PD-1 VARIANT HAVING IMPROVED BINDING ABILITY TO PD-L1
20230002472 · 2023-01-05
Assignee
Inventors
Cpc classification
A61P31/00
HUMAN NECESSITIES
C12N15/1024
CHEMISTRY; METALLURGY
C07K2319/30
CHEMISTRY; METALLURGY
C12N15/1034
CHEMISTRY; METALLURGY
C07K14/70596
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K14/705
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to a PD-1 variant having improved binding affinity to PD-L1. In addition, the present disclosure relates to a method for preparing the PD-1 variant and a method for screening the PD-1 variant. The PD-1 variant of the present disclosure effectively inhibits the binding between wild-type PD-1 and PD-L1, and thus is expected to have significantly higher penetration ability and anticancer effect by immune cells or therapeutic effect for infectious diseases as compared to existing immune checkpoint inhibitors. At the same time, the possibility of immunogenicity can be minimized. In addition, the convenience of developing biomedicine may be promoted through aglycosylation.
Claims
1. A PD-1 (programmed cell death protein 1) variant having improved binding affinity to PD-L1 (programmed death-ligand 1), wherein the PD-1 variant comprises a part of the amino sequence of wild-type PD-1, and comprises substitution of the 69th amino acid of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with C69S, C69T, C69Y, C69G or C69A.
2. The PD-1 variant according to claim 1, wherein the PD-1 variant further comprises substitution of the 36th amino acid of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with S36P.
3. The PD-1 variant according to claim 2, wherein the PD-1 variant further comprises substitution of the 114th amino acid of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with L114P.
4. The PD-1 variant according to claim 3, wherein the PD-1 variant further comprises substitution of one or more amino acid selected from a group consisting of the 12th, 34th, 92nd, 107th, 131st, 132nd and 142nd amino acids of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with a sequence different from the wild-type amino acid.
5. The PD-1 variant according to claim 4, wherein the PD-1 variant comprises one or more amino acid substitution selected from a group consisting of T12S, N34T, N92K or N92S, K107N, H131R, P132L and F142L.
6. The PD-1 variant according to claim 1, wherein the PD-1 variant further comprises substitution of the 13th amino acid of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with F13I or F13L, and the 46th amino acid with M46I.
7. The PD-1 variant according to claim 6, wherein the PD-1 variant further comprises substitution of one or more amino acid selected from a group consisting of the 1st, 17th, 36th, 50th, 79th, 100th, 114th, 127th and 139th amino acids of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with a sequence different from the wild-type amino acid.
8. The PD-1 variant according to claim 7, wherein the PD-1 variant comprises one or more amino acid substitution selected from a group consisting of N1S, L17M, S36P, N505, G79R, G100V, L114P, V127A and A139L.
9. The PD-1 variant according to claim 1, wherein the PD-1 variant further comprises substitution of the 25th amino acid of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with N25D, and the 92nd amino acid with N92S or N92K.
10. The PD-1 variant according to claim 9, wherein the PD-1 variant further comprises substitution of the 13th amino acid of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with F13I or F13L.
11. The PD-1 variant according to claim 9 or 10, wherein the PD-1 variant further comprises substitution of one or more amino acid selected from a group consisting of the 9th, 88th, 101st, 125th and 137th amino acids of the amino sequence of wild-type PD-1 of SEQ ID NO 61 with a sequence different from the wild-type amino acid.
12. The PD-1 variant according to claim 11, wherein the PD-1 variant comprises one or more amino acid substitution selected from a group consisting of N9D, R88K, A101V, A125S and R137K.
13. The PD-1 variant according to claim 1, wherein the PD-1 variant is an aglycosylated PD-1 variant.
14. A nucleic acid molecule encoding the PD-1 variant according to claim 1.
15. A vector comprising the nucleic acid molecule according to claim 14.
16. A host cell comprising the vector according to claim 15.
17. The host cell according to claim 16, wherein the host cell is a bacterial cell.
18. An inhibitor of the binding between wild-type PD-1 (programmed cell death protein 1) and PD-L1 (programmed death-ligand 1), comprising the PD-1 variant according to claim 1, a nucleic acid molecule encoding the PD-1 variant or a vector comprising the nucleic acid molecule as an active ingredient.
19. A composition comprising the PD-1 variant according to claim 1, the nucleic acid molecule according to claim 14 or a vector comprising the nucleic acid molecule as an active ingredient.
20. The composition according to claim 19, wherein the composition is a pharmaceutical composition for preventing or treating a cancer disease or an infectious disease.
21. A method for inhibiting binding between wild-type PD-1 (programmed cell death protein 1) and PD-L1 (programmed death-ligand 1), comprising a step of administering an effective amount of the PD-1 variant according to claim 1, a nucleic acid molecule encoding the PD-1 variant or a vector comprising the nucleic acid molecule to a subject.
22. A method for increasing immune response, comprising a step of administering an effective amount of the PD-1 variant according to claim 1, a nucleic acid molecule encoding the PD-1 variant or a vector comprising the nucleic acid molecule to a subject.
23. A method for treating a cancer disease or an infectious disease, comprising a step of administering a therapeutically effective amount of the PD-1 variant according to claim 1, a nucleic acid molecule encoding the PD-1 variant or a vector comprising the nucleic acid molecule to a subject.
24. A method for preparing a PD-1 variant, comprising: a) a step of culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the PD-1 variant according to claim 1; and b) a step of recovering the PD-1 variant expressed by the host cell.
25. A method for screening a PD-1 variant, comprising: a) a step of establishing a library of the PD-1 variant according to claim 1 to which random point mutations have been introduced or a nucleic acid molecule encoding the same; and b) a step of screening the PD-1 variant which inhibits the binding between wild-type PD-1 (programmed cell death protein 1) and PD-L1 (programmed death-ligand 1) from the library.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
BEST MODE
[0093] Hereinafter, the present disclosure will be described in detail through examples. The examples are provided only for the purpose of describing the present disclosure specifically and it will be obvious to those of ordinary skill in the art that the scope of the present disclosure is not limited by the examples.
EXAMPLES
Example 1: Verification of N-Linked Glycosylation Site Affecting Binding to Human PD-L1
[0094] In order to verify that the glycosylation of human PD-1 actually plays an important role in binding affinity to PD-L1, the effect of each glycosylation on the binding affinity was tested by deglycosylating the four glycosylation sites existing in PD-1. Because PD-1 has four N-glycosylation sites, four genes (N25A, N34A, N50A, N92A) were prepared by replacing each asparagine at the four sites with alanine. The DNA fragment encoding the outer membrane site (amino sequences L25-Q167) of PD-1 was amplified by PCR using a template gene (catalog number: HG10377-M) and primers (CKJ#1, CKJ#2) of PD-1 and Vent polymerase. The amplified DNA fragment was treated with BssHll and XbaI enzymes and was ligated into the pMaz vector, which is a vector for expression in animal cells, which was treated with the same enzymes. The sequences of the ligated plasmids were analyzed to identify a desired plasmid by individual colony analysis after transforming into Judet ((F-mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK A-rpsL nupG) E. coli. Primers (CKJ#3, CKJ#4, CKJ#5, CKJ#6, CKJ#7, CKJ#8, CKJ#9, CKJ#10) were designed to obtain variants with asparagine substituted with alanine through site-directed mutagenesis by QuikChange PCR using the plasmid. The DNA fragments containing the gene were amplified using the designed primers and Pfu Turbo polymerase (Agilent). The amplified genes were sequenced and confirmed after transforming into Jude1. After transfecting animal cells (HEK293F) with the prepared vectors for expressing wild-type PD-1 (pMaz-wild-type PD-1-His tag) and PD-1 glycovariants (pMaz-N25A PD-1-His tag, pMaz-N34A PD-1-His tag, pMaz-N50A PD-1-His tag, pMaz-N92A PD-1-His tag) and culturing for 6 days, the cell culture was centrifuged at 6,000 rpm for 20 minutes and then the supernatant was filtered through a 0.22-μm filter. The filtered supernatant was incubated with 1 mL of Ni-NTA resin (Qiagen) at 4° C. for 16 hours. The protein-bound resin was washed with 10 CV (column volume) of a PBS solution containing 10 mM imidazole (Sigma), and then washed again with 10 CV of a PBS solution containing 20 mM imidazole. Finally, an eluate was recovered with a PBS solution containing 250 mM imidazole (
TABLE-US-00001 TABLE 1 SEQ ID NO Primer Sequence (5′.fwdarw.3′) SEQ ID NO 1 CKJ#1 GCGGAATTCGGCGCGCACTCCGAATTAGACTCCCC AGACAGGCCC SEQ ID NO 2 CKJ#2 GAATTCCGCTCTAGATTATCAATGATGATGGTGGTG ATGTTGGAACTGGCCGGCTGG SEQ ID NO 3 CKJ#3 CGTGGTGACCGAAGGGGACGCCGCCACCTTCACC TGCAGCT SEQ ID NO 4 CKJ#4 AGCTGCAGGTGAAGGTGGCGGCGTCCCCTTCGGT CACCACG SEQ ID NO 5 CKJ#5 ACCTTCACCTGCAGCTTCTCCGCCACATCGGAGAG CTTCGTGCTAAAC SEQ ID NO 6 CKJ#6 GTTTAGCACGAAGCTCTCCGATGTGGCGGAGAAGC TGCAGGTGAAGGT SEQ ID NO 7 CKJ#7 GTACCGCATGAGCCCCAGCGCCCAGACGGACAAG CTGGCCG SEQ ID NO 8 CKJ#8 CGGCCAGCTTGTCCGTCTGGGCGCTGGGGCTCAT GCGGTAC SEQ ID NO 9 CKJ#9 GTCAGGGCCCGGCGCGCCGACAGCGGCACCTACC TCTG SEQ ID NO 10 CKJ#10 CAGAGGTAGGTGCCGCTGTCGGCGCGCCGGGCCC TGAC SEQ ID NO 11 Hw#1 GCGGAATTCGGCGCGCACTCCGAATTTACTGTCAC GGTTCCCAAGGACC SEQ ID NO 12 Hw#2 CTTGTGCCTTGCTATCTTTAGACGGGTCAGAGCCA CCGCCACCCCTTTCATTTGGAGGATGTGCCAGAG SEQ ID NO 13 HW#3 GACCCGTCTAAAGATAGCAAGGCACAAG SEQ ID NO 14 HW#4 GAATTCCGCTCTAGATCATTAGTGGTGATGATGGT GGTGAG SEQ ID NO 15 JY#1 CGCAGCGAGGCCCAGCCGGCCTTAGACTCCCCAG ACAGGCCC SEQ ID NO 16 JY#2 CGCAGCGAGGCCCCCGAGGCCCCTTGGAACTGGC CGGCTGG SEQ ID NO 17 JY#3 CGCAGCGAGGCCCAGCCGGCC SEQ ID NO 18 JY#4 CGCAGCGAGGCCCCCGAGGCCCC
[0095] Primers Used in the Experiment
Example 2: Cloning of Tetrameric Human PD-L1 (PD-L1-Streptavidin) for PD-1 Engineering
[0096] The cDNA of the human PD-L1 gene was purchased from Sino Biotech (Catalog number: HG10084-M) and the gene of the outer membrane of PD-L1 cells (amino sequences F19-R238) was amplified by PCR using primers (HW#1, HW#2) and Vent polymerase. Because the dissociation constant of wild-type PD-1 to wild-type PD-L1 is not good enough (equilibrium dissociation constant, K.sub.D=˜8.7 μM), avidity effect was induced through tetramerization for effective screening of aglycosylated PD-1 variants. The tetramerization was induced by expressing streptavidin at the C-terminal of PD-L1, and a GS linker was inserted between streptavidin and PD-L1 to ensure the flexibility of each protein. After amplifying the gene using primers (HW#3, HW#4) and Vent polymerase (New England Biolab), assembly PCR was conducted using the previously amplified PD-L1 gene and Vent polymerase. The prepared gene was treated with BssHII and XbaI restriction enzymes (New England Biolab). The restriction enzyme-treated PD-L1-streptavidin-His tag gene was ligated into a pMaz vector, which is a vector for mammalian expression, which had been treated with the same restriction enzymes. The ligated plasmid was transformed into Jude1 E. coli. Single clones were obtained and then it was confirmed through sequencing that the PD-L1-streptavidin-His tag was successfully inserted into the pMaz vector.
Example 3: Expression of Tetrameric PD-L1-Streptavidin in Animal Cells Purification, and Fluorescence Labeling
[0097] The prepared vector for tetrameric PD-L1 expression was transfected into animal cells (HEK293F). After culturing the cells for 6 days, the cell culture was centrifuged at 6,000 rpm for 20 minutes and the supernatant was taken and filtered through a 0.22-μm filter. The filtered supernatant was induced to bind to 1 mL of Ni-NTA resin (Qiagen) at 4° C. for 16 hours. The bound resin was washed with 10 CV of a PBS solution containing 10 mM imidazole (Sigma) and then washed again with 10 CV of a PBS solution containing 20 mM imidazole. Finally, proteins were eluted and recovered with a PBS solution containing 250 mM imidazole. The purified PD-L1 tetramer was fluorescence-labeled using an Alexa-488 labeling kit. As a result of ELISA assay, the fluorescence-labeled tetrameric PD-L1 showed superior binding affinity to PD-1 (
Example 4: Construction of Wild-Type PD-1, HAC-V PD-1 Expressing Plasmids for Displaying Human PD-1 in Inner Membrane of Bacterial Cells
[0098] In order to display the outer membrane site of PD-1, the DNA of PD-1 (amino sequences L25-Q167) was amplified by PCR using primers (JY#1, JY#2) and Vent polymerase and then treated with a SfiI restriction enzyme. In order to immobilize PD-1 protein to the cellular inner membrane during the transport to the periplasmic region of E. coli through NIpA signal peptide, a pMopac12-NIpA-WTPD-1-FLAG vector was prepared by ligating SfiI-treated PD-1 DNA fragment with a SfiI fragment of pMopac12-NIpA-FLAG vector. For a HAC-V variant as a control group, a synthesized HAC-V DNA fragment was also cloned into SfiI site of pMopac12-NIpA-FLAG vector to construct pMopac12-NIpA-HAC-V PD-1-FLAG. Then, after transforming into E. coli Jude1 and obtaining single clones, it was confirmed through sequencing that wild-type PD-1 and HAC-V PD-1 were successfully inserted into the pMopac-12 vector.
Example 5: Verification of Expression of PD-1 and PD-1 Variants (Wild-Type PD-1, HAC-V PD-1) in E. coli and Binding Affinity to PD-L1 by Flow Cytometry
[0099] Each of the plasmids (pMopac12-NIpA-PD-1-FLAG, pMopac12-NIpA-HAC-V PD-1-FLAG, pMopac12-NIpA-Fc-FLAG) prepared through cloning was transformed into Jude1. Each of the prepared samples was cultured in a TB medium containing 2% glucose and 40 μg/mL chloramphenicol at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated into 6 mL of a TB medium containing 40 μg/mL chloramphenicol at a ratio of 1:50. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, the protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same number of the protein-overexpressing E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute. In order to remove the remaining medium, the cells were washed twice through resuspension of the pellet in 1 mL of 10 mM Tris-HCl (pH 8.0) and centrifugation at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37° C. for 30 minutes to remove the outer membrane of the cells. After collecting E. coli by centrifuging at 13,500 rpm for 1 minute, the supernatant was removed. The E. coli cell pellet was resuspended in 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8] and then centrifuged at 13,500 rpm for 1 minute. After resuspending the cell pellet by adding 1 mL of a solution prepared by mixing 1 mL of solution A with 20 μL of a 50 mg/mL lysozyme solution, a peptidoglycan layer was removed by rotating at 37° C. for 15 minutes. After the centrifugation, the supernatant was removed. After resuspending the pellt in 1 mL of PBS, 300 μL was taken and added by 700 μL of PBS, 12.5 nM of a tetrameric PD-L1-Alexa488 probe and 33 nM of anti-FLAG-FTIC (Sigma). Then, spheroplasts were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and then analyzed using the Guava instrument (Merck Millipore). As a result, it was confirmed that the aglycosylated PD-1 was expressed well in E. coli (
Example 6: Construction of Error-Prone PD-1 Library for Use in High-Throughput Screening
[0100] For high-throughput screening of aglycosylated PD-1 showing high binding affinity to PD-L1, primers having SfiI sites on both sides (JY#3, JY#4) were designed such that errors can be inserted in all the sites of PD-1 during PCR-based amplification using pMopac12-NIpA-PD-1-FLAG as a template. In order to construct a library using the designed primers, Taq polymerase (Takara), dNTPs (Invitrogen), MgCl.sub.2 and MnCl.sub.2 (Sigma), the gene was amplified by error-prone PCR. The PCR product was treated with the SfiI enzyme, ligated to a SfiI fragment of pMopac12-NIpA-FLAG vector, and then transformed into Jude1 cells. The transformed E. coli cells were spread onto a square plate and cultured at 37° C. for 16 hours. Then, a primary library was obtained by recovering the E. coli cells with TB containing 2% glucose (
Example 7: Screening of PD-1 Variant by Flow Cytometry Sorting
[0101] After adding 40 μg/mL chloramphenicol to 25 mL of a TB medium containing 2% glucose, the constructed E. coli library was inoculated to a 250-mL flask and incubated at 37° C. and 250 rpm for 4 hours. Then, the E. coli cells were inoculated to 100 mL of a TB medium containing 40 μg/mL chloramphenicol at a ratio of 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG, and the cells were recovered by centrifuging at 14,000 rpm for 1 minute. In order to remove the remaining medium, the cells were resuspended in 1 mL of 10 mM Tris-HCl (pH 8.0), centrifuged at 13,500 rpm for 1 minute and then washed. This procedure was repeated 2 times. The cells were resuspended in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37° C. for 30 minutes to remove the outer membrane of the cells. After collecting E. coli by centrifuging at 13,500 rpm for 1 minute, the supernatant was removed. The cells were resuspended in 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8] and then centrifuged at 13,500 rpm for 1 minute. After resuspending the cells by adding 1 mL of a solution prepared by mixing 1 mL of solution A with 20 μL of a 50 mg/mL lysozyme solution, a peptidoglycan layer was removed by rotating at 37° C. for 15 minutes. After the centrifugation, the supernatant was removed. After resuspending the cells in 1 mL of PBS, 300 μL was taken and 700 μL of PBS and 12.5 nM of a tetrameric PD-L1-Alexa488 probe were added. Then, spheroplasts were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. From the cells resuspended in 1 mL of PBS, E. coli cells with high binding affinity to PD-L1 were chosen and recovered using an S3 sorter (Bio-Rad). Genes were obtained from the recovered E. coli by PCR using primers (JY#1, JY#2). The genes were treated with the SfiI restriction enzyme and then ligated to SfiI fragment of pMopac12-NIpA-FLAG vector. The resulting plasmid was transformed into Jude1 and the cells were spread onto a square plate. After incubation at 37° C. for 16 hours, the cells were recovered and stored in a deep freezer. This screening procedure was repeated 5 more times.
Example 8: Culturing of E. coli for Investigation of Enrichment of PD-1 Variants with Increased Affinity for PD-L1
[0102] After adding 40 μg/mL chloramphenicol to 25 mL of TB containing 2% glucose, a primary library, a 1st-round library, a 2vd-round library, a 3rd-round library, a 4th-round library, a 5th-round library and a 6th-round library were added to a 250-mL flask. After incubation at 37° C. and 250 rpm for 4 hours, E. coli cultured in 100 mL of TB containing 40 μg/mL chloramphenicol was inoculated at a ratio of 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. In addition, wild-type PD-1 and HAC-V-PD-1 expressing cells for use as a control group were inoculated into 4 mL of a TB medium containing 2% glucose and 40 μg/mL chloramphenicol and grown at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated to 6 mL of a TB medium containing 40 μg/mL chloramphenicol at a ratio of 1:50. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same number of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute.
Example 9: Investigation of Enrichment of PD-1 Variants with Increased Affinity for PD-L1 by Flow Cytometry
[0103] In order to remove the remaining medium, the cells that had been added to an e-tube were resuspended in 1 mL of 10 mM Tris-HCl (pH 8.0), centrifuged at 13,500 rpm for 1 minute and then washed. This procedure was repeated 2 times. The cells were resuspended in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37° C. for 30 minutes to remove the outer membrane of the cells. After collecting E. coli by centrifuging at 13,500 rpm for 1 minute, the supernatant was removed. The cell pellet was resuspended in 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8] and then centrifuged at 13,500 rpm for 1 minute. After resuspending the cells by adding 1 mL of a solution prepared by mixing 1 mL of solution A with 20 μL of a 50 mg/mL lysozyme solution, a peptidoglycan layer was removed by rotating at 37° C. for 15 minutes. After the centrifugation, the supernatant was removed. After resuspending in 1 mL of PBS, 300 μL was taken and 700 μL of PBS and 12.5 nM of a tetrameric PD-L1-Alexa488 probe were added together. Then, spheroplasts were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cell pellet was washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. After resuspending the cells in 1 mL of PBS, the binding affinity to PD-L1 was analyzed by measuring mean fluorescence intensity (MFI) using a flow cytometer (Guava, Millipore). It was confirmed that variants with higher binding affinity to PD-L1 were amplified from the libraries as the screening proceeded (
Example 10: Securing of PD-1 Variants Having Improved Binding Affinity to PD-L1 by Flow Cytometry
[0104] The individual colonies from the final round were inoculated to a TB medium containing 2% glucose and 40 μg/mL chloramphenicol and then cultured at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated to 6 mL of a TB medium containing 40 μg/mL chloramphenicol by diluting to a ratio of 1:50. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, the protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same number of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute. In order to remove the remaining medium, the cells that had been added into the e-tube were resuspended in 1 mL of 10 mM Tris-HCl (pH 8.0), centrifuged at 13,500 rpm for 1 minute and then washed. This procedure was repeated 2 times. The cells were resuspended in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] solution and rotated at 37° C. for 30 minutes to remove the outer membrane of the cells. After collecting cells by centrifuging at 13,500 rpm for 1 minute, the supernatant was removed. The cell pellet was resuspended in 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS, pH 6.8] and then centrifuged at 13,500 rpm for 1 minute. After resuspending the cells by adding 1 mL of a solution prepared by mixing 1 mL of solution A with 20 μL of a 50 mg/mL lysozyme solution, a peptidoglycan layer was removed by rotating at 37° C. for 15 minutes. After the centrifugation, the supernatant was removed. After resuspending in 1 mL of PBS, 300 μL was taken and 700 μL of PBS and 12.5 nM of a tetrameric PD-L1-Alexa488 probe were added together. Then, spheroplasts were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and the binding affinity to PD-L1 was analyzed by measuring fluorescence signals using the Guava instrument (
TABLE-US-00002 TABLE 2 SEQ ID NO PD-1 variant Location of PD-1 variant and substituted amino acids SEQ ID NO 48 No. 41 (CKJ 41) S36P/C69S/L114P SEQ ID NO 50 No. 45 (CKJ 45) S36P/C69S/K107N/L114P/F142L SEQ ID NO 51 No. 46 (CKJ 46) S36P/C69S/L114P/P132L SEQ ID NO 56 No. 56 (CKJ 56) S36P/C69S/N92K/L114P/H131R SEQ ID NO 58 No. 67 (CKJ 67) N34T/S36P/C69S/L114P SEQ ID NO 59 No. 70 (CKJ 70) S36P/C69S SEQ ID NO 60 No. 78 (CKJ 78) T12S/S36P/C69S/L114P SEQ ID NO 49 No. 44 (CKJ 44) F13I/M46I/N50S/C69Y/V127A SEQ ID NO 54 No. 52 (CKJ 52) F13I/M46I/C69Y SEQ ID NO 52 No. 49 (CKJ 49) F13L/N25D/C69S/N92S/R137K SEQ ID NO 53 No. 50 (CKJ 50) F13L/N25D/C69S/R88K/N92S/A125S SEQ ID NO 55 No. 55 (CKJ 55) N25D/C69S/N92S/A101V SEQ ID NO 57 No. 66 (CKJ 66) N9D/N25D/C69S/N92S/A101V
[0105] PD-1 Variants Having Improved Binding Affinity to PD-L1
Example 11. Cloning for Comparison with PD-1 Variants of Additional Control Groups (PD-1 S.6.8.3 and S.5.1T)
[0106] For use as additional control groups, S.6.8.3 and S.5.1T variants were cloned through primer assembly PCR. First, after conducting primer assembly PCR using primers (S.6.8.3: JY#5,6,7,8,9,10,11,12/S.5.1T: JY#13,14,15,16,17,18,19,20) and Vent polymerase, the assembled gene was amplified through Amplify PCR. The assembled gene was treated with SfiI and then ligated with SfiI fragment of pMopac12-NIpA-FLAG vector to construct pMopac12-NIpA-PD-1 S.6.8.3-FLAG and pMopac12-NIpA-PD-1 S.5.1T-FLAG vectors. Then, after obtaining single clones by transforming into E. coli Jude1, it was confirmed through sequencing that they were inserted successfully.
TABLE-US-00003 TABLE 3 SEQ ID NO Primer Sequence (5′.fwdarw.3′) SEQ ID NO 62 JY#5 TTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACC TTCTCCCCAGCCCTGCTCGTGGTGA SEQ ID NO 63 JY#6 ACGAAGCTCTCCGATGTGTTGGAGAAGCTGCAGGTG AAGGTGGCGTTGTCCCCTTCGGTCACCACGAGCAGG GCT SEQ ID NO 64 JY#7 AACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCA TGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCT TC SEQ ID NO 65 JY#8 TGGGCAGTTGTGTGACACGGAAGCGGCTGGCCTGGC CCAGCTGGCCGCGGTCCTCGGGGAAGGCGGCCAGC TTGT SEQ ID NO 66 JY#9 CGTGTCACACAACTGCCCAACGGGCGTGACTTCCAC ATGAGCGTGGTCAGGGCCCGGCGCAGCGACAGCGG CACC SEQ ID NO 67 JY#10 ACCCGCAGGCTCTCCCGGATCTGGATCCGGGGGGCC AGCAGGATGGCGCTACAGAGGTAGGTGCCGCTGTCG CTG SEQ ID NO 68 JY#11 GGGAGAGCCTGCGGGTGGAGCTCAGGGTGACAGAG AGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCC TCAC SEQ ID NO 69 JY#12 TTGGAACTGGCCGGCTGGCCTGGGTGAGGGGCTGG GGTG SEQ ID NO 70 JY#13 TTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACC TTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGG SEQ ID NO 71 JY#14 CAGTTTAGCACGAAGCTCTCCGATGTGTTGGAGAAGC TGCAGGTGAAGGTGGCGCTGTCCCCTTCGGTCACCA CG SEQ ID NO 72 JY#15 GGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCC CAGCAACCAGGCCGACAAGCTGGCCGCCTTCCCCGA GGA SEQ ID NO 73 JY#16 CACGCCCGTTGGGCAGTTGTGTGACACGGAAGCGGG AGTCCTGGCCGGGCTGGCTGCGGTCCTCGGGGAAG GCGG SEQ ID NO 74 JY#17 CTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTC GGGGCCCGGCGCTCCGACAGCGGCACCTACCTCTGT TCC SEQ ID NO 75 JY#18 CTGAGCTCTGCCCGCAGGCTCTCCCGGATCTGCACC TTGGGGGCCAGGGAGATGGCGGAACAGAGGTAGGT GCCG SEQ ID NO 76 JY#19 CTGCGGGCAGAGCTCAGGGTGGCAGAGAGAAGGGC AGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAG GCCA SEQ ID NO 77 JY#20 TTGGAACTGGCCGGCTGGCCTGGGTGAGGGG SEQ ID NO 78 JY#21 CCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCC SEQ ID NO 79 JY#22 GGAACTGGCCGGCTGGCCTGGGTGAGGGGCTGGGG
[0107] Primers Used in Additional Experiments
Example 12. Comparison of Screened PD-1 Variants with Control Groups in Binding Affinity to PD-L1 by Flow Cytometry
[0108] In order to compare the binding affinity to PD-L1 of PD-1 variants having high binding affinity with those of additional control groups, each of wild-type PD-1, PD-1 HAC-V, S.6.8.3 and S.5.1T, as control groups, CKJ 49 and CKJ 50 was inoculated to a TB medium containing 2% glucose and 40 μg/mL chloramphenicol and then cultured at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated to 6 mL of a TB medium containing 40 μg/mL chloramphenicol by diluting to a ratio of 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, the protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same number of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute. After conducting spheroplasting in the same manner as described in Example 5, 12.5 nM of a tetrameric PD-L1-Alexa488 probe was added to the prepared spheroplasts and they were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and the binding affinity to PD-L1 was analyzed by measuring fluorescence using the Guava instrument (
Example 13. Cloning for Screening of Variants Having Novel Mutations
[0109] In order to screen variants having novel mutations of CKJ 41, which has the newest mutation and high binding affinity from among the screened variants, the C69S in CKJ 41 was substituted with several amino acids (C, T, Y, A, G). For this, genes were amplified by Quikchange PCR using designed primers and Pfu Turbo polymerase (Agilent). The amplified genes were transformed into Jude1 and then analyzed by sequencing.
Example 14. Screening of Variants Having Novel Mutations by Flow Cytometry
[0110] CKJ 41, the HAC-V variant (control group) and CKJ 41C, CKJ 41T, CKJ 41Y, CKJ 41A, and CKJ 41G, wherein the 69th amino acid of CKJ 41 had been changed, were inoculated into TB medium containing 2% glucose and 40 μg/mL chloramphenicol and were cultured at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated again to 6 mL of a TB medium containing 40 μg/mL chloramphenicol by diluting to 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, the protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same quantity of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute. After conducting spheroplasting in the same manner as described in Example 5, 12.5 nM of a tetrameric PD-L1-Alexa488 probe was added to the prepared spheroplasts and they were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and the binding affinity to PD-L1 was analyzed by measuring fluorescence using the Guava instrument (
Example 15. Construction of Secondary Error-Prone PD-1 Library for Securing PD-1 Variant Having Improved Binding Affinity
[0111] For high-throughput screening of PD-1 showing higher binding affinity to PD-L1, inserts were prepared using pMopac12-NIpA-PD-1 CKJ 41T-FLAG, which exhibited less mutations but high fluorescence intensity, as a template such that errors can be inserted in all regions. A library was constructed by amplifying genes by error-prone PCR using primers having SfiI sites on both sides (JY#3, JY#4), Taq polymerase (Takara), dNTPs (Invitrogen), MgCl.sub.2 and MnCl.sub.2 (Sigma). The amplified genome was treated with the SfiI enzyme and ligated with SfiI fragment of pMopac12-NIpA-FLAG vector, and then transformed into Jude1 cells. The transformed E. coli cells were spread onto a square plate and cultured at 37° C. for 16 hours. Then, a primary library was prepared by recovering the E. coli cells with TB containing 2% glucose (
Example 16. Secondary Screening of PD-1 Variant by Flow Cytometry Sorting
[0112] After adding 40 μg/mL chloramphenicol to 25 mL of a TB medium containing 2% glucose, the constructed library was inoculated to a 250-mL flask and incubated at 37° C. and 250 rpm for 4 hours. Then, the E. coli was inoculated to 100 mL of a TB medium containing 40 μg/mL chloramphenicol at a ratio of 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG, and the cells were recovered by centrifuging at 14,000 rpm for 1 minute. After conducting spheroplasting in the same manner as described in Example 5, 12.5 nM of a tetrameric PD-L1-Alexa488 probe was added and rotated at room temperature to label the prepared spheroplasts. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and E. coli cells with higher binding affinity to PD-L1 were recovered using an S3 sorter (Bio-Rad). Genes were prepared from the recovered E. coli by PCR using primers (JY#3, JY#4)). The genes were treated with the SfiI restriction enzyme and then ligated to SfiI fragment of pMopac12-NIpA-FLAG vector. The resulting plasmid was transformed into Jude1 and the E. coli was spread onto a square plate. After incubation at 37° C. for 16 hours, the cells were recovered and stored in a deep freezer. This screening procedure was repeated 3 more times while gradually lowering the concentration of the probe.
Example 17. Culturing of E. coli for Investigation of Enrichment of Secondary PD-1 Variants with Increased Affinity for PD-L1
[0113] After adding 40 μg/mL chloramphenicol to 25 mL of TB containing 2% glucose, a primary library, a 1-round library, a 2-round library, a 3-round library and a 4-round library were added to a 250-mL flask. After incubation at 37° C. and 250 rpm for 4 hours, E. coli cultured in 100 mL of TB containing 40 μg/mL chloramphenicol was inoculated at a ratio of 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. In addition, for use as a control group, 40 μg/mL chloramphenicol was added to 4 mL of a TB medium containing 2% glucose and, after inoculating wild-type PD-1 and HAC-V-PD-1 cells, respectively, the cells were cultured at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated to 6 mL of a TB medium containing 40 μg/mL chloramphenicol at 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same number of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute.
Example 18. Determination of Enrichment of PD-1 Variants with Increased PD-L1 Affinity by Flow Cytometry
[0114] After conducting spheroplasting in the same manner as described in Example 5, 4 nM of a tetrameric PD-L1-Alexa488 probe was added to the prepared spheroplasts and rotated at room temperature for labeling. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and the binding affinity to PD-L1 was analyzed by measuring mean fluorescence intensity (MFI) using a flow cytometer (Guava, Millipore). It was confirmed that variants with higher binding affinity to PD-L1 were amplified from the libraries as the screening proceeded (
Example 19. Securing of Additional PD-1 Variants Having Improved Binding Affinity to PD-L1 by Flow Cytometry
[0115] Each of the single colonies from the final round (APD1-CKJ 41T: aglycosylated form of CKJ 41T, APD1-JY 101: aglycosylated form JY 101), wild-type PD-1 and HAC-V was inoculated to a TB medium containing 2% glucose and 40 μg/mL chloramphenicol and then cultured at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated again to 6 mL of a TB medium containing 40 μg/mL chloramphenicol by diluting to a ratio of 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, the protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same quantity of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute. After conducting spheroplasting in the same manner as described in Example 5, 4 nM of a tetrameric PD-L1-Alexa488 probe was added to the prepared spheroplasts and they were labeled with the fluorescent probe by rotating at room temperature. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and the binding affinity to PD-L1 was analyzed by measuring fluorescence signals using the Guava instrument (
Example 20. Cloning of Variants for Comparing Mutation Sites of Screened PD-1 Variants
[0116] It was investigated whether the introduction of novel mutation of CKJ 49 and 50 to LDSS affects binding affinity by cloning a PD-1_LDSS variant having overlapping mutations of CKJ 49 and CKJ 50. In order to prepare PD-1_LDSS, Quikchange PCR was conducted using a CKJ 49 vector as a template. For this, the gene was amplified using primers (JY#21, JY#22) and Pfu Turbo polymerase (Agilent). The amplified gene was transformed into Jude1 and then sequenced.
Example 21. Comparison of Binding Affinity to PD-L1 Among PD-1 Variants by Flow Cytometry
[0117] After inoculating each of wild-type PD-1, the HAC-V variant (control group) CKJ 49, CKJ 50 and LDSS to a TB medium containing 2% glucose and 40 μg/mL chloramphenicol, the cells were cultured at 37° C. and 250 rpm for 16 hours. The cultured cells were inoculated to 6 mL of a TB medium containing 40 μg/mL chloramphenicol by diluting to 1:100. After culturing to OD.sub.600=0.5, followed by cooling for 20 minutes at 25° C. and 250 rpm, the protein overexpression was induced at 25° C. and 250 rpm for 5 hours by adding 1 mM IPTG. The same number of the E. coli was added to an e-tube through OD.sub.600 normalization and the cells were recovered through centrifugation at 14,000 rpm for 1 minute. After conducting spheroplasting in the same manner as described in Example 5, 12.5 nM of a tetrameric PD-L1-Alexa488 probe was added to the prepared spheroplasts and rotated at room temperature for labeling. After conducting the labeling process for 1 hour, centrifugation was performed at 13,500 rpm for 1 minute. After discarding the supernatant, the cells were washed once with 1 mL of PBS and then centrifuged again at 13,500 rpm for 1 minute. The cells were resuspended in 1 mL of PBS and the binding affinity to PD-L1 was analyzed by measuring fluorescence signals using the Guava instrument (
TABLE-US-00004 TABLE 4 SEQ ID PD-1 variant Location of PD-1 variant and substituted amino acids SEQ ID NO 90 CKJ 41T S36P/C69T/L114P SEQ ID NO 91 CKJ 41Y S36P/C69Y/L114P SEQ ID NO 92 CKJ 41G S36P/C69G/L114P SEQ ID NO 93 CKJ 41A S36P/C69A/L114P SEQ ID NO 94 JY101 N1S, F13I, L17M, S36P, M46I, C69T, G79R, G100V, L114P, A139L SEQ ID NO 95 LDSS F13L, N25D, C69S, N92S
[0118] Additionally screened PD-1 variants with improved binding affinity to PD-L1
Example 22. Expression of PD-1 Variants in Animal Cells, Purification and Verification of Binding Affinity
[0119] In order to verify the binding affinity of PD-1 variants expressed in animal cells, the PD-1 variants were cloned into mammalian expression vector. The genes of HAC-V (control group) and the screened variants, CKJ 49 and CKJ50 were amplified by PCR using primers (CKJ#1, CKJ#2) and Vent polymerase. The amplified genes were treated with BssHII and XbaI enzymes were ligated into BssHII and XbaI fragment of pMaz vector. The sequence of the ligated plasmid was investigated by individual colony analysis by transforming into Jude1 E. coli. The prepared vector for expressing PD-1 glycovariants (pMaz-PD1 HAC-V-His tag, pMaz-PD1 CKJ 49-His tag, pMaz-PD1 CKJ 50-His tag) were transfected into animal cells (HEK293F). After culturing the cells for 6 days, the cell culture was centrifuged at 6,000 rpm for 20 minutes and the supernatant was taken and filtered through a 0.22-μm filter. The filtered supernatant was applied to 1 mL of Ni-NTA resin (Qiagen) at 4° C. for 16 hours. The protein-bound resin was washed with 10 CV (column volume) of a PBS solution containing 10 mM imidazole (Sigma), and then washed again with 10 CV of a PBS solution containing 20 mM imidazole. Finally, an eluate was recovered with a PBS solution containing 250 mM imidazole (
[0120] Although the specific embodiments of the present disclosure have been described in detail above, it is obvious to those of ordinary skill in the art that they are provided only as preferred exemplary embodiments and do not limit the scope of the present disclosure. Accordingly, the substantial scope of the present disclosure should be defined by the appended claims and their equivalents.
[0121] [National Research and Development Project Supporting the Present Disclosure] [0122] [Project ID] 1711053534. [0123] [Ministry in charge] Ministry of Science and ICT. [0124] [R&D management agency] National Research Foundation of Korea. [0125] [Research project name] Rising research supporting project. [0126] [Research title] Development of protein therapeutic agent and bispecific antibody using antigen-binding aglycosylated Fc variant. [0127] [Contribution factor] 1/2. [0128] [Research agency] Kookmin University Industry-Academic Cooperation. [0129] [Research period] 2017.06.01 to 2018.03.31.
[0130] [National Research and Development Project Supporting the Present Disclosure] [0131] [Project ID] 1711058394. [0132] [Ministry in charge] Ministry of Science and ICT. [0133] [R&D management agency] National Research Foundation of Korea. [0134] [Research project name] Management of new drug development pipeline. [0135] [Research title] Identification of serum persistent Fc-based next-generation anticancer antibody targeting endothelin GPCR. [0136] [Contribution factor] 1/2. [0137] [Research agency] Kookmin University Industry-Academic Cooperation. [0138] [Research period] 2017.06.30 to 2018.03.29.