LENT-ON-PLUS SYSTEM FOR CONDITIONAL EXPRESSION IN HUMAN STEM CELLS
20200199619 · 2020-06-25
Inventors
- Francisco MARTÍN MOLINA (Sevilla, ES)
- Karim BENABDELLAH ELKHLANJI (Sevilla, ES)
- Marién COBO PULIDO (Sevilla, ES)
- Pilar MUÑOZ FERNÁNDEZ (Sevilla, ES)
Cpc classification
C12N2830/46
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
Abstract
In the present invention, the inventors have generated a Tet-On all-in-one construct that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the integrative construct with the Is2 insulator, they have constructed the Lent-On-Plus Tet-On system that achieves efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus system did not require selection or cloning, and transgene regulation is maintained after long-term cultured and upon differentiation toward different lineages. The present invention thus offers a solution to the need to improve transgene expression systems in stem cells.
Claims
1. A genetic construct having nucleic acid sequences capable of integrating into the genome of a mammalian cell comprising: a) two regulatory control elements, b) at least two coding nucleic acid molecules referred to as the first coding nucleic acid molecule and as the second coding nucleic acid molecule, operatively associated with the regulatory control elements and capable of expression in the cell, c) a nucleic acid molecule encoding a nuclear localization element, and d) an insulator element, wherein the second coding nucleic acid molecule encodes a protein capable of repressing the regulatory control element that controls the expression of the first coding nucleic acid molecule, wherein the regulatory control element is inducible and can be regulated by the protein encoded by second coding nucleic acid molecule, wherein the nucleic acid molecule encoding the nuclear localization signal is associated to the second coding nucleic acid molecule so that both nucleic acid molecules encode a single polypeptide.
2. The genetic construct according to claim 1, wherein the nucleic acid molecule encoding the nuclear localization signal is selected from the list consisting of: a. SEQ ID No 4; and b. a nucleic acid molecule having at least 90% identity, over the total length of the sequence, to SEQ ID NO 4 and encoding an amino-acid sequence that is part of a larger polypeptide and that is capable to induce importation into the cell nucleus of said polypeptide.
3. The genetic construct according to claim 1, wherein the insulator sequence is, a. SEQ ID No 1 or a complementary sequence thereof; or b. a nucleic acid molecule having at least 90% identity, over the total length of the sequence, to SEQ ID NO 1 and capable of shielding the gene cassette integrated in the host genome from the effect of regulatory sequences from the host genome, and vice versa.
4. The genetic construct according to claim 1, wherein the insulator sequence is, a. SEQ ID No 1 associated with SEQ ID No 2 so that they form a single nucleic acid sequence or a complementary sequence thereof; or b. a nucleic acid molecule having at least 90% identity, over the total length of the sequence, to SEQ ID No 1 associated with SEQ ID No 2 so that they form a single nucleic acid sequence capable of shielding the gene cassette integrated in the host genome from the effect of regulatory sequences from the host genome, and vice versa.
5. The genetic construct according to claim 1, wherein the insulator sequence is, a. SEQ ID No 3 or a complementary sequence thereof; or b. a nucleic acid molecule having at least 90% identity, over the total length of the sequence, to SEQ ID No 3 and capable of shielding the gene cassette integrated in the host genome from the effect of regulatory sequences from the host genome, and vice versa.
6. The genetic construct according to claim 1, wherein the insulator element is introduced in the anti-sense orientation.
7. The genetic construct according to claim 1, wherein the second coding nucleic acid molecule encodes a regulatory protein whose regulatory function is drug-responsive.
8. The genetic construct according to claim 7, wherein the second coding nucleic acid molecule encodes a protein based on the original TetR repressor element.
9. The genetic construct according to claim 1, wherein the regulatory control element that regulates the expression of the first coding nucleic acid molecule comprises a binding site for the regulatory protein encoded by the second coding nucleic acid molecule.
10. The genetic construct according to claim 9, wherein the second coding nucleic acid molecule encodes a protein that in the absence a drug binds to the regulatory control element that regulates the expression of the first coding nucleic acid molecule to inhibit said expression.
11. The genetic construct according to claim 9, wherein the regulatory control element that regulates the expression of the first coding nucleic acid molecule further comprises the CMV promoter.
12. The genetic construct according to claim 1, wherein the regulatory control element that regulates the expression of the second coding nucleic acid molecule is constitutively active.
13. The genetic construct according to claim 12, wherein the regulatory control element that regulates the expression of the second coding nucleic acid molecule is the spleen focus forming virus (SFFV) promoter.
14. The genetic construct according to claim 1, wherein the regulatory control element that regulates the expression of the first coding nucleic acid molecule contains a binding site for the regulatory protein encoded by the second nucleic acid molecule and further comprises the CMV promoter; wherein the regulatory control element that regulates the expression of the second coding nucleic acid molecule is constitutively active, wherein the second coding nucleic acid molecule encodes a protein whose function is drug-responsive, wherein the nucleic acid molecule encoding the nuclear localization factor encodes the nuclear localization signal from the glucocorticoid receptor named nl2.
15. The genetic construct according to claim 1, wherein the genetic construct is a viral vector.
16. The genetic construct of claim 15, wherein the viral vector is a retroviral vector and wherein the regulatory control elements, the coding nucleic acid molecules, the nucleic acid molecule encoding the nuclear localization element are inserted between the retroviral LTRs with the U3 deleted, and the insulator element is inserted in place of the U3 of the 3LTR.
17. The genetic construct of claim 16, wherein the retroviral vector is a lentiviral vector.
18. A composition comprising the genetic construct of claim 1.
19. (canceled)
20. (canceled)
21. A mammalian host stem cell comprising the genetic construct of claim 1.
22. The host cell of claim 21 wherein the host cell is a stem cell of embryonic or adult tissue origin.
23. (canceled)
24. (canceled)
25. A method for expressing a nucleic acid molecule in a mammalian cell in a regulatable manner, comprising a) administering to the cell an effective amount of the genetic construct of claim 1, and b) expressing the nucleic acid molecules of the genetic construct to produce the coding nucleic acid molecule RNAs and its encoding polypeptides.
26. A method for producing a polypeptide in a mammalian cell in a regulatable manner, comprising a) administering to the cell an effective amount of the genetic construct of claim 1, and b) expressing the nucleic acid molecules of the genetic construct to produce the coding nucleic acid molecule RNA and its encoding polypeptide.
27. The method of claim 25, wherein the mammalian cell is a stem cell of embryonic or adult tissue origin.
28. The method of claim 25, wherein the mammalian cell is a cell factory for protein production.
29. The genetic construct of claim 7, wherein the drug is tetracycline or a variant thereof.
30. The genetic construct of claim 13, wherein the regulatory control element that regulates the expression of the second coding nucleic acid molecule is the human elongation factor-1 alpha (hEF1) promoter.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0022]
[0023]
[0024]
[0025] (a) Representative plots showing eGFP expression profiles of untransduced 293T (Mock) and 293T cells transduced with the different LVs (as indicated at the top of each plot) in the absence (top) or presence (bottom) of Dox (0.1 g/ml). A MOI=0.3 was used to keep the percentage of eGFP+ cells below 30% (in order to keep transduced cells with only one LV integration). The gates of the eGFP+ populations were set to 0.2-0.4% of eGFP+cells in the untransduced population (Mock; left plots) and subtracted to the % obtained under the different vectors and conditions for the analysis. The percentage (%) of the eGFP+ population (used to measure leaking) and the Mean Fluorescence Intensity (MFI) of the eGFP+ population are shown in each plot (b). Graph showing leaking of the different LVs in 293T taking into account the MFI of the eGFP+ population in the absence of Dox: (Leaking=[[% eGFP+(Dox)*100/% eGFP+(+Dox)]*MFI eGFP+(Dox)]. To measure leaking, the background (% of eGFP+ of Mock cells) were subtracted to the % of the eGFP+ under the different conditions. Values represent mean +/standard error of the mean of at least four separate experiments Asterisks indicate significance related to CEST (on top of the bars) or significance between the CEETnl2 and CEETnl2Is2 (as indicated in the Figure) (*p<0.05; **p<0.01).
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DESCRIPTION
Definitions
[0037] In the context of the present invention, coding nucleic acid molecules are understood to be DNA sequences that, when transcribed into RNA molecules through the action of the regulatory elements, will give rise to functional proteins or RNAs. [0038] In the context of the present invention, genetic construct is understood as a constructed segment of nucleic acid that is going to be introduced into a target tissue or cell. It consists on a vector that may contain a gene cassette, which comprises the nucleic acid sequence encoding at least a protein of interest and different regulatory sequences such as promoters or enhancers for expression in the host organism. It can be simple or double stranded. Optionally, the genetic construct is made of, or comprises, modified nucleic acid bases or morpholinos. Generally, genetic constructs express a wild-type protein, express mutant proteins that may contain deletion mutations or missense mutations, or prevent the expression of certain genes, by expressing inhibitor or competitor proteins, or by encoding silencing RNAs (i.e, siRNAs, miRNAs, piRNAs, snRNAs, etc) or morpholinos. [0039] In the context of the present invention, the term vector is referred to a small piece of DNA, taken from a virus, a plasmid (commonly found in bacteria), or the cell of a higher organism into which foreign genetic fragment/s can be inserted and is commonly used as a vehicle to artificially carry this foreign genetic material into another cell, where it can be replicated, expressed, and/or inserted into the host genome. The vector itself is generally a DNA sequence that consists of (a) transgene/s and a larger sequence that serves as the backbone of the vector. It can be simple or double stranded. Optionally, it can be formed or comprise modified nucleic acid bases or morpholinos. [0040] In the context of the present invention, the term gene cassette refers to a natural or recombinant nucleic acid sequence capable of expressing at least one nucleic acid molecule. This expression might give rise to an RNA that may be, or not, translated into a protein. It may optionally be formed or comprise modified nucleic acid bases or morpholinos. It typically comprises at least one nucleic acid molecule to be expressed and at least one promoter (allowing transcription initiation). Optionally, the gene cassette may include additional nucleic acid molecules to be expressed, additional regulatory sequences, such as transcriptional enhancers or transcription termination signals, and non-coding sequences, splicing signals, translation termination signals, polyadenylation signals, polyadenosine sequences, or internal ribosome entry sites (IRES). In the present invention the gene cassette is the nucleic acid sequence of the genetic construct that is aimed to be introduced into the genome of the target cell that then becomes the host cell. [0041] In the context of the present invention, the term transgene refers to the nucleic acid molecule of the gene cassette of the genetic construct that encodes the protein or RNA molecule whose expression and/or expression regulation in the host genome is the ultimate goal of the present invention. It is the coding nucleic acid molecule whose expression is regulated by the protein encoded by the other nucleic acid molecule present in the gene cassette. It may optionally be formed or comprise modified nucleic acid bases or morpholinos. [0042] In the context of the present invention, gene expression is understood as the process by which the nucleotide sequence of a gene is used to direct transcription and ultimately protein synthesis. The process of gene expression involves two main steps: [0043] 1) Transcription: the production of messenger RNA (mRNA) by an RNA polymerase using the DNA sequence as template. This step is followed by the processing or maturation of the resulting mRNA molecule. [0044] 2) Translation: the use of mRNA to direct protein synthesis. This second step can be followed by post-translational modifications of the protein molecule.
[0045] Additionally, in some cases gene expression leads to the production of other forms of RNA that are not translated into proteins, such as for example transfer RNAs (tRNAs), ribosomal RNAs (rRNAs), long non-coding (IncRNAs), or RNAs that will derive into micro-RNAs (miRNAs) or small interfering RNAs (siRNAs). [0046] In the context of the present invention, an insulator element is understood to be a DNA sequence that isolates genes located in one chromatin domain from the effect of enhancers or silencers present in neighboring domains and vice versa. The insulator element of the present invention is capable of blocking the regulatory action of the regulatory elements placed within its range of action and permits the expected expression of coding nucleic acid molecules (please note that it is herein understood that the term coding nucleic acid molecules includes the term transgene) in research, protein production and gene therapy in mammalian cells, preferably in embryonic and adult stem cells. [0047] In the context of the present invention, a nuclear localization signal or sequence refers an amino acid sequence that facilitates the import into the cell nucleus of the proteins it is physically associated with by protein-protein interaction or because it forms part of the said protein. [0048] In the context of the present invention, regulatory control elements are understood to be DNA sequences able to promote the synthesis of RNAs under specific conditions. [0049] In the context of the present invention, a mammalian cell refers to cells which are derived or isolated from tissue of a mammal. [0050] In the context of the present invention, the term multiplicity of infection (MOI) refers to the ratio of the number of genetic constructs containing the gene cassette to be introduced in the target cells, to the number of target cells in a defined space.
Description
[0051] The present invention offers a genetic construct capable to introduce a specific gene cassette into the genome of a target cell, that promotes a better regulation of a transgene and that requires a lower MOI, compared to previous constructs of the same type. Additionally, this construct allows for significant expression of the transgene in different human stem cells where previous constructs show no regulation of expression. Therefore, the present invention offers a solution to the need of technical improvements to reach tightly regulated transgene expression in bulk populations after one single round of transduction/transfection, especially for transgenes to be introduced in human stem cells.
[0052] The first aspect of the present invention refers to a genetic construct having nucleic acid sequences capable of integrating into the genome of a mammalian cell comprising:
[0053] a) two regulatory control elements, b) at least two coding nucleic acid molecules referred to as the first coding nucleic acid molecule and the second nucleic acid molecule, or as NAm-A and NAm-B respectively, operatively associated with the regulatory control elements and capable of expression in the cell, c) a nucleic acid molecule encoding a nuclear localization element, and d) an insulator element,
[0054] wherein NAm-B encodes a protein capable of repressing the regulatory control element, from now on referred as RCE-A, that controls the expression of NAm-A, wherein RCE-A is inducible and can be regulated by the protein encoded by NAm-B, wherein the nucleic acid molecule encoding the nuclear localization signal is associated to NAm-B so that both nucleic acid molecules encode a single polypeptide.
[0055] The nucleic acid molecule encoding the nuclear localization signal preferably encodes the nuclear localization signal from the glucocorticoid receptor, referred to as nuclear localization signal 2 (nl2), preferably with nucleic acid sequence SEQ ID n 4 (gcccgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaag). The insulator preferably consists on the SEQ ID n 1, even more preferably consists on the SEQ ID n 1 associated with SEQ ID n 2 so that they can form a single nucleic acid sequence, yet more preferably consists on the SEQ ID n 3. In a preferred embodiment, the nucleic acid molecule encoding the nuclear localization signal is SEQ ID n 4 and the insulator the one with SEQ ID n 3.
[0056] In previous embodiments of the invention, suitable sequences preferably have at least about: 70% identity, at least 80% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, at least 99.5% identity, over the total length of the sequence, to the sequence used to define them. Identity refers to the similarity of two nucleotide sequences that are aligned so that the highest order match is obtained. Identity is calculated according to methods known in the art. For example, if a nucleotide sequence (called Sequence A) has 90% identity to a portion of SEQ ID NO 1, then Sequence A will be identical to the referenced portion of SEQ ID NO 1 except that Sequence A may include up to 10 point mutations (such as substitutions with other nucleotides) per each 100 nucleotides of the referenced portion of SEQ ID NO 1.
[0057] The invention also includes an insulator that has a nucleic acid sequence with sufficient identity to the insulator elements described previously in this section of the invention to hybridize with them under stringent hybridization conditions. In this sense, the present invention also includes insulator elements having nucleic acid molecules that hybridize to one or more of the sequences in SEQ ID n I-SEQ ID n 3 or its complementary sequence. Similarly, the invention also includes a nucleic acid sequence with sufficient identity to the nuclear localization signals described previously in this section to hybridize with them under stringent hybridization conditions. In this sense, the present invention also includes insulator elements having nucleic acid molecules that hybridize to SEQ ID n 4 its complementary sequence. Such nucleic acid molecules preferably hybridize under high stringency conditions (see Sambrook et al. Molecular Cloning: A Laboratory Manual, Most Recent Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). High stringency washes preferably have low salt contents (preferably about 0.2% SSC) and a temperature of about 50-65 C. Thus, in another embodiment, the insulator element and/or the nucleic acid molecule encoding the nuclear localization signal are introduced in the anti-sense orientation. Additionally, other insulator elements and/or nucleic acid molecules encoding other nuclear localization signals can be readily inserted in the genetic construct provided that expression of NAm-A and NAm-B still occurs and that the encoded nuclear localization signal promotes the import of NAm-B encoded protein into the nucleus of the host cell.
[0058] Commonly, the purpose of introducing a transgene in a host cell is to promote its expression in this cell, and ideally it should be possible to turn on and off its expression according to the needs. Since the protein encoded by NAm-B can activate or repress the expression of NAm-A, ideally this activator or repressor function on NAm-A expression might be regulatable according to the needs. A common mechanism of regulation is that NAm-B protein can be targeted by a molecule in the cell, that is itself present in the cell according to the needs. Therefore, in a preferred embodiment, NAm-B encodes a protein whose regulatory function is drug-responsive, preferably tetracyclineor a variant thereofresponsive. In a more preferred embodiment, the regulatory element is based on the original TetR repressor element. In the context of the present invention, it is understood that the original TetR repressor is the product of the TetR gene (the TetR protein) from Escherichia coli.
[0059] In order to regulate the expression of NAm-A, NAm-B encoded protein has to be able to bind to RCE-A that controls the expression of NAm-A. Thus, in another embodiment, the RCE-A comprises a binding site for the protein encoded by NAm-B. In addition, preferably the regulation of NAm-A expression by NAm-B encoded protein is as follows: in the absence of the drug described in the previous paragraph, binding of NAm-B encoded protein to RCE-A leads to the repression of RCE-A and to the inhibition of NAm-A expression. Thus in another preferred embodiment, NAm-B encodes a protein that binds to REC-A to inhibit the expression of NAm-A. Preferably, in the presence of the drug, Nam-B encoded protein cannot further repress the expression of NAm-A. Then, in a yet more preferred embodiment, in the presence of the drug described previously in this section, NAm-B cannot efficiently repress the expression of NAm-A. Yet, in another more preferred embodiment, RCE-A comprises the Cytomegalovirus (CMV) promoter.
[0060] To allow that the molecule that regulates the function of the NAm-B encoded protein (such as a tetracycline-derived drug) has an effect on NAm-A expression at any time, the expression of NAm-B might be constitutive. Thus, in another preferred embodiment, the regulatory element that controls the expression of NAm-B (from now on referred as RCE-B) is a constitutive promoter. Preferably, RCE-B is the spleen focus forming virus (SFFV) promoter. According to
[0061] Overall, in a more preferred embodiment, the genetic construct of the first aspect of the invention comprises: an RCE-A that contains a binding site for the regulatory protein encoded by NAm-B and preferably further comprises the CMV promoter; an RCE-B that is constitutively active, preferably that is the SFFV promoter, more preferably that is the hEF1 promoter; a NAm-B that encodes a protein whose function is drug-responsive, preferably tetracyclineor a variant thereofresponsive, more preferably is based on the TetR repressor element, yet more preferably it represses the expression of NAm-A in the absence of the drug; a nucleic acid molecule (associated with the NAm-B so that both nucleic acid molecules encode a single polypeptide) that encodes a nuclear localization signal, preferably encoding that of the glucocorticoid receptor referred as nl2, more preferably sharing at least about a 70% of identity over the total length of the sequence with the sequence ID SEQ n 4, yet more preferably it is the sequence ID SEQ n 4; wherein the insulator sequence is the one sharing at least about a 70% of identity over the total length of the sequence preferably with the one consisting on the SEQ ID n 1, even more preferably with the one consisting on the SEQ ID n 1 associated with SEQ n 2 so that they form a single nucleic acid molecule, yet more preferably with the one consisting on the SEQ ID n 3; more preferably, the insulator sequence is any of the ones just mentioned, more preferably it is SEQ ID n 3.
[0062] The final goal of gene transfer is to insert a gene into a cell (and ultimately into an organism) using a vector that will transfer only the required nucleic acid sequences into the desired target cells. Viruses are naturally very efficient at transducing their own genetic information into host cells for their own replication. By replacing non-essential viral genes with foreign genes of therapeutic interest, recombinant viral vectors can be used to transduce the cell type that they would normally infect. For biosafety and viral safety reasons, in addition to the transgene(s) of interest, these modified vectors in many cases contain/express only the viral sequences required for the initiation of viral DNA replication and packaging (Bouard D. et al., Viral vectors: from virology to transgene expression, British Journal of Pharmacology (2009)). Therefore, in a particular embodiment, the genetic construct according to any of the previous embodiments is a viral vector. Examples of viral vectors that are commonly used for this purpose are retrovirus vectors, lentivirus vectors, Adenovirus Vectors, Adeno-associated virus (AAV) vectors and Semliki Forest Virus.
[0063] Retroviruses are viruses that carry RNA as genetic material instead of DNA and usually also carry reverse transcriptase enzymes that convert RNA into its DNA copy. Then, this DNA is integrated into the host genome using integrase enzyme. Thus, retroviruses are a subtype of virus that integrate their own genetic information into the host cell genome. They are broadly used in different gene transfer techniques. Therefore, in a preferred embodiment the genetic construct of the present invention is a retroviral vector.
[0064] Retrovirus vectors contain 5 and 3 Long Terminal Repeats (LTRs) that are found at either end of proviral DNA formed by reverse transcription of retroviral RNA. They are used by retroviruses to insert their genetic material into the host genomes. Each LTR consists of a U3, R, and U5 region. The ends of the LTRs subsequently participate in integration of the provirus DNA into the host genome. Once the provirus has been integrated, the LTR on the 5 end serves as the promoter for the entire retroviral genome, while the LTR at the 3 end provides for nascent viral RNA polyadenylation. The 3 LTR usually acts in transcription termination and polyadenylation. For safety reasons, retroviral vectors have the LTR promoter (U3) deleted and use an internal promoter to express transgenes in transduced cells.
[0065] Lentiviruses are a subtype of retroviruses. They present several advantages compared to other retroviruses for gene transfer purposes: (i) broad tissue tropisms, including important gene- and cell-therapy-target cell types; (ii) contrary to most retroviruses, the capability of infecting both dividing and non-dividing cells; (iii) no expression of viral proteins after vector transduction; (iv) the ability to deliver complex genetic elements, such as polycistronic or intron-containing sequences; (v) potentially safer integration site profile; and (vi) a relatively easy system for vector manipulation and production (Sakuma T. et al., Lentiviral vectors: basic to translational, Biochemical Journal (2012)). Therefore, they have been used to transfer genes into delicate cells such as stem cells or neurons. (Miyoshi H et al., Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors. Science (1999); Lois C et al., Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science (2002)). Thus, in a more preferred embodiment, the genetic construct of the present invention is a lentivirus vector (LV).
[0066] A second aspect of the invention refers to a composition comprising the genetic construct according to any of the previous embodiments, wherein this composition can be a pharmaceutical composition (from here in after pharmaceutical composition of the invention). The pharmaceutical composition of this invention can be used to treat patients having diseases, disorders or abnormal physical states such as blood diseases or neural diseases (neurodegenerative). Blood diseases treatable by stem cell transplant include leukemias, myelodysplastic syndromes, stem cell disorders, myeloproliferative disorders, lymphoproliferative disorders phagocyte disorders, inherited metabolic disorders, histiocytic disorders, inherited erythrocyte abnormalities, inherited immune system disorders, inherited platelet abnormalities, plasma cell disorders, and malignancies. Stem cell nerve diseases to be treated by neural stem cell transplantation include diseases resulting in neural cell damage or loss, eg. paralysis, Parkinson's disease, Alzheimer's disease, ALS, multiple sclerosis. Thus, in a particular embodiment of the second aspect, the invention is for use in therapy. It also relates to a method of medical treatment of a mammal, preferably a human, by administering to the mammal a genetic construct according to any of the previous embodiments of the invention or a cell containing this construct. The pharmaceutical composition of the invention can be administered by ex vivo and in vivo methods such as electroporation, DNA microinjection, liposome DNA delivery. Derivatives or hybrids of these vectors may also be used. Dosages to be administered depend on patient needs, on the desired effect and on the chosen route of administration.
[0067] The pharmaceutical composition of the invention could include acceptable carriers or excipients. It can be prepared by known methods for the preparation of pharmaceutically acceptable compositions which can be administered to patients, and such that an effective quantity of the genetic construct is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA). On this basis, the pharmaceutical composition could include an active compound or substance, such as the genetic construct, in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and isosmotic with the physiological fluids. The methods of combining the genetic construct with the vehicles or combining them with diluents is well known to those skilled in the art. The composition could include a targeting agent for the transport of the active compound to specified sites within the target cells. Thus, in a particular embodiment of the invention, the pharmaceutical composition optionally comprises a pharmaceutically acceptable vehicle.
[0068] In addition, the present invention also includes compositions and methods (from herein referred as method of the invention) for providing a genetic construct as defined in any of the embodiments of the first aspect of the invention, to a subject such that expression of the nucleic acid molecules of the genetic construct (NAm-A and NAm-B) in the cells provides the biological activity of the polypeptide encoded by the coding nucleic acid molecules in those cells. The invention includes methods and compositions for providing a coding nucleic acid molecule NAm-A to the cells of an individual such that the expression regulation of NAm-A in the cells provides the biological activity or phenotype of the polypeptide encoded by NAm-A to the cell. The method also relates to a method for providing an individual having a disease, disorder or abnormal physical state with a biologically active polypeptide by administering a genetic construct of the present invention. The amount of polypeptide will vary with the subject's needs. The optimal dosage of genetic construct may be readily determined using empirical techniques, for example by escalating doses. Various approaches to gene therapy may be used. The invention includes a process for providing a human with a therapeutic polypeptide including: introducing human cells into a human, said human cells having been treated in vitro or ex vivo to insert therein a pharmaceutical composition of the invention or a genetic construct of the invention, the human cells expressing in said human a therapeutically effective amount of said therapeutic polypeptide.
[0069] The method also relates to a method for producing a stock of recombinant virus by producing virus suitable for gene therapy. This method preferably involves transfecting cells permissive for virus replication and collecting the virus produced.
[0070] Furthermore, the invention also relates to a mammalian host cell (isolated cell in vitro, a cell in vivo, or a cell treated ex vivo and returned to an in vivo site) comprising the genetic construct of any of the embodiments of the first aspect of the invention. In this sense, cells transfected with a nucleic acid molecule as a DNA molecule, or transduced with the nucleic acid molecule as a DNA virus vector, may be used, for example, in bone marrow or cord blood cell transplants according to techniques known in the art. Examples of the use of transduced bone marrow or cord blood cells in transplants are for ex vivo gene therapy of Adenosine deaminase (ADA) deficiency. Other cells which may be transfected or transduced either ex vivo or in vivo include purified stem cells. Thus, a third aspect of the invention refers to a mammalian host stem cell comprising the genetic construct according to any of the embodiments of the first aspect of the invention. In a particular embodiment, the host stem cell is a cell of embryonic or adult tissue origin.
[0071] In any case such a mammalian cell or mammalian host cell transfected or transduced with the genetic constructs can be useful as research tools to measure levels of expression of the coding nucleic acid molecule NAm-A and the activity of the polypeptide encoded by NAm-A. In this sense the genetic constructs of the invention are useful in research to deliver marker genes or antisense RNA to cells. In a particular embodiment, the invention refers to the use of the genetic construct according to any of the embodiments of the first aspect of the invention, for cell marking. In another particular embodiment, the invention refers to the use of the genetic construct according to any of the previous embodiments, for cell genetic manipulation studies.
[0072] A fourth aspect of the invention refers to a method for expressing a nucleic acid molecule in a mammalian host cell, comprising a) administering to the cell an effective amount of the genetic construct according to any of the previous embodiments, and b) expressing the nucleic acid molecules of the genetic construct to produce the coding nucleic acid molecule RNA and its encoding polypeptide. Preferably, the host cell is a stem cell.
[0073] A fifth aspect of the invention refers to a method for producing a polypeptide in a mammalian host cell, comprising a) administering to the cell an effective amount of the genetic construct according to any of the previous embodiments, and b) expressing the nucleic acid molecule of the genetic construct to produce the coding nucleic acid molecule RNA and its encoding polypeptide. Preferably, the host cell is a stem cell.
[0074] In a preferred embodiment of the fourth and fifth aspects of the invention, the host cell is a pluripotent stem cell of embryonic origen (ESCs) or adult tissue origin (iPS). In a particular embodiment, the host cell is a cell factory for protein production (ie CHOs, HEK free style).
[0075] Finally a further aspect of the invention is an isolated polypeptide produced from a genetic construct or vector of the invention according to a method of the invention.
[0076] The following examples are only meant for illustrative purposes.
EXAMPLES
Materials and Methods
[0077] Plasmids Construction
[0078] Two different nuclear sequences named nl1 and nl2 were incorporated at the 3end of TetR preceding the stop codon in the StetR LV (Benabdellah, K. et al., Development of an all-in one lentiviral vector system based on the original TetR for the easy generation of Tet-ON cell lines. PLoS ONE (2011)) to generate STetRnl1 and STetRnl2. nl1 consist in a three tandem repeat sequence corresponding to the nuclear localization signal (DPKKKRKV) from SV40, whereas nl2 (RKCLQAGMNLEARKTKK) is the nuclear localization signal from the glucocorticoid receptor. A Pstl-Pstl 1231 bp fragment from the STetRnl1 and STetRnl2 LVs was inserted within the unique Pstl site of the CEWP vector (Demaison, C. et al. High-level transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency [correction of imunodeficiency] virus type 1-based lentiviral vector containing an internal spleen focus forming virus promoter. Hum Gene Ther (2002)) to get the CESTnl1 and CESTnl2 respectively. CESTnl2Is2 were constructed by inserting a Kpnl-Nhel 1509 bp fragment from the SE-Is2Rev (Benabdellah, K. et al., A chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells. PLoS ONE (2014)) into the Kpnl-Nhel site of CESTnl2. CEETnl2 and CEETnl2Is2 were constructed in three steps: 1a DNA fragment encompassing the TetRnl2 sequence was amplified from the StetRnl2 and inserted into the pLVTHM LV (Addgene plasmid 12247) using standard molecular techniques to obtain the pLVTHM-TetRnl2. 2The CEETnl2 vector was generated by insertion of a Sall-Kpnl fragment (encompassing the hEF1-TetRnl2) into the Pstl site of CEWP. 3Finally, the CEETnl2Is2 was constructed by inserting the Kpnl-Nhel 1509bp fragment from the SE-Is2Rev Benabdellah, K. et al., A chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells. PLoS ONE (2014) into the Kpnl-Nhel site of CEETnl2.
[0079] Lentiviral vector production, cells transduction and calculation of vector copy number per cell. The human immunodeficiency virus (HIV) packaging (pCMV_R8.91) and VSV-G (pMD2.G) plasmids (http://www.addgene.org/Didier_Trono) are described elsewhere (Zufferey, R. et al., Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. (1997); Naldini, L. et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science (1996)). Vector production was performed as previously described (Benabdellah et al., 2011). Briefly, 293T cells were plated on amine-coated petri-dishes (Sarsted, Newton, N.C.). The vector (CEST, CESTnl1, CESTnl2, CESTnl2Is2, CEETnl2 or CEETnl2Is2), the packaging (pCMVR8.9) and the envelope (pMD2.G) plasmids were transfected into the 293T cells using LipoD293 (SignaGen, Gainthersburg, Md., USA). Viral supernantants were collected and frozen or concentrated by ultrafiltration at 2000 g and 4 C., using 100 Kd centrifugal filter devices (Amicon Ultra-15, Millipore, Billerica, Mass.). Freshly collected virus particles, were used to transduce 293T, hMSCs and hESC as previously described (Benabdellah, K. et al., Development of an all-in-one lentiviral vector system based on the original TetR for the easy generation of Tet-ON cell lines. PLoS ONE (2011); Munoz, P. et al. Specific marking of hESCs-derived hematopoietic lineage by WAS-promoter driven lentiviral vectors. PLoS ONE (2012)) Briefly, hMSCs were dissociated and mixed with the viral particles at the desired MOI, left at room temperature for 10 minutes, seeded and maintained at the incubator (5% O2; 5% CO2; 37 C. and humidity) for 5 hours. hMSCs were then washed and seeded in a bigger flask for expansion. hESCs were dissociated with collagenase type IV and plated on fresh matrigel in the presence of the fresh viral particles. The media was changed after 5 hours. When the colonies reached confluence they were split and expanded in fresh matrigel tissue flasks.
[0080] The vcn/c of transduced cells was calculated using 0.6 g of genomic DNA (=100,000 hESCs) and plasmid DNA (from 10.sup.2 to 10.sup.7 copies) for the standard curve. The Q-PCR was performed as previously described (Aker, M. et al. Extended core sequences from the cHS4 insulator are necessary for protecting retroviral vectors from silencing position effects. Hum Gene Ther (2007)) using the eGFP primers shown in Supplementary Table 1.
[0081] Cell Lines and Culture Media
[0082] 293T cells (CRL11268; American Type Culture Collection; Rockville, Md.) were grown in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Edinburgh, Scotland) with GlutaMAX and supplemented with 10% Fetal Bovine Serum (FBS) (PAA Laboratories GmbH, Austria). hMSCs were obtained from Biobanco del Sistema Sanitario Pblico de Andalucia (Granada, Spain) and cultured as previously described (Carrillo-Galvez, A. B. et al. Mesenchymal stromal cells express GARP/LRRC32 on their surface: effects on their biology and immunomodulatory capacity. Stem Cells (2015)). Briefly hMSCs were cultured in advanced Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) (Invitrogen, Carlsbad, Calif.), Glutamax (GIBCO, Grand Island, N.Y., www.lifetechnologies.com), and 100 U/ml penicillin/streptomycin (GIBCO). All experiments using human samples were performed according to the Institutional Guidelines and approved by the ethics committee of the H.U. Virgen de Macarena.AND-1 (Spanish Stem Cell Bank.).sup.75 and H9 (Wicell Research Institute Inc. Madison, Wis.) hESC lines were maintained undifferentiated in a feeder-free culture as previously described (Munoz, P. et al. Specific marking of hESCs-derived hematopoietic lineage by WAS-promoter driven lentiviral vectors. PLoS ONE (2012)). Briefly hESCs were culture in matrigel-coated T25 flasks and fed daily with hMSC-conditioned medium (Ramos-Mejia, V. et al. Maintenance of Human Embryonic Stem Cells in Mesenchymal Stem Cell-Conditioned Media Augments Hematopoietic Specification. Stem Cells Dev (2012)) supplemented with 8 ng/ml bFGF (Miltenyi Biotech, Bergish Gladbach, Germany). Approval from the Spanish National Embryo Ethical Committee was obtained to work with hESCs.
[0083] Adipocyte and Osteocyte Differentiation.
[0084] Untransduced hMSCs as well as CEETnl2- and CEETnl2Is2 transduced hMSC were differentiated to adipocytes and osteocytes as previously described (Anderson, P. et al. CD105 (endoglin)-negative murine mesenchymal stromal cells define a new multipotent subpopulation with distinct differentiation and immunomodulatory capacities. PLoS ONE (2013)). Briefly, hMSCs were plated in 6-well plates at a density of 20,000 cells/cm.sup.2 for adipogenesis, 10,000 cells/cm.sup.2 for osteogenesis and incubated in the adipogenic and osteogenic MSCs differentiation BulletKits respectively (Ionza, Basel, Switzerland).
[0085] Human ESCs Hematopoietic Differentiation in OP9 Co-Culture System.
[0086] Hematopoietic differentiation was induced as described by Ji et al (Ji, J. et al. OP9 stroma augments survival of hematopoietic precursors and progenitors during hematopoietic differentiation from human embryonic stem cells. Stem Cells (2008)). Briefly, the hESCs lines were transferred onto OP9 feeders for 15 days. To evaluate hematopoietic differentiation and eGFP expression at the different days, cells were dissociated with collagenase IV and Tryple (Gibco), resuspended in FACS buffer, filtered through a 70 m cell strainer (BD Biosciences, Bedford, Mass.) and stained with anti-mouse CD29-FITC (AbD Serotec, Raleigh, GBK), anti-human CD34-PE-Cy7 and anti-human CD45-APC (all from eBiosciences, San Diego, Calif.) and analyzed in a FACS Canto II flow cytometer.
[0087] Differentiation of hESCs Towards the Mesenchymal Lineage.
[0088] Derivation of MSC-like cell was carried out as previously described (Liu et al., 2012), Briefly, AND-I hESC were treated with 10 M ROCK for 1 hours, and disaggregated into a single cells with trypsin. The cells were collected in maintenance medium (Embryonic fibroblast conditioned medium supplemented with 4 ng/ml FGF) (Invitrogen), and seeded at a density of 15000/cm2 in Type I collagen coated well tissue culture. 24 hours later, the maintenance medium was supplemented with an equal volume of basal -MEM (invitrogen) with 10% FBS (Hyclone), 100 U/ml penicillin, 100 g/ml streptomycin (Invitrogen) and 50 M magnesium L-ascorbic acid phosphate (Sigma-Aldrich). 10 days later, the medium was replaced with -MEM (Invitrogen), supplemented with 100 U/ml penicillin and 100 g/ml streptomycin, 2 mM L-glutamine. The third passage was used for flow cytometry analysis.
[0089] FACS Analysis and FACS-Sorting. [0090] eGFP expression of total populations: The different cell types cultured in the presence of absence of Dox (0.1 g/ml) were resuspended in PBS+FBS+EDTA buffer (FACS buffer) and filtered through a 70 m cell strainer (BD Biosciences, Bedford, Mass.). Live cells identifier by 7-AAD viability dye exclusion were analyzed for eGFP expression using a FACS Canto II flow cytometer equipped with the FACS Diva analysis software (BD Bioscience). [0091] eGFP expression in hESCs-derived subpopulations. hMSCs derived from untransduced and transduced hESCs were resuspended in FACS buffer and stained with anti-CD105-APC antibodies (eBioscience, San Diego, Calif.) and analyzed by FACS. eGFP expression was measured in the CD105.sup.+ population. Similarly, hematopoietic cells derived from untransduced and transduced hESCs were resuspended in FACS buffer and stained with anti-CD34-PE-Cy7 (BD Biosciences) and anti-CD45-APC (Miltenyi Biotech, Bergish Gladbach, Germany) antibodies. Live cells identified by 7-AAD viability dye exclusion were analyzed for surface-marker and eGFP expression using a FACS Canto II. The populations analyzed were hemogenic progenitors (CD45.sup.CD34.sup.+), hematopoietic progenitors (CD45.sup.+CD34.sup.+), and mature blood cells (CD45.sup.+CD34.sup.+). [0092] Analysis of pluripotency markers in untransduced and transduced hESCs. Untransduced and transduced hESCs were stained with the antibodies OCT3/4 (BD Pharmingen), SSE3, TRA-1-60, TRA-1-81 (eBiosciences) and live cells identified by 7-AAD viability dye exclusion (eBiosciences) (data not shown). Samples were acquired and analyzed in a FACS Canto II flow cytometer equipped with the FACS Diva analysis software (Becton Dickinson, Franklin Lakes, N.J.).
[0093] Separation of eGFP.sup.+hMSCs and hESCs.Dox-induced eGFP.sup.+ populations of CEETnl2 and CEETnl2Is2-transduced hMSCs or hESCs were washed and separated using fluorescence-activated cell sorting (FACS) Aria II Flow Cytometer. A MOI=0.4 was used to keep the percentage of transduced hMSCs below 15%. For hESCs a MOI=30 was used to achieve over 30% eGFP.sup.+ cells and good expression levels for sorting.
[0094] Western Blot
[0095] Cells were lysed in RIPA buffer (Sigma) containing protease inhibitors (Sigma Aldrich) at 110.sup.6 cells/100 l. The lysates (20 g/sample) were resolved by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (10% polyacrylamide under reducing conditions) and electrotransferred to nitrocellulose membranes (Bio-Rad Hercules Calif.). Milk-blocked Membranes were probed for 1 hour at room temperature with mouse anti-Tet-repressor (Mobitec; no TET02) at 1:500 dilution at 4 C., and rabbit anti-alpha-tubulin (Santa Cruz, sc-5546). Combination of IRDye 680LT Goat anti-Rabbit IgG (Licors: no 26-68021) and IRDye 800CW Goat anti-Mouse IgG (Licors: no 926-32210) were use at 1:10.000 dilutions to analyzed TetR and tubulin using an Odyssey Image scanner system (LI-COR Biosciences).
[0096] Determination of Fold Induction and Leaking Index.
[0097] Transduced cells incubated in the presence or absence of Dox (0.1g/ml) were analyzed by flow cytometry to determine the percentage and Mean Fluorescence Intensity (MFI) of eGFP positive cells as well as the MFI of WLC (WLC=P1 defined as the 7-AAD negative population). The fold induction was calculated using the following formula MFI P1 (+Dox)/MFI P1 (Dox). Similarly, the Leakiness of the system was determined by using the following formulas [% eGFP.sup.+ (Dox)100/% eGFP.sup.+(+Dox)] or [[% eGFP.sup.+ (Dox)100/% eGFP.sup.+(+Dox)]]MFI eGFP.sup.+(Dox)). Background (% eGFP.sup.+ cells in MOCK transduced cells) were subtracted to the % eGFP.sup.+ obtained in the different transductions and conditions. Therefore, when the % eGFP.sup.+ (Dox) is identical in Mock and Transduced cells the leaking is zero and when the % eGFP.sup.+ (Dox) is identical to the % eGFP.sup.+(+Dox) the leaking is 100.
[0098] DNA Methylation Assay
[0099] The promoter methylation was assessed by bisulfite treatment of Genomic DNA and sequencing of the resulting converted gDNA. In the presence of sodium bisulfite, only the unmethylated cytosines are chemically converted to uracil. The genomic DNA was isolated from hESCs at the desired time points using the DNaseasy kit (Qiagen, Crawly, UK). Sodium bisulfite treatment of genomic DNA was performed using the EpiTect bisulfit kit (Qiagene), according to the manufacturer's instruction. The converted gDNA was used for a nested PCR amplification of SFFV and EF1a promoters. The primers used for each amplification is shown in Table 1. The PCR product band was purified and cloned into PCR 2.1 (Invitrogen) according to the manufacturer's instruction. 15-30 clones were randomly selected and sequenced with M13 primers. Identical sequences were eliminated from the study to avoid duplicated clones.
TABLE-US-00001 TABLE1 Primersusedforthemethylationprofile analysisanddeterminationofvectorcopy numberpercell(vcn/c). SFFVf1 5'-TAGAAAAAGGGGGGAATGAAA-3' eGFPr1 5'-AAACAACTCCTCACCCTTACTCAC-3' SFFVf2 5'-GGGGGAATGAAAGATTTTATTTG-3' eGFPr2 5'-CCCTTACTCACCATAATTTCAACC-3' EF1f1 5'-GATGGATAAAGTTTTAAAT-3' EF1r1 5'-CTATTCTTTCCCCTACACTATAC-3' EF1f2 5'-AAGTTTTAAATAGAGAGGAA-3' EF1r2 5'-CTACACTATACCCCCCAATCC-3' TetRf 5'-GGGATCCTAGTGATTATGTCT-3' TetRr 5'-TTACGGGTTGTTAAACCTTC-3' GADPHf 5'-GAAGGTGAAGGTCGGAGTC-3' GADPHr 5'-GAAGATGGTGATGGGATTTC-3' eGFPfw 5'-GTTCATCTGCACCACCGGCAAG-3' eGFPrev 5'-TTCGGGCATGGCGGACTTGA-3'
[0100] Analysis of the Adipocyte and Osteocyte Differentiation:
[0101] The different cells line were incubated in osteogenic and adipogenic MSCs differentiation BulletKit media respectively (Ionza, Basel, Switzerland), and stained with Oil red (Amresco, solon, Ohio) to stain lipid vesicles present in adipocytes and with Alizarin Red S (Sigma) to stain calcium deposits in osteocytes.
[0102] mRNA Analysis by RT-qPCR.
[0103] Total RNA from hMSCs transduced with CESTln2Is2 or with CEETLN2Is2 was isolated using the Trizol reagent (Invitrogen) and reverse-transcribed using the Superscript first-strand system (Invitrogen). qPCRs were performed using the QuantiTect SYBRGreen PCR kit (Qiagen) on a Stratagene MX3005P system (Agilent Technologies, Santa Clara, Calif.). Q-PCR reactions consisted of 40 cycles at 94 C. (15 sec), then 60 C. (30 sec) and 72 C. (30 Sec). TetR and GADPH specific primers are shown in Table 1. The relative expression was calculated using CT method.
[0104] Statistical Analysis
[0105] All data are represented as mean +/(SEM). The statistical analysis was performed using the GraphPad Prism software (GraphPad Software, Inc., La Jolla, Calif.) applying the unpaired two-tailed t-test. Statistical significance was defined as a P value<0.05.
[0106] Results
Example 1. Development of an All-In-One LVs System with Lower Leaking and Enhanced Inducibility: The Lent-On-Plus System
[0107] In order to generate Tet-On all-in-one LVs that tightly regulate transgene expression in human stem cells we have constructed several LVs harboring different modifications (
[0108] Next, we constructed four all-in-one LVs harboring different promoters and insulator combinations (
[0109] Expression of the TetRnl2 through the hEF1 promoter in 293T cells decreased the leaking of the vectors in the absence of Dox (Compare CESTnl2 versus CEETnl2 in
[0110] In spite of the improvements in leaking and fold induction of the CEETnl2 and CESTnl2 LVs, both vectors still presented high leaking and poor fold induction. Insulators, such as the chicken hypersensitive site 4 (cHS4) (Chung, J. H., et al. A 5 element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila. Cell (1993)) can shield integrative vectors from nearby regulatory domains favoring a more autonomous regulation and also act as barriers to avoid silencing (Emery, D. W. et al. A chromatin insulator protects retrovirus vectors from chromosomal position effects. Proc Natl Acad Sci USA (2000); Rivella, S. et al. The cHS4 insulator increases the probability of retroviral expression at random chromosomal integration sites. J Virol (2000)).
[0111] SARs/MARs elements have also been incorporated into retroviral vectors improving their transgene expression and preventing promoter inactivation (Agarwal, M. et al. Scaffold attachment region-mediated enhancement of retroviral vector expression in primary T cells. J Virol (1998); Dang, Q. et al. Human beta interferon scaffold attachment region inhibits de novo methylation and confers long-term, copy number-dependent expression to a retroviral vector. J Virol (2000); Ramezani, A. et al. Performance- and safety-enhanced lentiviral vectors containing the human interferon-beta scaffold attachment region and the chicken beta-globin insulator. Blood (2003)). We have previously constructed the Is2 insulator (combining the HS4-650 and a synthetic SAR element) that was able to enhance expression and avoid silencing of LVs in hESCs (Benabdellah, K., A chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells. PLoS ONE (2014)). We hypothesized that the inclusion of this element in the CESTnl2 and CEETnl2 LVs could improve their performance.
[0112] As expected, the CESTnl2Is2 LV showed improved expression levels compared to their Is2-negative counterpart (CESTnl2) in the presence of Dox (
[0113] Leaking of a regulatable system can be analyzed in different ways. For simplicity, we have used the formula; leaking=[% eGFP.sup.+(Dox)*100/% eGFP.sup.+(+Dox) that generate values from 0 (no leaking) to 100 (absence of regulation). However, this analysis does not discriminate between partially-responsive cells from those cells that do not respond to Dox. We have therefore reanalyzed the leaking using an alternative formula; leaking=[% eGFP.sup.+ (Dox)/% eGFP.sup.+(Dox)]MFI eGFP.sup.+cells (Dox)] to take into account the expression levels of the transduced cells in the absence of Dox (
[0114] All together these data indicate that only the CEETnl2Is2 LV was able to regulate transgene expression in 293T harboring one vector copy number per cell (vcn/c). As a down side, we detected a reduction on the titer (2-3 fold) of the Is2-LVs compared to their Is2-negative counterparts (data not shown).
[0115] The fold induction parameter indicates the increment of eGFP expression of the total population upon the addition of Dox (see M&M for details). Since we kept transduction below 40% (to obtain cell populations harboring only one vcn/c), the fold induction is underestimated. To study the potency of the system we further analyzed the inducibility of the Lent-On-Plus LVs (CEETnl2 and CEETnl2Is2) on cell populations that are 100% responsive to Dox (
Example 2. The Is2+ Lent-On-Plus LVs Efficiently Regulate Transgene Expression in Human Mesenchymal Stromal Cells
[0116] We next tested the new inducible systems in hMSCs. We transduce hMSCs with the CESTnl2, CESTnl2Is2, CEETnl2 and CEETnl2Is2 LVs at a MOI=1 and 10 days later analyzed for GFP expression in the presence or absence of Dox (
[0117] Inducible systems should be able to maintain transgene regulation upon cellular expansion and/or differentiation. We therefore transduced hMSCs with the CEETnl2 and CEETnl2Is2 LVs and studied transgene regulation after expansion (
[0118] Finally we aimed to generate pure populations of CEETnl2 and CEETnl2Is2-cells harboring 1 vcn/c. hMSCs were transduced at low MOI to achieve 9-15% eGFP.sup.+ cells upon induction with Dox. Two weeks later eGFP.sup.+ hMSCs were sorted to a purity of 99% (
Example 3.Generation of Doxycycline-Responsive Pluripotent Stem Cells by the CEETnl2 and the CEETnl2Is2
[0119] The generation of pluripotent stem cells expressing the desired transgene under the tight control of an inducer has been a very difficult task to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the side effects of the transactivators. We hypothesized that the use of insulated LVs expressing the TetRnl2 through stable promoters could overcome previous existing limitations to generate Dox-inducible hESCs. To investigate this possibility, we first tested the Dox-responsiveness of two hESCs lines (AND-1 and H9) transduced with the CESTnl2, CESTnl2Is2, CEETnl2 and CEETnl2Is2 LVs at MOI=5 (
[0120] We next generated sorted CEETnl2- and CEETnl2Is2-transduced hESCs in order to study Dox responsiveness in a purer population. hESCs were transduced at MOI=30 and two weeks later, CEETnl2- and CEETnl2Is2-transduced hESCs were sorted to a purity of 74 and 50% respectively (
Example 4. The hEF1 Promoter is a Key Factor for Regulation of the CEETnl2 and CEETnl2Is2 LVs
[0121] Transgene silencing due to promoter methylation of integrative RVs has been a major problem for stable expression in hESCs. Several studies have shown that pluripotent cells can block expression of exogenous retroviral elements by complex defense mechanisms (Cherry, S. R. et al. Retroviral expression in embryonic stem cells and hematopoietic stem cells. Mol Cell Biol (2000)). It has been previously described that the SFFV promoter is silenced through methylation in human pluripotent cells (Herbst, F. et al. Extensive methylation of promoter sequences silences lentiviral transgene expression during stem cell differentiation in vivo. Mol Ther (2012)) while the hEF1 promoter is highly resistant allowing stable transgene expression in these cell types (Hong, S. et al. Functional analysis of various promoters in lentiviral vectors at different stages of in vitro differentiation of mouse embryonic stem cells. Mol Ther (2007); Wang, R. et al. Promoter-dependent EGFP expression during embryonic stem cell propagation and differentiation. Stem Cells Dev (2008); Xia, X. et al. Transgenes delivered by lentiviral vector are suppressed in human embryonic stem cells in a promoter-dependent manner. Stem Cells Dev (2007)). We therefore analyzed the methylation profiles of the SFFV and hEF1 promoters in CESTnl2- and in CEETnl2-transduced hESCs (
Example 5. Doxycycline Responsiveness of the Lent-On-Plus LVs is Maintained After Differentiation of hESCs Toward the Mesenchymal and Hematopoietic Lineages
[0122] Ideally, the inducible systems for pluripotent stem cells must be also able to maintain drug responses upon differentiation toward different cell types. We then analyzed whether the Lent-On-Plus systems (CEETnl2 and CEETnl2Is2) maintained the Dox responsiveness in mesenchymal and hematopoietic cells derived from transduced hESCs (
[0123] hESCs transduced with the CEETnl2 and CEETnl2Is2 LVs at high MOI (vcn/c of 2.5 and 1.9 respectively) (
[0124] We finally differentiated CEETnl2- and CEETnl2Is2-transduced hESCs toward the hematopoietic lineage using the OP9 differentiation protocol as previously described.sup.33 (see M&M for details). The cells were maintained in the presence or absence of Dox from day 1 of differentiation and the eGFP expression was analyzed in the different hematopoietic populations at day 8 and day 15 (
TABLE-US-00002 SEQUENCELISTING <160>NUMBEROFSEQIDNOS:3 <210>SEQIDNO1 <211>LENGTH:367 <212>TYPE:DNA <213>ORGANISM:ArtificialSequence <220>FEATURE: <223>OTHERINFORMATION:SyntheticS/MARnucleicacidmolecule containing5M/SARsrecognitionsignatures <220>FEATURE: <221>NAME/KEY:misc_feature <222>LOCATION:(I)...(367) <400>SEQUENCE:1 (MRS) taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacgga60 ggctcctcatttatttttgaacttaaagacttaatattgtgaaggtatactttctttaat120 aataagcctgcgcccaatatgttcaccccaaaaaagctgtttgttaacttgtcaacctca180 tttaaaatatataagaaacagcccaaagacaataacaaaagaataataaaaaagaatgaa240 atatgtaattctttcagagtaaaaatcacacccatgacctggccactgagggcttgatca300 attcactttgaatttggcattaaataccattaaggtatattaactgattttaaaataaga360 tatattc367 <210>SEQIDNO2 <211>LENGTH:655 <212>TYPE:DNA <213>ORGANISM:ArtificialSequence <220>FEATURE: <223>OTHERINFORMATION:NucleicacidmoleculeHS4-650bp <220>FEATURE: <221>NAME/KEY:misc_feature <222>LOCATION:(I)...(655 <400>SEQUENCE:2 aagatctgctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctc60 ccccgctagggggcagcagcgagccgcccggggctccgctccggtccggcgctccccccg120 catccccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcg180 ctttcctctgaacgcttctcgctgctctttgagcctgcagacacctggggggatacgggg240 aaaatgtgtctgagcctgcatgtttgatggtgtctggatgcaagcagaaggggtggaaga300 gcttgcctggagagatacagctgggtcagtaggactgggacaggcagctggagaattgcc360 atgtagatgttcatacaatcgtcaaatcatgaaggctggaaaagccctccaagatcccca420 agaccaaccccaacccacccaccgtgcccactggccatgtccctcagtgccacatcccca480 cagttcttcatcacctccagggacggtgacccccccacctccgtgggcagctgtgccact540 gcagcaccgctctttggagaaggtaaatcttgctaaatccagcccgaccctcccctggca600 caacgtaaggccattatctctcatccaactccaggacggagtcagtgagaatatt655 <210>SEQIDNO3 <211>LENGTH:1022 <212>TYPE:DNA <213>ORGANISM:ArtificialSequence <220>FEATURE: <223>OTHERINFORMATION:IS2 <220>FEATURE: <221>NAME/KEY:misc_feature <222>LOCATION:(I)...(I022) <400>SEQUENCE:3 aagatctgctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctc60 ccccgctagggggcagcagcgagccgcccggggctccgctccggtccggcgctccccccg120 catccccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcg180 ctttcctctgaacgcttctcgctgctctttgagcctgcagacacctggggggatacgggg240 aaaatgtgtctgagcctgcatgtttgatggtgtctggatgcaagcagaaggggtggaaga300 gcttgcctggagagatacagctgggtcagtaggactgggacaggcagctggagaattgcc360 atgtagatgttcatacaatcgtcaaatcatgaaggctggaaaagccctccaagatcccca420 agaccaaccccaacccacccaccgtgcccactggccatgtccctcagtgccacatcccca480 cagttcttcatcacctccagggacggtgacccccccacctccgtgggcagctgtgccact540 gcagcaccgctctttggagaaggtaaatcttgctaaatccagcccgaccctcccctggca600 caacgtaaggccattatctctcatccaactccaggacggagtcagtgagaatatttaaat660 aaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacggaggctc720 ctcatttatttttgaacttaaagacttaatattgtgaaggtatactttctttaataataa780 gcctgcgcccaatatgttcaccccaaaaaagctgtttgttaacttgtcaacctcatttaa840 aatatataagaaacagcccaaagacaataacaaaagaataataaaaaagaatgaaatatg900 taattctttcagagtaaaaatcacacccatgacctggccactgagggcttgatcaattca960 ctttgaatttggcattaaataccattaaggtatattaactgattttaaaataagatatat1020 tc1022 SEQIDNO4 ARKCLQAGMNLEARKTKKK gcccgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaag