQ ID NO. 23 in SEQ ID NO. 17 (CshC), SEQ ID NO. 18 (Bt189), SEQ ID NO. 19 (Bt188), SEQ ID NO. 20 (Bt192), SEQ ID NO. 21 (Cps3D), SEQ ID NO. 22 (Cps9D), SEQ ID NO. 24 (c3694), SEQ ID NO. 25 (CszC), SEQ ID NO. 26 (Cps7D), SEQ ID NO. 27 (Cps2D). C) Conserved serine (S) at a position corresponding to position 88 of SEQ ID NO. 23 in SEQ ID NO. 17 (CshC), SEQ ID NO. 18 (Bt189), SEQ ID NO. 19 (Bt188), SEQ ID NO. 20 (Bt192), SEQ ID NO. 21 (Cps3D), SEQ ID NO. 22 (Cps9D), SEQ ID NO. 24 (c3694), SEQ ID NO. 25 (CszC), SEQ ID NO. 26 (Cps7D), SEQ ID NO. 27 (Cps2D).
[0051]
[0052] A) Conserved isoleucine (I) at a position corresponding to position 38 of SEQ ID NO. 32 in SEQ ID NO. 28 (Fcs2), SEQ ID NO. 29 (Cps1B), SEQ ID NO. 30 (BtY31), SEQ ID NO. 31 (Ccs2). B) Conserved arginine (R) at a position corresponding to position 156 of SEQ ID NO. 32 in SEQ ID NO. 28 (Fcs2), SEQ ID NO. 29 (Cps1B), SEQ ID NO. 30 (BtY31), SEQ ID NO. 31 (Ccs2). C) Conserved phenylalanine (F) at a position corresponding to position 181 of SEQ ID NO. 32 in SEQ ID NO. 28 (Fcs2), SEQ ID NO. 29 (Cps1B), SEQ ID NO. 30 (BtY31), SEQ ID NO. 31 (Ccs2).
[0053]
[0054] Sequence identity of at least 18% choosing SEQ ID NO. 3 (TagF domain of Bt188) as the reference sequence.
[0055]
[0056] Sequence identity of at least 40% choosing SEQ ID NO. 23 (GT-B domain of Cps11D) as the reference sequence.
[0057]
[0058] Sequence identity of at least 30% choosing SEQ ID NO. 32 (GT-A domain of Cps4B) as the reference sequence.
[0059]
[0060] A) Coomassie-stained SDS-polyacrylamide gel showing the fractions collected during the purification of Bt-188-His6 by affinity chromatography (via its C-terminal His.sub.6-tag) and size exclusion chromatography (SEC). The pooled fraction contains the full-length construct (134.1 kDa) together with two smaller bands most likely resulting from N-terminal degradation. B) HPLC-AEC analysis of the Cps7B (GCT) and Bt-188 reaction. C) The polymer produced in the upscaled synthesis (see also B) being purified by AEC using a MonoQ column and a combination of linear NaCl gradients. D) .sup.1H NMR analysis of the polymer produced in the upscaled synthesis after purification. The integrals (enclosed in square brackets) of isolated proton signals from the Gal and glycerol (Gro) moieties are consistent with a dimeric repeating unit. E) Corresponding .sup.1H, .sup.13C HSQC NMR analysis demonstrating a dimeric repeating unit.
[0061]
[0062] A) Coomassie-stained SDS-polyacrylamide gel showing the fractions collected during the purification of MBP-Cps11D-His6 by affinity chromatography (via its C-terminal His.sub.6-tag) and size exclusion chromatography (SEC). The pooled fractions contain the full-length construct (176.4 kDa) together with one smaller band most likely resulting from N-terminal degradation. B) HPLC-AEC analysis of the Cps7B (GCT) and Cps11D reaction. C) The polymer produced in the upscaled synthesis (see also B) was purified by AEC using a MonoQ column and a combination of linear NaCl gradients. D) .sup.1H NMR analysis of the polymer produced in the upscaled synthesis after purification. The integrals (enclosed in square brackets) of isolated proton signals from the Gal and glycerol (Gro) moieties are consistent with a dimeric repeating unit. E) Corresponding .sup.1H, .sup.13C HSQC NMR analysis demonstrating a dimeric repeating unit.
[0063]
[0064] A) Coomassie-stained SDS-polyacrylamide gel showing the fractions collected during the purification of MBP-Cps4B-His6 by affinity chromatography (via its C-terminal His.sub.6-tag) and size exclusion chromatography (SEC). The pooled fractions (pool) contain the full-length construct (145.7 kDa) and one additional prominent band most likely resulting from N-terminal degradation. B) HPLC-AEC analysis of the Cps4B reaction. C) The polymer produced in the upscaled synthesis (see also B) was purified by AEC using a MonoQ column and a combination of linear NaCl gradients (dotted line). The material eluting from the column is consisted with long, negatively charged polymer. D) .sup.1H NMR analysis of the polymer produced by Cps4B after purification. The integrals (enclosed in square brackets) of isolated proton signals inform the GalNAc and Glc moieties are consistent with a dimeric repeating unit. E) Corresponding .sup.1H, .sup.13C HSQC NMR analysis demonstrating a dimeric repeating unit.
[0065]
[0066] To allow the synthesis of enantiopure polymer, we used the CTP:glycerol-3-phosphate cytidylyltransferase (GCT) from Actinobacillus pleuropneumoniae serotype 7 strain AP76 (encoded in gene cps7B) for the production of enantiopure CDP-glycerol from CTP and commercially available enantiopure sn-glycerol-3-phosphate.
[0067] A) Cps7B-His6 (subsequently referred to as Cps7B or GCT) was cloned, expressed in E. coli and purified using affinity and size exclusion chromatography. B) An HPLC-AEC assay was developed to confirm the CTP:glycerol-3-phosphate cytidylyltransferase activity of Cps7B. As expected, Cps7B converts its substrates CTP and sn-glycerol-3-phosphate (not UV-active at 280 nm) into enantiopure CDP-glycerol (brown chromatogram labeled GOT (Cps7B)). Small amounts of CDP in the reaction mixture can also be detected in the CTP control and are consequently not a side product of the GCT reaction. In the combined one-pot synthesis (green chromatogram labeled GCT (Cps7B)+polymerase (Cps7D)), Cps7B consumes CTP to generate CDP-glycerol, which, together with UDP-Gal, is in turn used up by the polymerase Cps7D to synthesize polymer. The nucleotide products of this reaction are UDP (resulting from the galactose transfer) and CMP (resulting from the sn-glycerol-3-phosphate transfer). C) Corresponding Alcian blue/silver stained PAGE used to visualize the polymer generated in the one-pot reaction.
DETAILED DESCRIPTION OF THE INVENTION
[0068] The solution of the present invention is described in the following, exemplified in the appended examples, illustrated in the figures and reflected in the claims.
[0069] The present invention provides a host cell, which comprises under the control of a heterologous promoter a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is selected from the group consisting of: [0070] a) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-B domain having the amino acid sequences shown in SEQ ID NO. 1 and 17, SEQ ID NO. 2 and 18, SEQ ID NO. 3 and 19, SEQ ID NO. 4 and 20, SEQ ID NO. 5 and 21, SEQ ID NO. 6 and 22, SEQ ID NO. 7 and 23, SEQ ID NO. 8 and 24, SEQ ID NO. 9 and 25, SEQ ID NO. 10 and 26, SEQ ID NO. 11 and 27, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0071] b) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-A domain having the amino acid sequences shown in SEQ ID NO. 12 and 28, SEQ ID NO. 13 and 29, SEQ ID NO. 14 and 30, SEQ ID NO. 15 and 31, SEQ ID NO. 16 and 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0072] c) a nucleotide sequence encoding a pair of fragments of the polypeptide as defined in (a) and in (b), wherein each fragment is at least 15 amino acid residues in length and wherein the pair of fragments synthesizes a polysaccharide consisting of a dimeric repeating unit; [0073] d) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 40% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0074] e) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 30% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit,
and wherein the nucleotide sequence of (a) to (e) encodes a polypeptide having a conserved tyrosine at a position corresponding to position 49 of SEQ ID NO. 3 or having a conserved aspartic acid at a position corresponding to position 49 of SEQ ID NO. 3.
[0075] The term host cell refers to a cell in which DNA (or RNA) e.g. a polynucleotide is introduced, which is not per se DNA (or RNA) from the host cell itself. Further, the host cell may also refer to a cell in which an expression vector may be propagated and which supports the replication or expression of the expression vector.
[0076] The term heterologous means derived from a cell or organism with a different genomic background. Thus, a heterologous nucleic acid or protein is one that originates from a foreign source (or species) or, if from the same source, is modified from its original form.
[0077] The term promoter refers to a region of DNA upstream from the translational start codon and which is involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. Promoters contain specific DNA sequences called response elements that make sure a secure initial binding site for RNA polymerase as well as for proteins called transcription factors recruiting RNA polymerase is provided.
[0078] A promoter may be located on an expression vector adjacent a restriction site such that a heterologous nucleotide sequence may be located downstream of the promoter and in correct reading frame in relation to a translational start codon. The start codon may be provided on the vector (e.g. immediately 3 to the promoter) or it may be inserted as a 5 end of the heterologous nucleotide sequence. A linker may be provided between the promoter and the start codon, if desired. 3-Regulatory regions may similarly be provided on the vector or inserted with the heterologous nucleotide sequence.
[0079] In this context, a heterologous promoter sequence is from a source different from that the encoding sequence was derived from, or, if from the same source, is modified from its original form. Modification may occur, e.g., by treating the DNA with a restriction enzyme to generate a promoter element that is capable of conferring tissue-specific expression on the expression cassette which includes the promoter.
[0080] Thus, the term under the control of a heterologous promoter means that the expression of the polynucleotide comprising a nucleotide sequence encoding a polypeptide is monitored/supervised/controlled by a heterologous promoter in a host cell of the present invention.
[0081] A polynucleotide refers to nucleotides, either ribonucleotides or deoxyribonucleotides or a combination of both, in a polymeric unbranched form of any length. Preferably, a polynucleotide refers to deoxyribonucleotides in a polymeric unbranched form of any length. Here, nucleotides consist of a pentose sugar (deoxyribose), a nitrogenous base (adenine, guanine, cytosine or thymine) and a phosphate group. The terms polynucleotide(s), nucleic acid sequence(s) are used interchangeably herein.
[0082] By nucleotide sequence of a polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides (succession of letters that indicate the order of nucleotides within a DNA molecule) and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U). By convention, sequences are usually presented from the 5 end to the 3 end. For DNA, the sense strand is used.
[0083] The term polypeptide, when used herein, means a peptide, a protein or a polypeptide, which are used interchangeable and which encompasses amino acid chains of a given length, wherein the amino acid residues are linked by covalent peptide bonds. However, peptidomimetics of such proteins/polypeptides, wherein amino acid(s) and/or peptide bond(s) have been replaced by functional analogs are also encompassed by the invention as well as other than the 20 gene-encoded amino acids, such as selenocysteine. Peptides, oligopeptides and proteins may be termed polypeptides. As mentioned, the terms polypeptide and protein are often used interchangeably herein. The term polypeptide also refers to, and does not exclude, modifications of the polypeptide. Modifications include glycosylation, acetylation, acylation, phosphorylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formulation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination (54).
[0084] The polypeptide of the present invention shares the common feature of being modeled onto the crystal structure of the teichoic acid polymerase TagF. While the TagF-like domain (SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 and 16) may generate the phosphodiester linkage in the CPS, a GT-A folded domain (SEQ ID NOs. 28, 29, 30, 31 and 32) located N-terminally or a GT-B folded domain (SEQ ID NOs. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 27) located C-terminally of the TagF-like domain may generate the glycosidic linkage. The GT-A folded domain of the polypeptide of the present invention may be located N-terminally or C-terminally of the TagF-like domain, preferably N-terminally of the TagF-like domain. The GT-B folded domain of the polypeptide of the present invention may be located N-terminally or C-terminally of the TagF-like domain, preferably C-terminally of the TagF-like domain.
[0085] In the following Table 1 an overview of the polypeptides of the present invention with both of their domains, either a TagF-like domain and a GT-B domain or a TagF-like domain and a GT-A domain is depicted.
TABLE-US-00001 TABLE 1 Overview of the polypeptides of the present invention and their corresponding SEQ ID NOs., which encode a TagF-like domain, a GT-B or a GT-A domain. SEQ ID NO. Domain Polymerase 1 TagF CshC 2 TagF Bt189 3 TagF Bt188 4 TagF Bt192 5 TagF Cps3D 6 TagF Cps9D 7 TagF Cps11D 8 TagF C3694 9 TagF CszC 10 TagF Cps7D 11 TagF Cps2D 12 TagF Fcs2 13 TagF Cps1B 14 TagF BtY31 15 TagF Ccs2 16 TagF Cps4B 17 GT-B CshC 18 GT-B Bt189 19 GT-B Bt188 20 GT-B Bt192 21 GT-B Cps3D 22 GT-B Cps9D 23 GT-B Cps11D 24 GT-B C3694 25 GT-B CszC 26 GT-B Cps7D 27 GT-B Cps2D 28 GT-A Fcs2 29 GT-A Cps1B 30 GT-A BtY31 31 GT-A Ccs2 32 GT-A Cps4B
[0086] The polynucleotide comprising a nucleotide sequence encoding the polypeptide of the present invention further comprises a nucleotide sequence encoding a linker polypeptide. Preferably, the nucleotide sequence encoding said linker polypeptide is disposed in the polynucleotide of the present invention between the nucleotide sequence encoding the TagF-like domain (e.g. SEQ ID NO. 1) and the GT-B domain (e.g. SEQ ID NO. 17) or between the nucleotide sequence encoding the TagF-like domain (e.g. SEQ ID NO. 12) and the GT-A domain (e.g. SEQ ID NO. 28) such that it results in a fusion between said TagF-like domain, linker polypeptide and GT-B or GT-A domain. Thus, the polypeptide comprising a TagF-like domain and a GT-B domain or a TagF-like domain and a GT-A domain having the amino acid sequences shown in (a) or (b) (e.g. SEQ ID NO. 1 and 17 or SEQ ID NO. 12 and 28) is being expressed in frame. In this context, a fusion refers to a co-linear linkage of two or more proteins, domains of proteins or fragments (e.g. fragments of domains) thereof via their individual peptide backbones through genetic expression of a nucleotide sequence encoding those proteins or domains. Preferably, it refers to a co-linear linkage of the TagF-like domain and the GT-B domain of a polypeptide of the present invention or the TagF-like domain and the GT-A domain of a polypeptide of the present invention via a polypeptide linker.
[0087] Said polypeptide linker is preferably a flexible linker. Preferably, it comprises plural, hydrophilic, peptide-bonded amino acids and connects the C-terminal end of the TagF-like domain and the N-terminal end of the GTB domain or the C-terminal end of the GT-A domain and the N-terminal end of the TagF-like domain. Preferably, said polypeptide linker comprises a plurality of glycine, alanine, aspartate, glutamate, proline, isoleucine and/or arginine residues. It is further preferred that said polypeptide linker comprises a plurality of consecutive copies of an amino acid sequence. Usually, the polypeptide linker comprises 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 amino acids or 1 to 50, preferably 1 to 40, 1 to 30, 1 to 20, 1 to 15 or 1 to 10 amino acids although polypeptide linkers of more than 50 amino acids may work as well.
[0088] Additionally, the present invention comprises a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a nucleotide sequence encoding a polypeptide comprising a GT-B or GT-A domain, wherein the nucleotide sequences are being separated on two different vectors used in the present invention. Preferably, the nucleotide sequence encoding the polypeptide comprising the TagF-like domain (e.g. SEQ ID NO. 1 or 12) may be inserted in one vector, whereas the nucleotide sequence encoding the polypeptide comprising the GT-B domain (e.g. SEQ ID NO. 17) or GT-A domain (e.g. SEQ ID NO. 28) may be inserted in another vector, such that it results not in a fusion between said TagF-like domain and said GT-B or said GT-A domain, instead resulting in a pair of polypeptides (two polypeptides) one comprising the TagF-like domain, the other polypeptide comprising the GT-B or GT-A domain. No matter if the polypeptide is expressed as a fusion protein or if a pair of polypeptides is expressed, the polypeptide(s) may synthesize a polysaccharide consisting of a dimeric repeating unit. Thus, a polypeptide comprising both domains (TagF-like domain and GT-B or TagF-like domain and GT-A) is able to catalyze the reaction of a polysaccharide consisting of a dimeric repeating unit in trans (a pair of polypeptides, one comprising the TagF-like domain, the other comprising the GT-B or GT-A domain) as well. Hence, the term a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-B (or GT-A domain) may also refer to a nucleotide sequence encoding a pair of polypeptides, one polypeptide comprising a TagF-like domain the other polypeptide comprising a GT-B or GT-A domain.
[0089] The term synthesize may be used interchangeably with the terms generate or produce. In some embodiments, synthesizing as used through the present invention may also refer to produce an enantiomerically pure polysaccharide consisting of a dimeric repeating unit. Commercially available racemic mixture of CDP-glycerol may be used as substrate for the TagF-like/GT-B folded CPs, leading to polymers that were not enantiopure (see e.g.
[0090] When said term to produce (an) enantiomerically pure polysaccharide(s) is used in the present invention, the substrate CDP-glycerol is enantiopure being produced from CTP and commercially available enantiopure sn-glycerol-3-phosphate by the CTP:glycerol-3-phosphate cytidylyltransferase (GCT) from Actinobacillus pleuropneumoniae serotype 7 strain AP76 (encoded in gene cps7B) or a polypeptide or enzyme with a similar function, thus consisting exclusively of sn-glycerol-3-phosphate. Non-limiting examples of entiomerically pure synthesized polysaccharide consisting of a dimeric repeating unit and being produced with the substrate CDP-glycerol may refer to the polysaccharide of said polypeptides Bt188, Cps11D and Cps7D (
[0091] The term polysaccharide refers to a polymeric carbohydrate molecule, which is composed of long chains of monosaccharides being bound together by glycosidic linkages. 3 monosaccharides built up a polysaccharide of the present invention. Preferably, 5 monosaccharides built up a polysaccharide of the present invention. More preferably, 10 monosaccharides built up a polysaccharide of the present invention.
[0092] Preferably, the polysaccharide of the present invention may be a capsule polysaccharide (CPS). Many pathogenic bacteria are surrounded by a thick layer of high-molecular weight polysaccharides referred to as capsule (4). The capsule can be up to 400 nm (1.50) thick and forms the outermost barrier of the bacterial cell. Due to the nature of the molecular building blocks (monosaccharides) capsules possess a high water binding capability and support bacterial survival by physical means (51). Moreover and of particular importance in the case of bacterial pathogenesis, capsules impair the efficiency of the hosts first line immune defense mechanisms (52). The grouping of capsular polysaccharides (CPSs) bases on molecular insight obtained by studying CPS biosynthesis in E. coli. 84 chemically distinct CPSs that have been identified in E. coli, which, based on chemical characteristics of the CPSs and based on genetic information, have been subdivided into four capsule groups (I-IV) (4).
[0093] The term a dimeric repeating unit refers to an assembly of two different building blocks, wherein building block 1 is a monosaccharide and building block 2 is a monosaccharide different from building block 1 or an alditol, whereas the monosaccharide or the alditol of building block 2 is connected to a phosphate.
[0094] In detail, Fcs2, Cps1B, BtY31, Ccs2 and Cps4B of the GT-A/TagF-like family as well as CshC, Bt189, Bt188, Bt192, Cps3D, Cps9D, Cps11D, c3694, CszC, Cps7D, Cps2D of the TagF-like/GT-B family (Tab. 1) synthesize a polysaccharide consisting of a dimeric repeating unit, whereas Cps12B and CslB as a member of the GT-A/TagF-like family synthesize a polysaccharide consisting of a trimeric repeating unit. In this context, a trimeric repeating unit refers to 3 building blocks, wherein either each building block comprises a monosaccharide, whereas building block 3 comprises a monosaccharide connected to a phosphate or wherein building block 1 and 2 comprise two monosaccharides and building block 3 comprises an alditol connected to a phosphate.
[0095] Further, a nucleotide sequence may encode a pair of fragments of a polypeptide being expressed by the host cell of the present invention, meaning that a nucleotide sequence encodes either one fragment of the TagF-like domain (e.g. SEQ ID NO. 1) of the polypeptide and another fragment of the GT-B domain (e.g. SEQ ID NO. 17) or one fragment of the TagF-like domain (e.g. SEQ ID NO. 12) of the polypeptide and another fragment of the GT-A domain (SEQ ID NO. 28), wherein the pair of fragments synthesizes a polysaccharide consisting of a dimeric repeating unit. Further, each fragment may be at least 15 amino acid residues in length. Preferably, each fragment may be at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 300, 400, or 500 amino acid residues in length or may have a length from 15-500, 30-500, 50-500, 100-500 or 200-500, or from 15-200, 30-200, 50-200, 100-200 amino acid residues, or may have a length from 15-100, 20-100, 25-100, 30-100, 35-100, 40-100, 45-100, 50-100 amino acid residues.
[0096] The present invention may also relate to a nucleotide sequence encoding a pair of fragments of a polypeptide being expressed by the host cell of the present invention, wherein the fragment of the TagF-like domain may be at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 300, 400, or 500 amino acid residues in length or may have a length from 15-500, 30-500, 50-500, 100-500 or 200-500, or a length from 15-200, 30-200, 50-200 or 100-200 amino acid residues, or a length from 15-100, 20-100, 25-100, 30-100, 35-100, 40-100, 45-100 or 50-100 amino acid residues, and may further comprise a conserved histidine at a position corresponding to the position 122 of SEQ ID NO. 3 (
[0097] Preferably, the fragment of the TagF-like domain may be at least 130 amino acids in length and the fragment of the GT-B domain may be at least 100 amino acids in length. Preferably, the fragment of the TagF-like domain may be at least 130 amino acids in length and the fragment of the GT-A domain may be at least 100 amino acids in length.
[0098] Again, the nucleotide sequence encoding a linker polypeptide as mentioned above is disposed in the polynucleotide of the present invention between the nucleotide sequence encoding the fragment of the TagF-like domain (e.g. SEQ ID NO. 1) and the fragment of the GT-B domain (e.g. SEQ ID NO. 17) or between the nucleotide sequence encoding the fragment of the TagF-like domain (e.g. SEQ ID NO. 12) and the fragment of the GT-A domain (e.g. SEQ ID NO. 28) such that it results in a fusion between said fragment of the TagF-like domain, the linker polypeptide and the fragment of the GT-B or GT-A domain, which may synthesize a polysaccharide consisting of a dimeric repeating unit.
[0099] Additionally, the present invention comprises a nucleotide sequence encoding a fragment of a polypeptide comprising a TagF-like domain and a nucleotide sequence encoding a fragment of a polypeptide comprising a GT-B or GT-A domain, wherein the nucleotide sequences are being separated on two different vectors used in the present invention. Preferably, the nucleotide sequence encoding a fragment of the TagF-like domain (e.g. SEQ ID NO. 1 or 12) may be inserted in one vector, whereas the nucleotide sequence encoding a fragment of the GT-B domain (e.g. SEQ ID NO. 17) or a fragment of the GT-A domain (e.g. SEQ ID NO. 28) may be inserted in another vector, such that it results not in a fusion between the fragment of the TagF-like domain and the fragment of the GT-B or GT-A domain, instead resulting in a pair of polypeptides (two polypeptides) one comprising the fragment of the TagF-like domain, the other polypeptide comprising the fragment of the GT-B or GT-A domain, wherein the pair of polypeptides each having only a fragment may synthesize a polysaccharide consisting of a dimeric repeating unit.
[0100] A nucleotide sequence encoding a polypeptide may have an amino acid sequence that is at least 15%, 16%, 16.5%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23. Amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 refers to the TagF-like domain of Bt188 and amino acid sequence of residues 1 to 389 of SEQ ID NO. 23 refers to the GT-B domain of Cps11D. Additionally, a nucleotide sequence encoding a polypeptide having an amino acid sequence that is from 30% to 99.5%, 35% to 99.5%, 40% to 99.5%, or 44% to 99.5% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is from 25% to 100%, 30% to 100%, 35% to 100%, 40% to 100% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23 may also be preferred by the present invention.
[0101] A nucleotide sequence encoding a polypeptide may have an amino acid sequence that is at least 15%, 16%, 16.5%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32. Again, amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 refers to the TagF-like domain of Bt188 and amino acid sequence of residues 1 to 256 of SEQ ID NO. 32 refers to the GT-A domain of Cps4B. Additionally, a nucleotide sequence encoding a polypeptide having an amino acid sequence that is from 30% to 99.5%, 35% to 99.5%, 40% to 99.5%, or 44% to 99.5% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is from 30% to 99%, 35% to 99%, 42% to 99%, 46.5% to 99%, 47% to 99% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32 may also be preferred by the present invention.
[0102] Percent (%) sequence identity with respect to amino acid sequences disclosed herein is defined as the percentage of amino acid residues in a candidate sequence that are pair-wise identical with the amino acid residues in a reference sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publically available computer software such as BLAST, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximum alignment over the full length of the sequences being compared. The overall sequence identity of the present invention is determined using the Clustal Omega program (20) (http://www.ebi.ac.uk/Tools/msa/clustalo/) and annotated with the Jalview software (13).
[0103] By a polynucleotide comprising a nucleotide sequence encoding a polypeptide expressed by the host cell of the present invention having an amino acid sequence at least, for example, 95% identical to a reference amino acid sequence is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the amino acid sequence of the polypeptide may include up to five point mutations per each 100 nucleotides of the reference amino acid sequence. In other words, to obtain a polynucleotide comprising a nucleotide sequence encoding a polypeptide expressed by the host cell of the present invention having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5 or 3 terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
[0104] The nucleotide sequence further encodes a polypeptide having a conserved tyrosine at residue 52 of SEQ ID NO.1 (CshC) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 48 of SEQ ID NO. 2 (Bt189) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 49 of SEQ ID NO. 3 (Bt188) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 49 of SEQ ID NO. 4 (Bt192) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 48 of SEQ ID NO. 5 (Cps3D) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 46 of SEQ ID NO. 6 (Cps9D) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 49 of SEQ ID NO. 7 (Cps11D) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 37 of SEQ ID NO. 9 (CszC) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 49 of SEQ ID NO. 10 (Cps7D) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 43 of SEQ ID NO. 11 (Cps2D) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 57 of SEQ ID NO. 12 (Fcs2) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 52 of SEQ ID NO. 13 (Cps1B) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 55 of SEQ ID NO. 14 (BtY31) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 38 of SEQ ID NO. 15 (Ccs2) which corresponds to residue 49 of SEQ ID NO. 3, or at residue 61 of SEQ ID NO. 16 (Cps4B) which corresponds to residue 49 of SEQ ID NO. 3, or having a conserved aspartic acid at residue 47 of SEQ ID NO. 8 (c3694) which corresponds to residue 49 of SEQ ID NO. 3 (
[0105] As used herein, the term conserved amino acid refers to an amino acid (e.g. tyrosine, aspartic acid, histidine etc.) that is similar or identical at a specific position along an alignment of sequences (amino acid sequences) of evolutionarily related polypeptides. If a certain number of aligned amino acid sequences of evolutionarily related polypeptides may have an identical amino acid at a specific position, which corresponds to a certain position of the reference sequence, the sequences (amino acid sequences) have a higher sequence identity.
[0106] The present invention may further envisage a vector comprising under the control of a heterologous promoter a nucleotide sequence encoding a polypeptide of the present invention. Such a vector may be, e.g., a plasmid, cosmid, virus, bacteriophage or another vector used e.g. conventionally in genetic engineering, and may comprise further genes such as marker genes which allow for the selection and/or replication of said vector in a suitable host cell and under suitable conditions. In a preferred embodiment, said vector is an expression vector, in which the nucleotide sequence of the present invention is operatively linked to expression control sequence(s) allowing expression in prokaryotic or eukaryotic host cells as described herein. The term operatively linked, as used in this context, refers to a linkage between one or more expression control sequences and the coding region in the polynucleotide to be expressed in such a way that expression is achieved under conditions compatible with the expression control sequence.
[0107] Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pET, pMal-c, pGEX, pBAD, pQE, pACYC, pSC101, pASK-IBA, pLAFR1, pBBR1MCS-3. Preferably, by using pMal-c-based vectors, the encoded polypeptides are expressed under a tac promoter control as fusion proteins with an N-terminal maltose-binding protein (MBP) fused by a protease-resistant S3N10 linker. In addition, prokaryotic vectors such as pcDNA2; and yeast vectors such as pYes2, and mammalian vectors such as pcDNA3; and insect cell vectors such as pFastBac and pMT; and protozoan vector (e.g. for Leishmania tarentolae) such as pLEXSY-2, pLEXSY_I-3 and pLEXSY_IE-blecherry4 are non-limiting examples of other vectors suitable for use with the present invention.
[0108] The coding sequences inserted in the vector can be synthesized by standard methods, isolated from natural sources, or prepared as hybrids. Ligation of the coding sequences to transcriptional regulatory elements (e.g., promoters, enhancers, and/or insulators) and/or to other amino acid encoding sequences can be carried out using established methods.
[0109] Furthermore, the vectors may, in addition to the nucleotide sequence(s) of the invention, comprise expression control elements, allowing proper expression of the coding regions in suitable hosts. Such control elements are known to the artisan and may include a promoter, translation initiation codon, translation and insertion site or internal ribosomal entry sites (IRES) (55) for introducing an insert into the vector.
[0110] Thus, the present invention may also encompass a method of producing a recombinant vector comprising inserting the nucleotide sequence encoding a polypeptide of the present invention into a vector and further inserting a heterologous promoter being able to control the expression of the polypeptide of the present invention.
[0111] Additionally, the host cell of the present invention may be isolated. In this context, the terms isolated or purified as used herein refer to the state of being free of other, dissimilar compounds with which the host cell of the invention is normally associated in its natural state. In the present invention the host cell is harvested by centrifugation, before the cell pellet is resuspended in lysis buffer.
[0112] The present invention may also relate to a host cell, which comprises under the control of a heterologous promoter a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is selected from the group consisting of: [0113] a) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-B domain having the amino acid sequences shown in SEQ ID NO. 1 and 17, SEQ ID NO. 2 and 18, SEQ ID NO. 3 and 19, SEQ ID NO. 4 and 20, SEQ ID NO. 5 and 21, SEQ ID NO. 6 and 22, SEQ ID NO. 7 and 23, SEQ ID NO. 8 and 24, SEQ ID NO. 9 and 25, SEQ ID NO. 10 and 26, SEQ ID NO. 11 and 27, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0114] b) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-A domain having the amino acid sequences shown in SEQ ID NO. 12 and 28, SEQ ID NO. 13 and 29, SEQ ID NO. 15 and 31, SEQ ID NO. 16 and 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0115] c) a nucleotide sequence encoding a pair of fragments of the polypeptide as defined in (a) and in (b), wherein each fragment is at least 15 amino acid residues in length and wherein the pair of fragments synthesizes a polysaccharide consisting of a dimeric repeating unit; [0116] d) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 40% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0117] e) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 30% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit,
and wherein the nucleotide sequence of (a) to (e) encodes a polypeptide having a conserved tyrosine at a position corresponding to position 49 of SEQ ID NO. 3 or having a conserved aspartic acid at a position corresponding to position 49 of SEQ ID NO. 3.
[0118] Additionally, the present invention may relate to a host cell, which comprises under the control of a heterologous promoter a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is selected from the group consisting of: [0119] a) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-B domain having the amino acid sequences shown in SEQ ID NO. 1 and 17, SEQ ID NO. 2 and 18, SEQ ID NO. 3 and 19, SEQ ID NO. 4 and 20, SEQ ID NO. 5 and 21, SEQ ID NO. 6 and 22, SEQ ID NO. 7 and 23, SEQ ID NO. 8 and 24, SEQ ID NO. 9 and 25, SEQ ID NO. 10 and 26, SEQ ID NO. 11 and 27, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0120] b) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-A domain having the amino acid sequences shown in SEQ ID NO. 12 and 28, SEQ ID NO. 13 and 29, SEQ ID NO. 14 and 30, SEQ ID NO. 15 and 31, SEQ ID NO. 16 and 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0121] c) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 40% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0122] d) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 30% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit,
and wherein the nucleotide sequence of (a) to (e) encodes a polypeptide having a conserved tyrosine at a position corresponding to position 49 of SEQ ID NO. 3 or having a conserved aspartic acid at a position corresponding to position 49 of SEQ ID NO. 3.
[0123] The present invention may also comprise a host cell, which comprises under the control of a heterologous promoter a polynucleotide comprising a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is selected from the group consisting of: [0124] a) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-B domain having the amino acid sequences shown in SEQ ID NO. 1 and 17, SEQ ID NO. 2 and 18, SEQ ID NO. 3 and 19, SEQ ID NO. 4 and 20, SEQ ID NO. 5 and 21, SEQ ID NO. 6 and 22, SEQ ID NO. 7 and 23, SEQ ID NO. 8 and 24, SEQ ID NO. 9 and 25, SEQ ID NO. 10 and 26, SEQ ID NO. 11 and 27, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0125] b) a nucleotide sequence encoding a polypeptide comprising a TagF-like domain and a GT-A domain having the amino acid sequences shown in SEQ ID NO. 12 and 28, SEQ ID NO. 13 and 29, SEQ ID NO. 15 and 31, SEQ ID NO. 16 and 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0126] c) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 40% identical to the amino acid sequence of residues 1 to 389 of SEQ ID NO. 23, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit; [0127] d) a nucleotide sequence encoding a polypeptide having an amino acid sequence that is at least 18% identical to the amino acid sequence of residues 1 to 378 of SEQ ID NO. 3 and that is at least 30% identical to the amino acid sequence of residues 1 to 256 of SEQ ID NO. 32, wherein the polypeptide synthesizes a polysaccharide consisting of a dimeric repeating unit,
and wherein the nucleotide sequence of (a) to (e) encodes a polypeptide having a conserved tyrosine at a position corresponding to position 49 of SEQ ID NO. 3 or having a conserved aspartic acid at a position corresponding to position 49 of SEQ ID NO. 3.
[0128] The host cell of the present invention may be a prokaryotic host cell or a eukaryotic host cell. Preferably, the host cell is a prokaryotic host cell, more preferably the prokaryotic host cell is a bacterium. The eukaryotic host cell may be a mammalian cell line such as HEK or CHO, and insect cell line such as Sf9 or S2 or a protozoan host cell such as Leishmania tarentolae. The prokaryotic host cell of the present invention may be selected from the group consisting of Escherichia coli, Actinobacillus pleuropneumoniae, Bibersteinia trehalosi, Actinobacillus suis, Haemophilus influenzae, Campylobacter jejuni, Campylobacter coli, Neisseria meningitidis, Mannheimia varigena, Neisseria mucosa, Moraxella lacunata, Neisseria elongate, Klebsiella sp G5, Cronobacter universalis, Cronobacter turicensis, Aeromonas veronii, Cronobacter sakazakii, Yersinia enterocolitica, Helicobacter pullorum, Bacillus subtilis and Bacillus cereus. Preferably, the prokaryotic host cell of the present invention may be selected from the group consisting of Escherichia coli, Actinobacillus pleuropneumoniae, Bibersteinia trehalosi, Actinobacillus suis, Haemophilus influenzae, Campylobacter jejuni, Campylobacter coli, Neisseria meningitidis, Mannheimia varigena, Neisseria mucosa, Moraxella lacunata, Neisseria elongate, Klebsiella sp G5, Cronobacter universalis, Cronobacter turicensis, Aeromonas veronii, Cronobacter sakazakii, Yersinia enterocolitica, Helicobacter pullorum and Bacillus cereus. More preferably, the prokaryotic host cell of the present invention may be selected from the group consisting of Escherichia coli, Actinobacillus pleuropneumoniae, Bibersteinia trehalosi, Actinobacillus suis, Haemophilus influenzae, Campylobacter jejuni, Campylobacter coli and Neisseria meningitidis. Even more preferably, the prokaryotic host cell is Escherichia coli, Actinobacillus pleuropneumoniae or Bibersteinia trehalosi.
[0129] Further, the host cell may be cultured and the polynucleotide comprising the nucleotide sequence encoding the polypeptide may be expressed. The host cell of the present invention is cultured under conditions that permit the expression of the polynucleotide comprising the nucleotide sequence to produce the encoded polypeptide. Preferably, the conditions refer to the use of colonies of transformed E. coli expression strains to inoculate an appropriate culture medium (e. g. LB or PowerBroth) while growing at 15-37 C., preferably at 37 C. At an OD.sub.600 of 0.5-3.0 (preferably 1.0), the incubation temperature is changed to 4 C.-37 C. (preferably 15 C.) and protein expression is induced by addition of 0.1-1.0 mM (preferably 0.5) isopropyl--D-1-thiogalactopyranoside (IPTG). The cells are cultures for 3-48 h, preferably 20 h.
[0130] The present invention mal also comprise the host cell of the present invention, wherein the heterologous promoter is a prokaryotic promoter. The prokaryotic promoter used in the present invention may be recognized by RNA polymerase and an associated sigma factor, which in turn may be brought to the promoter DNA by an activator protein's binding to its own DNA binding site nearby. Further, the present invention may also envisage a eukaryotic promoter such as a CMV promoter for mammalian cells; metallothionein (MT), polyhedrin and p10 promoter for insect cells; or T7 Promoter for protozoan cells.
[0131] The prokaryotic promoter of the present invention may be a tac promoter, lacUV5 promoter, T4 promoter, T7 promoter, araBAD (P.sub.BAD) promoter, tet promoter or a T5 promoter. Preferably, the prokaryotic promoter is a tac promoter. The term tac promoter refers to a synthetically produced DNA promoter, preferably used for protein production in Escherichia coli. The tac promoter is produced from the combination of promoters from the trp and lac operons.
[0132] Also encompassed by the present invention may be the host cell of the present invention, wherein the nucleotide sequence may encode a polypeptide having a conserved aspartic acid at a position corresponding to position 364 of SEQ ID NO. 3. The present invention may envisage the nucleotide sequence encoding a polypeptide of the present invention having a conserved tyrosine at a position corresponding to position 49 of SEQ ID NO. 3 or having a conserved aspartic acid at a position corresponding to position 49 of SEQ ID NO. 3 as previously described and further having a conserved aspartic acid at position 369 of SEQ ID NO.1 (CshC) which corresponds to position 364 of SEQ ID NO. 3, or at position 363 of SEQ ID NO. 2 (Bt189) which corresponds to position 364 of SEQ ID NO. 3, or at position 364 of SEQ ID NO. 3 (Bt188), or at position 364 of SEQ ID NO. 4 (Bt192) which corresponds to position 364 of SEQ ID NO. 3, or at position 364 of SEQ ID NO. 5 (Cps3D) which corresponds to position 364 of SEQ ID NO. 3, or at position 362 of SEQ ID NO. 6 (Cps9D) which corresponds to position 364 of SEQ ID NO. 3, or at position 365 of SEQ ID NO. 7 (Cps11D) which corresponds to position 364 of SEQ ID NO. 3, or at position 366 of SEQ ID NO. 8 (c3694) which corresponds to position 364 of SEQ ID NO. 3, or at position 358 of SEQ ID NO. 9 (CszC) which corresponds to position 364 of SEQ ID NO. 3, or at position 370 of SEQ ID NO. 10 (Cps7D) which corresponds to position 364 of SEQ ID NO. 3, or at position 364 of SEQ ID NO. 11 (Cps2D) which corresponds to position 364 of SEQ ID NO. 3, or at position 389 of SEQ ID NO. 12 (Fcs2) which corresponds to position 364 of SEQ ID NO. 3, or at position 383 of SEQ ID NO. 13 (Cps1B) which corresponds to position 364 of SEQ ID NO. 3, or at position 387 of SEQ ID NO. 14 (BtY31) which corresponds to position 364 of SEQ ID NO. 3, or at position 366 of SEQ ID NO. 15 (Ccs2) which corresponds to position 364 of SEQ ID NO. 3, or at position 388 of SEQ ID NO. 16 (Cps4B) which corresponds to position 364 of SEQ ID NO. 3 (
[0133] The present invention may also encompass the host cell of the present invention, wherein the nucleotide sequence may encode a polypeptide having a conserved asparagine and a conserved leucine at positions corresponding to positions 20 and 21 of SEQ ID NO. 23 (
[0134] The present invention may also encompass the host cell of the present invention, wherein the nucleotide sequence may encode a polypeptide having a conserved isoleucine corresponding to position 38 of SEQ ID NO. 32 (
[0135] Further, the present invention may envisage the nucleotide sequence encoding a polypeptide not comprising a glutamine tyrosine alanine (QYA) motif at positions corresponding to positions 160-162 of SEQ ID NO. 3. Also the nucleotide sequence encoding a polypeptide of the present invention does not have a glutamine histidine glycine (QHG) motif at positions corresponding to positions 160-162 of SEQ ID NO. 3.
[0136] Also contemplated by the present invention may be the nucleotide sequence encoding a polypeptide not comprising a serine tyrosine (ST) motif at positions corresponding to positions 289-290 of SEQ ID NO. 3.
[0137] Additionally, the present invention may encompass the nucleotide sequence encoding a polypeptide of the present invention not comprising a stretch in the TagF-like domain as can be seen at positions 297 to 366 and from positions 367 to 400 in SEQ ID NO. 36 (Cps8D) (
[0138] Additionally, the present invention may encompass the host cell of the present invention, wherein the polypeptide may be a polymerase, preferably a capsule polymerase (CPs), more preferably a glycosyltransferase and a hexose-phosphate transferase or glycosyltransferase and alditol-phosphate transferase
[0139] As used herein, the term a capsule polymerase (CP) refers to an enzyme that assembles the CPS.
[0140] A glycosyltransferase (GT) refers to a CP generating a linkage between two sugar positionsa so-called glycosidic linkage. Glycosyltransferases identify only three protein folds termed GT-A, GT-B, and GT-C (10). While GT-C folded enzymes represent a minor group of multi-membrane spanning proteins, enzymes with GT-A and GT-B folds can be monotopic or soluble. In this context, a GT-A fold (domain) as well as a GT-B fold (domain), have as their characteristic element two Rossmann-like domains that are either tightly associated, forming a central, continuous -sheet (GT-A), or opposed to each other, forming a deep cleft that contains the catalytic center (GT-B).
[0141] Another group of capsule polymerases display hexose-phosphate transferase or alditol-phosphate transferase activity. In this context, a hexose-phosphate transferase is able to generate a product containing a phosphodiester linkage when transferring a sugar-phosphate. An alditol-phosphate transferase is able to generate a product containing a phosphodiester linkage when transferring an alditol-phosphate.
[0142] The common feature of all members of this polymerase family is the domain catalyzing said phosphdiester linkage, called TagF-like domain. Since the crystal structure of the techoic acid polymerase TagF (15)a glycerol-phosphate transferasewas used as template for homology modelling by the structure prediction tool PHYRE.sup.2 (19), this domain was named TagF-like domain (
[0143] A -glycosidic linkage can be generated by a GT-A folded domain (
[0144] The capsule polymerase of the present invention may be able to generate both linkage types (gylcosidic and phosphodiester) in a polymer (e.g. polysaccharide) with a dimeric repeating unit, whereas the prior art has described capsule polymerases generating polysaccharides with either a glycosidic or a phosphodiester linkage or polymerases also generating both linkage types in a polymer, but wherein the polymer consists of a trimeric repeating unit (14).
[0145] In the present invention the TagF-like domain, the GT-A and the GT-B domain refer to catalytically active domains having catalytically important positions (
[0146] In detail, the present invention may comprise the nucleotide sequence encoding a polypeptide of the present invention having the conserved aspartate position of the DD motif at positions corresponding to positions 107-109 of SEQ ID NO. 32 (
[0147] Further, the present invention may envisage the nucleotide sequence encoding a polypeptide of the present invention having a conserved histidine at a position corresponding to position 122 of SEQ ID NO. 3 (
[0148] Further, the present invention may encompass the nucleotide sequence encoding a polypeptide of the present invention having a conserved histidine at a position corresponding to position 251 of SEQ ID NO. 3 (
[0149] Additionally, the present invention may envisage the nucleotide sequence encoding a polypeptide of the present invention having a conserved histidine at a position corresponding to position 251 of SEQ ID NO. 3 (
[0150] Further, the present invention may comprise the nucleotide sequence encoding a polypeptide having conserved aspartate positions of the DD motif at positions corresponding to positions 107-109 of SEQ ID NO. 32 (
[0151] The present invention may also comprise the nucleotide sequence encoding a polypeptide having conserved aspartate positions of the DD motif at positions corresponding to positions 107-109 of SEQ ID NO. 32 (
[0152] Also contemplated by the present invention may the nucleotide sequence encoding a polypeptide having conserved aspartate positions of the DD motif at positions corresponding to positions 107-109 of SEQ ID NO. 32 (
[0153] Further, the present invention may comprise the nucleotide sequence encoding a polypeptide having the conserved arginine at a position corresponding to position 234 of SEQ ID NO. 23 and the conserved lysine at a position corresponding to position 239 of SEQ ID NO. 23 (
[0154] Additionally, the present invention may comprise the nucleotide sequence encoding a polypeptide of the present invention having the conserved arginine at a position corresponding to position 234 of SEQ ID NO. 23 and the conserved lysine at a position corresponding to position 239 of SEQ ID NO. 23 (
[0155] Additionally, the present invention may comprise the nucleotide sequence encoding a polypeptide of the present invention having the conserved arginine at a position corresponding to position 234 of SEQ ID NO. 23 and the conserved lysine at a position corresponding to position 239 of SEQ ID NO. 23 (
[0156] In addition to the catalytically active domains, all members of the CP family of the GT-A/TagF-like capsule polymerases (Cps1B, Ccs2, Fcs2, Cps4B, BtY31) and of the TagF-like/GT-B capsule polymerases (Cps7D, Cps2D, CszC, Cps3D, Cps9D, CshC, Cps11D, c3694, Bt188, Bt189 and Bt192) may comprise a third domain that is rich in tetratricopeptide repeats (TPR) (
[0157] Also contemplated by the present invention may be the host cell of the present invention, wherein the polypeptide may be fused to a N- and/or C-terminal tag. A tag is an amino acid sequence which is homologous or heterologous to an amino acid sequence sequence to which it is fused. Said tag may, inter alia, facilitate purification of a protein or facilitate detection of said protein to which it is fused. If the polypeptide may be fused to a N-terminal tag, the tag may be a MBP tag. If the polypeptide may be fused to a C-terminal tag, the tag may be a His tag (in particular a hexa hisitidine (His.sub.6) tag) or a Strepll tag. A polypeptide being just fused to a C-terminal tag without having a N-terminal tag, whereas the C-terminal tag may be a His tag (in particular a hexa hisitidine (His.sub.6) tag) may also be preferred. Preferably, if the polypeptide of the present invention may be fused to a N- and C terminal tag, the N-terminal tag may be a MBP tag and the C-terminal tag may be a Strepll tag. More preferably, if the polypeptide of the present invention may be fused to a N- and C terminal tag, the N-terminal tag may be a MBP tag and the C-terminal tag may be a His tag (in particular a hexa hisitidine (His.sub.6) tag).
[0158] The N- and/or C-terminal tag may be selected from the group consisting of a His tag, MBP tag, GFP tag, FLAG tag, Strep tag, Strepll tag, NusA tag, GST tag, thioredoxin and intein. Preferably, the N- and/or C-terminal tag is a MBP tag and/or Strepll tag. More preferably, the N- and/or C-terminal tag is a MBP tag and/or His tag (in particular hexa hisitidine (His.sub.6) tag). If a MBP tag is preferred for the N-terminal tag, the MBP tag may be fused by a protease-resistant linker (in particular a S3N10 linker) to the polypeptide. In this context, the MBP refers to maltose binding protein (MBP) being a common protein expression tag. It is one of the most well-known and accomplished means of tagging proteins. Fusion of a target protein (e.g. polypeptide) to MBP permits its one-step purification using amylose resin. Additionally, in E. coli, MBP is known to have significantly enhanced the solubility of many proteins it has been fused to.
[0159] Additionally, the present invention may envisage the host cell of the present invention, wherein the polysaccharide may comprise a repeating unit of two different monosaccharides or one monosaccharide and one alditol. The polysaccharide consisting of a dimeric repeating unit of the present invention may comprise a repeating unit, which consists of two different building blocks (building block 1 and building block 2), wherein building block 2 also comprises a phosphate. In this context, the term two different monosaccharides refers to one monosaccharide (e.g. glucose) of building block 1 of the repeating unit and another monosaccharide of building block 2, which is either not identical to the monosaccharide of building block 1 (e.g. galactose) or identical to the monosaccharide of building block 1 (e.g. N-Acetylgalactosamine for the two different monosaccharides), but further modified by a glycosyltransferase and/or an O-acetyltransferase (preferably by an O-acetyltransferase) and which is always connected to a phosphate. Additionally, two identical monosaccharides, whereas the monosaccharide of building block 1 is further modified by a glycosyltransferase and/or an O-acetyltransferase may also be comprised by the present invention, when the term two different monosaccharides is used. In this context, the term alditol refers to an alditol being connected to a phosphate.
[0160] Building block 1 may be selected from N-acetyglucosamine (GlcNAc), galactose (Gal), N-acetylgalactosamine (GalNAc), glucose (Glc), galactofuranose, mannose (Man), N-acetylmannosamine (ManNAc), which are non-limiting examples of monosaccharides of the repeating unit and which may also be additionally modified by a glycosyltransferase and/or an O-acetyltransferase. In this context, the term glycosyltransferase refers to an enzyme, which catalyzes the transfer of a saccharide moiety to a nucleophilic glycosyl acceptor, preferably a hydroxyl group of a monosaccharide of building block 1 or a monosaccharide/alditol of building block 2. The term glycosyltransferase as used herein, may comprise glucosyltransferase, which catalyzes the transfer of glucose. It may also comprise galactosyltransferase, N-acetylglucosamintransferase, N-acetylgalactosamine transferase, mannosyltransferase, N-acetylmannosamine transferase or galactofuranosyltransferase. A glycosyltransferase may establish the natural glycosidic linkages known to a person skilled in the art. Thus, the present invention may comprise the host cell of the present invention, wherein the polysaccharide may comprise a repeating unit of two different monosaccharides or one monosaccharide and one alditol, wherein the first monosaccharide may have an additional modification such as glucose, galactose or N-acetylglucosamine and/or O-acetyl. Further, the polysaccharide of the present invention may also comprise a repeating unit of two different monosaccharides, wherein the first monosaccharide may have two additional modifications such as two glucose molecules, two galactose molecules or two N-acetylglucosamine molecules (in particular two glucose molecules) or two O-acetyl molecules.
[0161] Building block 2 may be selected from galactose-phosphate (Gal-P), N-acetylgalactosamine-phosphate (GalNAc-P) or glycerol-phosphate (Gro-P), the latter which refers to an alditol (
[0162] Thus, the present invention may comprise the host cell of the present invention, wherein the polysaccharide may comprise a repeating unit of two different monosaccharides, wherein the second monosaccharide may have an additional modification such as glucose, galactose or N-acetylglucosamine and/or O-acetyl. Further, the polysaccharide of the present invention may also comprise a repeating unit of two different monosaccharides, wherein the second monosaccharide may have two additional modifications such as two glucose molecules, two galactose molecules or two N-acetylglucosamine molecules or two O-acetyl molecules.
[0163] Thus, the repeating unit of the polysaccharide consisting of a dimeric repeating unit of the present invention comprises a building block 1 (monosaccharide) and a building block 2 (monosaccharide plus phosphate or alditol plus phosphate) and the modification(s) catalyzed by a glycosyltransferase and/or an O-acetyltransferase modifying building block 1. Further, the repeating unit of the polysaccharide consisting of a dimeric repeating unit of the present invention also comprises a building block 1 (monosaccharide) and a building block 2 (monosaccharide plus phosphate or alditol plus phosphate) and the modification(s) catalyzed by a glycosyltransferase and/or an O-acetyltransferase modifying building block 2.
[0164] Further, building block 1 and building block 2 build up the backbone chain of the repeating unit. In this context, the term backbone chain refers to the bonding of building block 1 (monosaccharide) to building block 2 (monosacchriade plus phosphate via phosphoester linkage or alditol plus phosphate via phosphoester linkage) in a chain, which is characterized as a glycosidic linkage. It further refers to the bonding of building block 2 (monosaccharide plus phosphate or alditol plus phosphate) to building block 1 (monosaccharide) of the following repeating unit in a chain, which is characterized as phosphodiester linkage.
[0165] The present invention may further comprise the host cell of the present invention, wherein the repeating unit may comprise one or more glycosidic and one or more phosphodiester linkage(s). Preferably, the repeating unit of the present invention comprises one, two or three glycosidic linkages (e.g. Cps2D of App2 in
[0166] The glycosidic linkage connecting the modifications (such as glucose(s), galactose(s) or N-acetylglucosamine(s), which are non-limiting examples of monosaccharides of the repeating unit) to building block 1 may also be an - or -glycosidic linkage. The glycosidic linkage connecting the modifications (such as glucose(s), galactose(s) or N-acetylglucosamine(s), which are non-limiting examples of monosaccharides of the repeating unit) to building block 2 may also be an - or -glycosidic linkage.
[0167] Additionally, the present invention comprises the host cell of the present invention, wherein the two different monosaccharides of the repeating unit are connected by a -glycosidic linkage or wherein the monosaccharide and the alditol of the repeating unit are connected by an -glycosidic linkage. The repeating unit having two different monosaccharides in building block 1 and 2 being connected by a -glycosidic linkage may also have a phosphodiester linkage connecting building block 2 of one repeating unit to building block 1 of the following repeating unit. The repeating unit having a monosaccharide in building block 1 and an alditol in building block 2 being connected by an -glycosidic linkage may also have a phosphodiester linkage connecting building block 2 of one repeating unit to building block 1 of the following repeating unit.
[0168] Further, the present invention may also comprise the host cell of the present invention, wherein the polysaccharide is a phosphate containing polysaccharide.
[0169] As mentioned above, building block 2 of the repeating unit comprises a monosaccharide, in particular galactose or N-acetylgalactosamine, or an alditol, in particular glycerol, which are bonded to a phosphate via a phosphoester linkage.
[0170] The new CP family synthesizes phosphate containing CPS in pathogens expressing a group 2 capsule. Group II capsules are characterized by a high negative charge density. The negative charge may be introduced by either the integration of negatively charged sugar moieties (sialic acid or glucuronic acid) or by the integration of phosphodiester linkages generated by the TagF-like domain or CPs belonging to the stealth protein family. Thus, in the present invention the polysaccharide may be negatively charged, since it has a phosphodiester linkage, thus the polysaccharide refers to a phosphate containing polysaccharide.
[0171] The polysaccharide of the present invention does not comprise Kdo, also called 3-deoxy-D-manno-oct-2-ulosonic acid (OclA), which may introduce the negative charge and may be transferred/integrated by domains similar to the TagF-like domain.
[0172] The present invention may further envisage a method of producing the host cell of the present invention, the method comprising: a) cloning a nucleotide sequence encoding a polypeptide expressed by the host cell of the present invention into a vector, b) transforming cells with said vector of (a) and growing the cells in medium.
[0173] A nucleotide sequence encoding the polypeptide of the present invention may be cloned into a vector of the present invention, preferably, a plasmid or cosmid, more preferably pET, pMal-c, pGEX, pBAD, pQE, pACYC, pSC101, pASK-IBA, pLAFR1, pBBR1MCS-3, using standard cloning techniques. Standard cloning techniques such as using restriction enzymes or recombinational cloning is known to the skilled person in the art. E. coli cells, preferably M15(pREP4), BL21, BL21(DE3), W3110, are then transformed with said vector and grown in LB or PowerBroth medium. If necessary, antibiotics may also be added for plasmid selection, preferably streptomycin, actinomycin, blasticidin, neomycin, kanamycin, gentamicin or ampicillin. In this context, the term transforming refers to the process by which foreign DNA, preferably a vector comprising the nucleotide sequence encoding the polypeptide of the present invention, is introduced into a cell. The process transformation is known to the person skilled in the art and may be performed by e.g. standard heatshock.
[0174] Additionally, the present invention may comprise a method of expressing a polypeptide in a host cell comprising a) culturing the host cell of the present invention, b) expressing the polypeptide in the host cell. The host cell of the present invention may be cultured under conditions sufficient for the expression of the polypeptide. Those conditions, under which the host cell is cultured may refer using colonies of transformed E. coli expression strains to inoculate an appropriate culture medium (e. g. LB or PowerBroth) while growing at 15-37 C., preferably at 37 C. At an OD.sub.600 of 0.5-3.0 (preferably 1.0), the incubation temperature is changed to 4 C.-37 C. (preferably 15 C.) and protein expression is induced by addition of 0.1-1.0 mM (preferably 0.5) isopropyl--D-1-thiogalactopyranoside (IPTG).
[0175] Also comprised by the invention is a vaccine composition comprising the host cell of the present invention.
[0176] The term vaccine composition refers to an attenuated vaccine or live vaccine, a subject is administered with, thus being vaccinated with. The vaccine composition is created by reducing the virulence of the host cell of the present invention, but still keeping the host cell viable (or live). Preferably, the vaccine composition may comprise the host cell of the present invention capable of eliciting an immune response against the host cell of the present invention. A particle of the host cell may be used in the vaccine composition or the whole host cell itself.
[0177] Accordingly said vaccine composition is administered to a subject in need thereof. Preferably, the subject is a vertebrate, even more preferred a mammal including rats, rabbits, pigs, mice, cats, dogs, sheep, horses, goats, cows and humans. Preferably, the subject being vaccinated may be an animal mentioned above. The term administered means administration of a therapeutically or diagnostically effective dose of the vaccine composition comprising the host cell of the present invention to a subject. By therapeutically or diagnostically effective amount is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment or diagnosis, and will be ascertainable by one skilled in the art using known techniques. As is known in the art and described above, adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art. The methods are applicable to both human therapy and veterinary applications.
[0178] The vaccine composition may be administered alone or in combination with other treatments. The vaccine may further comprise auxiliary substances, such as wetting or emulsifying agents or pH buffering agents, to further enhance their effectiveness. The vaccine composition may also comprise a carrier. In this context, the term carrier refers to a diluent, adjuvant, or vehicle with which the vaccine composition is administered. Carriers may be sterile liquids, such as water and oils including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the vaccine composition is administered orally or intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
[0179] The administration of the vaccine composition may be done in a variety of ways as discussed above, including, but not limited to intraperitoneally, intravenously, subcutaneously, intramuscularly or orally. Preferably, the administration of the vaccine composition is performed intramuscularly. More preferably, the administration of the vaccine composition is performed subcutaneously, if an animal, in particular small animals such as mice, rats, rabbits, cats or dogs are vaccinated. If pigs are vaccinated with a life vaccine, possible routes are systemic immunization (intradermal or intramuscular) and mucosal immunization (oral and intranasal routes), preferably mucosal immunization via intranasal route. If pigs are vaccinated with a glycoconjugate vaccine, systemic immunization is the preferred method.
[0180] The attending physician and clinical factors will determine the dosage regimen. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
[0181] An optimal amount for a particular vaccine composition may be ascertained by standard studies involving observation of appropriate immune responses in subjects. The dosages are preferably given once a year, however, during progression of the treatment the dosages can be given in much longer time intervals and in need can be given in much shorter time intervals. In a preferred case, the immune response is monitored using herein described methods and further methods known to those skilled in the art and dosages are optimized, e.g., in time, amount and/or composition. Following an initial vaccination, subjects may receive one or several booster immunization adequately spaced.
[0182] Additionally, the present invention may comprise a composition comprising a polypeptide expressed by the host cell of the present invention. The term composition, as used in accordance with the present invention, relates to a composition, which comprises at least a polypeptide expressed by the host cell of the present invention and a carrier.
[0183] It is envisaged that the composition of the present invention may comprise the polypeptide and the carrier in any combination. The composition comprising a polypeptide expressed by the host cell of the present invention, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents as a carrier. The pH of the buffering agent is preferably adjusted to lie between 5 and 10 by addition of an acid or a base, preferably pH 8.0. Preferably, the composition of the present invention may comprise 20 mM Tris pH 8.0, 1 mM DTT, 10 mM MgCl.sub.2 as a carrier.
[0184] The composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) powder(s), (a) tablet(s), (a) solution(s), (an) aerosol(s), granules, pills, suspensions, emulsions, capsules, syrups, liquids, elixirs, extracts, tincture or fluid extracts or in a form, which is particularly suitable for oral or parental or topic administration.
[0185] The composition comprising a polypeptide of the present invention is, for example, suitable for use in immunoassays in which it may be utilized in liquid phase or bound to a solid phase carrier. Examples of well-known carriers include glass, polystyrene, polyvinyl ion, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the carrier can be either soluble or insoluble for the purposes of the invention. Solid phase carriers are known to those in the art and may comprise polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, membranes, sheets, duracytes and the walls of wells of a reaction tray, plastic tubes or other test tubes. Suitable methods of immobilizing a polypeptide expressed by the host cell of the present invention on solid phases include but are not limited to ionic, hydrophobic, covalent interactions or (chemical) crosslinking and the like. Examples of immunoassays, which can utilize a polypeptide expressed by the host cell of the present invention, are competitive and non-competitive immunoassays in either a direct or indirect format. Commonly used detection assays can comprise radioisotopic or non-radioisotopic methods. Examples of such immunoassays are the radioimmunoassay (RIA), the sandwich (immunometric assay) and the Northern or Southern blot assay. Furthermore, these detection methods comprise, inter alia, IRMA (Immune Radioimmunometric Assay), EIA (Enzyme Immuno Assay), ELISA (Enzyme Linked Immuno Assay), FIA (Fluorescent Immuno Assay), and CLIA (Chemioluminescent Immune Assay).
[0186] Further, the composition comprising a polypeptide of the present invention is, for example, suitable for use in enzymatic activity reactions. The amount of purified polypeptide may be 0.1-1 nmol, preferably 0.1-0.3 nmol. The amount may be in a total volume of at least 50 L assay buffer, preferably 75 L assay buffer. If the volume is increased, the amount of polypeptide is increased as well. The assay buffer may contain 20 mM Tris pH 8.0, 1 mM DTT, 10 mM MgCl.sub.2 and 1-50 mM donor sugar, such as UDP-GlcNAc (Carbosynth), UDP-Gal (Carbosynth) and CDP-glycerol, or any other donor sugar known to the person skilled in the art. Preferably 6-10 mM donor sugar may be used for the enzymatic activity reaction.
[0187] Additionally, the composition comprising a polypeptide of the present invention is, for example, suitable for use in in vitro polysaccharide synthesis. For in vitro synthesis of 5-12 mg polysaccharide, 1-50 nmol polypeptides may be used for incubation with 1-50 mM (preferably 6-10 mM) donor sugars as mentioned above in a total volume of 5-10 mL. Preferably, 1-25 nmol polypeptide may be used.
[0188] Also contemplated by the present invention may be the composition further comprising one or more polypeptide(s) having an amino acid sequence selected from the group consisting of: a) SEQ ID NO. 33 and 41; b) SEQ ID NO. 34 and 42; c) SEQ ID NO. 35 and 43; d) SEQ ID NO. 36 and 44; e) SEQ ID NO. 37 and 45; f) SEQ ID NO. 38 and 46; g) SEQ ID NO. 39 and 47; h) SEQ ID NO. 40 and 48, or fragments thereof.
TABLE-US-00002 TABLE 2 Overview of the polypeptides additionally used in the composition of the present invention and their corresponding sequences, which encode a TagF-like domain or domains that are similar to TagF-like domains (SiaTF, KdoTF), a GTB or a GTA domain. SEQ ID NO. Domain Polymerase 33 TagF CslB 34 TagF Cps12B 35 TagF Cps6D 36 TagF Cps8D 37 KdoTF Cps5B 38 KdoTF Cps10C 39 SiaTF Csw 40 SiaTF Csy 41 GTA CslB 42 GTA Cps12B 43 GTB Cps6D 44 GTB Cps8D 45 GTB Cps5A 46 GTB Cps10D 47 GTB Csw 48 GTB Csy
[0189] The one or more polypeptide(s) having an amino acid sequence selected from the group consisting of: a), b), c), d), e), f), g), h) or fragments thereof may also comprise a linker as mentioned earlier, which connects the TagF-like domain (e.g. SEQ ID NO. 33) (or Sialyltransferase domain for Csw and Csy and KdoTF domain for Cps5B and Cps10C) and the GT-A domain (e.g. SEQ ID NO. 41) or the TagF-like domain (e.g. SEQ ID NO. 35) and the GT-B domain (e.g. SEQ ID NO. 43). Preferably, the nucleotide sequence encoding said linker polypeptide is disposed in the polynucleotide between the nucleotide sequence encoding the TagF-like domain (e.g. SEQ ID NO. 33) and the GT-A domain (e.g. SEQ ID NO. 41) or between the nucleotide sequence encoding the TagF-like domain (e.g. SEQ ID NO. 35) and the GT-B domain (e.g. SEQ ID NO. 43) such that it results in a fusion between said TagF-like domain, linker polypeptide and GT-B or GT-A domain. Also contemplated by the present invention may be a nucleotide sequence encoding the TagF-like domain (e.g. SEQ ID NO. 33 or 35) being inserted in one vector, whereas the nucleotide sequence encoding the GT-B domain (e.g. SEQ ID NO. 43) or GT-A domain (e.g. SEQ ID NO.41) may be inserted in another vector, such that it results not in a fusion between said TagF-like domain and said GT-B or GT-A domain, instead resulting in a pair of polypeptides one comprising the TagF-like domain, the other polypeptide comprising the GT-B or GT-A domain.
[0190] The composition of the present invention may comprise a polypeptide expressed by the host cell of the present invention and one polypeptide having an amino acid sequence selected from the group consisting of: a), b), c), d), e), f), g), h) or fragments thereof. The present invention may also comprise a polypeptide expressed by the host cell of the present invention and one, two, three, four, five, six, seven or even all eight polypeptides having an amino acid sequence selected from the group consisting of: a), b), c), d), e), f), g), h) or fragments thereof.
[0191] In this context, the term fragments thereof refers to a fragment of each domain (TagF-like and GTB domain or TagF-like and GTA domain) of a polypeptide having an amino acid sequence selected from the group consisting of: a), b), c), d), e), f), g), h), meaning either a fragment of the TagF-like domain (e.g. SEQ ID NO. 35) and a fragment of the GT-B domain (e.g. SEQ ID No. 43) or a fragment of the TagF-like domain (e.f. SEQ ID NO. 33) and a fragment of the GT-A domain (e.g. SEQ ID NO.41). Each fragment may be at least 15 amino acid residues in length. Preferably, each fragment may be at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 300, 400 or 500 amino acid residues in length or from 15-500, 30-500, 50-500, 100-500 or 200-500 amino acid residues in length, or each fragment may be 15-200, 30-200, 50-200 or 100-200 amino acid residues in length, or 15-100, 20-100, 25-100, 30-100, 35-100, 40-100, 45-100 or 50-100 amino acid residues in length.
[0192] The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents as a carrier. The pH of the buffering agent is preferably adjusted to lie between 5 and 10 by addition of an acid or a base, preferably pH 8.0. Preferably, the composition may comprise 20 mM Tris pH 8.0, 1 mM DTT, 10 mM MgCl.sub.2 as a carrier.
[0193] The present invention may also encompass a method for synthesizing a polysaccharide consisting of a dimeric repeating unit comprising bringing the composition of the present invention further comprising one or more polypeptide(s) having an amino acid sequence selected from the group consisting of: a), b), c), d), e), f), g) and h) into contact with two donor substrates. In this context, the term bringing into contact means reacting the (purified) polypeptide expressed by the host cell of the present invention and/or one or more polypeptide(s) having an amino acid sequence selected from the group of: a), b), c), d), e), f), g) and h) with two donor substrates or performing a reaction of the polypeptide expressed by the host cell of the present invention and/or one or more polypeptide(s) having an amino acid sequence selected from the group of: a), b), c), d), e), f), g) and h) with two donor substrates.
[0194] The polypeptides expressed by the host cell of the present invention were recombinantly expressed, in particular in E. coli, purified, preferably via their C-terminal histidine tag, and incubated with two donor substrates (nucleotide activated carbohydrates) and the reaction was analysed using a high performance liquid chromatography based anion exchange chromatography assay (HPLC-AEC). The HPLC-AEC assay allows monitoring the consumption of the donor substrates as well as the purification of all putative products of the reaction (
[0195] The present invention may encompass the method as mentioned above, wherein the two donor substrates may be nucleotide monosaccharides or wherein the two donor substrates are a nucleotide monosaccharide and a nucleotide alditol.
[0196] The donor substrates may be selected from uridine diphosphate N-acetylglucosamine (UDP-GlcNAc), uridine diphosphate galactose (UDP-Gal), uridine diphosphate N-acetylgalactosamine (UDP-GalNAc), uridine diphosphate glucose (UDP-Glc), uridine diphosphate galactofuranose, uridine diphosphate N-acetylmannosamine (UDP-ManNAc), CMP-sialic acid, CMP-ketodeoxyoctonate (CMP-kdo) and uridine diphosphate mannose (UDP-Man), which refer to nucleotide monosaccharides (nucleotide sugars) or cytidine diphosphate glycerol (CDP-glycerol) and cytidine diphosphate ribitol (CDP-ribitol), which refer to nucleotide alditols. Here, the nucleotide may be an adenosine diphosphate (ADP), uridine diphosphate (UDP), cytidine diphosphate (CDP), guanosine disphosphate (GDP) or cytosine monophosphate (CMP), preferably UDP or CDP. The two donor substrates comprising two nucleotide monosaccharides may be selected from UDP-GlcNAc, UDP-Gal, UDP-GalNAc, UDP-Glu, uridine diphosphate galactofuranose, UDP-ManNAc, CMP-sialic acid, CMP-kdo and UDP-Man. The two donor substrates comprising one nucleotide monosaccharide and one nucleotide alditol may be selected from UDP-GlcNAc, UDP-Gal, UDP-GalNAc, UDP-Glu, uridine diphosphate galactofuranose, UDP-ManNAc, CMP-sialic acid, CMP-kdo and UDP-Man for the nucleotide monosaccharide and CDP-glycerol and CDP-ribitol for the nucleotide alditol. All of the above mentioned compounds are non-limiting examples of donor substrates.
[0197] The nucleotide monosaccharide(s) and the nucleotide alditol as mentioned above are characterized as being activated. In this context, the term activated means adding a NDP to (a) nucleotide monosaccharide(s) or to an alditol or adding a NMP to sialic acid or adding a NMP to Kdo, wherein NDP may be selected from adenosine diphosphate (ADP), uridine diphosphate (UDP), cytidine diphosphate (CDP), guanosine disphosphate (GDP). Thus, the two donor substrates may also refer to nucleotide activated monosaccharides or to a nucleotide activated monosaccharide and a nucleotide activated alditol or a nucleotide activated sialic acid or a nucleotide activated Kdo.
[0198] Also encompassed by the present invention may be a polysaccharide consisting of a dimeric repeating unit obtainable by the method mentioned above for use as a glycoconjugate vaccine.
[0199] The polysaccharide consisting of a dimeric repeating unit may also be used to make efficient vaccines, the so called glycoconjugate vaccines, in which polysaccharide-fragments are covalently coupled to adjuvant proteins to elicite T cell responses and immunological memory.
[0200] In this context, the term glycoconjugate refers to polysaccharide fragments being comprised of multiple-oligosaccharides covalently linked to a carrier protein. Such glycoconjugate may then be used as a vaccine being administered to a subject in need thereof.
[0201] The subject may be mammals, including rats, rabbits, pigs, mice, cats, dogs, sheep, horses, goats, cows and humans. Preferably, the glycoconjugate vaccine made by the polysaccharides generated by the polypeptides of the present invention is administered to animals mentioned above.
[0202] In general, polysaccharides, in particular capsular polysaccharide (CPSs) are isolated from large scale fermentation of pathogenic bacteria. This step essentially depends on the high-tech infrastructure of modern production plants and, as vaccines are applied to healthy individuals, requests extended control systems to guarantee product homogeneity and consistency (53). The isolation of polysaccharides, in particular CPSs from pathogen cultures is a major driver of costs, making glycoconjugate vaccines expensive and thus not sufficiently accessible to low-income countries or for their use in animal husbandry.
[0203] Immunogenic glycoconjugates may be formed between multifunctionalized CPS and proteins if the conditions are controlled very carefully. Most of the conjugates are today synthesized by coupling either CPS or oligosaccharides activated at hydroxyl groups or through their reducing end, respectively, to a protein or peptide with or without a linker group.
[0204] General glycoconjugation methods involve random activation of the capsular polysaccharide by periodate treatment or specific activation of fragments of the polysaccharide by reductive amination at their reducing ends. The former method for long CPS leads to a random oxidative cleavage of vicinal hydroxyl groups of the carbohydrates with the formation of reactive aldehyde groups. Coupling to a protein carrier for both methods is by reductive amination to the lysyl groups. A spacer group such as aminocaproic acid or adipic acid based derivatives can be reacted with the aldehydes by reductive amination and then coupled to the protein lysyl groups.
[0205] Thus, the present invention may also comprise an alternative, safe and economic way for glycoconjugate production by applying chemo-enzymatic synthesis of polysaccharides, in particular CPSs by use of recombinant capsule biosynthesis enzymes, e.g. the polypeptides of the present invention.
[0206] It is noted that as used herein, the singular forms a, an, and the, include plural references unless the context clearly indicates otherwise. Thus, for example, reference to a reagent includes one or more of such different reagents and reference to the method includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.
[0207] Unless otherwise indicated, the term at least preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.
[0208] The term and/or wherever used herein includes the meaning of and, or and all or any other combination of the elements connected by said term.
[0209] The term less than or in turn more than does not include the concrete number.
[0210] For example, less than 20 means less than the number indicated. Similarly, more than or greater than means more than or greater than the indicated number, e.g. more than 80% means more than or greater than the indicated number of 80%.
[0211] Throughout this specification and the claims which follow, unless the context requires otherwise, the word comprise, and variations such as comprises and comprising, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term comprising can be substituted with the term containing or including or sometimes when used herein with the term having. When used herein consisting of excludes any element, step, or ingredient not specified.
[0212] The term including means including but not limited to. Including and including but not limited to are used interchangeably.
[0213] It should be understood that this invention is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0214] All publications cited throughout the text of this specification (including all patents, patent application, scientific publications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.
[0215] The content of all documents and patent documents cited herein is incorporated by reference in their entirety.
[0216] A better understanding of the present invention and of its advantages will be gained from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the present invention in any way.
EXAMPLES OF THE INVENTION
Material and Methods
Example 1: General Cloning
[0217] The generation of plasmid pAN37-cslB-His6 (tac) encoding the capsule polymerase CslB38-874-His6 of NmL was described in (14). Plasmids encoding the polymerases of App1, App3, App7, App12 and Hic were cloned similarly. The genes encoding the polymerases Cps1B (Genbank: KY798410), Cps3D (Genbank: KY807157), Cps7D (uniprot: B3GYRO), Cps12B (uniprot: Q69AA8) and Ccs2 (uniprot: F6KWE2) were amplified by polymerase chain reaction (PCR) from heat-inactivated bacterial lysates as template and with primers given in Table 3 and Table 4. The Actinobacillus pleuropneumoniae lysates were kindly provided by Dr. Jochen Meens (University of Veterinary Medicine, Hannover, Germany) and Haemophilus influenzae serotype c lysate was kindly provided by Dr. Heike Claus (Institute for Hygiene and Microbiology, Wuerzburg, Germany).
TABLE-US-00003 TABLE3 Listofprimersused. Primersusedforgeneratingthelistedplasmids. Restrictionsitesareunderlined. CL57 5-CCATAGGGATCCAATAAAGTAAAACGTAAATTTAG-3(SEQIDNO:49) CL59 5-CTTTTACCTAGGAACGCCCAACTTAATTAACATTAGTGGTGGTGGTGGTGGTGCTCGAG GATGAATTTTTCAAAAAAGATAG-3(SEQIDNO:50) CL147 5-CCATAGGGATCCTTAATAAACAACGAGAATG-3(SEQIDNO:51) CL148 5-GGTGCTCGAGTTTAGTATTTTCGTTAAATTC-3(SEQIDNO:52) CL74 5-CCATAGGGATCCAAGAAAAAATTTTATAAAGC-3(SEQIDNO:53) CL94 5-CTTTTACCTAGGAACGCCCAACTTAATTAACATTAGTGGTGGTGGTGGTGGTGCTC GAGAATAACATTATAAAATCTATTAATTG-3(SEQIDNO:54) CL33 5-CCATAGGGATCCAATAAAATTAGTA-3(SEQIDNO:55) CL56 5-GGTGCTCGAGGTTTATATTTCTTTTTGG-3(SEQIDNO:56) CL40 5-GCATCTCATATGAGCAAAATCAATAGAAAACTTAAGAAAC-3(SEQIDNO:57) CL39 5-GGTGCTCGAGTGAAAGTAAATCGGCTAATTTTAATTG-3(SEQIDNO:58) PrimersusedforgeneratingtruncatedCps1Bconstructs. CL102 5-AAACATTTACCTGTTAAATATGAAG-3(SEQIDNO:59) CL104 5-CATGGACTATGGTCCTTG-3(SEQIDNO:60) CL128 5-ATCCGGCATATCTAAGTTAATAATAG-3(SEQIDNO:61) CL129 5-CTCGAGCACCACC-3(SEQIDNO:62) PrimerpairsusedforgeneratingfollowingmutationsinCps1B.Altered nucleotidepositionscomparedtowildtypesequencesareunderlined. D133A/ CL162 5-TTACCTTTATTgcgCCAgcgGATTTTCTTAG-3(SEQIDNO:63) D135A CL163 5-CCCATTCTGTTTGTACGTATTTTAGTCC-3'(SEQIDNO:64) H743A CL137 5-TAAAGATGATTTATCTCAATGGTTC-3(SEQIDNO:65) CL136 5-GTTATACCcgcCTGTAAA-3(SEQIDNO:66) H717A CL164 5-CCATATTTAAATGAGTTTAACATCCCC-3(SEQIDNO:67) CL165 5-TTCAATATTAGGcgcTGGTGCAAAAATAAC-3(SEQIDNO:68) PrimerpairsusedforgeneratingfollowingmutationsinCps7D.Altered nucleotidepositionscomparedtowildtypesequencesareunderlined. H612A CL177 5-TTAAAACATTAGGAAGAGATATGGAG-3(SEQIDNO:69) CL176 5-ATGGAGTTCCcgcCCATGTAC-3(SEQIDNO:70) H743A CL179 5-AAGCATTATCCAAAATTAATCTAG-3(SEQIDNO:71) CL178 5-CCTGAAGTAATGAcgcCCCTCTAA-3(SEQIDNO:72) R1123A CL181 5-GAGAAGGACCACGCTAAGT-3(SEQIDNO:73) CL180 5-TATTGATAGcgcACCTATTGTT-3(SEQIDNO:74) K1132A CL160 5-GCTAAGTTAATTAATAGTTTTGC-3(SEQIDNO:75) CL159 5-GTGGTCcgcCTCTATT-3(SEQIDNO:76)
[0218] Resulting PCR products were cloned via restriction sites given in Table 4 into modified pMal-c vectors (New England Biolabs). Amplified gene sequences of Cps1B, Cps3D, Cps7D and Cps12B were cloned into the modified pMal-c vector called pMBP-csxA-His6 (tac) (Table 4), thereby replacing the csxA sequence coding for the CP of NmX (16), resulting in plasmids pMBP-cps1B-His6, pMBP-cps3D-His6, pMBP-cps7D-His6 and pMBP-cps12B-His6, respectively (Table 4). In these plasmids the encoded proteins are expressed under tac promoter control as fusion proteins with an N-terminal maltose-binding protein (MBP) fused by a protease-resistant S3N10 linker (17) and a C-terminal 6His tag (His6).
[0219] The amplified gene sequence of Ccs2 was cloned into the modified pMal-c vector pAN37-cslB-His6 (tac), which generation is described in (14), using the restriction sites given in Table 4. Plasmid pcps1B32-858-His6 (tac) for expression of the truncated Cps1B32-858-His6 protein was cloned in two steps. First plasmid pcps1B32-1246-His6 (tac) was generated with the Q5 site-directed mutagenesis kit (New England Biolabs) according to the manufacturer's guidelines. Primers CL102/CL104 and pMBP-cps1B-His6 were used as template. Subsequently, plasmid pcps1B32-858-His6 (tac) was generated with the Q5 site-directed mutagenesis kit using primers CL128/CL129 and pcps1B32-858-His6 as template.
[0220] Mutations at positions D133/D135, H587 and H717 to alanine in Cps1B were introduced in plasmid pcps1B32-858-His6 (tac). Cps7D mutations at positions H612, H743, R1123 and K1132 to alanine were introduced in plasmid pMBP-cps7D-His6. All mutants were generated with the Q5 site-directed mutagenesis kit (New England Biolabs) and the respective primers shown in Table 3.
TABLE-US-00004 TABLE 4 Bacterial species, strains and proteins as well as plasmids and primers used. Heat-inactivated Genebank/uniprot strain used for Bacterial species Protein accession number gene amplification App Cps1B KY798410 4074 App Cps3D KY807157 S1421 App Cps7D B3GYR0 7074 App Cps12B Q69AA8 8329 Hi Ccs2 F6KWE2 ATC 9007 Encoded recombinant Molecular mass of the Plasmid protein protein (in kDa) Primer Restriction sites pMBP-cps1B-His MBP-Cps1B-His 190 CL57/CL59 BamHI/AvrII pMBP-cps3D-His MBP-Cps3D-His 177 CL147/CL148 BamHI/XhoI pMBP-cps7D-His MBP-Cps7D-His 192 CL74/CL94 BamHI/AvrII pMBP-cps12B-His MBP-Cps12B-His 146 CL33/CL56 BamHI/XhoI pccs2-His Ccs2-His 144 CL40/CL39 NdeI/XhoI .sup.pCp.sup.s1B.sub.32-1246.sup.-His .sup.Cps1B32-1246.sup.-His6 144 CL102/CL104 .sup.pCP.sup.s1 B32-858.sup.-His6 pCpS1B.sub.32-858-His.sub.6 99 CL128/CL129
Example 2: Expression and Purification of Recombinant Proteins
[0221] The expression and purification protocols were carried out as described in (14). Briefly, recombinant proteins were expressed in Escherichia coli M15[pREP4] in 500 mL expression cultures. Protein expression was induced at OD.sub.600 of 0.6-1.0 and the culture was further incubated at 15 C. and 200 rpm for 21 h. After harvesting the cells by centrifugation, the cell pellet was resuspended in lysis buffer (50 mM Tris, pH 8.0, 500 mM NaCl, 2 mM DTT, 0.2 mg/mL DNase (Roche), 0.1 mg/mL RNaseA (Roche), 0.1 mg/mL lysozyme (Serva) and EDTA free protease inhibitor (complete EDTA-free, Roche) and the cell suspension was additionally sonified (Branson Digital Sonifier, 50% amplitude, 830 s, interrupted by cooling on ice). Recombinant His.sub.6-tagged proteins were enriched by immobilized metal ion affinity chromatography and a subsequent elution of proteins using an imidazole gradient (25-500 mM imidazole over 20 min). Protein-containing fractions were pooled and applied to a size exclusion chromatography column (Superdex 10/300 GL, GE Healthcare) for further purification. Obtained protein solutions were stored at 80 C.
Example 3: Determination of the Oligomerization State
[0222] The oligomerization states of Cps1B wildtype and truncation constructs were determined via size exclusion chromatography (SEC). Protein standards (gel filtration markers kit, Sigma) used to calibrate the Superdex 200 10/300 GL column (GE Healthcare) were: Thyroglobulin (669 kDa), Apoferritin (443 kDa), R-Amylase (200 kDa), Alcohol Dehydrogenase (150 kDa), Albumin (66 kDa) and Carbonic Anhydrase (29 kDa). Elution volumes of protein standards normalized to the column void volume were plotted against the logarithm of their molecular weights. The equation of the standard plot obtained by linear regression was used to determine the observed molecular weight values (M.sub.obs) of the Cps1B constructs. The oligomerization states were obtained by division of the observed molecular weight by the theoretical molecular weights of the proteins.
Example 4: Activity Tests
[0223] Enzymatic activity reactions were carried out with 0.1-0.3 nmol of purified protein in a total volume of 75 pL assay buffer (20 mM Tris pH 8.0, 1 mM DTT, 10 mM MgCl.sub.2, 5-10 mM donor sugar). Donor sugars used were UDP-GlcNAc (Carbosynth), UDP-Gal (Carbosynth) and CDP-glycerol (racemic, from Sigma Aldrich). Reactions containing wildtype proteins were incubated for 24 h at 37 C. Activity tests of mutant constructs were incubated for only 3 h at 37 C. to minimize the spontaneous hydrolysis of donor-sugar.
Example 5: SDS Polyacrylamide Gel Electrophoresis (SDS-PAGE)
[0224] SDS polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described in (14).
Example 6: Analysis of Enzymatic Reactions Via HPLC and Polyacrylamide Gel Electrophoresis (PAGE)
[0225] HPLC-based anion exchange chromatography (HPLC-AEC) was performed on a Prominence UFLC-XR (Shimadzu) equipped with a CarboPac PA-100 column (2250 mm, Dionex). Samples were separated as described in (14), with the adjustment that 20 mM Tris pH 8.0 and 1 M NaCl, 20 mM Tris pH 8.0 were used as mobile phases M1 and M2, respectively. 6 L of the samples were loaded for the detection of nucleotides at 280 nm and 50 L for the detection of capsular polysaccharide at 214 nm. Nucleotides were separated using a linear elution gradient from 0 to 30% M2 over 11 min. Polysaccharides were separated using an elution gradient consisting of a 2 curved gradient from 0 to 30% M2 over 4 min followed by a linear gradient from 30 to 84% M2 over 33 min. Chromatography was conducted at 0.6 mL/min with a column temperature of 50 C. 4 L of Cps3D and Cps7D reaction samples mixed with 4 L of a 2 M sucrose solution were used for separation on high percentage (15%) PAGE and visualized by a combined alcian blue/silver staining procedure described in (18).
Example 7: Upscaling of the In Vitro Polysaccharide Synthesis and Subsequent Purification
[0226] For in vitro synthesis of 5-12 mg polysaccharide, 1-25 nmol protein were incubated over night at 37 C. in reaction buffer (20 mM Tris pH 8.0, 10 mM MgCl.sub.2, 1 mM DTT) with 6-10 mM of the activated sugars in a total volume of 5-10 mL. In vitro synthesized polysaccharide was purified by anion exchange chromatography (AEC) using a MonoQ HR10/100 GL column (GE Healthcare) and a linear NaCl gradient starting from 0 to 1 M NaCl at a flow rate of 1 mL/min. Polysaccharide containing fractions were pooled, dialyzed against water (ZelluTrans, Roth, 1 kDa MWCO) and freeze-dried before further analysis.
Example 8: NMR Analysis
[0227] All .sup.1H, .sup.13C and .sup.31P NMR experiments were recorded as previously described (14, 16). NMR experiments were recorded on a BrukerAvance III 400 MHz spectrometer equipped with a 5-mm broadband probe (Bruker). To specify the structures and to detect the .sup.13C chemical shifts, .sup.1H, .sup.13C heteronuclear single quantum coherence (HSQC), .sup.1H, .sup.1H correlated spectroscopy (COSY), .sup.1H, .sup.31P heteronuclear multiple bond correlation (HMBC), .sup.1H, .sup.1H nuclear overhauser enhancement spectroscopy (NOESY) and .sup.1H, .sup.1H total correlated spectroscopy (TOCSY) experiments were performed. The Bruker TopSpin 3.5p16 program was used to process NMR data.
Example 9: Bioinformatics
[0228] Homologs of CslB were identified by protein blast searches using the CslB sequence and the blastp algorithm on ncbi website (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The given structure prediction results for the TagF-like capsule polymerase family were obtained using the intensive mode of the structure prediction tool PHYRE.sup.2 (19). Sequence Alignments were performed with the Clustal Omega program (https://www.uniprot.org/align/ (21) or http://www.ebi.ac.uk/Tools/msa/clustalo/ (20)).
[0229] In detail, protein structure prediction was performed for each polypeptide sequence using the structure prediction software PHYRE.sup.2. Alignment of all GTA domains from SEQ ID NO. 28 (Fcs2), SEQ ID NO. 29 (Cps1B), SEQ ID NO. 30 (BtY31), SEQ ID NO. 31 (Ccs2), SEQ ID NO. 32 (Cps4B), SEQ ID NO. 41 (CslB) and SEQ ID NO. 42 (Cps12B) was performed with Clustal Omega (see above) and annotated with the Jalview software (
Example 10: Generation of Bt-188, Cps11D and Cps4B
[0230] The gene encoding the polymerase Cps11D (uniprot: EOFCQ3) was amplified by polymerase chain reaction (PCR) from heat-inactivated bacterial lysates of Actinobacillus pleuropneumoniae serotype 11 strain 56153 (Frey and Nicolet 1990, J. Clin. Microbiol. 28, 232-6) using the primers TF156 (GCATCTGGATCCTTATTAAAAAGCGAGAACTTTAAAATGAAACATAATG, SEQ ID NO. 78) and TF157 (GCATCTCTCGAGATTTGTTAATAATGAATAAAACTTCGCCATAGC, SEQ ID NO. 79) and subsequently cloned via BamHI/XhoI into the modified pMal-c vector pMBP-csxA-His6 mentioned in paragraph [00170], resulting in the plasmid pMBP-cps11D-His6.
[0231] The gene encoding the polymerase Cps4B (uniprot: F4YBG0) was amplified by PCR from heat-inactivated bacterial lysates of Actinobacillus pleuropneumoniae serotype 4 strain M62 (Frey and Nicolet 1990, J. Clin. Microbiol. 28, 232-6) using the primers IB 46 (GCTCCAATAACAATAACAACAACAATAACAATAACGGATCCAATAAAGTAAAACGTAAATTTA GAAAATTACTACGAGATCC, SEQ ID NO. 80) and IB 47 (GGTGGTGGTGGTGGTGCTCGAGGGCTTTCTCCGTGTATGAATAAAGTGTG, SEQ ID NO. 81) and cloned according to the restriction free protocol described in Bond and Naus 2012 (Nucleic Acids Res. 40, W209-13) into the modified pMal-c vector pMBP-csxA-His6 mentioned in paragraph [00170], resulting in the plasmid pMBP-cps4B-His6. Sanger sequencing demonstrated that the amplified cps4B gene contained two point mutations if compared to the sequence from the uniprot database (uniprot: F4YBG0). The mutations led to the amino acid exchanges A635T and R176S.
[0232] The protein sequence of Bt-188 was reverse translated into DNA (SEQ ID NO. 77) from the sequence deposited in the database (Genbank: AHG82487.1), synthesized and cloned into the expression vector pET-22b(+) via NdeI/XhoI, resulting in the plasmid pBt-188-His6.
[0233] The gene cps7B encoding the CTP:glycerol-3-phosphate cytidylyltransferase (GCT) from Actinobacillus pleuropneumoniae serotype 7 strain AP76 was amplified by PCR from heat-inactivated bacterial lysates using the primers TF116 (GCATCTCTCGAGCTCTTTTTCGTGAATTTGTTTTTGTC, SEQ ID NO. 82) and TF117 (GCATCTCATATGAAAAAAGTATTAACCTATGGAACC, SEQ ID NO. 83) and cloned into p1N37-cslB-His.sub.6 (Litschko et al. 2015, J. Biol. Chem. 290, 24355-56), replacing the cslB gene and resulting in the construct pcps7B-His6.
[0234] Expression and purification of all enzymes was performed as described in paragraph [00174], with the adjustment that the buffer for the Cps7B-His purification was changed to 10 mM Tris pH 8.0, 300 mM NaCl, 10% glycerol, 1 mM DTT.
[0235] Activity tests were performed as described in [00177]. 5 mM UDP-GalNAc (Sigma) and 5 mM UDP-Glc (Roche) were used as donor substrate in the Cps4B reaction. 5 mM CTP (Sigma) and 5 mM sn-glycerol-3-phosphate (Sigma) were used as substrates for the GCT reaction.
[0236] HPLC analysis was performed as described in paragraph [00178]. However, separation of nucleotides in the Cps11D and Bt-188 reaction was performed using a linear gradient from 0 to 25% M2 over 41 min.
[0237] The upscaled polymer synthesis was performed as described in [00180] with the adjustments that the reaction volume was 2.2-3.5 ml, the concentration of sugar donors, CTP and sn-glycerol-3-phosphate was 5 mM each. The polymer was purified by anion exchange chromatography (AEC) using a MonoQ HR10/100 GL column (GE Healthcare) at a flow rate of 6 ml/min using a combination of linear gradients: from 0 mM to 150 mM NaCl over 3 column volumes (CV) and from 150 mM to 1000 mM NaCl over 28.5 CV. NMR analysis was performed as previously described (Litschko et al. 2018, MBio. 9, e00641-18).
Example 11: Synthesis of an Enantiopure Polysaccharide
[0238] Cps7B-His6 (subsequently referred to as Cps7B or GCT) was cloned, expressed in E. coli and purified using affinity and size exclusion chromatography (
[0239] An HPLC-AEC assay was developed to confirm the CTP:glycerol-3-phosphate cytidylyltransferase activity of Cps7B. As expected, Cps7B converts its substrates CTP and sn-glycerol-3-phosphate (not UV-active at 280 nm) into enantiopure CDP-glycerol (brown chromatogram labeled GCT (Cps7B)). Small amounts of CDP in the reaction mixture can also be detected in the CTP control and are consequently not a side product of the GCT reaction. In the combined one-pot synthesis (green chromatogram labeled GCT (Cps7B)+polymerase (Cps7D)), Cps7B consumes CTP to generate CDP-glycerol, which, together with UDP-Gal, is in turn used up by the polymerase Cps7D to synthesize polymer. The nucleotide products of this reaction are UDP (resulting from the galactose transfer) and CMP (resulting from the sn-glycerol-3-phosphate transfer) (
[0240] Corresponding Alcian blue/silver stained PAGE was then used to visualize the polymer generated in the one-pot reaction (
Results
Example 12: Definition of the TagF-Like Capsule Polymerase Family
[0241] With the aim to analyze the conservation and to identify homologs of CslB, (i) protein blast searches using the CslB amino acid sequence (AEQ62070.1) was performed and (ii) the literature for linear CPS consisting of oligosaccharides connected through phosphodiesters was manually searched. The best score (99% query cover, 58% sequence identity) in the protein blast search was obtained for the putative glycosyltransferase Cps12B (AAS7749.1) from Actinobacillus pleuropneumoniae serotype 12 (App12). App12 expresses a CPS identical to the NmL-CPS consisting of a GlcNAc-trimer linked by a phosphodiester bond (22) (
[0242] Another hit was Ccs2 (AEC50903.1, 97% query cover, 33% sequence identity) from Haemophilus influenzae serotype c (Hic), which has been reported to express a CPS consisting of a disaccharide repeating unit composed of GlcNAc and Gal connected by a phosphodiester bond (23) (
[0243] Moreover, a multitude of strains were found that express a group II CPS in which the hexoses are not linked by phosphodiesters alone but through glycerol-phosphate moieties instead. Among them are NmH (28) and NmZ (29), E. coli K2 (30), App2 (31), App3 (32), App7 (33), App9 (34), App11 (35) as well as Bibersteinia trehalosi (Bt) T3 (36), T4 (37) and T15 (38) (former Mannheimia (Pasteurella) haemolytica) (39). Although some of these CPS are modified by glycosylation or O-acetylation, they appear to have highly similar polymer backbones (
[0244] Following the hypothesis that all of these CPS backbones are generated by homologs of CslB, it was analyzed the DNA sequence information of the above mentioned strains and identified putative capsule polymerases by their conserved location in the capsule gene cluster and their unusual length of more than 2500 bp per open reading frame (ORF) (
[0245] As a characteristic feature, all putative CPs contained a domain adopting a GT-B-like fold that was modeled with 100% confidence in each case onto the crystal structure of TagF, a teichoic acid polymerase from Staphylococcus epidermidis (15) (
[0246] Consequently, it was hypothesized that the TagF-like domain transfers the hexose-phosphate, N-acetylhexosamine-phosphate and glycerol-phosphate moieties of the polymers shown in
[0247] The GT-A fold was modeled (among others) onto the glucuronic acid transferase domain of the polymerase K4CP of E. coli K4, an enzyme synthesizing a chondroitin-like CPS (40). Consistent with the template being an inverting GT, the GT-A fold was only found in polymerases from strains expressing a capsular polymer in which a -glycosidic linkage is present (
[0248] In contrast, the GT-B fold, modeled (among others) onto the -glycosyltransferase TarM from Staphylococcus aureus, an enzyme modifying the glycerol moieties of teichoic acid (41), that is only present in strains expressing a CPS in which an -glycosidic linkage is present (
Example 13: Functional Testing of Recombinant Capsule Polymerases
[0249] Besides CslB, five representative of the TagF-like capsule polymerase family were selected for further analyses. Cps12B (App12) was chosen due to its GT-A/TagF-like architecture and high similarity to the already described CslB polymerase. Cps1B (App1) and Ccs2 (Hic) were selected as candidates generating a dimeric repeating unit and carrying a C-terminal TPR domain. Cps3D (App3) and Cps7D (App7) linking the glycerol at position 2 or 1, respectively, were chosen as TagF-like/GT-B folded variants (
[0250] In all reactions, the consumption of the activated donor substrates and the formation of the by-products (UMP or CMP and UDP) in the 280 nm channel (compare controls and reaction in
Example 14: Confirming the Identity of In Vitro Synthesized Polymers with the Natural Bacterial Capsules
[0251] To confirm the identity and to determine the detailed structure of the in vitro synthesized polymers by NMR spectroscopy, the in vitro polysaccharide production was scaled up. The resulting products were purified by preparative anion exchange chromatography (AEC) using a NaCl-gradient which enables the separation from other reaction components. The structure of the synthesized polysaccharide was determined by high resolution one- and two-dimensional .sup.1H, .sup.13C and .sup.31P NMR techniques.
[0252] The polymers synthesized in vitro by Cps1B (App1), Ccs2 (Hic), Cps3D (App3) and Cps7D (App7) were analyzed more extensively by .sup.1H-NMR, .sup.31P-NMR, .sup.1H, .sup.13C-HSQC, .sup.1H, .sup.31P-HMBC, 2D-COSY and selective NOESY and TOCSY experiments. To provide a clear and concise display of the findings, only the .sup.13C chemical shifts are presented in comparison to published reference spectra of the natural CPS (Table 5 and 6).
[0253] The backbone structures of the App1- and Hic-CPSs only differ by their position of the glycosidic linkages (
[0254] Table 5: Comparison of .sup.13C-chemical shifts of natural (n) and in vitro (iv) synthesized App1 and Hic polysaccharides. The chemical shift values of the natural App1 polymer (App1 n) and of the natural Hic polymer (Hic n) were taken from Altman et al. (24) and Branefors-Helander et al. (23), respectively. .sup.13C-chemical shifts of in vitro synthesized polymers were obtained from .sup.1H, .sup.13C-HSQC experiments.
TABLE-US-00005 .sup.13C chemical shifts glucosamine galactose C.sub.1 C.sub.2 C.sub.3 C.sub.4 C.sub.5 C.sub.6 C.sub.1 C.sub.2 C.sub.2 C.sub.4 C.sub.5 C.sub.6 ppm Comparison of natural (n) and in vitro (iv) synthesized App1 polymer App1 n (24) 101.8 56.2 73.9 74.9 75.9 61.3 96.7 69.1 69.6 69.7 71 67.9 App1 iv 101.7 56.3 73.9 74.8 75.9 61.3 96.8 69.1 69.4 70.0 71.0 67.8 Comparison of natural (n) and in vitro (iv) synthesized Hic polymer Hic n (23) 104.3 57 74.1 75.1 76.2 61.5 97.6 68.7 80.1 70.3 72.9 62.2 Hic iv 104.3 57.1 74.1 75.0 76.2 61.6 97.7 69.0 79.9 70.3 73.0 62.2
[0255] Due to the fact that the natural App3-capsule polymer is modified by glycosylation (
[0256] Table 6: Comparison of .sup.13C-chemical shifts of in vitro (iv) synthesized App3 and App7 polysaccharides and reference spectra (NmH, App7 n). The chemical shift values of natural NmH and App7 polymers were taken from van der Kaaden et al. (45) and Beynon et al. (33), respectively. .sup.13C-chemical shifts of in vitro synthesized polymers were obtained from .sup.1H, .sup.13C-HSQC experiments.
TABLE-US-00006 .sup.13C chemical shifts Galactose Glycerol C.sub.1 C.sub.2 C.sub.3 C.sub.4 C.sub.5 C.sub.6 C.sub.1 C.sub.2 C.sub.3 ppm Comparison of in vitro (iv) synthesized App3 and chemically identical NmH polymer NmH (45) 99.3 69.6 70 75.8 71.9 62.0 62.5 78.3 65.8 App3 iv 99.1 69.8 69.9 75.9 72.1 62.1 62.4 78.4 65.9 Comparison of natural (n) and in vitro (iv) synthesized App7 polymer App7 n (33) 99.3 68.5 75.6 75.8 71.2 61.6 69.5 70 67.5 App7 iv 99.1 68.1 75.7 69.1 71.5 61.8 69.1 70.0 67.2
Example 15: Truncational Studies of Cps1B and Relevance of the Tetratricopeptide Domain
[0257] Many TagF-like polymerases were predicted to contain a domain modeled on templates rich in tetratricopeptide repeats (TPRs) (
[0258] With the aim to obtain homogeneity prior to the truncation of the TPR domain, N-terminal sequencing of the major degradation product was performed and revealed a fragment truncated N-terminally by 31 amino acids. Thus, the N-terminal truncation construct Cps1B32.i246-His6 was first generated. Cps1B32_1246-His6 was still active and displayed increased homogeneity in SDS PAGE analysis (
[0259] To investigate if the TPR domain is necessary for enzymatic activity, the N-terminally and C-terminally truncated construct Cps1B32_858-His6 was subsequently generated. As expected, Cps1B32-858-His6 maintained its activity in the HPLC-AEC assay, but eluted as a monomer during SEC (
Example 16: Mutational Studies of TagF-Like Capsule Polymerase Family Members
[0260] The alignments in
[0261] Focusing on Cps1B (expressed as Cps1B32_858-His6) as representative of the polymerases that possess the GT-A/TagF-like architecture and on Cps7D (expressed as MBP-Cps7D-His6) as representative of the polymerases that possess the TagF-like/GT-B architecture, all conserved positions were mutated to alanine to give the single domain mutants Cps1B32-858(D133A/D135A), Cps1B32-858(H587A) and Cps1B32-85s(H717A) for Cps1B (
[0262] With the aim to verify the two-domain architecture of the TagF-like polymerase family and assuming that each single domain mutant should still contain one remaining functional domain, trans-complementation reactions were performed, combining the GT-A domain mutant and the TagF-like domain mutants of Cps1B as well as the TagF-like domain mutants and the GT-B domain mutants of Cps7D.
Example 17: Purification and Characterization of Bt-188
[0263] Coomassie-stained SDS-polyacrylamide gel showing the fractions collected during the purification of Bt-188-His6 by affinity chromatography (via its C-terminal His.sub.6-tag) and size exclusion chromatography (SEC) is depicted in
[0264] HPLC-AEC analysis of the Cps7B (GCT) and Bt-188 reaction is shown in
[0265] The polymer produced in the upscaled synthesis (see also B) was purified by AEC using a MonoQ column and a combination of linear NaCl gradients. Since the generated polymer is not UV-active, an Alcian blue/silver stained PAGE was used for visualization and to identify polymer containing fractions. The material eluting from the column is consistent with long, negatively charged polymer (
[0266] .sup.1H NMR analysis of the polymer produced in the upscaled synthesis after purification is shown in
[0267] Corresponding .sup.1H, .sup.13C HSQC NMR analysis is depicted in
TABLE-US-00007 TABLE 7 .sup.13C and .sup.1H chemical shifts (ppm) obtain from the .sup.1H, .sup.13C HSQC experiment. C1 C2 C3 C4 C5 C6 Gal 101.30 71.29 71.71 77.52 73.58 63.72 H1 H2 H3 H4 H5 H6 H6 Gal 5.00 3.90 3.98 4.55 4.04 3.77 3.73 C1 C2 C3 Gro 71.16 72.00 69.48 H1a H1b H2 H3a H3b Gro 3.82 3.63 4.11 4.05 3.98
Example 18: Purification and Characterization of Cps11D
[0268] Coomassie-stained SDS-polyacrylamide gel showing the fractions collected during the purification of MBP-Cps11D-His6 by affinity chromatography (via its C-terminal His.sub.6-tag) and size exclusion chromatography (SEC) is depicted in
[0269] HPLC-AEC analysis of the Cps7B (GCT) and Cps11D reaction is shown in
[0270] The polymer produced in the upscaled synthesis (see also B) was purified by AEC using a MonoQ column and a combination of linear NaCl gradients. Since the generated polymer is not UV-active, an Alcian blue/silver stained PAGE was used for visualization and to identify polymer containing fractions. The material eluting from the column is consisted with long, negatively charged polymer (
[0271] .sup.1H NMR analysis of the polymer produced in the upscaled synthesis after purification is shown in
[0272] Corresponding .sup.1H, .sup.13C HSQC NMR analysis is depicted in
TABLE-US-00008 TABLE 8 .sup.13C and .sup.1H chemical shifts (ppm) obtainfrom the .sup.1H, .sup.13C HSQC experiment. C1 C2 C3 C4 C5 C6 Gal 100.92 71.21 71.53 77.41 73.51 63.56 H1 H2 H3 H4 H5 H6 H6 Gal 5.22 3.90 3.98 4.54 4.18 3.76 3.76 C1 C2 C3 Gro 64.00 79.95 67.18 H1a H1b H2 H3a H3b Gro 3.79 3.79 3.97 4.12 4.06
Example 19: Purification and Characterization of Cps4B
[0273] Coomassie-stained SDS-polyacrylamide gel showing the fractions collected during the purification of MBP-Cps4B-His6 by affinity chromatography (via its C-terminal His.sub.6-tag) and size exclusion chromatography (SEC) is depicted in
[0274] HPLC-AEC analysis of the Cps4B reaction is shown in
[0275] The polymer produced in the upscaled synthesis (see also B) was purified by AEC using a MonoQ column and a combination of linear NaCl gradients (dotted line). The material eluting from the column is consisted with long, negatively charged polymer (
[0276] .sup.1H NMR analysis of the polymer produced by Cps4B after purification. The integrals (enclosed in square brackets) of isolated proton signals from the GalNAc and Glc moieties are consistent with a dimeric repeating unit (
[0277] Corresponding .sup.1H, .sup.13C HSQC NMR analysis is depicted in
TABLE-US-00009 TABLE 9 .sup.13C and .sup.1H chemical shifts (ppm) obtain from the .sup.1H, .sup.13C HSQC experiment. C1 C2 C3 C4 C5 C6 CH3 GalNAc 97.09 51.36 80.24 70.84 74.64 63.59 24.90 Glc 107.05 75.70 78.15 71.90 77.15 67.29 H1 H2 H3 H4 H5 H6 H6 CH3 GalNAc 5.50 4.38 4.07 4.32 4.16 3.80 3.76 2.06 Glc 4.60 3.31 3.50 3.49 3.55 4.18 4.10
DISCUSSION
[0278] These findings present the identification of a novel family of capsule polymerases, designated the TagF-like capsule polymerase family. Members of this family are abundant among pathogenic group II capsule expressing bacteria with human and animal hosts, e.g. Neisseria meningitidis (Nm), Actinobacillus pleuropneumoniae (App), Haemophilus influenzae (Hi), Bibersteinia trehalosi (Bt) and Escherichia coli (E. coli). Based on the recently characterized bifunctional and so far unprecedented protein CslB (14), homologs with similar protein architectures and enzymatic functions were found, some of them even having a new function of generating polysaccharides consisting of a dimeric repeating unit instead of synthesizing polysaccharides consisting of a trimeric repeating unit such as CslB and CPs12B.
[0279] By characterization of five further family members, the conserved functionality and architecture of TagF-like polymerases was proofed. After gene amplification, protein expression and purification of the selected candidates Cps1B of App1, Cps3D of App3, Cps7D of App7, Cps12B of App12 and Ccs2 of Hic, their capsule polymerase activities were analyzed (
[0280] To determine the bifunctionality and bipartite architecture of TagF-like polymerases, mutational studies were performed using representative candidates of the novel family. It was focused on Cps1B as representative of the polymerases possessing the GT-A/TagF-like architecture and on Cps7D as representative of the polymerases possessing the TagF-like/GT-B architecture (
[0281] The positions of mutations were selected based on the already identified catalytic positions of the template proteins, TagF (15), K4CP (40) and TarM (41), that were used for modeling the predicted protein structures. The TagF-like domain present in all TagF-like polymerases (
[0282] The GT-A fold of GT-A/TagF-like polymerases were modeled onto the glucuronic acid transferase domain of the polymerase K4CP from E. coli K4 (40). The DD motif that is highly conserved among GT-A folded proteins, interacts with the phosphate groups of the nucleotide donor sugars through the coordination of divalent cations (10, 40). As expected, mutating the DD motif in Cps1B resulted in an inactive enzyme (
[0283] Importantly, testing the mutants in trans-complementation reactions restored capsule polymerase activity (
[0284] In addition, the mutational studies corroborate the predicted GT-A/TagF-like and TagF-like/GT-B architecture of the polymerases and highlight the importance of the catalytic positions. GT-A folded proteins are dependent on divalent cations for the coordination of the negatively charged donor substrates (11). In contrast, conserved amino acids stabilize the negative charges of donor substrates in GT-B folded proteins and enable a cation-independent reaction mechanism (10). The cation-dependency and -independency of TagF-like capsule polymerases was analyzed using the HPLC-AEC assay. Again in agreement with the predicted folds, it could be demonstrated that polymerases with the TagF-like/GT-B architecture are active even in the absence of divalent cations, while the activity of polymerases adopting the GT-A/TagF-like architecture depend on the presence of magnesium ions (
[0285] The bioinformatics analyses indicate that the TagF-like domain catalyzes the transfer of the hexose-phosphate and glycerol-phosphate positions of the repeating units, whereas GT-A folds transfer hexose positions with inverted stereochemistry (-glycosidic linkages) and GT-B folds transfer hexose positions with retained stereochemistry (-glycosidic linkages) (
[0286] It was found that the TPR (tetratricopeptide repeat) domain predicted in the majority of TagF-like polymerases (
[0287] The CDP-glycerol used as substrate for the Cps3D and Cps7D reactions was a racemic mixture with regard to C2 of the glycerol. Interestingly, the NMR results clearly showed that both polymerases incorporate both enantiomers, although the natural capsule was reported to be enantiomerically pure (32, 33).
[0288] It is known that glycerol-phosphate resulting from CDP-glycerol has R-chirality (regarding C2 of glycerol) (sn-glycerol-3-phosphate), while phosphatidylglycerol is the source of sn-glycerol-1-phosphate (C2 of glycerol has S-chirality) in bacteria (49). It is thus tempting to speculate that the lacking pressure for the selection of sn-glycerol-3-phosphate allowed the polymerases to evolve a low specificity for enantiomerically pure glycerol-phosphate.
REFERENCES
[0289] 1. Willis, L. M., and Whitfield, C. (2013) Structure, biosynthesis, and function of bacterial capsular polysaccharides synthesized by ABC transporter-dependent pathways. Carbohydr. Res. 378, 35-44. [0290] 2. Roberts, I. S. (1996) The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu. Rev. Microbiol. 50, 285-315. [0291] 3. Geno, K. A., Gilbert, G. L., Song, J. Y., Skovsted, I. C., Klugman, K. P., Jones, C., Konradsen, H. B., and Nahm, M. H. (2015) Pneumococcal Capsules and Their Types: Past, Present, and Future. Clin. Microbiol. Rev. 28, 871-99. [0292] 4. Whitfield, C. (2006) Biosynthesis and assembly of capsular polysaccharides in Escherichia coli. Annu. Rev. Biochem. 75, 39-68. [0293] 5. Harrison, O. B., Claus, H., Jiang, Y., Bennett, J. S., Bratcher, H. B., Jolley, K. A., Corton, C., Care, R., Poolman, J. T., Zollinger, W. D., Frasch, C. E., Stephens, D. S., Feavers, I., Frosch, M., Parkhill, J., Vogel, U., Quail, M. A., Bentley, S. D., and Maiden, M. C. J. (2013) Description and Nomenclature of Neisseria meningitidis Capsule Locus. Emerg. Infect. Dis. 19, 566-573. [0294] 6. Jessing, S. G., Ahrens, P., Inzana, T. J., and Angen, O. (2008) The genetic organisation of the capsule biosynthesis region of Actinobacillus pleuropneumoniae serotypes 1, 6, 7, and 12. Vet. Microbiol. 129, 350-359. [0295] 7. Kroll, J. S., Zamze, S., Loynds, B., and Moxon, E. R. (1989) Common Organization of Chromosomal Loci for Production of Different Capsular Polysaccharides in Haemophilus influenzae. J. Bacteriol. 171, 3343-3347. [0296] 8. Guerry, P., Poly, F., Riddle, M., Maue, A. C., Chen, Y.-H., and Monteiro, M. A. (2012) Campylobacter polysaccharide capsules: virulence and vaccines. Front. Cell. Infect. Microbiol. 2, 7. [0297] 9. Lo, R. Y. C., McKerral, L. J., Hills, T. L., and Kostrzynska, M. (2001) Analysis of the capsule biosynthetic locus of Mannheimia (Pasteurella) haemolytica A1 and proposal of a nomenclature system. Infect. Immun. 69, 4458-4464. [0298] 10. Breton, C., Snajdrova, L., Jeanneau, C., Koca, J., and Imberty, A. (2006) Structures and mechanisms of glycosyltransferases. Glycobiology. 16, 29R-37R. [0299] 11. Lairson, L. L., Henrissat, B., Davies, G. J., and Withers, S. G. (2008) Glycosyltransferases: structures, functions, and mechanisms. Annu. Rev. Biochem. 77, 521-555 [0300] 12. Gloster, T. M. (2014) Advances in understanding glycosyltransferases from a structural perspective. Curr. Opin. Struct. Biol. 28, 131-141. [0301] 13. Sperisen, P., Schmid, C. D., Bucher, P., and Zilian, O. (2005) Stealth proteins: in silico identification of a novel protein family rendering bacterial pathogens invisible to host immune defense. PLoS Comput. Biol. 1, e63. [0302] 14. Litschko, C., Romano, M. R., Pinto, V., Claus, H., Vogel, U., Berti, F., Gerardy-Schahn, R., and Fiebig, T. (2015) The Capsule Polymerase CslB of Neisseria meningitidis Serogroup L Catalyzes the Synthesis of a Complex Trimeric Repeating Unit Comprising Glycosidic and Phosphodiester Linkages. J. Biol. Chem. 290, 24355-24366. [0303] 15. Lovering, A. L., Lin, L. Y.-C., Sewell, E. W., Spreter, T., Brown, E. D., and Strynadka, N. C. J. (2010) Structure of the bacterial teichoic acid polymerase TagF provides insights into membrane association and catalysis. Nat. Struct. Mol. Biol. 17, 582-589. [0304] 16. Fiebig, T., Berti, F., Freiberger, F., Pinto, V., Claus, H., Romano, M. R., Proietti, D., Brogioni, B., Stummeyer, K., Berger, M., Vogel, U., Costantino, P., and Gerardy-Schahn, R. (2014) Functional expression of the capsule polymerase of Neisseria meningitidis serogroup X: A new perspective for vaccine development. Glycobiology. 24, 150-158. [0305] 17. Kavoosi, M., Creagh, A. L., Kilburn, D. G., and Haynes, C. A. (1996) Strategy for Selecting and Characterizing Linker Peptides for CBM9-Tagged Fusion Proteins Expressed in Escherichia coli. Biotechnol. Bioeng. 98, 599-610. [0306] 18. Min, H., and Cowman, M. K. (1986) Combined alcian blue and silver staining of glycosaminoglycans in polyacrylamide gels: application to electrophoretic analysis of molecular weight distribution. Anal. Biochem. 2, 275-285. [0307] 19. Kelley, L. A., and Sternberg, M. J. E. (2009) Protein structure prediction on the Web: a case study using the Phyre server. Nat. Protoc. 4, 363-71. [0308] 20. Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez, R., Mcwilliam, H., Remmert, M., So Ding, J., Thompson, J. D., and Higgins, D. G. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 10.1038/msb.2011.75. [0309] 21. Boutet, E., Lieberherr, D., Tognolli, M., Schneider, M., Bansal, P., Bridge, A. J., Poux, S., Bougueleret, L., and Xenarios, I. (2016) UniProtKB/Swiss-Prot, the Manually Annotated Section of the UniProt KnowledgeBase: How to Use the Entry View, pp. 23-54, 10.1007/978-1-4939-3167-5_2. [0310] 22. Beynon, L. M., Richards, J. C., and Perry, M. B. (1991) Structural studies of the capsular polysaccharide from Actinobacillus pleuropneumoniae serotype 12. Carbohydr. Res. 212, 21927. [0311] 23. Branefors-Helander, P., Classon, B., Kenne, L., and Lindberg, B. (1979) Structural studies of the capsular antigen of Haemophilus infuenzae type c. Carbohydr. Res. 76, 197-202. [0312] 24. Altman, E., Brisson, J., and Perry, M. B. (1986) Structural studies of the capsular polysaccharide from Haemophilus pleuropneumoniae serotype 1. Biochem. Cell Biol. 64, 707716. [0313] 25. Altman, E., Brisson, J.-R., and Perry, M. B. (1988) Structural studies of the capsular polysaccharide from Actinobacillus (Haemophilus) pleuropneumoniae serotype 4. Biochem. Cell Biol. 66, 998-1004. [0314] 26. Branefors-Helander, P., Kenne, L., and Lindqvist, B. (1980) Structural studies of the capsular antigen from Haemophilus influenzae type f. Carbohydr. Res. 79, 308-12. [0315] 27. Egan, W., Tsui, F. P., and Schneerson, R. (1980) Structural studies of the Haemophilus influenzae type f capsular polysaccharide. Carbohydr. Res. 79, 271-7. [0316] 28. Michon, F., Roy, R., Jennings, H. J., and Ashton, F. E. (1984) Structural elucidation of the capsular polysaccharide of Neisseria meningitidis group H. [0317] 29. Jennpngs, H. J., Rosell, M.-G., and Paul K E N, D. C. Structural elucidation of the capsular polysaccharide antigen of Neisserk mmeningitidis sersgrcsup Z using I a 4: nuclear magnetic resonance. [0318] 30. Fischer, W., Schmidt, M. A., Jann, B., and Jann, K. (1982) Structure of the Escherichia coli K2 capsular antigen. Stereochemical configuration of the glycerophosphate and distribution of galactopyranosyl and galactofuranosyl positions. Biochemistry. 21, 1279-1784. [0319] 31. Altman, E., Brisson, J.-R., and Perry, M. B. (1987) Structural studies of the capsular polysaccharide from Haemophilus pleuropneumoniae serotype 2. Biochem. Cell Biol. 65, 414422. [0320] 32. Altman, E., Brisson, J. R., and Perry, M. B. (1987) Structure of the Capsular Polysaccharide of Hemophilus-Pleuropneumoniae Serotype 3. Eur. J. Biochem. 170, 185-192. [0321] 33. Beynon, L. M., Perry, M. B., and Richards, J. C. (1991) Structure of the capsular polysccharide from Actinobacillus pleuropneumoniae serotype 7. Carbohydr. Res. 209, 211-223. [0322] 34. Beynon, L. M., Richards, J. C., and Perry, M. B. (1992) Nuclear-magnetic-resonance analysis of the capsular antigen of Actinobacillus pleuropneumoniae serotype 9. Its identity with the capsular antigen of Escherichia coli K62 (K2ab), Neisseria meningitidis serogroup H and Pasteurella haemolytica serotype T15. Eur. J. Biochem. 210, 119-124. [0323] 35. Perry, M. B., Altman, E., Brisson, J. R., Beynon, L. M., and Richards, J. C. (1990) Structural characteristics of the antigenic capsular polysaccharides and lipopolysaccharides involved in the serological classification of Actinobacillus (Haemophilus) pleuropneumoniae strains. Serodiagn. Immunother. Infect. Dis. 4, 299-308. [0324] 36. Richards, J. C., and Leitch, R. A. (1990) Determination of the structure and absolute configuration of the glycerolphosphate-containing capsular polysaccharide of Pasteurella haemolytica serotype T 3 by high-resolution nuclear magnetic resonance spectroscopyl. Can. J. Chem. 68, 1574-1584. [0325] 37. Adlam, C., Knights, J. M., Mugridge, A., Lindon, J. C., and WilliamsS, J. M. (1985) Purification, Characterization and Immunological Properties of the Serotype-specific Capsular Polysaccharide of Pasteurella haemolytica (Serotype T4) Organisms. Microbiology. 131, 387394. [0326] 38. Adlam, C., Knights, J. M., Mugridge, A., Lindon, J. C., Williams, J. M., and Beesley, J. E. (1985) Purification, Characterization and Immunological Properties of the Capsular Polysaccharide of Pasteurella haemolytica Serotype T15: Its Identity with the K62 (K2ab) Capsular Polysaccharide of Escherichia coli and the Capsular Polysaccharide of Neisser. J. Gen. Microbiol. 62, 1963-1972. [0327] 39. Blackall, P. J., Bojesen, A. M., Christensen, H., and Bisgaard, M. (2007) Reclassification of [Pasteurella] trehalosi as Bibersteinia trehalosi gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 57, 666-674. [0328] 40. Osawa, T., Sugiura, N., Shimada, H., Hirooka, R., Tsuji, A., Shirakawa, T., Fukuyama, K., Kimura, M., Kimata, K., and Kakuta, Y. (2009) Crystal structure of chondroitin polymerase from Escherichia coli K4. Biochem. Biophys. Res. Commun. 378, 10-4. [0329] 41. Sobhanifar, S., Worrall, L. J., Gruninger, R. J., Wasney, G. A., Blaukopf, M., Baumann, L., Lameignere, E., Solomonson, M., Brown, E. D., Withers, S. G., and Strynadka, N. C. J. (2015) Structure and mechanism of Staphylococcus aureus TarM, the wall teichoic acid a-glycosyltransferase. Proc. Natl. Acad. Sci. U.S.A. 10.1073/pnas.1418084112. [0330] 42. D'Andrea, L. D., and Regan, L. (2003) TPR proteins: The versatile helix. Trends Biochem. Sci. 28, 655-662. [0331] 43. Jennings, H. J., Lugowsky, C. W., Ashton, F. E., and Ryan, J. A. (1983) The Structure of the Capsular Polysaccharide obtained from a new Serogroup (L) of Neisseria meningitidis. Carbohydr. Res. 112, 105-111. [0332] 44. Beynon, L. M., Richards, J. C., and Perry, M. B. (1991) Structural studies of the capsular polysaccharide Actinobacillus pleuropneumonias serotype 12. Carbohydr. Res. 212, 219-227. [0333] 45. van Der Kaaden, A., van Doorn-Van Wakeren, J. I. M., Kamerling, J. P., Vliegenthart, J. F., and Tiesjema, R. H. (1985) Structure of the capsular antigen of Neisseria meningitidis serogroup H. Eur. J. Biochem. 152, 663-668. [0334] 46. Blatch, G. L., and Lassie, M. (1999) The tetratricopeptide repeat: A structural motif mediating protein-protein interactions. BioEssays. 21, 932-939. [0335] 47. Schertzer, J. W., Bhaysar, A. P., and Brown, E. D. (2005) Two conserved histidine positions are critical to the function of the TagF-like family of enzymes. J. Biol. Chem. 280, 36683-36690. [0336] 48. Romanow, A., Haselhorst, T., Stummeyer, K., Claus, H., Bethe, A., Mhlenhoff, M., Vogel, U., Itzstein, M. Von, and Gerardy-Schahn, R. (2013) Biochemical and biophysical characterization of the sialyl-/ hexosyltransferase synthesizing the meningococcal serogroup W135 heteropolysaccharide capsule. J. Biol. Chem. 288, 11718-11730. [0337] 49. van der Es, D., Hogendorf, W. F. J., Overkleeft, H. S., van der Marel, G. A., and Codee, J. D. C. (2017) Teichoic acids: synthesis and applications. Chem. Soc. Rev. 10.1039/C6CS00270F. [0338] 50. Krncke, K. D., Golecki, J. R., Jann, K. & Kroncke, K.-D. Further Electron Microscopic Studies on the Expression of Escherichia coli Group II Capsules. J. Bacteriol. 172, 3469-3472 (1990). [0339] 51. Ophir, T. & Gutnick, D. L. A role for exopolysaccharides in the protection of microorganisms from desiccation. Appl. Environ. Microbiol. 60, 740-745 (1994). [0340] 52. Hill, D. J., Griffiths, N. J., Borodina, E. & Virji, M. Cellular and molecular biology of Neisseria meningitidis colonization and invasive disease. Clin. Sci. (Lond). 118, 547-64 (2010). [0341] 53. Costantino, P., Rappuoli, R. & Berti, F. The design of semi-synthetic and synthetic glycoconjugate vaccines. Expert Opin. Drug Discov. 6, 1045-66 (2011). [0342] 54. PROTEINSSTRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); POST-TRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York (1983), pgs. 1-12; Seifter, Meth. Enzymol. 182 (1990); 626-646, Rattan, Ann. NY Acad. Sci. 663 (1992); 48-62. [0343] 55. Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476.