MULTIBLOCK COPOLYPEPTIDES OF ELASTIN-BASED POLYPEPTIDES AND MUSSEL FOOT PROTEINS WITH STIMULI-RESPONSIVENESS AND SURFACE-ADHESIVE, METHODS OF PREPARING THEREOF AND USE THEREOF

20200199199 ยท 2020-06-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a multiblock copolypeptide having stimulus responsivity and surface adhesiveness. The multiblock copolypeptide of the present disclosure, which is composed of an elastin-based polypeptide and a mussel foot protein, can form self-assembled core-shell structures and hydrogels exhibiting reversible change in response to temperature stimulation and can be used usefully for biomedical applications due to remarkably superior surface adhesiveness.

Claims

1. A multiblock copolypeptide comprising: an elastin-based polypeptide (EBP); and a mussel foot protein (MFP).

2. The multiblock copolypeptide according to claim 1, wherein the multiblock copolypeptide is composed of an arrangement selected from a group consisting of (EBP).sub.n(MFP).sub.n, (EBP).sub.n(MFP).sub.n(EBP).sub.n and (MFP).sub.n(EBP).sub.n(MFP).sub.n, wherein the n, which is an integer 1 or greater, is the number of EBP or MFP repeat unit.

3. The multiblock copolypeptide according to claim 1, wherein the elastin-based polypeptide (EBP) is composed of an amino acid sequence selected from a group consisting of a [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block, a [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block and an [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block, wherein the X is an amino acid excluding proline.

4. The multiblock copolypeptide according to claim 3, wherein the X of the [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block comprises: A (Ala), G (Gly) and I (Ile) at a ratio of 1:4:1; K (Lys), G (Gly) and I (Ile) at a ratio of 1:4:1; D (Asp), G (Gly) and I (Ile) at a ratio of 1:4:1; E (Glu), G (Gly) and I (Ile) at a ratio of 1:4:1; G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2; K (Lys), A (Ala) and F (Phe) at a ratio of 1:3:2; D (Asp), A (Ala) and F (Phe) at a ratio of 1:3:2; K (Lys) and F (Phe) at a ratio of 3:3; D (Asp) and F (Phe) at a ratio of 3:3; H (His), A (Ala) and I (Ile) at a ratio of 3:2:1; H (His) and G (Gly) at a ratio of 5:1; or G (Gly), C (Cys) and F (Phe) at a ratio of 1:3:2.

5. The multiblock copolypeptide according to claim 3, wherein the X of the [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block comprises: A (Ala), G (Gly) and I (Ile) at a ratio of 1:4:1; K (Lys), G (Gly) and I (Ile) at a ratio of 1:4:1; D (Asp), G (Gly) and I (Ile) at a ratio of 1:4:1; E (Glu), G (Gly) and I (Ile) at a ratio of 1:4:1; or G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2.

6. The multiblock copolypeptide according to claim 3, wherein the X of the [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block comprises: G (Gly), A (Ala) and F (Phe) at a ratio of 1:4:1 or 1:3:2.

7. The multiblock copolypeptide according to claim 1, wherein the mussel foot protein (MFP) is California mussel foot protein 5 (Mytilus californianus foot protein 5 (Mcfp5)) or Mediterranean mussel foot protein 5 (Mytilus galloprovincialis foot protein 5 (Mgfp5)).

8. The multiblock copolypeptide according to claim 1, which is represented by an amino acid sequence of SEQ ID NOS 50-70.

9. A gene encoding the multiblock copolypeptide according to claim 1.

10. A recombinant vector comprising the gene according to claim 9.

11. A recombinant microorganism with the gene according to claim 9.

12. The recombinant microorganism according to claim 11, wherein a gene encoding tyrosinase or an expression vector comprising a gene encoding tyrosinase is further introduced for coexpression.

13. A method for preparing a multiblock copolypeptide, comprising: (a) a step of producing a multiblock copolypeptide by culturing the recombinant microorganism according to claim 11; and (b) a step of obtaining the produced multiblock copolypeptide.

14. The method according to claim 13, wherein a gene encoding tyrosinase or an expression vector comprising a gene encoding tyrosinase is further introduced in the recombinant microorganism of the step (a) for coexpression of the multiblock copolypeptide and tyrosinase.

15. The method according to claim 14, wherein a tyrosine residue of the multiblock copolypeptide is modified to a DOPA (3,4-dihydroxyphenylalanine) residue by the tyrosinase.

16. A self-assembled nanostructure of a core-shell structure wherein an EBP block of the multiblock copolypeptide according to claim 1 forms a core structure and an MFP block forms a shell structure in response to temperature stimulation.

17. A drug delivery composition comprising the self-assembled nanostructure according to claim 16.

18. A hydrogel prepared through crosslinking between block polypeptides of the multiblock copolypeptide according to claim 1 in response to temperature stimulation.

19. The hydrogel according to claim 18, wherein the hydrogel is formed through oxidation or noncovalent interaction of a DOPA (3,4-dihydroxyphenylalanine) residue comprised in the mussel foot protein (MFP).

20. A bioadhesive composition comprising the hydrogel according to claim 18.

21. A surgical suture comprising the hydrogel according to claim 18.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0018] FIG. 1 schematically shows various block copolypeptides composed of EBP and MFP ((A): diblock and triblock copolypeptides forming a core-shell (micelle) structure, (B): MFP-EBP-MFP triblock copolypeptide forming a hydrogel, (C): EBP-MFP-EBP triblock copolypeptide forming a hydrogel, (D): stimulus responsivity and surface adhesiveness mechanisms of an EBP-MFP-EBP triblock copolypeptide).

[0019] FIG. 2 shows a result of investigating MFP DNA of the present disclosure by agarose gel electrophoresis ((A): Mcfp5, (B) Mgfp5, lane (M): size marker, lane (1): one MFP repeat unit, lane (2): two MFP repeat units, lane (3): four MFP repeat units).

[0020] FIG. 3 schematically shows cloning of an EBP-MFP block copolypeptide gene of the present disclosure ((A): multiple cloning of MFP, (B): EBP-MFP block copolypeptide cloning).

[0021] FIG. 4 schematically shows cloning of tyrosinase and ORF438 genes of the present disclosure ((A): tyrosinase cloning, (B): ORF438 cloning).

[0022] FIG. 5 shows a result of investigating (A) tyrosinase and (B) ORF438 DNA of the present disclosure by agarose gel electrophoresis (lanes (1) and (2) DNA template: 25 ng, lanes (3) and (4) DNA template: 50 ng, lane (N): negative control group).

[0023] FIG. 6 shows (A) a agarose gel electrophoresis (1.2%) result of tyrosinase gene (824 bp) and ORF438 gene (438 bp) DNAs; (B) an SDS-PAGE result of tyrosinase (35 kDa), EBP-MFP diblock copolypeptide (24 kDa) and ORF438 (15 kDa) coexpressed in E. coli (lane (1): EBP-MFP diblock copolypeptide, lane (2): tyrosinase and ORF438, lane (3): diblock copolypeptide, tyrosinase and ORF438 coexpressed in E. coli); (C) an SDS-PAGE result of EBP-MFP-EBP triblock copolypeptide (41 kDa), tyrosinase (35 kDa) and ORF438 (15 kDa) coexpressed in E. coli (lane (1): EBP-MFP-EBP triblock copolypeptide, lane (2): triblock copolypeptide, tyrosinase and ORF438 coexpressed in E. coli); (D) schematic chemical mechanism of tyrosine modification of EBP-MFP block copolypeptide; (E) a result of confirming hydroxylation of EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide through a coexpression system of tyrosinase, ORF438 and diblock copolypeptide in E. coli by NBT staining; and (F) a result of confirming hydroxylation of EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F1].sub.6 triblock copolypeptide in E. coli through a coexpression system of tyrosinase, ORF438 and triblock copolypeptide by NBT staining.

[0024] FIG. 7 shows a result of investigating the tyrosine residue modification of a diblock copolypeptide of the present disclosure by treating with mushroom-derived tyrosinase and then staining with NBT/glycinate ((1) dopamine hydrochloride as a positive control group, (2) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with mushroom-derived tyrosinase, (3) unmodified EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 as a negative control group, (4) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6).

[0025] FIG. 8 shows an SDS-PAGE of a copper-stained block copolypeptide of the present disclosure ((A): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide treated with mushroom-derived tyrosinase, (B): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide treated with mushroom-derived tyrosinase, (C): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide treated with NalO.sub.4 of various concentrations; lane (M): standard protein marker, lane (1): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1, lane (2): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with 5 mM NalO.sub.4, lane (3): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with 50 mM NalO.sub.4, lane (4): hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1, lane (5): hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with 5 mM NalO.sub.4, lane (6): hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with 50 mM NalO.sub.4; The diblock and triblock copolypeptides were treated with mushroom-derived tyrosinase to modify the tyrosine residue.).

[0026] FIG. 9 shows a result of thermal profiling under different conditions ((A) (a): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide treated with mushroom-derived tyrosinase, (b): unmodified EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide (c): monoblock EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 as a control group; (B) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with mushroom-derived tyrosinase depending on the concentration of the diblock copolypeptide; (C) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 treated with mushroom-derived tyrosinase depending on the concentration of NalO.sub.4; (D) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock treated with 25 M mushroom-derived tyrosinase and EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide treated with mushroom-derived tyrosinase).

[0027] FIG. 10 shows (A) photographs of mushroom-derived tyrosinase-catalyzed EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide treated with NalO.sub.4 of different concentrations (10-100 mM); (B) photographs of 30 wt % diblock copolypeptide treated with 100 mM NalO.sub.4; and (C) photographs of 40 wt % diblock copolypeptide treated with 10 mM NalO.sub.4.

[0028] FIG. 11 shows (A) photographs of mushroom-derived tyrosinase-catalyzed EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide (10 wt %) treated with 10 mM NalO.sub.4; and (B) a photograph of mushroom-derived tyrosinase-catalyzed EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide adhered onto a surface under the condition of (A) (left) and a photograph of 20 wt % EBP triblock copolypeptide treated under the condition of (A) as a control group (right).

[0029] FIG. 12 shows (A) photographs of a hydroxylated block copolypeptide (10 wt %) treated with 10 mM NalO.sub.4 in a coexpression system; and (B) photographs of testing adhesiveness of a hydroxylated block copolypeptide in a coexpression system in the presence of water.

[0030] FIG. 13 shows (A) a result of measuring the hydrodynamic radius of mushroom-derived tyrosinase-catalyzed, hydroxylated or unmodified block copolypeptide by DLS (The hydrodynamic radius of the block copolypeptide was measured at 12.5 M in a 10 mM phosphate buffer (pH 5). The hydrodynamic radius of the block copolypeptide above the phase transition is 50-70 nm, which suggests that the block copolypeptide exists as a specific structure. (a): unmodified EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide at 10 C., (b): unmodified EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide at 45 C., (c): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide treated with mushroom-derived tyrosinase at 10 C., (d): EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide treated with mushroom-derived tyrosinase at 45 C.); and (B) a result of confirming the surface adhesiveness of a hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide in a coexpression system using a fluorescent dye ((1) nonspecific reaction between tube surface and fluorescent dye, (2) surface adhesiveness of EBP diblock copolypeptide and fluorescent dye, (3) surface adhesiveness of hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide below transition temperature, (4) surface adhesiveness of hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide above transition temperature).

[0031] FIG. 14 shows transmission electron microscopic images of mushroom-derived tyrosinase-catalyzed, hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide depending on temperature ((A, B, C) The EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide nanostructure observed at 10 C. has scales of 0.2 m, 50 nm and 50 nm, respectively. (D, E, F) The EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide structure observed at 37 C. has scales of 0.5 mm, 100 nm and 50 nm, respectively. (G, H, I) The EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide structure observed at 50 C. has scales of 0.5 m, 100 nm and 50 nm, respectively.).

BEST MODE

[0032] In the present disclosure, it was confirmed that a multiblock copolypeptide composed of an elastin-based polypeptide (EBP) and a mussel foot protein (MFP) forms self-assembled core-shell structures and hydrogels exhibiting reversible change in response to temperature stimulation and exhibiting remarkably superior surface adhesiveness.

[0033] Accordingly, in an aspect, the present disclosure relates to a multiblock copolypeptide composed of an elastin-based polypeptide (EBP) and a mussel foot protein (MFP).

[0034] In the present disclosure, the term copolypeptide refers to a polypeptide which is a copolymer.

[0035] In the present disclosure, the term polypeptide refers to any polymer chain of amino acids. The terms peptide and protein may be used interchangeably with the term polypeptide and also refer to a polymer chain of amino acids. The term polypeptide includes natural or synthetic proteins, protein fragments and polypeptide analogues of protein sequences. The polypeptide may be a monomer or a polymer.

[0036] The term phase transition refers to change in the state of matter, e.g., change from water to water vapor or from ice to water.

[0037] Basically, the polypeptide having such a phase transition behavior according to the present disclosure is a stimulus responsivity elastin-based polypeptide (EBP). The elastin-based polypeptide is also called an elastin-like polypeptide (ELP). They are the terms widely used in the related art.

[0038] The EBP undergoes reversible phase transition at a transition temperature (T.sub.t), also called a lower critical solution temperature (LOST). It is highly soluble below T.sub.t but becomes insoluble above T.sub.t.

[0039] In the present disclosure, the physical and chemical properties of EBP are regulated by a combination of the pentapeptide repeat unit Val-Pro-(Gly or Ala)-X.sub.aa-Gly[VP(G or A)XG]. Specifically, the third amino acid of the repeat unit determines relative mechanical properties. For examples, in the present disclosure, the third amino acid Gly determines elasticity and Ala determines plasticity. The elasticity or plasticity is the property occurring after the transition.

[0040] Meanwhile, both the hydrophobicity of the guest residue X.sub.aa, which is the fourth amino acid, and the multimerization of the pentapeptide repeat unit affect the T.sub.t.

[0041] The mussel foot protein of the present disclosure may be adhered to various surfaces through DOPA. The DOPA having a catechol side chain provides surface adhesivity through hydrogen bonding or coordination with surface molecules, and the quinone, which is an oxidized form of the DOPA, exhibits cohesive force through intermolecular crosslinking. Although the quinone cannot interact with surface molecules because it is an oxidized form of the DOPA, it provides powerful cohesive force in water by forming intramolecular and intermolecular crosslinkages through aryl-aryl coupling, metal chelation, and Michael-type addition reaction with amine-containing proteins. The crosslinkages formed by the quinone result in a hardened sheath and exhibit moisture resistance. Therefore, DOPA and quinone are essential factors in surface adhesion, which is determined depending on pH condition. When mussel secretes MFP for surface adhesion, the pH around the mussel foot is below 3.0, and the oxidation of DOPA is restricted for adsorption of surface oxides through hydrogen bonding and metal ion coordination. After surface adhesion, the MFP is exposed to seawater (pH 8.3). As a result, the DOPA is induced to be oxidized to quinone, and crosslinking and protein coagulation occur. In addition, the hydrophilic amino acids of MFP such as Ser and Gly participate in cohesive interactions through hydrogen bonding, cation-pi interaction or electrostatic and hydrophobic interaction (Waite, J. H., Journal of Experimental Biology, 220(4), 517-530, 2017).

[0042] In the present disclosure, a new type of multifunctional block copolypeptide composed of an EBP block and an MFP block is designed, synthesized and characterized reasonably. Based on the surface adhesiveness of naturally occurring MFP, the present disclosure aims at combining the MFP with the EBP block, which is a stimulus-responsive protein, for biomimetic adhesion in water, formation of self-assembled structures and application to biomedicine. In order to achieve strong interfacial underwater adhesiveness, the gene sequences of California mussel foot protein 5 (Mytilus californianus foot protein 5 (Mcfp5)) and Mediterranean mussel foot protein 5 (Mytilus galloprovincialis foot protein 5 (Mgfp5)), which exhibit the highest tyrosine content (30%) from among all mussel foot proteins, were selected. The tyrosine content of MFP is related with the efficiency and strength of surface adhesion (Silverman H. G. et al., Marine Biotechnology, 9(6), 661-681, 2007).

[0043] In the present disclosure, the multiblock copolypeptide may be composed of an arrangement selected from a group consisting of (EBP).sub.n(MFP).sub.n, (EBP).sub.n(MFP).sub.n(EBP).sub.n and (MFP).sub.n(EBP).sub.n(MFP).sub.n, wherein the n, which is an integer 1 or greater, is the number of EBP or MFP repeat unit.

[0044] In the present disclosure, the elastin-based polypeptide (EBP) may be composed of an amino acid sequence selected from a group consisting of a [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block, a [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block and an [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block, wherein the X is an amino acid excluding proline.

[0045] In the present disclosure, the X (or X.sub.aa) is referred to as a guest residue. EBPs of various types according to the present disclosure can be prepared by introducing different X.sub.aa's.

[0046] The polypeptide may have multi-stimuli responsivity.

[0047] The term multi-stimuli responsivity means responsivity to more than one stimulus. Specifically, the stimulus may be one or more selected from a group consisting of temperature, pH, ionic strength and a ligand.

[0048] In the present disclosure, the ligand refers to a substance binding specifically to a certain target substance, for example, an antibody, an antigen, an enzyme, a substrate, a receptor, a peptide, a DNA, an RNA, an aptamer, protein A, protein G, avidin, biotin, a chelate compound, a metal ion (e.g., calcium ion, etc.), etc.

[0049] In the present disclosure, the [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block is represented by the amino acid sequence of SEQ ID NO 1, the [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block is represented by the amino acid sequence of SEQ ID NO 2, and the [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block is represented by the amino acid sequence of SEQ ID NO 3.

[0050] In the present disclosure, the term amino acid means a natural amino acid or an artificial amino acid, specifically a natural amino acid. For example, the amino acid may be glycine, alanine, serine, valine, leucine, isoleucine, methionine, glutamine, asparagine, cysteine, histidine, phenylalanine, arginine, tyrosine, tryptophan, etc.

[0051] The properties of these amino acids are well known in the art. Specifically, they exhibit hydrophilic (negatively charged or positively charged) or hydrophobic properties, and exhibit aliphatic or aromatic properties.

[0052] The abbreviations such as Gly (G), Ala (A), etc. used in the present disclosure are abbreviations of amino acids. The abbreviations of amino acids include glycine (Gly, G), alanine (Ala, A), valine (Val, V), leucine (Leu, L), isoleucine (Ile, I), proline (Pro, P), phenylalanine (Phe, F), tyrosine (Tyr, Y), tryptophan (Trp, W), cysteine (Cys, C), methionine (Met, M), serine (Ser, S), threonine (Thr, T), lysine (Lys, K), arginine (Arg, R), histidine (His, H), aspartic acid (Asp, D), glutamic acid (Glu, E), asparagine (Asn, N) and glutamine (Gln, Q). These abbreviations are widely used in the art.

[0053] In the present disclosure, a hydrophilic amino acid refers to an amino acid exhibiting hydrophilic property and includes lysine, arginine, etc., and a hydrophobic amino acid refers to an amino acid exhibiting hydrophobic property and includes phenylalanine, leucine, etc.

[0054] In the present disclosure, the X of the [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] block may include: A (Ala), G (Gly) and I (Ile) at a ratio of 1:4:1; K (Lys), G (Gly) and I (Ile) at a ratio of 1:4:1; D (Asp), G (Gly) and I (Ile) at a ratio of 1:4:1; E (Glu), G (Gly) and I (Ile) at a ratio of 1:4:1; G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2; K (Lys), A (Ala) and F (Phe) at a ratio of 1:3:2; D (Asp), A (Ala) and F (Phe) at a ratio of 1:3:2; K (Lys) and F (Phe) at a ratio of 3:3; D (Asp) and F (Phe) at a ratio of 3:3; H (His), A (Ala) and I (Ile) at a ratio of 3:2:1; H (His) and G (Gly) at a ratio of 5:1; or G (Gly), C (Cys) and F (Phe) at a ratio of 1:3:2.

[0055] In the present disclosure, the X of the [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] block may include: A (Ala), G (Gly) and I (Ile) at a ratio of 1:4:1; K (Lys), G (Gly) and I (Ile) at a ratio of 1:4:1; D (Asp), G (Gly) and I (Ile) at a ratio of 1:4:1; E (Glu), G (Gly) and I (Ile) at a ratio of 1:4:1; or G (Gly), A (Ala) and F (Phe) at a ratio of 1:3:2.

[0056] In the present disclosure, the X of the [IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] block may include G (Gly), A (Ala) and F (Phe) at a ratio of 1:4:1 or 1:3:2.

[0057] In the present disclosure, the different EBPs having Val-Pro-(Gly or Ala)-X.sub.aa-Gly [VP(G or A)XG] as pentapeptide repeat units are named as follows. The X.sub.aa may be any amino acid excluding Pro. First, the repetition of the Val-Pro-Ala-X.sub.aa-Gly (VPAXG) pentapeptide with plasticity is defined as an elastin-based polypeptide with plasticity (EBPP). Meanwhile, the repetition of the Val-Pro-Gly-X.sub.aa-Gly (VPGXG) pentapeptide is referred to as an elastin-based polypeptide with elasticity (EBPE). And, the repetition of the Ile-Pro-Ala-X.sub.aa-Gly (IPAXG) pentapeptide is defined as elastin-based polypeptide with plasticity with the first position replaced by Ile (EBPPI). In [X.sub.iY.sub.jZ.sub.k].sub.n, the capital letters in the brackets represent the single-letter amino acid codes for the guest residues, i.e., the amino acids at the 4th position of the EBP pentapeptide (X.sub.aa or X), and their subscripts represent the ratio of the guest residues of the EBP monomer gene. The subscript n of the [X.sub.iY.sub.jZ.sub.k].sub.n represents the total number of repetitions of EBP of SEQ ID NO 1 [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG], SEQ ID NO 2 [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] or SEQ ID NO 3[IPAXG IPAXG IPAXG IPAXG IPAXG IPAXG] of the present disclosure. For example, EBPP[G.sub.1A.sub.3F.sub.2].sub.12 is an EBPP block consisting of 12 repeat units of SEQ ID NO 2 [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG], wherein the ration of Gly, Ala and Phe at the 4th guest residue position (X.sub.aa) is 1:3:2.

[0058] The gene and amino acid sequences of the EBP blocks of the present disclosure are shown in Tables 1 and 2, respectively.

TABLE-US-00001 TABLE1 GenesequencesofEBPlibrary EBPE[A.sub.1G.sub.4I.sub.1] GTCCCAGGTGGAGGTGTACCCGGCGCGGGTGTCCCAGGT (SEQIDNO4) GGAGGTGTACCTGGGGGTGGGGTCCCTGGTATTGGCGTA CCTGGAGGCGGC EBPP[A.sub.1G.sub.4I.sub.1] GTTCCAGCTGGCGGTGTACCTGCTGCTGCTGTTCCGGCC (SEQIDNO5) GGTGGTGTTCCGGCGGGCGGCGTGCCTGCAATAGGAGTT CCCGCTGGTGGC EBPE[K.sub.1G.sub.4I.sub.1] GTTCCGGGTGGTGGTGTTCCGGGTAAAGGTGTTCCGGGT (SEQIDNO6) GGTGGTGTTCCGGGTGGTGGTGGTGTTCCGGGTATCGGT GTTCCGGGTGGC EBPP[K.sub.1G.sub.4I.sub.1] GTTCCGGCGGGTGGTGTTCCGGCGAAAGGTGTTCCGGCG (SEQIDNO7) GGTGGTGTTCCGGCGGGTGGTGTTCCGGCGATCGGTGTT CCGGCGGGTGGC EBPE[D.sub.1G.sub.4I.sub.1] GTTCCGGGTGGTGGTGTTCCGGGTGATGGTGTTCCGGGT (SEQIDNO8) GGTGGTGTTCCGGGTGGTGGTGGTGTTCCGGGTATCGGT GTTCCGGGTGGC EBPP[D.sub.1G.sub.4I.sub.1] GTTCCGGCGGGTGGTGTTCCGGCGGATGGTGTTCCGGCG (SEQIDNO9) GGTGGTGTTCCGGCGGGTGGTGTTCCGGCGATCGGTGTT CCGGCGGGTGGC EBPE[E.sub.1G.sub.4I.sub.1] GTTCCGGGTGGTGGTGTTCCGGGTGAAGGTGTTCCGGGT (SEQIDNO GGTGGTGTTCCGGGTGGTGGTGGTGTTCCGGGTATCGGT 10) GTTCCGGGTGGC EBPP[E.sub.1G.sub.4I.sub.1] GTTCCGGCGGGTGGTGTTCCGGCGGAAGGTGTTCCGGCG (SEQIDNO GGTGGTGTTCCGGCGGGTGGTGTTCCGGCGATCGGTGTT 11) CCGGCGGGTGGC EBPE[G.sub.1A.sub.3F.sub.2] GTCCCGGGTGCGGGCGTGCCGGGATTTGGAGTTCCGGGT (SEQIDNO GCGGGTGTTCCAGGCGGTGGTGTTCCGGGCGCGGGCGTG 12) CCGGGCTTTGGC EBPP[G.sub.1A.sub.3F.sub.2] GTGCCGGCGGCGGGCGTTCCAGCCTTTGGTGTGCCAGCG (SEQIDNO GCGGGAGTTCCGGCCGGTGGCGTGCCGGCAGCGGGC 13) GTGCCGGCTTTTGGC EBPP[K.sub.1A.sub.3F.sub.2] GTGCCGGCGGCGGGCGTTCCAGCCTTTGGTGTGCCAGCG (SEQIDNO GCGGGAGTTCCGGCCAAAGGCGTGCCGGCAGCGGGCGTG 14) CCGGCTTTTGGC EBPP[D.sub.1A.sub.3F.sub.2] GTGCCGGCGGCGGGCGTTCCAGCCTTTGGTGTGCCAGCG (SEQIDNO GCGGGAGTTCCGGCCGATGGCGTGCCGGCAGCGGGC 15) GTGCCGGCTTTTGGC EBPP[K.sub.3F.sub.3] GTTCCAGCGTTTGGCGTGCCAGCGAAAGGTGTTCCGGCG (SEQIDNO TTTGGGGTTCCCGCGAAAGGTGTGCCGGCCTTTGGTGTG 16) CCGGCCAAAGGC EBPP[D.sub.3F.sub.3] GTTCCAGCGTTTGGCGTGCCAGCGGATGGTGTTCCGGCG (SEQIDNO TTTGGGGTTCCCGCGGATGGTGTGCCGGCCTTTGGTGTG 17) CCGGCCGATGGC EBPP[H.sub.3A.sub.3I.sub.1] GTGCCGGCGCATGGAGTTOCTGCCGCCGGTGTTOCTGCG (SEQIDNO CATGGTGTACCGGCAATTGGCGTTCCGGCACATGGTGTG 18) CCGGCCGCCGGC EBPP[H.sub.5G.sub.1] GTTCCGGCCGGAGGTGTACCGGCGCATGGTGTTCCGGCA (SEQIDNO CATGGTGTGCCGGCTCACGGTGTGOCTGCGCATGGCGTT 19) CCTGCGCATGGC EBPP[G.sub.1C.sub.3F.sub.2] GTGCCGGCGTGCGGCGTTCCAGCCTTTGGTGTGCCAGCG (SEQIDNO TGCGGAGTTCCGGCCGGTGGCGTGCCGGCATGCGGC 20) GTGCCGGCTTTTGGC EBPPI[G.sub.1A.sub.4F.sub.1] ATTOCTGCAGCCGGTATCCCGGCCGGTGGCATTCCGGCA (SEQIDNO GCCGGCATTCCGGCCGCCGGCATCCCGGCATTTGGCATT 21) CCTGCAGCAGGC EBPPI[G.sub.1A.sub.3F.sub.2] ATTCCGGCCGCAGGCATTOCTGCATTTGGTATTCCGGCG (SEQIDNO GCAGGCATTOCTGCCGGTGGCATCCCGGCAGCGGGCATT 22) CCGGCCTTTGGC

TABLE-US-00002 TABLE2 AminoacidsequencesofEBPlibrary EBPE[A.sub.1G.sub.4I.sub.1] VPGGGVPGAGVPGGGVPGGGVPGIGVPGGG (SEQIDNO23) EBPP[A.sub.1G.sub.4I.sub.1] VPAGGVPAAGVPAGGVPAGGVPAIGVPAGG (SEQIDNO24) EBPE[K.sub.1G.sub.4I.sub.1] VPGGGVPGKGVPGGGVPGGGVPGIGVPGGG (SEQIDNO25) EBPP[K.sub.1G.sub.4I.sub.1] VPAGGVPAKGVPAGGVPAGGVPAIGVPAGG (SEQIDNO26) EBPE[K.sub.1G.sub.4I.sub.1] VPGGGVPGDGVPGGGVPGGGVPGIGVPGGG (SEQIDNO27) EBPP[K.sub.1G.sub.4I.sub.1] VPAGGVPADGVPAGGVPAGGVPAIGVPAGG (SEQIDNO28) EBPE[E.sub.1G.sub.4I.sub.1] VPGGGVPGEGVPGGGVPGGGVPGIGVPGGG (SEQIDNO29) EBPP[E.sub.1G.sub.4I.sub.1] VPAGGVPAEGVPAGGVPAGGVPAIGVPAGG (SEQIDNO30) EBPE[G.sub.1A.sub.3F.sub.2] VPGAGVPGFGVPGAGVPGGGVPGAGVPGFG (SEQIDNO31) EBPP[G.sub.1A.sub.3F.sub.2] VPAAGVPAFGVPAAGVPAGGVPAAGVPAFG (SEQIDNO32) EBPP[K.sub.1A.sub.3F.sub.2] VPAAGVPAFGVPAAGVPAGGVPAAGVPAFG (SEQIDNO33) EBPP[D.sub.1A.sub.3F.sub.2] VPAAGVPAFGVPAAGVPAGGVPAAGVPAFG (SEQIDNO34) EBPP[K.sub.3F.sub.3] VPAFGVPAKGVPAFGVPAKGVPAFGVPAKG (SEQIDNO35) EBPP[D.sub.3F.sub.3] VPAFGVPADGVPAFGVPADGVPAFGVPADG (SEQIDNO36) EBPP[H.sub.3A.sub.3I.sub.1] VPAHGVPAAGVPAHGVPAIGVPAHGVPAAG (SEQIDNO37) EBPP[H.sub.5G.sub.1] VPAGGVPAHGVPAHGVPAHGVPAHGVPAHG (SEQIDNO38) EBPP[G.sub.1C.sub.3F.sub.2] VPACGVPAFGVPACGVPAGGVPACGVPAFG (SEQIDNO39) EBPPI[G.sub.1A.sub.4F.sub.1] IPAAGIPAGGIPAAGIPAAGIPAFGIPAAG (SEQIDNO40) EBPPI[G.sub.1A.sub.3F.sub.2] IPAAGIPAFGIPAAGIPAGGIPAAGIPAFG (SEQIDNO41)

[0059] In the present disclosure, the mussel foot protein (MFP) may be California mussel foot protein 5 (Mytilus califomianus foot protein 5 (Mcfp5)) or Mediterranean mussel foot protein 5 (Mytilus galloprovincialis foot protein 5 (Mgfp5)).

[0060] In MFP[Mgfp5].sub.n and MFP[Mcfp5].sub.n, the characters and numbers in the brackets represent the species of mussel and the type of foot protein, and the subscript n represents the number of repetition of the MFP blocks. For example, MFP[Mgfp5].sub.1 means Mediterranean mussel ((Mytilus galloprovincialis), MFP type 5, and one MFP block repeat unit. Finally, diblock and triblock copolypeptides composed of EBP and MFP are denoted by using a hyphen between the MFP block and the EBP block. For example, a diblock copolypeptide may be denoted as EBPPI[G1A4F1].sub.n-MFP[Mgfp5].sub.n, and a triblock copolypeptide may be denoted as EBPPI[G1A4F1].sub.n-MFP[Mgfp5].sub.n-EBPPI[G1A4F1].sub.n.

[0061] The gene and amino acid sequences of the MFP blocks of the present disclosure are shown in Tables 3 and 4, respectively.

TABLE-US-00003 TABLE3 GenesequencesofMFPlibrary MFP TCTAGTGAAGAATATAAAGGTGGTTATTAC [Mgfp5] CCCGGCAACACCTATCATTATCATAGTGGG (SEQID GGCAGTTATCACGGCAGCGGCTACCATGGC NO42) GGCTATAAAGGTAAATACTACGGTAAAGCG AAAAAATACTATTATAAATACAAAAACAGC GGCAAATATAAGTACCTGAAAAAAGCTCGT AAATACCATCGTAAAGGCTATAAAAAATAT TACGGCGGCGGCAGTTCG MFP GTGGGTAGCGGCTATGACGGCTATTCAGAT [Mcfp5] GGCTACTATCCTGGTAGTGCATATAACTAC (SEQID CCGTCAGGGTCCCATGGCTACCATGGTCAT NO43) GGCTATAAAGGCAAATACTATGGCAAAGGC AAAAAATATTACTATAAATATAAACGCACC GGCAAGTATAAATATCTGAAAAAAGCGCGC AAATATCATCGCAAGGGCTATAAAAAATAC TATGGTGGCGGCTCCAGT

TABLE-US-00004 TABLE4 AminoacidsequencesofMFPlibrary MFP SSEEYKGGYYPGNTYHYHSGGSYHGSGYHGGYKGKYYGKA [Mgfp5] KKYYYKYKNSGKYKYLKKARKYHRKGYKKYYGGGSS (SEQID NO44) MFP VGSGYDGYSDGYYPGSAYNYPSGSHGYHGHHYKGKYYGKG [Mcfp5] KKYYYKYKRTGKYKYLKKARKYHRKGYKKYYGGGSS (SEQID NO45)

[0062] In In the present disclosure, the multiblock copolypeptide may be represented by an amino acid sequence of SEQ ID NOS 50-70 and may be represented by a base sequence of SEQ ID NOS 71-91.

[0063] In another aspect, the present disclosure relates to a gene encoding the multiblock copolypeptide.

[0064] In another aspect, the present disclosure relates to a recombinant vector including the gene.

[0065] In another aspect, the present disclosure relates to a recombinant microorganism with the gene or the recombinant vector introduced.

[0066] In the present disclosure, a gene encoding tyrosinase or an expression vector including a gene encoding tyrosinase may be further introduced in the recombinant microorganism for coexpression.

[0067] In the present disclosure, the mussel foot protein (MFP) may form DOPA having a hydroxylated catechol side chain at the tyrosine residue by tyrosinase, and the DOPA may bind to a metal ion, an oxide and a semimetal through coordination or hydrogen bonding.

[0068] In the present disclosure, the DOPA is stained specifically by NBT and glycinate through an oxidation-reduction reaction.

[0069] In the present disclosure, the expression vector may further include the ORF438 gene.

[0070] In another aspect, the present disclosure relates to a method for preparing a multiblock copolypeptide, including: (a) a step of producing a multiblock copolypeptide by culturing the recombinant microorganism; and (b) a step of obtaining the produced multiblock copolypeptide.

[0071] In the present disclosure, a gene encoding tyrosinase or an expression vector including a gene encoding tyrosinase may be further introduced in the recombinant microorganism of the step (a) for coexpression of the multiblock copolypeptide and tyrosinase.

[0072] In the present disclosure, a tyrosine residue of the multiblock copolypeptide may be modified to a DOPA (3,4-dihydroxyphenylalanine) residue by the tyrosinase.

[0073] The method for preparing a multiblock copolypeptide of the present disclosure is economical because the expensive tyrosinase can be expressed in large quantities in bacteria.

[0074] In the present disclosure, the vector refers to a DNA construct including the base sequence of a polynucleotide encoding a target protein, which is operably linked to an appropriate control sequence to express the target protein in a suitable host cell. The control sequence may include a promoter that can initiate transcription, an optional operator sequence for regulating the transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation, and may be prepared variously depending on purposes. The promoter of the vector may be constitutive or inducible. After the vector is transformed into a suitable host cell, it can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0075] The vector used in the present disclosure is not particularly limited as long as it is able to replicate in a host cell, and any vector known in the art can be used. Examples of commonly used vectors may include a natural or recombinant plasmid, phagemid, cosmid, virus and bacteriophage. For instance, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A and Charon21A may be used as a phage vector or a cosmid vector. As a plasmid vector, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL and pET may be used. The vector that can be used in the present disclosure is not particularly limited, and any known expression vector may be used.

[0076] The expression expression control sequence refers to a DNA sequence that is essential for expression of a coding sequence operably linked to other DNA sequences in a specific host cell. This control sequence includes a promoter for initiating transcription, an optional operator sequence for controlling the transcription, a sequence for encoding a suitable mRNA ribosome binding site, and a sequence for controlling termination of transcription and translation. For example, a control sequence specific to a prokaryote includes a promoter, an optional operator sequence and a ribosome binding site. For a eukaryote, a control sequence includes a promoter, a polyadenylation signal, and an enhancer. In a plasmid, a promoter is the factor with the greatest effect on amount of gene expression. For high level of expression, an SRa promoter, a cytomegalovirus-derived promoter, etc. may be used.

[0077] To express the DNA sequence of the present disclosure, any one of various expression control sequences may be applied to a vector. For example, useful expression control sequences include early and late promoters of SV40 or adenovirus, a lac system, a trp system, a TAC or TRC system, T3 and T7 promoters, a major operator and promoter region of phage , a control region of fd code protein, a promoter for 3-phophoglycerate kinase or other glycolytic enzymes, promotors for the phosphatases, e.g., Pho5, a promoter for a yeast alpha-mating system, other sequences of constructs known for controlling the expression of genes of prokaryotes, eukaryotes or viruses and combinations thereof. The T7 RNA polymerase promoter 10 can be usefully used to express protein NSPs in E. coli.

[0078] A nucleic acid is operably linked when it is arranged with another nucleic acid sequence in a functional relationship. The nucleic acid may be a gene and a control sequence(s) linked to be capable of expressing the gene when it binds to a control sequence(s) (e.g., transcription-activating protein). For example, a DNA for a pre-sequence or a secretory leader is operably linked to a DNA for a polypeptide when it is expressed as a pre-protein participating in secretion of the polypeptide; a promoter or an enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; and a ribosome binding site is operably linked to a coding sequence when it affects the transcription of the sequence, or is operably linked to a coding sequence when it is arranged to facilitate translation. Generally, the term operably linked means that the linked DNA sequences are contiguous, and in the case of the secretory leader, are contiguous and present in a reading frame. However, an enhancer is not necessarily contiguous. The linkage between these sequences is performed by ligation at a convenient restriction enzyme site. However, when the site does not exist, a synthetic oligonucleotide adaptor or a linker is used according to the conventional method.

[0079] The term expression vector used herein generally means a double-stranded DNA fragment functioning as a recombinant carrier into which a heterologous DNA fragment is inserted. Here, the heterologous DNA means a hetero-type DNA, which is not naturally found in a host cell. The expression vector may be self-replicable regardless of the host chromosomal DNA once it is present in the host cell, and may produce several copies of the vector and (heterologous) DNA inserted thereinto.

[0080] As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the corresponding gene should be operably linked to transcription and translation expression control sequences which are operated in a selected expression host. Specifically, the expression control sequences and the corresponding gene are included in one expression vector together with a bacterial selection marker and a replication origin. When the expression host is a eukaryotic cell, the expression vector should further include an expression marker which is useful in the eukaryotic expression host.

[0081] A variety of combinations of expression host/vector may be used to express a gene encoding the polypeptide of the present disclosure. Examples of expression vectors suitable for eukaryotic hosts include expression control sequences derived from SV40, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus and retrovirus. Expression vectors that may be used for bacterial hosts include bacterial plasmids that can be obtained from E. coli, e.g., pBluescript, pGEX2T, pUCvector, colE1, pCR1, pBR322, pMB9 and derivatives thereof, plasmids having broader host ranges such as RP4, phage DNAs, e.g., various phage lambda derivatives such as gt10, gt11 and NM989, and other DNA phages such as M13 and filamentous single-stranded DNA phages. Expression vectors suitable for yeast cells are 2 plasmid and derivatives thereof. A vector suitable for insect cells is pVL 941.

[0082] In another aspect, the present disclosure relates to a host cell transformed or transfected with the expression vector described above. The term transformation, as used herein, means that DNA can be replicated as a factor outside of chromosome or by means of completion of the entire chromosome by introducing the DNA as a host. As used herein, the term transfection means that an expression vector is accepted by a host cell regardless of whether or not any coding sequence is actually expressed.

[0083] The host cell of the present disclosure refers to a recombinant microorganism into which a vector having a polynucleotide encoding one or more target protein is introduced, or a recombinant microorganism transfected to express the target protein as a polynucleotide encoding one or more target protein is incorporated into the chromosome. The host cell may be a prokaryotic or eukaryotic cell. In general, a host cell exhibiting high DNA introduction efficiency and high expression efficiency of the introduced DNA is used. Examples of the host cell that can be used include known eukaryotic and prokaryotic host cells such as E. coli, Pseudomonas, Bacillus, Streptomyces, fungi and yeast, insect cells such as Spodoptera frugiperda (SF9), animal cells such as CHO and mouse cells, African green monkey cells such as COS 1, COS 7, BSC 1, BSC 40 and BMT 10, and tissue-cultured human cells. When COS cells are used, since SV40 large T antigen is expressed in the COS cells, the plasmid having the origin of replication of SV40 is present as a large number of copies of the episome in the cells and higher expression can be expected. The introduced DNA sequence may be obtained from the same species as the host cell, may be of a species different from the host cell, or may be a hybrid DNA sequence including any heterologous or homologous DNA.

[0084] Of course, it should be understood that not all vectors and expression control sequences function equally in expressing the DNA sequences of the present disclosure. Likewise not all hosts function equally for the same expression system. However, those skilled in the art can make appropriate choices from among various vectors, expression control sequences and hosts without departing from the scope of the present disclosure without undue experimental burden. For example, in selecting a vector, the host must be considered, since the vector must be replicated in it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered. In selecting expression control sequences, several factors must be considered. For example, the relative strength of the sequence, controllability and compatibility with the DNA sequences of the present disclosure should be considered, particularly with regard to possible secondary structures. Single cell hosts must be selected in consideration of the selected vector, the toxicity of the product encoded by the DNA sequence of the present disclosure, the secretory properties, the ability to accurately fold the protein, the culture and fermentation requirements, the easiness of purification of the product encoded by the DNA sequence of the present disclosure from the host, etc. Within the scope of these variables, one skilled in the art can select various vector/expression control sequence/host combinations that can express the DNA sequences of the present disclosure in fermentation or large-scale animal culture. As a screening method when cloning the cDNA of the NSP protein by expression cloning, a binding method, a panning method, a film emulsion method, etc. can be applied.

[0085] In the present disclosure, as a method for inserting the gene into the chromosome of a host cell, a commonly known gene manipulication method may be used. Methods of non-viral delivery include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNAs, artificial virions, and agent-enhanced DNA uptake. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Additional exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.) and BTX Molecular Delivery Systems (Holliston, Mass.). The lipofection method is described in, e.g., U.S. Pat. Nos. 5,049,386, 4,946,787 and 4,897,355, and lipofection reagents are sold commercially (e.g., Transfectam and Lipofectin). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner (WO 91/17424 and WO 91/16024). Delivery can be made into cells (through ex-vivo introduction) or target tissues (through in-vivo introduction). The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028 and 4,946,787).

[0086] The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, thereby expanding the potential population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. The selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV) and combinations thereof (Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700).

[0087] In case of temporarily expressing a sucrose phosphorylase protein, an adenoviral-based system is frequently used. Adenoviral-based vectors provide very high transduction efficiency in many cell types and do not require cell division. When these vectors are used, high titer and high levels of expression may be obtained and a large-scale production is possible with a relatively simple system. In addition, adeno-associated viral (AAV) vectors are also used to transduce cells with target nucleic acids, for example, for in-vitro production of nucleic acids and peptides, and for in-vivo and ex-vivo gene therapy (West et al., Virology., 160:38-47, 1987; U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy., 5:793-801, 1994; Muzyczka, J. Clin. Invest., 94:1351, 1994), and the construction of recombinant AAV vectors is already known (U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol., 5:3251-3260, 1985; Tratschin, et al., Mol. Cell. Biol., 4:20722081, 1984; Hermonat & Muzyczka, PNAS., 81:6466-6470, 1984; Samulski et al., J Virol., 63:3822-3828, 1989). In clinical trials, genes are transferred using at least six viral vector, which involves complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent. pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al., Blood., 85:3048, 1995; Kohn et al., Nat. Med., 1:1017, 1995; Malech et al., PNAS., 94:12133, 1997), PA317/pLASN is the first therapeutic vector used in a gene therapy trial (Blaese et al., Science., 270:475-480, 1995), and transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors (Ellem et al., Immunol Immunother., 44(1):10-20, 1997; Dranoff et al., Hum. Gene Ther., 1:111-2, 1997).

[0088] Recombinant adeno-associated virus vectors (rAAV) are a promising alternative gene delivery system based on the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from a plasmid that retains the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system (Wagner et al., Lancet., 351:9117, 1998; Kearns et al., Gene Ther., 9:748-55, 1996).

[0089] In the present disclosure, coexpression refers to expression of two or more genes at the same time.

[0090] In an exemplary embodiment of the present disclosure, the tyrosine residue of the MFP block is hydroxylated by two methods ((1) bacterial coexpression system (coexpression of ORF438, tyrosinase and block copolypeptide in E. coli) and (2) catalytic reaction by mushroom-derived tyrosinase). The diblock and triblock copeptides composed of EBP (block A) and MFP (block B) designed into AB-, ABA-and BAB-types form self-assembled micelle structures and injectable hydrogels and can be used as biocoating and bioadhesive materials having surface adhesivity. First, a purified EBP-MFP block copolypeptide is changed to DOPA as the tyrosine residue was modified by mushroom-derived tyrosinase. In order to investigate surface adhesiveness, each block copolypeptide was dissolved in 10 mM phosphate buffer (pH 5) (for preventing autoxidation of DOPA) and incubated with NalO.sub.4 (for intermolecular crosslinking). As a result, different surface adhesivity was observed for the oxidizing agent at concentrations of 10-100 mM depending on the type of the block copolypeptide. Through this, it can be seen that DOPA and quinone are essential components in achieving bulk adhesivity. In the MFP, DOPA plays an important role in surface adhesion. Quinone, which is an oxidized form of DOPA, provides cohesive force through intermolecular crosslinking. In addition, the EBP block exhibiting phase transition at LOST or above provides improved cohesive force for physically crosslinked hydrogelation and surface adhesion. Second, the EBP-MFP block copolypeptide, ORF438 and tyrosinase were coexpressed in E. coli to hydroxdylate the tyrosine residue of the block copolypeptide without further treatment. As a result, it was confirmed that the EBP-MFP block copolypeptide has superior adhesivity as compared to the EBP-MFP block copolypeptide modified by mushroom-derived tyrosinase and is useful for industrial scales (FIG. 12). In addition, the strength of surface adhesion of the block copolypeptide coexpressed in the form of micelles and hydrogels was investigated. As a result, it was confirmed that the EBP-MFP block copolypeptide of the present disclosure has a great potential as micelles and hydrogels having surface adhesiveness (FIG. 10, FIG. 11, FIG. 13 and FIG. 14).

[0091] In another aspect, the present disclosure relates to a self-assembled nanostructure of a core-shell structure, wherein an EBP block of the multiblock copolypeptide forms a core structure and an MFP block forms a shell structure in response to temperature stimulation. In the present disclosure, the core-shell structure means a micelle structure.

[0092] In general, the micelle refers to a thermodynamically stable and uniform spherical structure composed of low-molecular-weight materials having amphiphilic, e.g., hydrophilic ad hydrophobic, groups at the same time. When a nonaqueous drug is administered by dissolving in a compound having a micelle structure, the drug is present inside the micelle. Since the micelle enables target-oriented drug release in response to the change in temperature or pH in vivo, it has a high potential for use as a carrier for drug delivery.

[0093] In the present disclosure, a self-assembled nanostructure is formed as MFP and EBPPI with different block lengths are fused in response to thermal stimulus. The EBPPI-MFP diblock copolypeptide molecule may be self-assembled into a core-shell nanostructure in response to temperature (FIG. 1(A)). MFP is fused to the N-terminal or C-terminal of EBPPI[G1A4F1]6 and exhibits surface adhesiveness in the presence of water. The surface-adhesive micelle may be applied to a stent as a surface-coated nanostructure, and may serve as a passage and drug delivery carrier by being inserted into the lumen of a blood vessel.

[0094] In another aspect, the present disclosure relates to a drug delivery composition containing the self-assembled nanostructure.

[0095] The self-assembled nanostructure according to the present disclosure may be used as a matrix of artificial cells, as a scaffold for drug delivery. The drug is not particularly limited and includes a chemical substance, a small molecule, a peptide or protein drug, a nucleic acid, a virus, an antibacterial agent, an anticancer agent, an antiinflammatory agent, etc.

[0096] The small molecule may be, for example, a contrast agent (e.g., T1 contrast agents, T2 contrast agents such as supraparamagnetic materials, radioisotopes, etc.), a fluorescence marker, a dye, etc., although not being limited thereto.

[0097] The peptide or protein drug includes a hormone, hormone analogue, an enzyme, an enzyme inhibitor, a signal transducing protein or a fragment thereof, an antibody or a fragment thereof, a single-chain antibody, a binding protein or a binding domain thereof, an antigen, an adherence protein, a structural protein, a regulatory protein, a toxin protein, a cytokine, a transcriptional regulatory factor, a blood coagulation factor, a vaccine, etc., although not being limited thereto. More specifically, it includes fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF), transforming growth factor (TGF), bone morphogenetic protein (BMP), human growth hormone (hGH), porcine growth hormone (pGH), granulocyte colony-stimulating factor (G-CSF), erythropoietin (EPO), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), epithelial growth factor (EGF), platelet-derived growth factor (PDGF), interferons, interleukins, calcitonin, nerve growth factor (NGF), growth hormone-releasing hormone, angiotensin, luteinizing hormone-releasing hormone (LHRH), luteinizing hormone-releasing hormone agonist (LHRH agonist), insulin, thyrotropin-releasing hormone (TRH), angiostatin, endostatin, somatostatin, glucagon, endorphine, bacitracin, mergain, colistin, monoclonal antibodies, vaccines or mixtures thereof, although not being limited thereto.

[0098] The nucleic acid may be RNA, DNA or cDNA, and the sequence of the nucleic acid may be a coding region sequence or a non-coding region sequence (e.g., antisense oligonucleotide or siRNA).

[0099] The virus may be an entire virus or a viral core including the nucleic acid of the virus (i.e., nucleic acid of virus packaged without viral envelope). Examples of the virus and viral core that can be delivered include papillomavirus, adenovirus, baculovirus, retroviral core, semilkiviral core, etc., although not being limited thereto.

[0100] The antibacterial agent may be minocycline, tetracycline, ofloxacin, fosfomycin, mergain, profloxacin, ampicillin, penicillin, doxycycline, thienamycin, cephalosporin, nocardicin, gentamicin, neomycin, kanamycin, paromomycin, micronomicin, amikacin, tobramycin, dibekacin, cefotaxime, cefaclor, erythromycine, ciprofloxacin, levofloxacin, enoxacin, vancomycin, imipenem, fusidic acid and mixtures thereof, although not being limited thereto.

[0101] The anticancer agent may be paclitaxel, taxotere, adriamycin, endostatin, angiostatin, mitomycin, bleomycin, cisplatin, carboplatin, doxorubicin, daunorubicin, idarubicin, 5-fluorouracil, methotrexate, actinomycin-D and mixtures thereof, although not being limited thereto.

[0102] The antiinflammatory agents may be acetaminophen, aspirin, ibuprofen, diclofenac, indometacin, piroxicam, fenoprofen, flubiprofen, ketoprofen, naproxen, suprofen, loxoprofen, cinnoxicam, tenoxicam and mixtures thereof, although not being limited thereto.

[0103] In another aspect, the present disclosure relates to a hydrogel prepared as the multiblock copolypeptide forms crosslinkages between the block polypeptides in response to temperature stimulation.

[0104] The hydrogel of the present disclosure has mechanical flexibility similar to that of actual tissue and contains a lot of water, but the bonds of the gel is not broken by the water. Therefore, it is widely applied to medical adhesives, etc., which require adhesion on the water-containing surface and resistance to water. Accordingly, the hydrogel having superior tissue adhesiveness according to the present disclosure is applicable to various biomedical applications for tissue adhesives, hemostatics, scaffolds for tissue engineering, drug delivery carriers, tissue fillers, wound healing, prevention of intestinal adhesion, etc.

[0105] In the present disclosure, two triblock copolypeptides having various block sequences and lengths were prepared. MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 and EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptides were prepared as injectable hydrogels having surface adhesiveness (FIG. 1(B) and FIG. 1(C)).

[0106] In the present disclosure, the EBP block is used as a physical crosslinking agent having stimulus responsivity, whereas the MFP block is used for surface adhesiveness and introduction of chemical crosslinking through formation of quinone. The MFP-EBP-MFP and EBP-MFP-EBP triblock copolypeptides can be self-assembled to hydrogels through oxidation in response to change in temperature or treatment with NalO.sub.4. The mechanisms of surface adhesion, intermolecular crosslinking and stimulus responsivity of the triblock copolypeptides are shown in FIG. 1(D).

[0107] In the present disclosure, the hydrogel may be formed through oxidation or noncovalent interaction of a DOPA (3,4-dihydroxyphenylalanine) residue included in the mussel foot protein (MFP).

[0108] In another aspect, the present disclosure relates to a bioadhesive composition containing the hydrogel.

[0109] The bioadhesive composition of the present disclosure can be used in various fields including skin, blood vessels, digestive organs, cranial nerve, plastic surgery, orthopedic surgery, etc. by replacing cyanoacrylate-based adhesives, fibrin glues, etc. For example, the biocompatible tissue adhesive of the present disclosure can replace surgical suture and can be used for obstruction of unnecessary blood vessels, stanching and suture of soft tissue such as facial tissue, cartilage, etc. and hard tissue such as bone, tooth, etc. and household medicine. Various applications of the biocompatible bioadhesive composition of the present disclosure can be summarized as follows.

[0110] In an exemplary embodiment, the bioadhesive of the present disclosure can be applied to the inner and outer surfaces of the human body. That is to say, the bioadhesive of the present disclosure can be applied topically onto the outer surface of the human body such as skin or onto the surface of internal organs exposed during surgery. In addition, the bioadhesive of the present disclosure may be used to bond damaged tissue, prevent leakage of air/fluid from tissue, adhere a medical device to tissue or fill the defective part of tissue. In the present disclosure, the term biological tissue is not particularly limited and includes, for example, skin, bone, nerve, axon, cartilage, blood vessel, cornea, muscle, fascia, brain, prostate gland, breast, endometrium, lung, spleen, small intestine, liver, testicle, ovary, cervix, rectum, stomach, lymph node, bone marrow, kidney, etc.

[0111] In another exemplary embodiment, the bioadhesive of the present disclosure may be used for wound healing. For example, the biocompatible bioadhesive of the present disclosure may be used for wound dressing.

[0112] In another exemplary embodiment, the bioadhesive of the present disclosure may be used for skin suture. That is to say, the bioadhesive of the present disclosure may be used topically to suture a wound, replacing a stitching fiber. In addition, the bioadhesive of the present disclosure may also be used for hernia repair. For example, it may be used for surface coating of a mesh used for hernia repair.

[0113] In another exemplary embodiment, the bioadhesive of the present disclosure may also be used for suturing and prevention of leakage of a tubular structure such as blood vessel. In addition, the bioadhesive of the present disclosure may also be used for hemostasis.

[0114] In another exemplary embodiment, the bioadhesive of the present disclosure may be used as an anti-adhesive agent after surgery. Adhesion refers to the phenomenon of tissues nearby surgical site adhering to the wound following surgery. Adhesion occurs in about 97% of cases after surgery, and may cause severe problems in 5-7%. Often, the surgical site is minimized or an antiinflammatory agent is used to prevent the adhesion. Further, to prevent fibrosis, TPA (tissue plasminogen activator) may be activated or a physical barrier such as a crystalline solution, a polymer solution, a solid membrane, etc. may be used. But, these methods may cause toxicity and other adverse effects in vivo. The bioadhesive of the present disclosure may be applied to a tissue exposed after surgery to prevent adhesion between the tissue and surrounding tissues.

[0115] In another aspect, the present disclosure relates to a surgical suture including the hydrogel.

[0116] In another aspect, the present disclosure may relate to a scaffold for tissue engineering, which includes the hydrogel of the present disclosure.

[0117] Tissue engineering refers to a process of culturing cells separated from the tissue of a patient on a scaffold to prepare a cell-scaffold complex, and then transplanting the prepared cell-scaffold complex into the body. Tissue engineering is applied to regeneration of almost all organs such as artificial skin, artificial bone, artificial cartilage, artificial cornea, artificial blood vessel, artificial muscle, etc. The bioadhesive hydrogel of the present disclosure may provide a scaffold similar to a biological tissue, in order to optimize regeneration of the biological tissues and organs in tissue engineering. Further, the scaffold of the present disclosure may be used to easily implement an artificial extracellular matrix, and may be utilized as a medical material such as cosmetics, wound dressing, dental matrix, etc.

[0118] To the hydrogel of the present disclosure, a variety of physiologically active substances involved in promoting cell growth and differentiation and helping regeneration and recovery of tissues via interaction with cells or tissues of a living body may be easily adhered. The physiologically active substances generally refer to biomolecules which may be included in order to implement an artificial extracellular matrix having a similar structure to that of a natural extracellular matrix. The physiologically active substances may include cells, proteins, nucleic acids, sugars, enzymes, etc., and for example, cells, proteins, polypeptides, polysaccharides, monosaccharides, oligosaccharides, fatty acids, nucleic acids, etc., specifically, cells. The cells may be all cells including prokaryotic cells and eukaryotic cells, and may be exemplified by immunocytes and embryonic cells, including osteoblasts, fibroblasts, hepatocytes, neurons, cancer cells, B cells, white blood cells, etc. In addition, the physiologically active substances may include a plasmid nucleic acid as a nucleic acid material, hyaluronic acid, heparin sulfate, chondroitin sulfate, or alginate as a sugar material, or a hormone protein as a protein material, although not being limited thereto.

[0119] Hereinafter, the present disclosure will be described in detail through examples. However, the following examples are for illustrative purposes only and it will be apparent to those of ordinary skill in the art that the scope of the present disclosure is not limited by the examples.

EXAMPLE 1

Preparation of Experimental Materials

[0120] A pET-21a vector and BL21 (DE3) E. coli were purchased from Novagen Inc. (Madison, Wis., U.S.). Top10 competent cells were purchased from Invitrogen (Carlsbad, Calif., U.S.). Oligonucleotides were synthesized chemically by Cosmo Gene Tech (Seoul, South Korea). The thermosensitive alkaline phsphatase Fast AP and restriction endonucleases including BamHI and XbaI were purchased from Fermentas (Ontario, Canada). Other restriction endonucleases including BseRI, Acul, etc. were acquired from New England Biolabs (Ipswich, Mass., U.S.). T4 DNA ligase was obtained from Elpis Biotech (Taejeon, South Korea). All kits for DNA minipreparation, gel extraction and PCR purification were obtained from Geneall Biotechnology (Seoul, South Korea). Dyne Agarose High was obtained from Dyne Bio (Seongnam, South Korea). All the Top10 cells were grown in TB DRY medium (MO BIO Laboratories, Carlsbad, Calif., U.S.) and SOC (super optimal broth with catabolite repression) medium (Formedium, UK) supplemented with 20 mM glucose. All the BL21 (DE3) cells were grown in the Circlegrow medium obtained from MP Biomedicals (Solon, Ohio, U.S.). The precast gel, Ready Gel (Tris-HCl, 2-20%), was obtained from Bio-Rad (Hercules, Calif., U.S.). Phosphate-buffered saline (PBS, pH 7.4), ampicillin and polyethyleneimine (PEI) were purchased from Sigma-Aldrich (St Louis, Mo.).

EXAMPLE 2

Synthesis of MFP Gene

[0121] MFP gene was acquired from M. galloprovincialis- and M. californianus-derived foot protein 5. A pUC plasmid including the MFP gene sequence was treated at 37 C. with a buffer containing 10 U of XbaI and 15 U of Acu1 for 30-60 minutes and then an mpET-21a plasmid vector was treated with 10 U of XbaI and 15 U of BseRI. Subsequently, ligation was conducted by incubating 90 pmol of MFP dsDNA and 30 pmol of a linearized mpET-21a cloning vector in a T4 DNA ligase buffer containing 1 U of T4 DNA ligase at 16 C. for 30 minutes. The ligated plasmid was transformed into Top 10 chemocompetent cells and then coated on an SOC plate supplemented with 50 g/mL ampicillin. Then, the inserted sequence was identified by DNA sequencing (Table 3).

[0122] In order to achieve strong adhesivity by increasing the number of DOPA molecules, the MFP gene sequence was multimerized up to 4 repeat units. The sequence and size of the multimerized gene encoding the MFP gene were identified by DNA sequencing and DNA agarose gel electrophoresis.

[0123] As a result, the length of MFP varied from 231 bp to 924 bp as shown in FIG. 2, because the MFP was repeated 1, 2 and 4 times.

EXAMPLE 3

Establishment of Block Copolypeptide Gene Composed of EBP and MFP

[0124] A block copolypeptide library composed of EBP and MFP was synthesized using plasmids having EBP or MFP monoblock genes. The plasmids including EBP, represented by the gene and amino acid sequences shown in Table 1 and Table 2, were treated at 37 C. for 30-60 minutes with a buffer containing 10 U of XbaI and 15 U of BseRI and then purified with a PCR purification kit. The plasmids having the MFP block gene were treated at 37 C. for 30-60 minutes with a buffer containing 10 U of XbaI and 15 U of Acul. The MFP genes represented by the amino acid sequences shown in Table 3 were separated by agarose gel electrophoresis and then purified with a gel purification kit. A plasmid having an EBP block was used as a vector and the MFP gene was fused as an insert. Ligation was conducted by incubating 90 pmol of the purified insert and 30 pmol of the linearized vector in a ligase buffer containing 1 U of T4 DNA ligase at 16 C. for 30-60 minutes. Subsequently, the product was transformed into Top10 competent cells and then streaked on an SOC plate supplemented with 50 g/mL ampicillin. In order to synthesize diblock and triblock copolypeptides of EBP and MFP, the EBPPI-MFP diblock gene was synthesized by inserting the MFP gene to the 5- or 3-end of the EBPPI gene. The MFP-EBPPI-MFP or EBPPI-MFP-EBPPI triblock gene was synthesized by inserting the MFP or EBPPI gene to the 5- or 3-end of the EBPPI-MFP diblock gene. Other diblock and triblock copolypeptide genes were synthesized by varying the sequence and length of EBP and MFP blocks.

[0125] The triblock copolypeptide was synthesized by RDL (recursive directional ligation) using the diblock copolypeptide as a building block (FIG. 3(B)). The EBPPI[G1A4F1]6-MFP[Mgfp5]1-EBPPI[G1A4F1]6 triblock copolypeptide gene was synthesized by fusing the EBPPI[G1A4F1]6 gene to the N-terminal of the MFP[Mgfp5]1-EBPPI[G1A4F1]6 diblock copolypeptide gene seamlessly by RDL.

[0126] The length and molecular weight of the diblock copolypeptide are given in Table 5.

TABLE-US-00005 TABLE5 Nucleotide chain M.W Diblockcopolypeptides length(bp) (kDa) MFP[Mgfp5].sub.1-EBPP[G.sub.1A.sub.3F.sub.2].sub.24 2400 69.55 (SEQIDNO50) MFP[Mgfp5].sub.2-EBPP[G.sub.1A.sub.3F.sub.2].sub.24 2631 78.47 (SEQIDNO51) MFP[Mgfp5].sub.4-EBPP[G.sub.1A.sub.3F.sub.2].sub.24 3093 96.31 (SEQIDNO52) MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.3F.sub.2].sub.24 780 25.23 (SEQIDNO53) MFP[Mgfp5].sub.2-EBPPI[G.sub.1A.sub.3F.sub.2].sub.24 1011 34.15 (SEQIDNO54) MFP[Mgfp5].sub.4-EBPPI[G.sub.1A.sub.3F.sub.1].sub.6 1470 51.98 (SEQIDNO55) MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 780 24.40 (SEQIDNO56) MFP[Mgfp5].sub.2-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 1011 33.20 (SEQIDNO57) MFP[Mgfp5].sub.4-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 1470 50.15 (SEQIDNO58)

[0127] The length and molecular weight of the triblock copolypeptide are given in Table 6.

TABLE-US-00006 TABLE6 Chain length M.W Triblockcopolypeptides (bp) (kDa) EBPPI[G.sub.1A.sub.3F.sub.2].sub.6-MFP[Mgfp.sub.5].sub.1-EBPPI[G.sub.1A.sub.3F.sub.2].sub.6 1320 41.13 (SEQIDNO59) EBPPI[G.sub.1A.sub.3F.sub.2].sub.6-MFP[Mgfp.sub.5].sub.2-EBPPI[G.sub.1A.sub.3F.sub.2].sub.6 1551 50.05 (SEQIDNO60) EBPPI[G.sub.1A.sub.3F.sub.2].sub.6-MFP[Mgfp.sub.5].sub.4-EBPPI[G.sub.1A.sub.3F.sub.2].sub.6 2010 67.88 (SEQIDNO61) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp.sub.5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 1320 40.10 (SEQIDNO62) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp.sub.5].sub.2-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 1551 49.50 (SEQIDNO63) EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp.sub.5].sub.4-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 2010 67.10 (SEQIDNO64) MFP[Mgfp.sub.5].sub.1-EBPPI[G.sub.1A.sub.3F.sub.2].sub.6-MFP[Mgfp.sub.5].sub.1 1050 34.16 (SEQIDNO65) MFP[Mgfp.sub.5].sub.2-EBPPI[G.sub.1A.sub.3F.sub.2].sub.6-MFP[Mgfp.sub.5].sub.2 1500 52.40 (SEQIDNO66) MFP[Mgfp.sub.5].sub.4-EBPPI[G.sub.1A.sub.3F.sub.2].sub.6-MFP[Mgfp.sub.5].sub.4 2436 94.77 (SEQIDNO67) MFP[Mgfp.sub.5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp.sub.5].sub.1 1050 33.40 (SEQIDNO68) MFP[Mgfp.sub.5].sub.2-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp.sub.5].sub.2 1500 52.35 (SEQIDNO69) MFP[Mgfp.sub.5].sub.4-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp.sub.5].sub.4 2436 88.03 (SEQIDNO70)

EXAMPLE 4

PCR of Tyrosinase and ORF438 and Vector Construction for Bacterial Coexpression

[0128] E. coli cells were grown in TB dry medium containing 50 g/mL ampicillin. pIJ702, a plasmid including tyrosinase and S. lividans including ORF438 were acquired from American Type Culture Collection (ATCC, 35387). The single colony of S. lividans was grown in R2 YE medium at 30 C. A plasmid including both tyrosinase and ORF438 was purified from S. lividans. The tyrosinase gene was purified by polymerase chain reaction (PCR) using pSA-tyr-5p and pSA-tyr-3 primers (pSA-tyr-5p (SEQ ID NO 46): 5-g gaG GAT CCg acc gtc cgc aag aac cag-3; pSA-tyr-3 (SEQ ID NO 47): 5-gga AAG CTT gac gtc gaa ggt gta gtg ccg-3). The amplified PCR product was treated with BamI and HindIII. Similarly, the ORF438 gene was amplified by PCR using pSA-438-5 and pSA-438-3 primers and the amplified product was treated with EcoRV and KpnI (pSA-438-5 (SEQ ID NO 48): 5-c acG ATA TCg ccg gaa ctc acc cgt cgt-3, pSA-438-3 (SEQ ID NO 49): 5-caa GTT ACC gtt gga ggg gaa ggg gag gag-3). The expression vector, pACYCDuet-1 plasmid (Merck, Darmstadt, Germany), was treated with the same restriction enzymes as for the PCR product and the cleaved product was introduced. Finally, the DNA sequence was identified by DNA sequencing.

EXAMPLE 5

Coexpression of Block Copolypeptide, ORF438 and Tyrosinase and Purification of Block Copolypeptide

[0129] E. coli BL21 (DE3) cells including a plasmid having pET21a with the block copolypeptide and pACYC of ORF438 and tyrosinase were grown in Circlegrow medium. The cells were inoculated to 50 mL of TB medium supplemented with 50 g/mL ampicillin (Duchefa) and 50 g/mL chloramphenicol (Duchefa) per mL of the colony. Pre-culturing was conducted at 37 C. and 200 rpm overnight under shaking. After inoculating 500 mL of high nutrition medium (Circlegrow) containing 50 g/mL ampicillin and chloramphenicol to the pre-cultured medium, incubation was conducted at 37 C. and 200 rpm until OD600 of 0.6-0.8 was reached. In order to induce protein expression, incubation was conducted further at 37 C. and 200 rpm overnight after adding isopropyl--D-thiogalactopyranoside (IPTG) with a final concentration of 1 mM. Then, the cells were obtained by conducting centrifugation at 4 C. and 4,500 rpm for 10 minutes. The expressed EBPPI-MFP block copolypeptide was purified by ITC (inverse transition cycling). The cell pellet was resuspended in 5% acetic acid containing 8 M urea. Subsequently, the cells were lysed by sonicating (VC-505, Sonic and Materials Inc., Danbury, Conn.) in an ice bath for 10 seconds and cooling for 30 seconds. The cell lysate was centrifuged in a 50-mL centrifugal tube at 4 C. and 13000 rpm for 15 minutes in order to precipitate insoluble residues in the cell lysate. Then, the supernatant including the soluble EBPPI-MFP block copolypeptide was transferred to a fresh 50-mL centrifugal tube and nucleic acid contaminants were precipitated by conducting centrifugation at 4 C. and 13000 rpm for 15 minutes. The ITC (inverse transition cycling) of EBPPI was conducted several times by adding sodium chloride with a final concentration of 0.5-1.0 M. The EBPPI-MFP block copolypeptide was aggregated due to the salt effect and separated from the lysate by conducting centrifugation at 37 C. and 13,000 rpm for 15 minutes. The aggregated block copolypeptide was resuspended at 4 C. in a well containing 30 mL of sodium acetate buffer (pH 5.0) and 4 M urea. In order to remove any aggregated protein contaminant, the resuspended protein solution was centrifuged at 4 C. and 13,000 rpm for 15 minutes. The aggregation and resuspension were repeated 5-10 times until the purity of the block copolypeptide reached about 95%. The purity was measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

[0130] For hydroxylation of the tyrosine residue of the block copolypeptide, the block copolypeptide, tyrosinase (32 kDa) and ORF438 (15 kDa) were coexpressed as soluble forms.

[0131] As a result, the recombinant EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide was coexpressed in E. coli together with tyrosinase and ORF438 by the pET21a vector including the diblock copolypeptide and the pACYC binary vector system including tyrosinase and ORF438.

[0132] As seen from FIG. 5 and FIG. 6(A), the tyrosinase and ORF438 genes were identified from the amplified tyrosinase and the ORF438-coded pACYC duet vector.

[0133] FIG. 6(B) shows (1) the diblock copolypeptide expressed in the bacteria with pET21 alone, (2) tyrosinase and ORF438 expressed in the bacteria with the pACYC duet vector alone, and (3) the coexpressed diblock copolypeptide of the pET21a vector and tyrosinase and ORF438 of the pACYC duet vector. The number of copies of the plasmid for each vector was higher for the block copolypeptide in the pET vector (40) than for the pACYC duet vector encoding tyrosinase and ORF438 (12). That is to say, the block copolypeptide of the pET vector alone was expressed in large quantities as compared to the coexpression system.

[0134] FIG. 6(C) shows (1) the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide expressed with pET21 alone, and (2) the coexpressed triblock copolypeptide of the pET21a vector and tyrosinase and ORF438 of the pACYC duet vector.

[0135] As shown in FIG. 6(E) and FIG. 6(F), the block copolypeptide coexpressed with tyrosinase and ORF438 was stained violet, whereas the control group block copolypeptide expressed alone was stained yellow. It can be seen that the block copolypeptide coexpressed with tyrosinase and ORF438 undergoes hydroxylation.

EXAMPLE 6

Hydroxylation of Tyrosine Residue of EBP-MFP Block Copolypeptide by Mushroom-Derived Tyrosinase

[0136] The tyrosine residue of the EBP-MFP block copolypeptide was changed to DOPA through modification by mushroom-derived tyrosinase (Sigma Aldrich, T3824) (FIG. 6(D)).

[0137] The EBP-MFP block copolypeptide was resuspended in 10 mM phosphate buffer supplemented with 10 mM sodium borate and pH was adjusted to 7.0 using ascorbic acid. Then, mushroom-derived tyrosinase with a final concentration of 0.01 mg/mL was added. The solution was shaken gently at room temperature (RT) for 3 hours. The tyrosinase-treated EBP-MFP block copolypeptide underwent phase transition at 40 C. as the temperature was raised. In order to remove the tyrosinase, purification was conducted by centrifuging at 40 C. and 16,000 rpm for 10 minutes. The modified block copolypeptide was resupspended in 10 mM phosphate buffer (pH 5) in an ice bath and the sample was centrifuged at 4 C. and 16,000 rpm for 15 minutes to remove insoluble materials.

[0138] In particular, the EBP-MFP block copolypeptide was freeze-dried after adding 5% acetic acid (pH 3) in order to prevent autoxidation during the purification. It is because quinone, which is an oxidized form of DOPA, induces intermolecular covalent bonding and reduces interaction with surface molecules under oxidizing conditions.

[0139] The EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide expressed alone in E. coli was purified by ITC, and the tyrosine residue of the diblock copolypeptide was changed to DOPA by catalytic reaction by mushroom-derived tyrosinase.

[0140] As seen from FIG. 7, the hydroxylated diblock copolypeptide developed violet color upon NBT staining due to hydroxylation of the tyrosine residue. In contrast, unmodified diblock copolypeptide of the control group developed whitish yellow color.

EXAMPLE 7

Characterization of EBP-MFP Block Copolypeptide

[0141] The purity and molecular weight of the block copolypeptide were characterized by SDS-PAGE including copper staining. The phase transition behavior of the block copolypeptide was characterized by UV-visible spectrophotometry.

[0142] The MFPs with different block lengths were fused with EBPPI and formed self-assembled nanostructures in response to thermal stimulation.

[0143] The EBPPI-MFP diblock copolypeptide, the MFP-EBPPI-MFP triblock copolypeptide and the EBPPI-MFP-EBPPI triblock copolypeptide were self-assembled to core-shell nanostructures having a hydrodynamic radius (R.sub.h) of 20-40 nm at concentrations of 12.5 M or higher, whereas the triblock copolypeptides under concentrated conditions formed hydrogels in response to temperature.

[0144] FIGS. 8(A) and 8(B) show the copper-stained SDS-PAGE images of the mushroom-derived tyrosinase-catalyzed EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide and the mushroom-derived tyrosinase-catalyzed EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide, respectively. The molecular weight of the hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide is similar to the expectation (24.6 kDa), and the molecular weight of the hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide is also similar to the expectation (40.1 kDa).

[0145] The 48.0 kDa and 92.0 kDa hydroxylated EBPPI[G1A4F1]6-MFP[Mgfp5]1 diblock copolypeptides was identified to be in multimerized forms.

[0146] Likewise, the hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide was in multimerized forms with molecular weights of 80.0 kDa and 120.0 kDa.

[0147] The multimerized form of hydroxylated diblock and triblock copolypeptides are formed in 10 mM phosphate buffer (pH 5.0) due to intermolecular crosslinking by quinone formed through autoxidation of DOPA. This suggests that the block copolypeptides underwent mushroom-derived tyrosinase-catalyzed hydroxylation.

[0148] FIG. 8(C) shows the copper-stained SDS-PAGE images of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptides and hydroxylated forms thereof, which were treated with the oxidizing agent NalO.sub.4 at different concentrations. When treated with NalO.sub.4, two tyrosine residues are formed and intermolecular crosslinking occurs between the unmodified EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptides. As a result, the chemically crosslinked diblock copolypeptide remains in the well during SDS-PAGE (lanes (2-3) in FIG. 8(C)).

[0149] In contrast, the hydroxylated diblock copolypeptide showed not only the formation of two tyrosine residues at neutral pH but also multimerization due to the formation of quinone induced by autoxidation of DOPA. That is to say, NalO.sub.4 induced intermolecular crosslinking through formation of quinone and two tyrosine residues, and the chemically crosslinked hydroxylated diblock copolypeptide showed no movement during SDS-PAGE.

[0150] The thermal characteristics of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide were observed by measuring absorbance at 350 nm in a temperature range from 10 C. to 70 C. while heating at a rate of 1 C./min in 10 mM phosphate buffer (pH 5, for preventing oxidation).

[0151] FIG. 9(A) shows the thermal profiles of the control group EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 and the 25 M EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptides hydroxylated by mushroom-derived tyrosinase or not. The monoblock, EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 showed complete solubility under aquatic conditions below T.sub.t (45 C.), but showed rapid transition above LOST due to aggregation of EBPPI[G.sub.1A.sub.4F.sub.1].sub.6.

[0152] In contrast, the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide showed thermal responsivity different from that of the EBPPI monoblock. Because the MFP block makes EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 more hydrophobic, the LOST of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide was decreased to 35 C. regardless of hydroxylation by the mushroom-derived tyrosinase. In addition, the absorbance of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide above the transition temperature shows thermally induced aggregation of the EBPPI block (core) and the water-soluble MFP block (shell), suggesting the formation of the self-assembled nanostructure.

[0153] The behavior of LOST depending on the concentrations of the block copolypeptide and the NalO.sub.4 oxidizing agent was analyzed. As a result, the 250 M hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide and the 25 M diblock copolypeptide treated with 10 mM NalO.sub.4 showed rapid transition of the EBP block (FIGS. 9(B) and 9(C)). This is due not only to the formation of quinone induced by DOPA autoxidation and the noncovalent interaction of the MFP block but also to the two tyrosine residues formed at neutral pH. Especially, the aggregation of the MFP block at high concentrations is induced by noncovalent interactions such as hydrogen bonding, - stacking, and electrostatic and hydrophobic interactions.

[0154] FIG. 9(D) shows the thermal profiles of the 25 M EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide and EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide hydroxylated by mushroom-derived tyrosinase, obtained by measuring absorbance at 350 nm in 10 mM phosphate buffer (pH 5) at a heating rate of 1 C./min. The LOST of the triblock was decreased to 25 C., 10 C. lower than that of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide. It is because the hydrophobic EBPPI blocks were introduced to both ends of the MFP[Mgfp5].sub.1 block. In addition, the thermal responsivity of the triblock copolypeptide is similar to that of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide hydroxylated with 10 mM NalO.sub.4 as shown in FIG. 9(C). The triblock copolypeptide was aggregated at temperatures higher than the LOST of the EBPPI block. It is because the EBPPI block in the diblock and triblock copolypeptides is capable of forming both physical crosslinkages and chemical crosslinkages of MFP through formation of quinone.

EXAMPLE 8

Analysis of Bulk-Scale Surface Adhesiveness of (1) Block Copolypeptide Treated with Mushroom-Derived Tyrosinase and (2) Hydroxylated Block Copolypeptide in Coexpression System

[0155] In order to test bulk-scale shear strength to an aluminum adherend, the strength of surface adhesion was analyzed depending on the block copolypeptide and the concentration of NalO.sub.4.

[0156] Hydroxylated diblock and triblock copolypeptides were prepared by treating with mushroom-derived tyrosinase or in a bacterial coexpression system. First, 10, 20 and 30 wt % of the EBPPI[G1A4F1]6-MFP[Mgfp5]1 diblock copolypeptide was dissolved in 10 mM phosphate buffer (pH 5) containing 10 mM and 100 mM NalO.sub.4. The surface of the adherend was rinsed with acetone, ethanol and water. Each block copolypeptide solution was applied on the adherend and then mixed with 10 mM NalO.sub.4 as an oxidizing agent. The adherend was covered with another adherend and then hardened at 4 C. for 1 hour. The surface adhesivity was compared with the EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-EBPP[A.sub.1G.sub.4I.sub.1].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 triblock copolypeptide as a control group after hardening in DW at 25 C.

[0157] As shown in FIG. 10(B), the 30 wt % diblock copolypeptide treated with 100 mM NalO.sub.4 showed chemical gelation due to quinone-mediated intermolecular crosslinking. However, it showed lower surface adhesiveness than the diblock copolypeptide treated with 10 mM NalO.sub.4 (FIG. 10(C)). This means that the diblock copolypeptide treated with 100 mM NalO.sub.4 underwent more oxidation of DOPA to quinone as compared to that treated with 10 mM NalO.sub.4.

[0158] In addition, it was confirmed that the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide (10 wt %) treated with 10 mM NalO.sub.4 exhibited stronger surface adhesiveness than the EBPPI[G.sub.1A.sub.3F.sub.2].sub.12-EBPP[G.sub.1A.sub.4F.sub.1].sub.6-EBPPI[G.sub.1A.sub.3F.sub.2].sub.12 triblock copolypeptide of the control group. It is because the intermediate MFP block has surface adhesiveness (FIG. 11).

[0159] In addition, it was confirmed that the surface adhesion strength of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1-EBPPI[G.sub.1A.sub.4F.sub.1].sub.6 triblock copolypeptide is superior as compared to the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide. This is due to the cohesive force induced by the aggregation of the EBPPI block through physical crosslinking.

EXAMPLE 9

Characterization of Block Copolypeptide Expressed and Purified by Bacterial Coexpression and Investigation of Adhesvity of Hydrogel

[0160] Hydroxylated block copolypeptides were prepared with various wt % using a bacterial coexpression system. First, 10 wt % of the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide was dissolved in 10 mM phosphate buffer (pH 5). Each block copolypeptide solution was mixed with 10-100 mM of the NalO.sub.4 oxidizing agent before being applied on an adherend. After applying each block copolypeptide on the adherend, it was covered with another adherend and hardened at 4 C. for 1 hour.

[0161] As shown in FIG. 12(A), 10 wt % of the hydroxylated EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide showed strong bonding between the adherends in the bacterial coexpression system due to surface adhesiveness. In addition, the adherends showed strong adhesiveness in the aquatic environment (FIG. 12(B)).

[0162] The adhesivity of 10 wt % of the hydroxylated diblock copolypeptide in the bacterial coexpression system was compared with that of the mushroom-derived tyrosinase-treated diblock copolypeptide. It was confirmed that the hydroxylated block copolypeptide in the bacterial coexpression system exhibited stronger surface adhesivity.

[0163] For the hydroxylated diblock or triblock copolypeptide, the degree of hydroxylation of the tyrosine residue is increased coexpression system. Accordingly, it can be seen that stronger surface adhesivity can be achieved when the block copolypeptide is hydroxylated in the bacterial coexpression system. This is also useful in industrial scales.

EXAMPLE 10

Characterization of Core-Shell Structure of Diblock and Triblock Copolypeptides and Investigation of Surface Adhesiveness

[0164] The characteristics of core-shell structures of EBP-MFP block copolypeptides with or without hydroxyl groups were analyzed by dynamic light scattering (DLS) (Malvern Instruments, Worcestershire, UK). The hydrodynamic radius (R.sub.h) of the 12.5 M block copolypeptide was measured in 10 mM phosphate buffer (pH 5) consecutively for 11 times after equilibrating at 10 C. and 45 C. for 1 minute.

[0165] As shown in (c) of FIG. 13(A), the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide hydroxylated by mushroom-derived tyrosinase had a hydrodynamic radius of 25-30 nm at 10 C. This means that the hydrophobic interaction MFP molecules is increased greatly due to cohesive force and, as a result, a structure compose of an MFP core is formed (FIG. 14(A), FIG. 14(B) and FIG. 14(C)). Also, as shown in (d), the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide hydroxylated by mushroom-derived tyrosinase had a hydrodynamic radius of 50-60 nm at 45 C. This means that a core-shell structure is formed as the EBP blocks which are soluble below transition temperature form hydrophobic cores above transition temperature through phase transition (FIG. 14(G), FIG. 14(H) and FIG. 14(I)).

[0166] In addition, the surface adhesiveness of the core-shell structure of the EBP-MFP block copolypeptide was investigated using a hydrophobic fluorescent dye.

[0167] The rhodamine 6G fluorescent dye with a final concentration of 0.5 w/v % was used to investigate the surface adhesiveness of the core-shell structure. The fluorescent dye was (1) placed in a vacant PCR tube (# PCR-02-C, Axygen), (2) mixed with the EBP diblock copolypeptide, (3) mixed with the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide hydroxylated through coexpression at 10 C., or (4) mixed with the EBPPI[G.sub.1A.sub.4F.sub.1].sub.6-MFP[Mgfp5].sub.1 diblock copolypeptide hydroxylated through coexpression at 40 C. Each block copolypeptide was dissolved to 25 M in 10 mM phosphate buffer (pH5). For (2), (3) and (4), pH was increased to 8 using sodium hydroxide and the mixtures were stabilized at 25 C., 50 C., 10 C. and 40 C., respectively, for 3 hours. Then, all the tubes were washed using distilled water and ethanol.

[0168] As shown in FIG. 13(B), only the tube of (4) showed the color of the fluorescent dye. A hydrophobic is formed by the block copolypeptide and the hydrophobic fluorescent dye is bound to the polypeptide core through hydrophobic interaction. For (2), although the fluorescent dye is bound to the EBP block which forms a hydrophobic core, the fluorescent dye is washed off the core-shell structure of the EBP diblock copolypeptide due to lack of surface adhesiveness. For (3), although the fluorescent dye is bound to the MFP block which forms a hydrophobic core, surface adhesiveness is decreased greatly due to the MFP block present in the core and the fluorescent dye is not observed after the washing. For (1), which is for investigating binding due to the nonspecific reaction between the fluorescent dye and the tube during the stabilization, the fluorescent dye was not observed after the washing. For (4), the color of the fluorescent dye was observed even after the washing due to the surface adhesiveness resulting from the interaction between the hydrophobic core of the EBP block formed above the transition temperature and the fluorescent dye.

[0169] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present disclosure. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the disclosure as set forth in the appended claims.