DNA-peptide combination vaccine
10695420 ยท 2020-06-30
Assignee
Inventors
- Hironori Nakagami (Suita, JP)
- Ryuichi Morishita (Suita, JP)
- Hiroshi Koriyama (Suita, JP)
- Hideki Tomioka (Ibaraki, JP)
- Kenji Naohara (Osaka, JP)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2730/10122
CHEMISTRY; METALLURGY
C12N2730/10134
CHEMISTRY; METALLURGY
A61K39/292
HUMAN NECESSITIES
A61K39/0008
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention provides a combination preparation for inducing a specific immune response to an antigenic peptide, which contains (I) the antigenic peptide, and (II) an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide, into which the antigenic peptide has been inserted or added, wherein said antigenic peptide is inserted in a region of amino acid residues 74-87 or 130-138 of the hepatitis B virus core antigen polypeptide, or added to the N-terminal or C-terminal of the hepatitis B virus core antigen polypeptide, wherein the antigenic peptide of (I) and the expression vector of (II) are substantially simultaneously administered to a subject.
Claims
1. A combination for inducing a specific immune response to an angiotensin II peptide in a subject, which comprises (I) the angiotensin II peptide consisting of the amino acid sequence of DRVYIHPF (SEQ ID NO: 21), and (II) an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide, into which the angiotensin II peptide of (I) has been inserted or added, wherein the angiotensin II peptide of (I) is inserted in a region of amino acid residues 74-87 or 130-138 of the hepatitis B virus core antigen polypeptide, or added to the N-terminal or C-terminal of the hepatitis B virus core antigen polypeptide, wherein the angiotensin II peptide of (I) is cross-linked with a carrier protein, and wherein the angiotensin II peptide of (I) and the expression vector of (II) are substantially simultaneously administered to the subject.
2. The combination according to claim 1, wherein, in the chimeric hepatitis B virus core antigen polypeptide, the angiotensin II peptide of (I) is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.
3. The combination according to claim 1, which is formulated as a single preparation.
4. The combination according to claim 1, which is free of an adjuvant.
5. The combination according to claim 1, which is for the treatment or prophylaxis of cardiac failure, hypertension, renal failure, arteriosclerosis, myocardial infarction, cerebral infarction, arteriosclerosis obliterans, or dementia.
6. The combination according to claim 5, which is for the treatment or prophylaxis of cardiac failure caused by mitral insufficiency.
7. The combination according to claim 1, wherein the subject is human or a non-human mammal.
8. A method of inducing a specific immune response to an angiotensin II peptide in a subject, which comprises substantially simultaneously administering to the subject one or more times: (I) the angiotensin II peptide consisting of the amino acid sequence of DRVYIHPF (SEQ ID NO: 21), and (II) an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide, into which the angiotensin II peptide of (I) has been inserted or added, wherein the angiotensin II peptide of (I) is inserted in a region of amino acid residues 74-87 or 130-138 of the hepatitis B virus core antigen polypeptide, or added to the N-terminal or C-terminal of the hepatitis B virus core antigen polypeptide, and wherein the angiotensin II peptide of (I) is cross-linked with a carrier protein.
9. The method according to claim 8, wherein the carrier protein is Keyhole Limpet Hemocyanin (KLH).
10. The method according to claim 8, wherein the angiotensin II peptide of (I) and the expression vector of (II) are administered in a single dose.
11. The method according to claim 8, wherein the angiotensin II peptide of (I) and the expression vector of (II) are administered by the same administration route.
12. The method according to claim 11, wherein the angiotensin II peptide of (I) and the expression vector of (II) are administered subcutaneously, intradermally, or intramuscularly.
13. The method according to claim 8, wherein electroporation and/or a nucleic acid introduction reagent are/is used for administration of the angiotensin II peptide of (I) and the expression vector of (II).
14. The combination according to claim 1, wherein the carrier protein is KLH.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DESCRIPTION OF EMBODIMENTS
(23) The present invention provides a combination preparation for inducing a specific immune response to an antigenic peptide, which comprises (I) the antigenic peptide, and (II) an expression vector encoding a chimeric hepatitis B virus core antigen polypeptide, into which the antigenic peptide has been inserted or added, wherein said antigenic peptide is inserted in a region of amino acid residues 74-87 or 130-138 of the hepatitis B virus core antigen polypeptide, or added to the N-terminal or C-terminal of the hepatitis B virus core antigen polypeptide.
(24) Antigenic peptide refers to a peptide recognized by the immune system of a subject of administration, and having an activity to induce an immune response specific to the peptide, preferably, a humoral immune response specific to the peptide (i.e., production of antibody that specifically recognizes the peptide).
(25) Specific recognition of antigen X by antibody means that the binding affinity of the antibody to antigen X in an antigen-antibody reaction is higher than that to a non-specific antigen (e.g., BSA).
(26) The kind of the antigenic peptide to be used in the present invention is not particularly limited as long as it has antigenicity. Preferred is an autoantigen protein of a subject to whom the preparation of the present invention is applied, or a partial peptide thereof. In the present invention, an expression vector encoding a chimeric hepatitis B virus core (HBc) antigen polypeptide, into which the antigenic peptide has been inserted, wherein said antigenic peptide is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide is used. HBc antigen protein constitutes a spherical core particle by self-assembly. The core particle has very high immunogenicity. When a desired peptide is inserted between the amino acid residues 80 and 81 of the HBc antigen protein, the peptide is presented on the surface of the particles formed by self-assembly. Using the chimeric HBc antigen polypeptide, the inserted epitope is easily recognized by an immune system, and the production of an antibody that specifically recognizes the peptide can be efficiently induced. Therefore, utilizing the HBc antigen protein as a platform of vaccine makes it possible to induce even production of an antibody against an autoantigen protein or a partial peptide thereof that is difficult to be recognized by an immune system (D. C. Whitacre et al., Expert Rev. Vaccines, vol.8, no.11, pp.1565-1573, 2009; B. E. Clarke et al., Nature, vol.330, pp.381-384, 1987; JP-B-3228737).
(27) Autoantigen protein means an antigen protein encoded on a gene of a subject animal itself to whom the preparation of the present invention is applied. The application subject of the preparation of the present invention is a mammal. Examples of the mammal include rodents such as mouse, rat, hamster, guinea pig and the like, lagomorphas such as rabbit and the like, ungulates such as swine, bovine, goat, horse, sheep and the like, carnivore such as dog, cat and the like, primates such as human, monkey, Macaca mulatta, Macaca fascicularis, marmoset, orangutan, chimpanzee and the like, and the like. The mammal is preferably a carnivore (dog, cat etc.) or a primate (human etc.). Therefore, for example, when the preparation of the present invention is applied to human, use of human autoantigen protein or a partial peptide thereof is preferably intended, but is not limited thereto. In addition, when the preparation of the present invention is applied to dog, use of an autoantigen protein of the dog or a partial peptide thereof is preferably intended, but is not limited thereto. Furthermore, when the preparation of the present invention is applied to cat, use of an autoantigen protein of the cat or a partial peptide thereof is preferably intended, but is not limited thereto.
(28) In the present specification, regarding the particular factor X (polypeptide or polynucleotide), factor X derived from organism Y or organism Y factor X means that the amino acid sequence or nucleic acid sequence of factor X has the same amino acid sequence or nucleic acid sequence as the amino acid sequence or nucleic acid sequence of factor X naturally expressed in organism Y.
(29) The kind of the autoantigen protein is not particularly limited. In one embodiment, it is an antigen that contributes to the exacerbation of a disease. In this embodiment, when the preparation of the present invention is administered to a subject, an immune response specific to the autoantigen protein or a partial peptide thereof, preferably, a humoral immune response specific to the peptide (i.e., production of antibody that specifically recognizes the peptide), is induced, and the activity of the autoantigen protein is neutralized by the antibody, whereby the disease exacerbated by the involvement of the autoantigen protein can be prevented or treated.
(30) In one embodiment, an autoantigen protein is an antigen that contributes to the exacerbation of a lifestyle-related disease (a lifestyle-related disease-associated factor). In the present specification, the lifestyle-related disease is a generic term of the diseases caused by lifestyle such as dietary habits, exercise habits, rest, smoking, alcohol drinking and the like. Examples of the lifestyle-related disease include hypertension, hyperlipidemia, diabetes, insulin resistance, arteriosclerosis (arteriosclerosis obliterans etc.), ischemic disease (myocardial infarction, cerebral apoplexy etc.), obesity, diabetic retinopathy, high LDLemia and the like. In the preparation of the present invention, by using a lifestyle-related disease-associated factor or a partial peptide thereof as an antigenic peptide, the lifestyle-related disease can be treated or ameliorated by inducing production of an antibody to a lifestyle-related disease-associated factor and neutralizing the lifestyle-related disease-associated factor by the antibody.
(31) In one embodiment, the autoantigen protein is a humoral factor. Using a humoral factor protein as an autoantigen protein, rather than an intracellular protein or cellular surface protein, humoral immunity to the humoral factor is predominantly induced, and the activity of the humoral factor can be effectively neutralized while avoiding an adverse influence of the induced immunity (cellular immunity and humoral immunity, particularly cellular immunity) on normal tissues.
(32) While autoantigen protein as a humoral factor that contributes to the exacerbation of a disease (e.g., lifestyle-related disease) is not particularly limited, for example, angiotensin II, angiotensin I, ACE, renin, cholesteryl ester transfer protein (CETP), VEGF (VEGF-A, B, C, D or E, PLGF-1, or PLGF-2), angiopoietin-2, apolipoprotein (a), proprotein convertase subtilisin/kexin type 9 (PCSK9), DPP4 (Dipeptidyl Peptidase-4), IL-17 (interleukin17) and the like can be mentioned. Angiotensin II, angiotensin I, ACE and renin contribute to the exacerbation of cardiac failure, hypertension, hyperlipidemia, and renal failure. CETP contributes to the exacerbation of hyperlipidemia. VEGF and angiopoietin-2 promote tumor angiogenesis, and contribute to the exacerbation of cancer (particularly solid tumor). Apolipoprotein (a) contributes to the exacerbation of arteriosclerosis (particularly, atherosclerosis). PCSK9 is involved in high LDLemia. DPP4 is involved in diabetes and insulin resistance. IL-17 is involved in autoimmune diseases and inflammatory diseases such as rheumatism, SLE, ulcerative colitis and the like, and cancer.
(33) The size of the antigenic peptide to be used in the present invention is generally 5-30 amino acids, preferably 6-25 amino acids, more preferably 10-18 amino acids, furthermore preferably 11-16 amino acids. When the peptide is too short, the antigenicity may be lost. When the peptide is too long, chimeric hepatitis B virus core antigen polypeptides do not easily form a core particle due to self-assembly, as a result of which production of an antibody that specifically recognizes the peptide may not be induced effectively.
(34) When a partial peptide of an autoantigen protein is used as an antigenic peptide in the present invention, the partial peptide is preferably specific to the autoantigen protein. Being specific means that a gene product other than the autoantigen protein (excluding variable regions of immunoglobulin and T cell receptor), which is naturally expressed in a mammal from which the autoantigen protein is derived, does not contain the partial peptide.
(35) When a partial peptide of an autoantigen protein is used as an antigenic peptide in the present invention, as the partial peptide to be used, one at a position where the activity of the autoantigen protein is inhibited when an antibody that recognizes the partial peptide binds to the partial peptide in the autoantigen protein, is preferably selected. Such partial peptide can be in a functional site, for example, receptor binding site, divalent ion binding site, site recognized by a specific enzyme and the like. A partial peptide contained in a site removed during the maturation process of protein such as signal sequence and the like, is preferably excluded from partial peptide to be used in the present invention. Those of ordinary skill in the art can select appropriate partial peptide based on the steric structures and the like of autoantigen protein.
(36) When a partial peptide of an autoantigen protein is used as an antigenic peptide in the present invention, specific examples of the partial peptide include the following. (VEGF) (WO 2014/034735 A1)
(37) TABLE-US-00001 a) (SEQIDNO:1) IMRIKPHQSQHIG b) (SEQIDNO:2) MRIKPHQ c) (SEQIDNO:3) MQIMRIKPHQSQHIGEM
d) peptide consisting of a partial sequence of amino acid sequence shown in SEQ ID NO: 3, which contains the amino acid sequence shown in SEQ ID NO: 1 or 2
(38) TABLE-US-00002 e) (SEQIDNO:4) IMRIKPHQGQHIG f) (SEQIDNO:5) MRIKPHQ g) (SEQIDNO:6) MQIMRIKPHQGQHIGEM
h) a peptide consisting of a partial sequence of the amino acid sequence shown in SEQ ID NO: 6, which contains the amino acid sequence shown in SEQ ID NO: 4 or 5
(39) SEQ ID NOs: 1, 2 and 3 are partial amino acid sequences of mouse VEGF-A. SEQ ID NOs: 4, 5 and 6 are partial amino acid sequences of human VEGF-A.
(40) The length of the partial sequence in the above-mentioned (d) and (h) is 8, 9, 10, 11, 12, 13, 14, 15 or 16 amino acids. (angiopoietin-2) (WO 2014/034735 A1)
(41) TABLE-US-00003 a) (SEQIDNO:7) PQRQNTNKFNGIKWYY b) (SEQIDNO:8) YYPQRQNTNKE
(42) SEQ ID NOs: 7 and 8 are partial amino acid sequences of human angiopoietin-2. (angiotensin II) (WO 2003/031466 and Journal of Hypertension, vol.25, no.1, pp. 63-72, 2007)
(43) TABLE-US-00004 a) (SEQIDNO:9) CGGDRVYIHPF b) (SEQIDNO:10) CGGDRVYIHPFHL c) (SEQIDNO:11) DRVYIHPFHLGGC d) (SEQIDNO:12) CDRVYIHPFHL e) (SEQIDNO:13) CHPFHL f) (SEQIDNO:14) CGPFHL g) (SEQIDNO:15) CYIHPF h) (SEQIDNO:16) CGIHPF i) (SEQIDNO:17) CGGHPF j) (SEQIDNO:18) CRVYIGGC k) (SEQIDNO:19) DRVYGGC 1) (SEQIDNO:20) DRVGGC m) (SEQIDNO:21) DRVYIHPF
(44) a)-l) are peptides containing a partial amino acid sequence of angiotensin II. m) is a full-length peptide of angiotensin II. Preferably, DRVYIHPF (SEQ ID NO: 21) is used as an antigenic peptide. When the peptide is used, an antibody having higher specificity to angiotensin II than angiotensin I is induced. Since the amino acid sequence of angiotensin II is common to human, dog, cat, mouse, and rat, each peptide of a)-m) is applicable to not only human but also dog, cat, mouse, and rat. (cholesteryl ester transfer protein (CETP)) (Vaccine, vol.24, pp. 4942-4950, 2006)
(45) TABLE-US-00005 a) (SEQIDNO:22) RDGFLLLQMDFGFPEHLLVDFLQSL
(46) a) is a partial peptide of human, mouse or rabbit CETP. (apolipoprotein (a))
(47) TABLE-US-00006 a) (SEQIDNO:23) EAPSEQAPTEQR
(48) SEQ ID NO: 23 is a partial amino acid sequence of human apolipoprotein (a). (DPP4) (Proc Natl Acad Sci USA. 2014 Apr. 1; 111(13):E1256-63)
(49) TABLE-US-00007 a) (SEQIDNO:33) SKDEAAADSRRT b) (SEQIDNO:34) KSTFRVKSYS c) (SEQIDNO:35) ENSTFESFG
(50) a)-c) are partial peptides of mouse DPP4 (a:29-40aa, b:48-57aa, c:89-97aa). (IL-17) (Immunotherapy, vol. 4, no. 12, 1799-1807, 2012)
(51) TABLE-US-00008 a) (SEQIDNO:36) SSACPNTEAKD b) (SEQIDNO:37) KVSSRRPSDYLNRSTS c) (SEQIDNO:38) HRNEDPDRYPSVIWE d) (SEQIDNO:39) KREPESCPFT e) (SEQIDNO:40) EKMLVGVGCTCVASI
(52) a)-e) are partial peptides of mouse IL-17.
(53) Partial peptides of human ortholog proteins corresponding to the aforementioned partial peptides of non-human mammal proteins may also be useful as an antigenic peptide. Those of ordinary skill in the art can easily identify such antigenic peptide by aligning the amino acid sequence of a protein of a non-human mammal with the amino acid sequence of a human ortholog protein, and specifying a region in the amino acid sequence of the human ortholog protein, which corresponds to the partial peptide to be noted.
(54) In the preparation of the present invention, the antigenic peptide of (I) is preferably isolated. The isolation means that an operation to remove factors other than the target cell or component has been performed, and the native state no longer exists. The purity of the isolated antigenic peptide X (percentage (weight/weight) of antigenic peptide X in the total peptide amount) is generally not less than 70%, preferably not less than 80%, more preferably not less than 90%, still more preferably not less than 99%, most preferably 100%.
(55) In the preparation of the present invention, the antigenic peptide of (I) may form a complex by being crosslinked to a carrier protein such as bovine serum albumin, KLH (Keyhole Limpet Hemocyanin), VLP (Virus like particle) and the like, to be more easily recognized by the immune system, and contained in the preparation of the present invention. In this case, the purity of the isolated antigenic peptide X is calculated as the purity of the isolated complex.
(56) A method of crosslinking the antigenic peptide to a carrier protein is not particularly limited, and a well-known protein crosslinking agent may be used therefor. Examples of the protein crosslinking agent include, but are not limited to, aldehyde (e.g., glutaraldehyde, para-formaldehyde, formaldehyde etc.), hetero divalent reactive crosslinker (ANB-NOS, BMPS, EMCS, GMBS, LC-SPDP, MBS, PDPH, SBA, SIA, SMCC, SMPB, SMPH, SPDP, Sulfo-LC-SPDP, Sulfo-MBS, Sulfo-SANPAH, Sulfo-SMCC etc.), homo divalent reactive crosslinker (BS2G, BS3, DSG, DSP, DSS, DSSeb, DST, DTSSP, EGS, Sulfo-EGS etc.), crosslinker with spacer arm with zero length (CDI, DCC, EDC-HCL, NHS, Sulfo-NHS etc.), deuteration crosslinker (BS2G-d4, BS3-d4, ESG-d4, DSP-d8, DSS-d4 etc.) and the like. A preferable protein crosslinking agent is aldehyde (glutaraldehyde etc.).
(57) When the antigenic peptide does not contain a cysteine residue, a sulfhydryl group may be introduced to facilitate crosslinking, by adding cysteine to the terminal of the antigenic peptide.
(58) In addition, to stably present an antigenic peptide on the complex while maintaining its structure, and facilitate access of an antibody to the antigenic peptide, a spacer sequence may be introduced into the terminal of the antigenic peptide. While the length of the spacer sequence is not limited as long as the antigenicity of the antigenic peptide is not impaired, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids.
(59) In one embodiment, the antigenic peptide and the carrier protein (KLH etc.) are fixed with aldehyde (glutaraldehyde etc.), without adding a spacer sequence to the terminal of the antigenic peptide.
(60) Hepatitis B virus core antigen polypeptide used in the present invention is (1) a polypeptide containing the amino acid sequence shown by SEQ ID NO: 24, or (2) a polypeptide containing an amino acid sequence having not less than 90% (preferably not less than 95%, more preferably not less than 97%, still more preferably not less than 99%) identity with the amino acid sequence shown by SEQ ID NO: 24, and having an activity to form a core particle due to self-assembly.
(61) Self-assembly refers to a phenomenon wherein molecules dissolved in a solution associate to form an assembly. Core particle refers to a rigid structure having a specific repetitive constitution. In the present specification, the core particle may be a product of synthesis steps or a product of biological steps.
(62) As the polypeptide of the embodiment of (2), a polypeptide containing the amino acid sequence shown by SEQ ID NO: 25 disclosed in WO 2003/031466 can be mentioned. A polypeptide containing the amino acid sequence shown by SEQ ID NO: 25 except that one or plural cysteine residues at the positions 48, 61, 107 and 185 are deleted or substituted by other amino acid residue (e.g., serine residue) is also preferable as the polypeptide of the embodiment of (2). As recognized by those of ordinary skill in the art, in a polypeptide having an amino acid sequence different from that of SEQ ID NO: 25, cysteine residues at similar positions can be deleted or substituted by other amino acid residues, and polypeptides obtained by such deletion or substitution are also encompassed in the polypeptide of the embodiment of (2).
(63) The polypeptide of the embodiment of (2) also encompasses a variant polypeptide wherein the isoleucine residue at the position corresponding to the position 97 of SEQ ID NO: 25 is substituted by leucine residue or phenylalanine residue (Yuan et al., J. Virol. vol. 73, pages 10122-10128 (1999)). In addition, amino acid sequences of many HBcAg variants and several kinds of hepatitis B core antigen precursor variants are disclosed in GenBank reports AAF121240, AF121239, X85297, X02496, X85305, X85303, AF151735, X85259, X85286, X85260, X85317, X85298, AF043593, M20706, X85295, X80925, X85284, X85275, X72702, X85291, X65258, X85302, M32138, X85293, X85315, U95551, X85256, X85316, X85296, AB033559, X59795, X8529, X85307, X65257, X85311, X85301, X85314, X85287, X85272, X85319, AB010289, X85285, AB010289, AF121242, M90520, P03153, AF110999 and M95589 (each of the disclosures is incorporated in the present specification by reference), and polypeptides containing amino acid sequences of these variants are also encompassed in the polypeptide of the embodiment of (2). The above-mentioned variants have amino acid sequences different at many positions including amino acid residues corresponding to the amino acid residues present at the positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO: 25.
(64) Furthermore, polypeptides containing the amino acid sequences of the HBcAg variants described in WO 01/98333, WO 01/77158 and WO 02/14478, all of which are incorporated in the present specification by reference are also encompassed in the polypeptide of the embodiment of (2).
(65) In Pumpens et al. Intervirology 2001; 44:98-114, the kind of substitutable amino acid in each amino acid residue in hepatitis B virus core antigen polypeptide is described. Based on the information, those of ordinary skill in the art can easily design the polypeptide of the embodiment of (2) by substituting one or multiple amino acids in the amino acid sequence shown in SEQ ID NO: 24 to other amino acid(s).
(66) In the present specification, unless particularly indicated, the positions of amino acid residues in the amino acid sequence of hepatitis B virus core antigen polypeptide are specified with the amino acid sequence shown by SEQ ID NO: 24 as the standard. When a polypeptide does not contain the amino acid sequence shown by SEQ ID NO: 24, the amino acid sequence of the polypeptide is aligned with the amino acid sequence shown by SEQ ID NO: 24, and the position of the corresponding amino acid residue is adopted.
(67) The hepatitis B virus core antigen polypeptide used in the present invention is preferably a polypeptide containing the amino acid sequence shown by SEQ ID NO: 24.
(68) In the preparation of the present invention, in the chimeric hepatitis B virus core antigen polypeptide encoded by the expression vector of (II), the antigenic peptide is inserted in the region of amino acid residues 74-87 or 130-138 in the hepatitis B virus core antigen polypeptide, or added to the N-terminal or C-terminal of the hepatitis B virus core antigen polypeptide. Since the region of amino acid residues 74-87 or 130-138 in the hepatitis B virus core antigen polypeptide is a B cell epitope of the hepatitis B virus core antigen polypeptide (Pumpens et al. Intervirology 2001; 44:98-114), insertion of the antigenic peptide in this region is expected to efficiently induce production of an antibody against the antigenic peptide. Preferably, in chimeric hepatitis B virus core antigen polypeptide, the antigenic peptide is inserted between the amino acid residues 80 and 81 of the hepatitis B virus core antigen polypeptide.
(69) In an embodiment of chimeric hepatitis B virus core antigen polypeptide wherein the antigenic peptide is inserted in the region of amino acid residues 74-87 or 130-138 of the hepatitis B virus core antigen polypeptide, the chimeric hepatitis B virus core antigen polypeptide to be used in the present invention contains the following elements (a)-(c): (a) N-terminus part polypeptide residues of hepatitis B virus core antigen polypeptide (consisting of the continuous partial amino acid sequence of hepatitis B virus core antigen polypeptide from N-terminus to the amino acid residue x) (wherein X is any integer selected from the group consisting of 74-86 and 130-137, preferably 80), (b) an antigenic peptide residue, and (c) C-terminus partial polypeptide residues of hepatitis B virus core antigen polypeptide (consisting of the continuous partial amino acid sequence of hepatitis B virus core antigen polypeptide from the amino acid residue Y to C-terminus) (wherein Y is an integer of X plus 1, preferably 81) in the order of (a), (b), (c) from the N terminus side.
(70) The chimeric hepatitis B virus core antigen polypeptide to be used in the present invention having the above-mentioned constitution forms a core particle due to self-assembly, and the antigenic peptide residue is presented on the outside of the particle.
(71) The amino acid sequence inserted between constituent element (a) and constituent element (c) may further contain, in addition to constituent element (b) (antigenic peptide residue), one or more (preferably 1-3, more preferably 1) other antigenic peptide residues. A further antigenic peptide residue may be inserted at any position between constituent element (a) and constituent element (b), or constituent element (b) and constituent element (c). The length of the further antigenic peptide residue is generally 5-30 amino acids, preferably 6-25 amino acids, more preferably 10-18 amino acids, furthermore preferably 11-16 amino acids.
(72) When plural antigenic peptide residues are inserted between constituent element (a) and constituent element (c), the antigenic peptide residues may be directly linked by a covalent bond, or linked via a spacer sequence. The spacer sequence means an amino acid sequence containing one or more amino acid residues to be inserted between two adjacent constituent elements contained in the chimeric hepatitis B virus core antigen polypeptide. The antigenic peptide residues are preferably linked via a spacer sequence so that plural antigenic peptide residues can be stably presented while maintaining their structures. The length of the spacer sequence is not limited as long as the chimeric hepatitis B virus core antigen polypeptide forms a core particle by self-assembly, and all inserted antigenic peptide residues are presented outside the particle, and is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids.
(73) An antigenic peptide residue on the most N-terminus side between constituent element (a) and constituent element (c), and constituent element (a) may be directly linked by a covalent bond or via a spacer sequence. The element (a) and the antigenic peptide residue on the most N-terminus side are preferably linked via a spacer sequence so that the antigenic peptide will be stably presented on the outside of the particle formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. While the length of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms a core particle due to self-assembly and the antigenic peptide is presented on the outside of the particle, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms a core particle due to self-assembly and the antigenic peptide is presented on the outside of the particle. Examples of a preferable spacer sequence include, but are not limited to, IT, GAT, CGG and the like.
(74) An antigenic peptide residue on the most C-terminus between constituent element (a) and constituent element (c), and constituent element (c) may be directly linked by a covalent bond or via a spacer sequence. The antigenic peptide residue on the most C-terminus side and the element (c) are preferably linked via a spacer sequence so that the antigenic peptide will be stably presented on the outside of the particle formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. While the length of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms a core particle due to self-assembly and a antigenic peptide is presented on the outside of the particle, it is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms a core particle due to self-assembly and a antigenic peptide is presented on the outside of the particle. Examples of a preferable spacer sequence include, but are not limited to, IT, GAT, CGG and the like.
(75) The length of the amino acid sequence inserted between constituent element (a) and constituent element (c) is not particularly limited as long as chimeric hepatitis B virus core antigen polypeptide forms a core particle due to self-assembly, an antigenic peptide is presented on the outside of the particle, and specific immune response to the antigenic peptide can be induced, and is generally 5-80 amino acids. When the inserted amino acid sequence is too short, the antigenicity as an epitope may be lost. When the inserted amino acid sequence is too long, formation of core particle by chimeric hepatitis B virus core antigen polypeptide due to self-assembly becomes difficult, as a result of which an antibody specifically recognizing the antigenic peptide may not be produced.
(76) In an embodiment wherein the target antigenic peptide is added to the N-terminal or C-terminal of the hepatitis B virus core antigen polypeptide, the antigenic peptide and the hepatitis B virus core antigen polypeptide may be directly linked by a covalent bond or via a spacer sequence. The antigenic peptide and hepatitis B virus core antigen polypeptide are preferably linked via a spacer sequence so that the antigenic peptide will be stably presented on the outside of the core particle formed by self-assembly of chimeric hepatitis B virus core antigen polypeptides, while maintaining its structure. The length of the spacer sequence is not limited as long as the chimeric hepatitis B virus core antigen polypeptide forms a core particle by self-assembly, and antigenic peptide is presented outside the particle, and is generally 1-10 amino acids, preferably 1-5 amino acids, more preferably 1-3 amino acids, most preferably 2 or 3 amino acids. Also, the kind of the spacer sequence is not limited as long as chimeric hepatitis B virus core antigen polypeptide forms a core particle due to self-assembly and antigenic peptide is presented on the outside of the particle.
(77) In the preparation of the present invention, the expression vector of (II) is a recombinant vector incorporating a polynucleotide encoding the above-mentioned chimeric hepatitis B virus core antigen polypeptide. When the expression vector is administered to a target mammal, the expression vector is incorporated into a cell of the target mammal, and the cell expresses the above-mentioned chimeric hepatitis B virus core antigen polypeptide. Examples of the expression vector inserted with polynucleotide encoding chimeric hepatitis B virus core antigen polypeptide include plasmid, virus, phage, cosmid and other vectors conventionally used in the art. Examples of the plasmid vector include, but are not limited to, pCAGGS (Gene 108: 193-199 (1991)), pCR-X8 (Vaccine 24: 4942-4950 (2006)), pcDNA3.1 (trade name, Invitrogen), pZeoSV (trade name, Invitrogen), pBK-CMV (trade name, Stratagene), pVAX1 (trade name, Life Technologies) and the like. The virus vector is a DNA virus or an RNA virus. Examples of the virus vector include, but are not limited to, detoxicated retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, polio virus, Sindbis virus, Hemagglutinating Virus of Japan (HVJ), SV40, human immunodeficient virus (HIV) and the like. Furthermore, Hemagglutinating Virus of Japan envelope (HVJ-E) and the like can also be utilized.
(78) In the above-mentioned expression vector, polynucleotide (preferably DNA) encoding chimeric hepatitis B virus core antigen polypeptide is operably linked to a promoter capable of exhibiting a promoter activity in the cell of a mammal (preferably human, dog, or cat) to be the administration subject.
(79) The promoter to be used is not particularly limited as long as it can function in the cell of a mammal to be the administration subject. Examples of the promoter include pol I promoter, pol II promoter, pol III promoter and the like. Specifically, virus promoters such as SV40-derived initial promoter, cytomegalovirus LTR and the like, mammal constitutive protein gene promoters such as -actin gene promoter and the like, RNA promoters such as tRNA promoter and the like, and the like are used.
(80) The above-mentioned expression vector preferably contains a transcription termination signal, i.e., terminator region, at the downstream of the polynucleotide encoding chimeric hepatitis B virus core antigen polypeptide. It can further contain a selection marker gene for the selection of a transformed cell (gene conferring resistance to drugs such as tetracycline, ampicillin, kanamycin and the like, gene complementing auxotrophic mutation etc.).
(81) In one embodiment, the above-mentioned expression vector may contain an immune stimulatory sequence (ISS) (also referred to as CpG) to potentiate the immune effect. The immune stimulatory sequence is a DNA containing a non-methylated CpG motif of bacterium, and is known to function as a ligand of a particular receptor (Toll-like receptor 9) (see Biochim. Biophys. Acta 1489, 107-116 (1999) and Curr. Opin. Microbiol. 6, 472-477 (2003) for the detail). Preferable examples of the immune stimulatory sequence include the following.
(82) TABLE-US-00009 CpG-B101822bp (SEQIDNO:26) 5-tgactgtgaacgttcgagatga-3 CpG-AD1920bp(Dtype) (SEQIDNO:27) 5-ggtgcatcgatgcagggggg-3 CpG-CC27421bp (SEQIDNO:28) 5-tcgtcgaacgttcgagatgat-3 CpG-CC69525bp (SEQIDNO:29) 5-tcgaacgttcgaacgttcgaacgtt-3
(83) Alternatively, 2, 3 or 4 from these ISSs may be ligated and used. Preferable examples of the ligated ISS sequence include the following. 5-ggt gca tcg atg cag ggg gg tga ctg tga acg ttc gag atg a tcg tcg aac gtt cgagat gat tcg aac gtt cga acg ttc gaa cgt t-3 (SEQ ID NO: 30)
(84) Those of ordinary skill in the art can construct the aforementioned expression vector according to well-known genetic engineering techniques described in, for example, edit. Sambrook et al., Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory (1989) N.Y., edit. Ausubel et al., Current Protocols in Molecular Biology (1987) John Wiley & Sons and the like.
(85) The preparation of the present invention may be a single preparation obtained by simultaneously formulating the antigenic peptide of (I) and the expression vector of (II), or may be a combination of two kinds of preparations obtained by separately formulating the antigenic peptide of (I) and the expression vector of (II). In a preferable embodiment, the preparation of the present invention is a single preparation obtained by simultaneously formulating the antigenic peptide of (I) and the expression vector of (II).
(86) The preparation of the present invention can be provided as a pharmaceutical composition containing, in addition to an effective amount of the antigenic peptide of (I) and/or the expression vector of (II), any carrier, for example, a pharmaceutically acceptable carrier.
(87) Examples of the pharmaceutically acceptable carrier include, though not limited thereto, excipients such as sucrose, starch, mannit, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate and the like, binders such as cellulose, methylcellulose, hydroxypropylcellulose, gelatin, gum arabic, polyethylene glycol, sucrose, starch and the like, disintegrants such as starch, carboxymethylcellulose, hydroxypropylstarch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, calcium citrate and the like, lubricants such as magnesium stearate, aerosil, talc, sodium lauryl sulfate and the like, aromatics such as citric acid, menthol, glycyrrhizin-ammonium salt, glycine, orange powder and the like, preservatives such as sodium benzoate, sodium bisulfite, methylparaben, propylparaben and the like, stabilizers such as citric acid, sodium citrate, acetic acid and the like, suspending agent such as methylcellulose, polyvinylpyrrolidone, aluminum stearate and the like, dispersing agents such as surfactant and the like, diluents such as water, saline and the like, base waxes such as cacao butter, polyethylene glycol, white kerosine and the like, and the like.
(88) While the preparation of the present invention can be administered orally or parenterally to a subject mammal, the preparation of the present invention is preferably administered parenterally to a mammal.
(89) A preparation preferable for parenteral administration (e.g., subcutaneous injection, intradermal injection, intramuscular injection, local injection, intraperitoneal administration and the like) is an aqueous or nonaqueous isotonic aseptic injection liquid, which may contain an antioxidant, a buffer, a bacteriostatic agent, an isotonicity agent and the like. In addition, an aqueous or nonaqueous aseptic suspension can be mentioned, which may contain a suspending agent, a solubilizer, a thickener, a stabilizer, a preservative and the like. Such preparation can be sealed in a container such as ampoule, vial, syringe cartridge, by unit dosage or multiple doses. Also, it is possible to freeze-dry the active ingredient and a pharmaceutically acceptable carrier, and preserve them in a form that requires dissolving or suspending in an appropriate sterile vehicle immediately before use. In one embodiment, the preparation of the present invention is provided as a preparation in which effective amounts of the antigenic peptide of (I) and the expression vector of (II), and a pharmaceutically acceptable carrier are sealed in a container by unit dosage or multiple doses. In another embodiment, the preparation of the present invention is provided as a combination of a preparation in which an effective amount of the antigenic peptide of (I) and a pharmaceutically acceptable carrier are sealed in a container by unit dosage or multiple doses and a preparation in which an effective amount of the expression vector of (II) and a pharmaceutically acceptable carrier are sealed in a container by unit dosage or multiple doses.
(90) The preparation of the present invention may further contain an adjuvant to potentiate a specific immune response to the antigenic peptide. Examples of the adjuvant include aluminum hydroxide, complete Freund's adjuvant, incomplete Freund's adjuvant, pertussis adjuvant, poly(I:C), CpG-DNA and the like. When the expression vector of (II) contains an immunostimulatory sequence (ISS), ISS is not encompassed in the adjuvant here.
(91) In the preparation of the present invention, an induction effect of a specific immune response to the antigenic peptide is enhanced by combining the antigenic peptide of (I) and the expression vector of (II). Therefore, a specific immune response to the antigenic peptide can be sufficiently induced without requiring the aforementioned adjuvant. In one embodiment, therefore, the preparation of the present invention does not contain an adjuvant. In this embodiment, to increase uptake of the antigenic peptide of (I) and the expression vector of (II) into antigen presenting cells, promote presentation of antigenic peptide by antigen presenting cells, and strongly induce specific immune response to the antigenic peptide, the preparation of the present invention is preferably administered (injected) intradermally, subcutaneously, or intramuscularly.
(92) To promote introduction of the expression vector of (II) into cells, the preparation of the present invention may further contain a reagent for nucleic acid introduction. As the reagent for nucleic acid introduction, cationic lipids such as lipofectin (trade name, Invitrogen), lipofectamine (trade name, Invitrogen), transfectam (trade name, Promega), DOTAP (trade name, Roche Applied Science), dioctadecylamidoglycyl spermine (DOGS), L-dioleoyl phosphatidyl-ethanolamine (DOPE), dimethyldioctadecyl-ammonium bromide (DDAB), N,N-di-n-hexadecyl-N,N-dihydroxyethylammonium bromide (DHDEAB), N-n-hexadecyl-N,N-dihydroxyethylammonium bromide (HDEAB), polybrene, poly(ethyleneimine) (PEI) and the like can be used. In addition, the expression vector of (II) may be included in any known liposome constituted of a lipid bilayer such as electrostatic liposome. Such liposome may be fused with a virus such as inactivated Hemagglutinating Virus of Japan (HVJ). HVJ-liposome has a very high fusion activity with a cellular membrane, as compared to general liposomes. When retrovirus is used as an expression vector, RetroNectin, fibronectin, polybrene and the like can be used as transfection reagents.
(93) In the preparation of the present invention, an induction effect of a specific immune response to the antigenic peptide is enhanced by combining the antigenic peptide of (I) and the expression vector of (II). Therefore, a sufficient, specific immune response to the antigenic peptide can be induced without requiring the aforementioned reagent for nucleic acid introduction. In one embodiment, therefore, the preparation of the present invention does not contain a reagent for nucleic acid introduction. In this embodiment, to increase uptake of the antigenic peptide of (I) and the expression vector of (II) into antigen presenting cells, promote presentation of antigenic peptide by antigen presenting cells, and strongly induce specific immune response to the antigenic peptide, the preparation of the present invention is preferably administered (injected) intradermally, subcutaneously, or intramuscularly.
(94) While the content of the antigenic peptide of (I) in the pharmaceutical composition is not particularly limited and is appropriately selected from a wide range, it is generally about 0.00001 to 99 wt % of the whole pharmaceutical composition. While the content of the expression vector of (II) in the pharmaceutical composition is not particularly limited and is appropriately selected from a wide range, it is generally about 0.00001 to 99 wt % of the whole pharmaceutical composition. The above-mentioned numerical value ranges are applicable whether the preparation of the present invention is a single preparation obtained by simultaneously formulating the antigenic peptide of (I) and the expression vector of (II), or a combination of two kinds of preparations obtained by separately formulating the antigenic peptide of (I) and the expression vector of (II).
(95) In the preparation of the present invention, the antigenic peptide of (I) and the expression vector of (II) are substantially simultaneously administered to a subject.
(96) Being substantially simultaneous means that one of the antigenic peptide of (I) and the expression vector of (II) is administered and the other is additionally administered before the antigenic peptide-specific acquired immune response is induced by the earlier administration. In the substantially simultaneous administration of the antigenic peptide of (I) and the expression vector of (II), the time interval between the administration of the antigenic peptide of (I) and that of the expression vector of (II) is generally within 24 hr, preferably within 12 hr, within 6 hr, within 2 hr, within 1 hr, within 30 min, within 15 min, within 5 min, or within 1 min, most preferably 0 min (simultaneous). The boost for potentiating an immune response reaction by administering one of the antigenic peptide of (I) and the expression vector of (II) and additionally administering the other after the antigenic peptide-specific acquired immune response is induced by the earlier administration is not included in the substantially simultaneous administration.
(97) The administration form of the antigenic peptide of (I) and the expression vector of (II) is not particularly limited as long as the antigenic peptide of (I) and the expression vector of (II) are substantially simultaneously administered to a subject. Examples of such administration form include (1) administration of a single preparation obtained by simultaneously formulating the antigenic peptide of (I) and the expression vector of (II), (2) simultaneous administration of two kinds of preparations of the antigenic peptide of (I) and the expression vector of (II), which have been separately formulated, by the same administration route, (3) administration of two kinds of preparations of the antigenic peptide of (I) and the expression vector of (II), which have been separately formulated, by the same administration route in a staggered manner, (4) simultaneous administration of two kinds of preparations of the antigenic peptide of (I) and the expression vector of (II), which have been separately formulated, by different administration routes, (5) administration of two kinds of preparations of the antigenic peptide of (I) and the expression vector of (II), which have been separately formulated, by different administration routes in a staggered manner (e.g., administration in the order of the expression vector of (II) and the antigenic peptide of (I), or in the reverse order) and the like.
(98) In a preferable embodiment, a single preparation obtained by simultaneously formulating the antigenic peptide of (I) and the expression vector of (II) is administered to a subject.
(99) The preparation of the present invention may be administered by any method as long as a specific immune response to an antigenic peptide is induced in a mammal to be the administration subject. Preferably, the preparation of the present invention is parenterally administered in an amount sufficient for inducing a specific immune response to an antigenic peptide in a subject. Examples of the administration method include intradermal, subcutaneous, intramuscular, intravenous, intraperitoneal or intraadipose tissue administration, or administration via a pathway in mammalian gland tissue; gas-induced particle bombardment method (by electron gun and the like); administration with a needleless syringe (including spring type (e.g., ShimaJET etc.), powder type (e.g., Daicel etc.)); a method via a mucosal pathway in the form of collunarium and the like, and the like. To increase uptake of the antigenic peptide of (I) and the expression vector of (II) into antigen presenting cells, promote presentation of antigenic peptide by antigen presenting cells, and strongly induce specific immune response to the antigenic peptide, the preparation of the present invention is preferably administered (injected) intradermally, subcutaneously, or intramuscularly.
(100) When the antigenic peptide of (I) and the expression vector of (II) are administered separately, respective administration methods may be the same or different. Preferably, they are administered by the same method. In this embodiment, the antigenic peptide of (I) and the expression vector of (II) are preferably administered intradermally, subcutaneously or intramuscularly to a subject. In this case, while the administration sites of the antigenic peptide of (I) and the expression vector of (II) may be the same or different, they are preferably administered at the same site.
(101) In a preferable embodiment, a single preparation obtained by simultaneously formulating the antigenic peptide of (I) and the expression vector of (II) is intradermally, subcutaneously or intramuscularly administered to a subject.
(102) In one embodiment, the preparation of the present invention is intradermally, subcutaneously or intramuscularly administered by a needleless injector. The needleless injector is preferably a pressure syringe. Examples of the needleless injector include, but are not limited to, ShimaJET (trade name, SHIMADZU CORPORATION), Twin-Jector EZ II (trade name, Japan chemical research), Syrijet (trade name, Keystone), ZENEO (trade name, Crossject) and the like. In this case, the preparation of the present invention can be provided as an injection preparation containing the antigenic peptide of (I), the expression vector of (II) and needleless injector, wherein the antigenic peptide of (I) and the expression vector of (II) are enclosed in the needleless injector.
(103) In one embodiment, the preparation of the present invention is administered subcutaneously, intradermally or intramuscularly with a gene gun. In this case, the antigenic peptide of (I) and the expression vector of (II) may be applied onto the carrier particles such as colloidal gold particles and the like to be introduced into a living body and used for administration. A technique for coating carrier particles with polynucleotide is known (see, for example, WO 93/17706).
(104) In the preparation of the present invention, an induction effect of a specific immune response to the antigenic peptide is enhanced by combining the antigenic peptide of (I) and the expression vector of (II). Therefore, a specific immune response to an antigenic peptide can be sufficiently induced by administering to a subject of administration, without requiring a special device or apparatus such as needleless syringe, gene gun and the like as mentioned above. For example, the antigenic peptide of (I) and the expression vector of (II) are intradermally, subcutaneously or intramuscularly administered to a subject with a general syringe (with needle).
(105) The preparation of the present invention may be substantially simultaneously administered to plural sites (e.g., 2-10 sites) of a subject of administration. A good immune response can be obtained by administering the preparation of the present invention to multiple sites.
(106) The number of administrations of the preparation of the present invention is not particularly limited as long as a specific immune response to an antigenic peptide is induced, and the preparation may be administered only once or multiple times. When the preparation of the present invention is divided and substantially simultaneously administered multiple times, multiple times of substantially simultaneous administration are gathered and counted as a single time of administration of the preparation of the present invention. For example, in an embodiment in which the antigenic peptide of (I) and the expression vector of (II) are separately administered substantially simultaneously, a single time administration of the antigenic peptide of (I) and a single time administration of the expression vector of (II) are added and counted as a single time administration of the preparation of the present invention. When the preparation of the present invention is substantially simultaneously administered to multiple sites of a subject of administration, the multiple times of substantially simultaneous administrations are added and counted as a single time administration. In one embodiment, to induce good immune responses, the preparation of the present invention is administered multiple times at given intervals. While the number of administrations can be appropriately determined by monitoring the level of immune response, it is generally 2-10 times, preferably 2-6 times. The frequency of administrations is generally once a week to once a year, preferably once every 1 to 6 months.
(107) In the preparation of the present invention, an induction effect of a specific immune response to the antigenic peptide is enhanced by combining the antigenic peptide of (I) and the expression vector of (II). In one embodiment, therefore, a specific immune response to the antigenic peptide can be sufficiently induced even by a single time administration.
(108) By introducing the expression vector of (II) into a tissue (or cell) of a subject mammal, the preparation of the present invention induces in vivo expression of the above-mentioned chimeric hepatitis B virus core antigen polypeptide, and induces a specific immune response to the antigenic peptide (preferably, production of antibody that specifically recognizes the antigenic peptide) as a result of immunization of the expressed chimeric hepatitis B virus core antigen polypeptide and administered antigenic peptide of (I). Various methods for introducing nucleic acids such as expression vector and the like into a living body are known (T. Friedman, Science 244: 1275-1281 (1989)), and any introduction method can be adopted as long as it can induce in vivo expression of the above-mentioned chimeric hepatitis B virus core antigen polypeptide, and a specific immune response to antigenic peptide (preferably, production of antibody that specifically recognizes the antigenic peptide).
(109) Examples of the method for introducing an expression vector into a mammalian tissue (or cell) in vivo include, but are not limited to, inner liposome method, electrostatic liposome method, HVJ-liposome method, HVJ-AVE liposome method, receptor-mediated gene transfer, particle gun method, naked DNA method, introduction method by positively charged polymer, electroporation method and the like.
(110) In the preparation of the present invention, an induction effect of a specific immune response to the antigenic peptide is enhanced by combining the antigenic peptide of (I) and the expression vector of (II). Therefore, in one embodiment, a specific immune response to the antigenic peptide can also be sufficiently induced by a comparatively mild introduction method such as a naked DNA method. In this embodiment, to increase uptake of the antigenic peptide of (I) and the expression vector of (II) into antigen presenting cells, promote presentation of antigenic peptide by antigen presenting cells, and strongly induce specific immune response to the antigenic peptide, the preparation of the present invention is preferably administered (injected) intradermally, subcutaneously, or intramuscularly.
(111) As for the dose of the preparation of the present invention, effective amounts (amount that induces specific immune response to antigenic peptide) of the antigenic peptide of (I) and the expression vector of (II) are administered. While the dose depends on the administration method, conditions of the administration subject (sex, age, body weight and the like), immunogenicity of antigenic peptide in a mammal to be the administration subject, the strength of the regulatory sequence such as promoter contained in expression vector and the like, those of ordinary skill in the art can determine the dose necessary for a good immune response by administering a given amount of the antigenic peptide of (I) and the expression vector of (II) to a mammal to be the administration subject, measuring the antibody titer specific to the antigenic peptide by a detection method such as ELISA and the like, and observing the immune response. The dose of the antigenic peptide of (I) for subcutaneous, intradermal or intramuscular administration to a mammal (e.g., human, dog, cat) by injection is, for example, 1 g-1 mg, preferably about 5 g-50 g, as the amount of antigenic peptide per single time administration, but the dose is not limited thereto. The dose of the expression vector of (II) for subcutaneous, intradermal or intramuscular administration to a mammal (e.g., human, dog, cat) by injection is, for example, 1 g-200 g, preferably about 5 g-100 g, as the amount of expression vector per single time administration, but the dose is not limited thereto.
(112) In one embodiment, the preparation of the present invention has an action to induce synergistic immune response specific to antigenic peptide. As used herein, the action to induce synergistic immune response specific to antigenic peptide means an action to induce immune response specific to antigenic peptide which exceeds the total of an action to induce immune response specific to antigenic peptide by single administration of the antigenic peptide of (I) and an action to induce immune response specific to antigenic peptide by single administration of the expression vector of (II). In this embodiment, synergistically effective amounts of the antigenic peptide of (I) and the expression vector of (II) are administered to an application subject.
(113) As mentioned above, the preparation of the present invention, when an autoantigen protein which is an antigen that contributes to the exacerbation of a particular disease (e.g., lifestyle-related disease) or a partial peptide thereof is used is as antigenic peptide, an immune response specific to the autoantigen protein or a partial peptide thereof, preferably, a humoral immune response specific to the peptide (i.e., production of antibody that specifically recognizes the peptide), is induced, and the activity of the autoantigen protein is neutralized by the antibody, whereby the disease exacerbated by the involvement of the autoantigen protein (e.g., lifestyle-related disease) can be prevented or treated. Therefore, the preparation of the present invention can be used as a prophylactic or therapeutic agent for such diseases.
(114) For example, when angiotensin II, angiotensin I, ACE, renin, or a partial peptide thereof is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for renal failure, cardiac failure, hypertension, hyperlipidemia, arteriosclerosis (arteriosclerosis obliterans etc.), myocardial infarction, cerebral infarction, dementia and the like. When CETP is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for hyperlipidemia. When VEGF or angiopoietin-2 is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for cancer (particularly solid tumor), diabetic retinopathy, age-related macular degeneration, retinopathy of prematurity and the like. When apolipoprotein (a) is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for arteriosclerosis (particularly, atherosclerosis). When PCSK9 or a partial peptide thereof is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for high LDLemia. When DPP4 or a partial peptide thereof is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for diabetes and insulin resistance. When IL-17 is used as an antigenic peptide, the preparation of the present invention can be used as a prophylactic or therapeutic agent for autoimmune disease or inflammatory disease such as rheumatism, SLE, ulcerative colitis and the like; and cancer.
(115) Particularly, when angiotensin II or a partial peptide thereof is used as an antigenic peptide, the preparation of the present invention affords a superior effect as a prophylactic or therapeutic agent for cardiac failure in dogs. In many cases of human cardiac failure, left ventricle is thickened and becomes hard by hypertension to cause diastolic dysfunction. Many cases of cardiac failure in dogs occur since the mitral valve is not properly closed due to a valvular disease, as a result of which the delivery of blood becomes bad and the burden on the heart increases. The present inventors have found that the preparation of the present invention is extremely effective for cardiac failure caused by such valvular disease (mitral insufficiency). For example, since a subject (e.g., dog) that developed mitral insufficiency has a high risk of developing cardiac failure, cardiac failure caused by mitral insufficiency can be prevented by administering an effective amount of the preparation of the present invention using angiotensin II or a partial peptide thereof as an antigenic peptide to such subject. Also, by administering an effective amount of the preparation of the present invention using angiotensin II or a partial peptide thereof as an antigenic peptide to a subject (e.g., dog) that developed cardiac failure caused by mitral insufficiency, the cardiac failure can be treated.
(116) In addition, since an increase in the blood pressure of glomerulus and glomerulus hypertrophy due to angiotensin II are considered to be one of the major causes of renal failure (particularly renal failure in cats), the preparation of the present invention using angiotensin II or a partial peptide thereof as an antigenic peptide is expected to be effective.
(117) As described above, when the preparation of the present invention is used for the prophylaxis or treatment of a particular disease, the application subject may be a patient suffering from the disease, a person having a history of having the disease or a person having a risk of developing the disease but not affected with the disease. By administering the agent of the present invention to a patient having the particular disease, a neutralizing antibody against an antigen that contributes to exacerbation of the disease is induced to treat the disease. By administering the agent of the present invention to a person having a history of having the particular disease, a neutralizing antibody against an antigen that contributes to exacerbation of the disease is induced, whereby recurrence of the disease can be suppressed. By administering the agent of the present invention to a person having a risk of developing the disease but not affected with the disease, a neutralizing antibody against an antigen that contributes to exacerbation of the disease is induced, whereby the onset of the disease can be prevented.
(118) As described above, when the preparation of the present invention is used for the prophylaxis or treatment of a particular disease, the preparation of the present invention in an amount effective for the prophylaxis or treatment of the disease (preferably, amount effective for synergistic prophylaxis or treatment) is administered to a subject.
(119) All references cited in the present specification, including publication, patent document and the like, are hereby incorporated in full by reference, to the extent that they have been disclosed herein.
(120) The present invention is explained in more detail in the following by referring to Examples, which do not limit the present invention in any way.
EXAMPLES
Reference Example 1
(121) Increase in Antibody Titer to Angiotensin II by Vaccine Administration
(122) (Method)
(123) A DNA fragment encoding a modified HBc, wherein a spacer sequence and the amino acid sequence DRVYIHPF (SEQ ID NO: 21) of angiotensin II are inserted between the amino acid residues 80 and 81 of HBc, were obtained by PCR and ligation. This DNA fragment was TA-cloned into pcDNA 3.1/V5-His TOPO TA Expression Kit (Invitrogen) to give the pcDNA3.1-HBc-AngII vector.
(124) Six dogs were divided into 3 groups (n=2 per group), immunized with pcDNA3.1-HBc-AngII according to the following 3 protocols, and the antibody titer of the peripheral blood to angiotensin II was measured on day 0, 4 weeks later, and 6 weeks later, with the day of the start of immunization as day 0. (I) pcDNA3.1-HBc-AngII prepared to 100 g/100 l was intradermally administered per single time administration to the dogs at 4 sites by using needleless syringe ShimaJET (trade name, Shimadzu Corporation). The dose was 0.4 mg/time/dog. This administration was performed twice on day 0 and day 14. (II) pcDNA3.1-HBc-AngII prepared to 150 g/100 l was intradermally administered together with CpG DNA (total dose 160 g/time/dog) per single time administration to the dogs at 8 sites by using ShimaJET. The dose of pcDNA3.1-HBc-AngII was 1.2 mg/time/dog. This administration was performed twice on day 0 and day 14. CpG DNA used was a 1:1 mixture of single strand DNAs having the following two sequences.
(125) TABLE-US-00010 No.2006: (SEQIDNO:31) TCGTCGTTTTGTCGTTTTCTCGTT No.YW07: (SEQIDNO:32) TCGTCGTTAACGTTAACGCTA (III) pcDNA3.1-HBc-AngII prepared to 3 mg/2 ml was intramuscularly administered together with CpG DNA (total dose 160 g/time/dog) at one site. The dose of pcDNA3.1-HBc-AngII was 3.0 mg/time/dog. This administration was performed twice on day 0 and day 14.
(Results)
(126) The intramuscular administration of pcDNA3.1-HBc-AngII hardly increased the antibody titer to angiotensin II. At 6 weeks after the administration by ShimaJET, the antibody titer to angiotensin II increased somewhat.
Example 1
(127) Increase in Antibody Titer by DNA-Peptide Combination Vaccine
(128) Eight dogs were divided into 4 groups (n=2 per group), immunized with pcDNA3.1-HBc-AngII and a conjugate of a partial peptide of angiotensin II and KLH (AngII-KLH) according to the following 4 protocols, and the antibody titer of the peripheral blood to angiotensin II was measured over time. (I) pcDNA3.1-HBc-AngII prepared to 250 g/100 l was intradermally administered together with CpG DNA (total dose 40 g/time/dog) per single time administration to the dogs at 4 sites by using ShimaJET. The dose of pcDNA3.1-HBc-AngII was 1.0 mg/time/dog. This administration was performed three times on day 0, day 14 and day 42. (DNA single administration group 1) (II) AngII-KLH prepared to 12.5 g/250 l was intradermally administered together with CpG DNA (total dose 40 g/time/dog) per single time administration to the dogs at 2 sites. The dose of AngII-KLH was 25 g/time/dog. This administration was performed three times on day 0, day 14 and day 42. (peptide single administration group) (III) A solution prepared to a final concentration of pcDNA3.1-HBc-AngII of 250 g/100 l, and a final concentration of AngII-KLH of 6.25 g/100 l was intradermally administered together with CpG DNA (total dose 40 g/time/dog) per single time administration to the dogs at 4 sites by using ShimaJET. The dose of pcDNA3.1-HBc-AngII was 1.0 mg/time/dog, and the dose of AngII-KLH was 25 g/time/dog. This administration was performed 3 times on day 0, day 14 and day 42. (DNA-peptide combination group) (IV) pcDNA3.1-HBc-AngII prepared to 250 g/100 l was intradermally administered together with CpG DNA (total dose 80 g/time/dog) per single time administration to the dogs at 8 sites by using ShimaJET. The dose of pcDNA3.1-HBc-AngII was 2.0 mg/time/dog. This administration was performed 4 times on day 0, day 14, day 28 and day 42. (DNA single administration group 2)
(Results)
(129) The antibody titer to angiotensin II increased in the peptide single administration group (II) and DNA-peptide combination group (III) (
(130) It was confirmed in the DNA-peptide combination group (III) that a high antibody titer to angiotensin II is maintained for about 2 months from 2 to 10 weeks after the start of the administration (
(131) In the DNA-peptide combination group (III), a significant antibody titer to angiotensin II was confirmed even after 20 weeks from the start of the administration (
(132) When observed at a high dilution rate (1250-fold diluted), the antibody titer that increased by the additional immunization on week 20 was lower than the peak after 3 times of administration. The combination group (III) showed a higher booster effect than the peptide single administration group (II).
(133) The increase in the antibody titer by additional immunization was maintained for a longer term in the DNA-peptide combination group (III) (No. 5, 6) than the peptide single administration group (II) (No. 4) (
Example 2
(134) Effect of DNA-Peptide Combination Vaccine on Cardiac Failure Model Dog
(135) (Method)
(136) The effect of the DNA-peptide combination vaccine was studied according to the following protocol. dog: n=3 cardiac failure model: Cardiac failure model dog was generated by surgical cutting of mitral valve to cause chordae tendinae mitral insufficiency 4 weeks before the start of vaccine administration. vaccine: pcDNA3.1-HBc-AngII+AngII-KLH administration schedule (I) vaccine administration group [(pcDNA3.1-HBc-AngII final concentration 250 g/100 l+AngII-KLH final concentration 6.25 g/100 l)4 sites (DNA 1 mg+peptide 25 g)+CpG (dose 40 g/time/dog)]3 times (on day 0, day 14, and day 42) (ShimaJET) (II) control group saline4 sites3 times (on day 0, day 14, and day 42) (ShimaJET) evaluation item
(137) Time-course changes of the antibody titer to angiotensin II in the peripheral blood were measured.
(138) As a parameter of cardiac failure, time-course changes of the amount of change of average blood pressure (dMAP), the amount of change of left atrial pressure (dLAP), the amount of change of systemic vessel resistance (dSVR) and the amount of change of cardiac output (dCO) were measured. The blood pressure and LAP were measured by telemetry. CO was measured by echocardiography.
(139) (Results)
(140) The vaccine administration groups (Nos. 2, 4, 6) showed a significant increase in the antibody titer to angiotensin II (
(141) The vaccine administration group showed a tendency of cardiac failure parameter improvement along with a tendency toward a decrease in the blood pressure (
Example 3
(142) Effect of DNA-Peptide Combination Vaccine on SHR Rat
(143) The effect of the DNA-peptide combination vaccine was studied according to the following protocol. SHR rat (spontaneously hypertensive rat): n=3 vaccine: pcDNA3.1-HBc-AngII and/or AngII-KLH
(144) As a control vector, pcDNA3.1-HBc free of insertion of AngII peptide was used. test group (I) pcDNA3.1-HBc-AngII+AngII-KLH (ShimaJET, intradermal) (II) pcDNA3.1-HBc+AngII-KLH (ShimaJET, intradermal) (III) AngII-KLH (ShimaJET, intradermal) (IV) pcDNA3.1-HBc-AngII+AngII-KLH (intramuscular) (V) Freund's adjuvant+AngII-KLH (subcutaneous) All administered on day 0, day 14, and day 28. evaluation item
(145) Time-course changes of the antibody titer to angiotensin II in the peripheral blood were measured.
(146) (Results)
(147) The combined use of pcDNA3.1-HBc-AngII and AngII-KLH more remarkably increased the antibody titer to angiotensin II than AngII-KLH single administration. The DNA-peptide combination vaccine was effective not only by ShimaJET (intradermal administration) but also by intramuscular administration. The increase in the antibody titer tended to last for a longer term with the DNA-peptide combination vaccine than in the peptide single administration group (
Example 4
(148) Immune Effect of Single Administration of DNA-Peptide Combination Vaccine
(149) (Method)
(150) The immune effect of single administration of the DNA-peptide combination vaccine was studied according to the following protocol. SHR rat (spontaneously hypertensive rat): n=3 vaccine: pcDNA3.1-HBc-AngII+AngII-KLH test group (I) pcDNA3.1-HBc-AngII+AngII-KLH (1 g) (ShimaJET, intradermal) (II) pcDNA3.1-HBc-AngII+AngII-KLH (5 g) (ShimaJET, intradermal) (III) pcDNA3.1-HBc-AngII+AngII-KLH (20 g) (ShimaJET, intradermal) (IV) AngII-KLH (1 g) (ShimaJET, intradermal) (V) AngII-KLH (5 g) (ShimaJET, intradermal) (VI) AngII-KLH (20 g) (ShimaJET, intradermal)
(151) All by single administration (on day 0). evaluation item
(152) Time-course changes of the antibody titer to angiotensin II in the peripheral blood were measured.
(153) (Results)
(154) The DNA-peptide combination vaccine showed, even by single administration, a higher increase in the anti-angiotensin II antibody titer than the peptide single administration group. The increase in the antibody titer was maintained for a longer term with the DNA-peptide combination vaccine than in the peptide single administration group (
Example 5
(155) Immune Effect of DNA-Peptide Combination Vaccine
(156) (Method)
(157) The effect of the DNA-peptide combination vaccine was studied according to the following protocol. Balb/ca mouse (female, 6-week-old (on the start of vaccine administration)): n=6 vaccine: pcDNA3.1-HBc-mVEGF+-mVEGF-KLH See WO 2014/034735 A1 for reference.
(158) TABLE-US-00011 mVEGFpeptide: (SEQIDNO:1) IMRIKPHQSQHIG test group (I) pcDNA3.1-HBc-mVEGF (2 mg/ml, 60 l)+mVEGF-KLH (1 mg/ml, 10 l) (intramuscular administration in legs, each leg 35 l) (with electroporation) (II) saline (60 l)+mVEGF-KLH (1 mg/ml, 10 l) (intramuscular administration in legs, each leg 35 l) (with electroporation) (III) pcDNA3.1-HBc-mVEGF (2 mg/ml, 60 l)+mVEGF-KLH (1 mg/ml, 10 l) (intramuscular administration in legs, each leg 35 l) (without electroporation) Administered twice in total on day 0 and day 14. evaluation item
(159) Time-course changes of the antibody titer to VEGF in the peripheral blood were measured.
(160) (Results)
(161) Using the DNA-peptide combination vaccine, the antibody titer to VEGF increased without using electroporation. The group (III) without electroporation showed a higher antibody titer to VEGF than the group (I) with electroporation (
(162) It was shown from the above results that the use of DNA-peptide combination vaccine can effectively induce a specific immune response to the target antigenic peptide, without using a special apparatus such as electroporation and ShimaJET (needleless syringe).
Example 6
(163) Immune Effect of DNA-Peptide Combination Vaccine
(164) (Method)
(165) The efficacy of pVAX1 vaccine and pcDNA3.1 vaccine was compared according to the following protocol. SHR rat: n=5-6 In each group, a medicament (200 l) was intramuscularly administered to the thigh muscle one time, and blood samples were collected on day of administration (immediately before administration), 2, 4, 8, 12 weeks after the administration. test group group 1: pcDNA3.1-HBc-AngII (200 g)+AngII-KLH (5 g) group 2: pVAX1-HBc-AngII (200 g)+AngII-KLH (5 g) group 3: pVAX1-HBc-AngII (40 g)+AngII-KLH (5 g) group 4: pVAX1-HBc-AngII (8 g)+AngII-KLH (5 g) evaluation item
(166) The antibody titer to AngII in the peripheral blood was measured.
(167) (Results)
(168) Even when pVAX1 was used as a vector, the DNA-peptide combination vaccine showed an increase in the antibody titer of the same level as the use of pcDNA3.1 (
Example 7
(169) Comparison of Embodiment of AngII Peptide-KLH Conjugate in DNA-Peptide Combination Vaccine
(170) Using three kinds of AngII-KLH conjugates, DNA-peptide combination vaccine was inoculated according to the following protocol, and the effect on antibody titer to angiotensin II in the peripheral blood was compared. animal used
(171) SD rats (male, 8-week-old (on administration, Japan SLC, Inc.): n=6 test material (1) test substance 1: angiotensin II vaccine-1
(172) solution containing KLH-AngII conjugate (prepared by glutaraldehyde method) and pVAX1-HBc-AngII (saline). (2) test substance 2: angiotensin II vaccine-2
(173) solution containing KLH-Cys-AngII conjugate (prepared by Sulpho-GMBS method) and pVAX1-HBc-AngII (saline). (3) test substance 3: angiotensin II vaccine-3
(174) solution containing KLH-Cys-Gly-Gly-AngII conjugate (prepared by Sulpho-GMBS method) and pVAX1-HBc-AngII (saline). test substance administration solution concentration
(175) TABLE-US-00012 TABLE 1 administration solution KLH conjugate pVAX1-HBc-AngII low dose 0.125 mg/mL (0.025 mg/ 1 mg/mL (0.2 mg/200 L) 200 L) high dose 0.5 mg/mL (0.025 mg/ 1 mg/mL (0.2 mg/200 L) 200 L) test group (1) angiotensin II vaccine-1, low dose, n=6. (2) angiotensin II vaccine-1, high dose, n=6. (3) angiotensin II vaccine-2, low dose, n=6. (4) angiotensin II vaccine-2, high dose, n=6. (5) angiotensin II vaccine-3, low dose, n=6. (6) angiotensin II vaccine-3, high dose, n=6. administration
(176) Each vaccine solution was administered singly into the thigh muscle of the rat at a dose of 200 L/rat by using a polypropylene injection syringe and 27 G injection needle. blood sampling (1) blood for plasmid DNA concentration measurement
(177) About 4 hr after test substance administration, blood (about 0.4 mL) was collected from the cervical vein under inhalational anesthesia with 3.0% isoflurane. The blood (300 L) was collected in a tube added with 100 mmol/L EDTA (60 L) in advance. The blood was immediately frozen with liquid nitrogen, and cryopreserved at 80 C. until measurement. (2) serum for antibody titer measurement
(178) On the day before test substance administration, and 2 and 4 weeks after the test substance administration, blood (about 500 L) was collected into a micro blood-collecting vessel (CAPIJECT, TERUMO, Inc.) from the cervical vein under inhalational anesthesia with 3.0% isoflurane, and centrifuged using a centrifuge (1800 g, room temperature, 10 min) to give serum. The serum was cryopreserved at 80 C. until measurement. evaluation item (1) antibody titer measurement
(179) The antibody titer to AngII peptide in serum was measured by enzyme immunoassay before the vaccine administration, and 2 weeks and 4 weeks after the administration. (2) plasmid DNA concentration measurement
(180) The blood plasmid concentration 4 hr after vaccine administration was measured by quantitative PCR. For the quantitative PCR, primer sets with 69 bp as an amplification region, which specifically detects plasmid, was used. results (1) antibody titer
(181) The antibody titer to AngII peptide in the serum increased in all groups 2 weeks and 4 weeks after the vaccine administration than before the administration. The low dose group and high dose group of angiotensin II vaccine-1 showed significantly high values (p<0.01,
(182) The blood plasmid concentrations (copies/L blood) 4 hr after the vaccine administration are shown in the following Table. No group showed a remarkable difference.
(183) TABLE-US-00013 TABLE 2 angiotensin II angiotensin II angiotensin II vaccine-1 vaccine-2 vaccine-3 low high low high low high test dose dose dose dose dose dose group group group group group group group 1 2.14 10.sup.4 5.14 10.sup.3 2.01 10.sup.4 1.54 10.sup.3 1.33 10.sup.3 2.45 10.sup.4 2 3.50 10.sup.3 3.71 10.sup.3 1.03 10.sup.4 3.40 10.sup.3 6.39 10.sup.3 4.60 10.sup.3 3 1.15 10.sup.4 2.56 10.sup.3 1.71 10.sup.3 1.15 10.sup.3 1.34 10.sup.3 2.99 10.sup.4 4 1.12 10.sup.3 3.86 10.sup.3 1.76 10.sup.3 3.59 10.sup.3 2.42 10.sup.3 5.71 10.sup.3 5 7.27 10.sup.2 4.78 10.sup.3 3.56 10.sup.3 5.53 10.sup.3 2.56 10.sup.3 4.10 10.sup.3 6 6.22 10.sup.3 2.19 10.sup.3 4.35 10.sup.4 6.22 10.sup.3 4.59 10.sup.4 3.66 10.sup.4 Mean 7.41 10.sup.3 3.72 10.sup.3 1.35 10.sup.4 3.57 10.sup.3 9.98 10.sup.3 1.76 10.sup.4 SD 7.91 10.sup.3 1.15 10.sup.3 1.63 10.sup.4 2.04 10.sup.3 1.77 10.sup.4 1.45 10.sup.4
Example 8
(184) Effect of DNA-Peptide Combination Vaccine on Blood Pressure of SHR Rat (Measurement by Telemetry)
(185) According to the following protocol, a telemetry transmitter for blood pressure measurement was embedded in SHR/Izm rat, and an influence of the administration of the DNA-peptide combination vaccine on the blood pressure was evaluated. test schedule
(186) The test was performed according to the schedule shown in
(187) SHR/Izm rat (male, 21-week-old (on vaccine administration), Japan SLC, Inc.) 3 rats. vaccine
(188) solution containing KLH-AngII conjugate (50 g/200 L) and HBc-AngII expression vector (pVAX1-HBc-AngII: 200 g/200 L). administration
(189) Each vaccine solution was administered singly into the thigh muscle of the rat at a dose of 200 L/rat by using a polypropylene injection syringe and 27 G injection needle. telemetry transmitter embedding surgery
(190) The rat was anesthetized by intramuscular administration of ketamine hydrochloride and xylazine. The femoral artery was exposed, and a catheter of a telemetry transmitter (TA11PA-C40, DSI) was dwelled in the blood vessel. The main unit of the telemetry transmitter was intraperitoneally dwelled and the wound was sutured. blood pressure and heart rate measurement measurement period: from one week before vaccine administration (10 days before) to 5 weeks after vaccine administration (35 days later). measurement items: systolic blood pressure, diastolic blood pressure, average blood pressure, heart rate (calculated from pulse wave of blood pressure) measurement method: Blood pressure signals sent from the telemetry transmitter embedded in the rat were received by a receiving device (RPC-1, Data Sciences International), and uptaken into a chronic experimental telemetry automatic measurement system (Ponemah Physiology Platform 5.0). data uptake: Data was uptaken continuously during the measurement period, and the data was preserved at appropriate times. sampling time: Average of blood pressure and heart rate was calculated every one hour. blood sampling blood sampling period: before vaccine administration (on sensor embedding), 2 weeks and 5 weeks after the vaccine administration blood sampling method: Under inhalational anesthesia with isoflurane, a blood sample (about 0.5 mL) was collected from the cervical vein of the rat, placed in a blood collection tube containing EDTA and stirred. The blood was centrifuged (3000 rpm, 10 min, 4 C.) and plasma was collected. The collected plasma was cryopreserved at 80 C. antibody titer measurement
(191) The antibody titer to AngII peptide in plasma was measured by enzyme immunoassay before the vaccine administration, and 2 weeks and 5 weeks after the administration. results (1) Effect on blood pressure
(192) Continuous data of blood pressure and heart rate extracted for 10 min from each animal in the active period (night time) and inactive period (daytime) before the vaccine administration and 2 weeks after the vaccine administration are shown in
(193) In the animals of No. 1 and No. 2, systolic blood pressure, diastolic blood pressure, average blood pressure, and heart rate decreased significantly by the vaccine administration. Also in the animal of No. 3, a decreasing tendency of systolic blood pressure and heart rate in the active period (night time) by the vaccine administration could be confirmed. (2) antibody titer
(194) The measurement results of antibody titer to AngII peptide (absorbance) by enzyme immunoassay using 250-fold diluted plasma are shown in
INDUSTRIAL APPLICABILITY
(195) According to the present invention, a vaccine capable of strongly inducing a specific antibody against an antigenic peptide can be provided.
(196) According to the present invention, a specific antibody against an antigenic peptide can be effectively induced using a DNA vaccine, without requiring a treatment such as electroporation, nucleic acid introduction reagent and the like.
(197) According to the present invention, moreover, since an increase in the antibody titer specific to the antigenic peptide lasts for a long term, the number of vaccine administrations can be reduced.
(198) The contents disclosed in any publication cited herein, including patents, patent applications and scientific documents, are hereby incorporated in their entireties by reference, to the extent that they have been disclosed herein.
(199) This application is based on a patent application No. 2014-235736 filed in Japan (filing date: Nov. 20, 2014), the contents of which are incorporated in full herein.