METHODS FOR PRODUCING OR ISOLATING EPICARDIAL CELLS AND USES THEREOF
20230002734 · 2023-01-05
Inventors
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
A61K35/34
HUMAN NECESSITIES
C12N2501/165
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to in vitro methods for isolating, or producing selected populations of human epicardial cells derived from human pluripotent stem cells; defined mixtures of said cells, and therapeutic uses thereof. Said population comprises epicardial cells with or without the potential to differentiate into cardiac fibroblasts, or a mixture thereof.
Claims
1. A method for separating in vitro-differentiated human epicardial cells into a first population of cells characterised by higher levels of expression of transcription factor 21 when compared to basonuclin 1 and a second population of cells characterised by higher levels of expression basonuclin 1 when compared to transcription factor 21, the method comprising cell-sorting based upon the use of a capture agent specific to a cell surface marker for the first population of cells and/or the second population of cells.
2. A method for separating in vitro-differentiated human epicardial cells according to claim 1, wherein said cells are derived from human induced pluripotent stem cells.
3. A method for separating in vitro-differentiated human epicardial cells according to claim 1 or claim 2, wherein the first population of cells expresses at least 5, at least 8, at least 10 times more transcription factor 21 than basonuclin 1.
4. A method for separating in vitro-differentiated human epicardial cells according to any one of the preceding claims, wherein the cell surface protein marker for the first population of cells is selected from the group consisting of THY1, SIPR3, PDGFRA, BAMBI, PLD3, ADAM12, TGFBR3, STRA6, SLC12A8, BEST1, SMIM3, NRP1, ITGA1, TEK, IGDCC4, CD99, ABCA1, CD9, NDRG2, IFITM1 and ACVR2A.
5. A method for separating in vitro-differentiated human epicardial cells according to claim 4, wherein the cell surface protein marker for the first population of human epicardial cells is THY1.
6. A method for separating in vitro-differentiated human epicardial cells according to claim 5, wherein the capture agent is an antibody, preferably a mouse anti-THY1 antibody.
7. A method for separating in vitro-differentiated human epicardial cells according to any one of claims 1 to 3, wherein the cell surface marker for the second population is selected from the group consisting of PODXL, LRP2, ITGA6, TMEM98, CDH3, CDH1, LEPROTL1, SLC34A2, PKHD1L1, AQP1, GPNMB, SLC7A7, CNTN6, CXADR, SLC4A8, PTPRF, ATP7B, ACKR3, SLC2A1, SLC16A3, OLR1, TMEM88, S100A10, CD82, PARM1, PLXNB2 and APLP2.
8. A method for separating in vitro-differentiated human epicardial cells according to claim 7, wherein the cell surface marker for the second population of human epicardial cells is PODXL.
9. A method for separating in vitro-differentiated human epicardial cells according to any one of the preceding claims, said method comprising cell-sorting based upon the use of a capture agent specific to a cell surface marker for the first population of cells and/or the second population of cells and collecting the eluted cells.
10. A method for separating in vitro-differentiated human epicardial cells according to any one of the preceding claims, wherein under cardiac fibroblast differentiation conditions more cells in the first population differentiate forming cardiac fibroblasts than cells in the second population.
11. A method for separating in vitro-differentiated human epicardial cells according to claim 8 or 9, wherein more than 50, more than 60, more than 70, more than 80% of the cells in the first population differentiate forming cardiac fibroblasts.
12. A method for separating in vitro-differentiated human epicardial cells according to claim 8, 9 or claim 10, wherein less than 50, less than 40, less than 30, less than 20% of the cells in the second population differentiate forming cardiac fibroblasts.
13. An isolated first population of in vitro-differentiated human epicardial cells characterised by higher expression of transcription factor 21 when compared to basonuclin 1.
14. An isolated first population of in vitro-differentiated human epicardial cells according to claim 13, wherein the first population expresses at least 5, at least 8, at least 10 times more transcription factor 21 than basonuclin 1.
15. An isolated first population of in vitro-differentiated human epicardial cells according to claim 13 or claim 14, wherein under cardiac fibroblast differentiation conditions more than 50, more than 60, more than 70, more than 80% of the cells in the first population of human epicardial cells differentiate forming cardiac fibroblasts.
16. An isolated second population of in vitro-differentiated human epicardial cells characterised by higher expression of basonuclin 1 when compared to transcription factor 21.
17. An isolated second population of in vitro-differentiated human epicardial cells according to claim 16, wherein under cardiac fibroblast differentiation conditions less than 50, less than 40, less than 30, less than 20% of the cells in the second population differentiate forming cardiac fibroblasts.
18. A mixture of first and second populations of in vitro-differentiated human epicardial cells, wherein the first population is characterised by higher expression of transcription factor 21 when compared to basonuclin 1 and the second population is characterised by higher expression of basonuclin 1 when compared to transcription factor 21, wherein the mixture is enriched with either the first or second populations.
19. A mixture according to claim 18, wherein the mixture is formed by the combination of unseparated in vitro-differentiated human epicardial cells and either the first or second populations after separation.
20. A mixture according to claim 18 or claim 19 additionally comprising cardiomyocytes.
21. A mixture of first and second populations of in vitro-differentiated human epicardial cells according to claim 18, 19 or claim 20, wherein the first population expresses at least 5, at least 8, at least 10 times more transcription factor 21 than basonuclin 1.
22. A mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 18 to 21, wherein under cardiac fibroblast differentiation conditions more than 50, more than 60, more than 70, more than 80% of the cells in the first population differentiate forming cardiac fibroblasts.
23. A mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 18 to 21, wherein under cardiac fibroblast differentiation conditions less than 50, less than 40, less than 30, less than 20% of the cells in the second population differentiate forming cardiac fibroblasts.
24. An isolated first population of in vitro-differentiated human epicardial cells according to any one of claims 13 to 15 or an isolated second population of in vitro-differentiated human epicardial cells according to claim 16 or claim 17 or a mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 18 to 22 for use as a medicament.
25. An isolated first population of in vitro-differentiated human epicardial cells according to any one of claims 13 to 15 or an isolated second population of in vitro-differentiated human epicardial cells according to claim 16 or claim 17 or a mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 18 to 23 for use in treating and/or repairing cardiac tissue damage.
26. An isolated first population of in vitro-differentiated human epicardial cells according to any one of claims 12 to 14 or a mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 17 to 21 wherein the mixture is enriched with the first population for use in treating and/or repairing cardiac blood vessel, smooth muscle fibre or cardiac fibroblast damage.
27. An isolated second population of in vitro-differentiated human epicardial cells according to claim 15 or claim 16 or a mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 17 to 21 wherein the mixture is enriched with the second population for use in treating and/or repairing smooth muscle fibre damage, preferably with reduced fibrosis.
28. A pharmaceutical composition comprising the invitro—differentiated cell population of claims 13 to 15 or an isolated second population of in vitro-differentiated human epicardial cells according to claim 16 or claim 17 or a mixture of first and second populations of in vitro-differentiated human epicardial cells according to any one of claims 18 to 23 and a pharmaceutically acceptable excipient.
29. A method for the production of a first population of in vitro-differentiated epicardial cells, characterised by higher levels of expression of transcription factor 21 when compared to basonuclin 1, comprising the knockdown of BNC1 in human pluripotent stem cells.
Description
[0039] SUMMARY OF THE FIGURES
Scale bar=20 μm in B
[0040]
Scale bar=30 μm in D, 9 μm in E and 20 μm in F.
[0041]
[0042]
[0043]
All displayed error bars are s.e.m.
[0044]
[0045]
[0046] Scale bar=40 μm in C and D and 20 μm in I.
[0047] Statistics were performed with Prism 7 from GraphPad with a ratio paired t-test.
[0048] All displayed error bars are s.e.m.
[0049]
[0050]
[0051]
DETAILED DESCRIPTION OF THE INVENTION
[0052] The present invention is based on the inventors discovery that the in vitro-differentiated human epicardial cells are actually a heterogeneous population of cells, with two distinct signatures and such populations may be separated in to two distinct homogenous poulations. The heart is made of three major tissue layers: the endocardium, myocardium, and epicardium. The epicardium is the outermost epithelial layer of the heart and is responsible for the formation of coronary vascular smooth muscle cells. The epicardium can be re-activated to a more fetal form and/or the epicardial cells can undergo epithelial-to-mesenchymal transition (EMT) in response to an acute injury to the myocardium (e.g., a myocardial infarction).
[0053] Provided herein are novel epicardial cell populations and uses thereof in the treatment of cardiac injury, cardiac disease/disorder, and/or promoting vascularization and engraftment of coadministered cardiomyocytes.
[0054] In a first aspect of the invention, a method for separating in vitro-differentiated human epicardial cells into a first population of cells characterised by higher levels of expression of transcription factor 21 when compared to basonuclin 1, and a second population of cells characterised by higher levels of expression basonuclin 1 when compared to transcription factor 21, the method comprising cell sorting using a capture agent specific for a cell surface marker for the first population of cells and/or the second population of cells. The populations of cells can be separated based on cell surface markers: TCF21.sup.high cells, the first population, express THY1 (they are THY1.sup.+); whilst BNC1.sup.high cells (the second population) do not express this marker (THY1.sup.−). The cells may be sorted on this basis, since this is a cell surface marker. Other cell markers include PODXL, in this case the first population do not express PODXL (thus PODXL.sup.−), whilst the second population does express PODXL (PODXL+)
[0055] The in vitro-differentiated human epicardial cells are derived from human pluripotent stem cells (hPSCs). These may be autologous stem cells or allogenic stem cells. Optionally the cells are induced pluripotent stem cells (iPSC). Such cells are obtainable from mature cell types using reprogramming methods well known in the art. Alternatively, the use of embryonic stem cells (ESCs) or cell lines derived from ESCs may be possible. The embryonic stem cells may be obtained from a human blastocyst without destruction of said blastocyst. The in vitro-differentiated human epicardial cells may be obtained from the pluripotent stem cells by culturing the cells under the appropriate conditions in order to reach an epicardial fate. The inventors have reported Oyer D, et al. Development. 2015; 142(8):1528-1541, herein incorporated by reference) a method of generating epicardial cells from hPSCs under chemically defined conditions by first inducing an early mesoderm lineage, then lateral plate mesoderm (LM) before further specification to epicardium. They demonstrated that a combination of WNT, BMP and RA signalling promotes robust epicardium differentiation from LM. These in vitro-differentiated human epicardial cells display characteristic epithelial cell morphology and express elevated levels of epicardial markers (such as TBX18, WT1 and TCF21), similar to human foetal epicardial outgrowths. Importantly, these epicardial cells undergo epithelial-to-mesenchymal transition (EMT) and differentiate in vitro into mature and functional SMCs (SMCs), and CFs. hPSCs can be efficiently differentiated to epicardial cells by recapitulating early developmental events in vitro.
[0056] As used herein, the term “in vitro-differentiated epicardial cells” refers to epicardial cells that are generated in culture, usually by step-wise differentiation from a precursor such as a stem cell, an early mesoderm cell, a lateral plate mesoderm cell or a cardiac progenitor cell. In one embodiment, the term “in vitro-differentiated epicardial cells” may exclude human tissue-derived epicardial cells obtained from a subject (primary epicardial cells). The term “EMT” or “epithelial to mesenchymal transition” refers to the transition of a cell having an epithelial phenotype to a cell having a mesenchymal phenotype. EMT usually occurs in response to an injury to the myocardium in the adult heart. An epithelial phenotype includes expression of epithelial cell markers (such as cadherin, cytokeratins, ZO-1, laminin, desmoplakin, MUC1). A mesenchymal phenotype includes expression of mesenchymal markers (such as vimentin, fibronectin, twist, FSP-1 Snail, Snai2), with increased cell mobility.
[0057] The term “differentiated progeny of epicardial cells” may refer to any of the cells developmentally downstream of, or differentiated from, epicardial cells. Examples of differentiated progeny of most interest in the current invention are smooth muscle cells and cardiac fibroblasts, although epicardial cells may also develop into interstitial fibroblasts, mesenchymal-like cells and possibly endothelial cells, cardiomyocytes or cardiac progenitor cells. The “differentiated progeny of epicardial cells” may refer to any of the differentiated cells that are downstream from any of the epicardial cell populations. As described above, the inventors have determined that BNC1.sup.high or TCF21.sup.high cells can differentiate into smooth muscle cells, but only TCF21.sup.high cells in vitro have been demonstrated to differentiate into cardiac fibroblasts. The smooth muscle cells may be coronary and/or vascular.
[0058] The term “marker” may describe a characteristic and/or phenotype of a particular cell. Markers can be used for selection and/or separation of cells comprising characteristics/phenotype of interest. Markers are characteristics, which may be morphological, structural, functional or biochemical characteristics of the cell, or molecules expressed by the cell type. Markers may be cell-surface or intracellular. Markers may be proteins. Such proteins can possess an epitope for capture agents such as antibodies, which allows for the separation of cells based on this marker. Markers may consist of any molecule found in or on a cell, including, but not limited to, proteins (peptides and polypeptides), lipids, polysaccharides, and nucleic acids. The marker may be a cell surface marker, which is preferred for the separation of the cell populations. The marker may be intracellular, such as a transcription factor. If a cell is “positive for” a marker this means that said marker is physically detectable above background levels on the cell using standard methods (e.g. immunofluorescence microscopy or flow cytometry methods, such as fluorescence activated cell sorting (FACS)), or expression of mRNA encoding the marker is detectable above background levels using standard techniques (e.g. RT-PCR). The expression level of a marker may be compared to the expression level obtained from a negative control (cells known to lack the marker). If a cell is “negative for” a marker (alternatively “does not express”) then a marker cannot be detected above background levels on the cell using standard techniques. Alternatively, the terms “negative” or “does not express” means that expression of the mRNA for a marker cannot be detected above background levels using techniques such as RT-PCR. The expression level of a cell surface marker or intracellular marker can be compared to the expression level obtained from a negative control. Thus, a cell that “does not express” a marker appears similar to the negative control with respect to that marker. Relative levels of expression can be determined in a similar fashion, by comparison to a control with a known expression level.
[0059] In relation to separating in vitro-differentiated epicardial cells into sub-populations, the presence or absence of a cell surface marker can be used to distinguish the two populations. The cells may be separated using cell-sorting, optionally using cell surface markers that are expressed on one cell population, but not the other. Any suitable method of cell sorting is envisioned. Such methods include, but are not limited to: magnetic-activated cell sorting (MACS), fluorescence-activated cell sorting (FACS), microfluidic cell separation, or buoyancy-activated cell sorting. It is preferred that the cell sorting method relies upon a capture agent. As used herein a “capture agent” may be considered to be an antibody or an antibody mimetic. Optionally the capture agent may be an antibody, an antibody fragment, a derivative of an antibody, a non-antibody protein capture agent such as an affibody, an aptamer (peptide or nucleic acid) or any other antibody mimetic. Those skilled in the art will appreciate that a capture agent will be specific for a target molecule, in relation to the present invention, a marker. The use of a capture agent allows for the selective binding of cells which display said marker, and therefore allows for the cell populations to be separated and/or enriched.
[0060] Within the field of cell ontogeny, the term “differentiate/differentiating” is relative and indicates that a “differentiated cell” has progressed further down the developmental pathway than its precursor. The in vitro-differentiated epicardial cells of the invention are therefore further down the developmental pathway than a pluripotent stem cell, but are still capable of further differentiation into mature cell types.
[0061] An “isolated cell” is a cell that has been removed from an organism in which it was originally found, or a descendant of such a cell. Optionally the cell has been cultured in vitro. The cells of the invention may be isolated.
[0062] As used herein, “substantially pure,” with respect to a particular cell population, refers to a population of cells that is at least about 75%, preferably at least about 85%, more preferably at least about 90%, and more preferably at least about 95% pure, most preferably at least 97% with respect to the cells making up a total cell population. That is, the terms “substantially pure” or “essentially purified”, with regard to a population of BNC1.sup.high or TCF21.sup.high cells, refers to a population of cells that contain fewer than about 20%, more preferably fewer than about 15%, 10%, 8%, 7%, most preferably fewer than about 5%, 4%, 3%, 2%, 1%, or less than 1%, of cells that are not BNC1.sup.high or TCF21.sup.high cells, respectively.
[0063] As used herein “enriched” may mean that the fraction of cells of one type, such as TCF21.sup.high, is increased by at least 10%, by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, or by at least 75%, over the fraction of cells of that type in a starting preparation.
[0064] Thus a TCF21.sup.high enriched population may be at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, or by at least 75%, or by at least 80%, or at least 90% or 95% of the cells in the mixture. The rest of the mixture may comprise BNC1.sup.high cells, human cardiomyocytes, or both.
[0065] Conversely a BNC1.sup.high enriched population may be at least 60%, by at least 65%, by at least 70%, or by at least 75%, or by at least 80%, or at least 90% or 95% of the cells in the mixture. The rest of the mixture may comprise TCF21.sup.high cells, human cardiomyocytes, or both.
[0066] As used herein “separation” or “selection” refers to isolating different cell types (notably BNC1.sup.high or TCF21.sup.high cells) into one or more populations and collecting the isolated population as a target cell population which is enriched, for example, in a specific target cell. This can be performed using positive selection, where a target enriched cell population is retained, or negative selection, whereby non-target cell types are discarded.
[0067] The cells of the invention may be used to treat conditions involved in cardiac repair. As used herein “treating/treatment” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder. Treatment may involve administering to a subject an effective amount of a composition, e.g., an effective amount of a cell therapy composition comprising a population of BNC1.sup.high or TCF21.sup.high cells or a mixture thereof. “Treatment” of a cardiac disorder, a cardiac disease, or a cardiac injury (e.g., myocardial infarction) may be a therapeutic intervention that enhances cardiac function or improves the function of the heart.
[0068] In one aspect, the in vitro-differentiated epicardial cells and mixtures thereof, optionally together with cardiomyocytes described herein can be admixed with or grown in or on a preparation that provides a scaffold to support the cells. Such a scaffold can provide a physical advantage in securing the cells in a given location, e.g., after implantation, as well as a biochemical advantage in providing, for example, extracellular cues for the further maturation or, e.g., maintenance of phenotype until the cells are established. Biocompatible synthetic, natural, as well as semi-synthetic polymers, can be used for synthesising polymeric particles that can be used as a scaffold material. In general, for the practice of the methods described herein, it is preferable that a scaffold biodegrades such that the cardiomyocytes and/or epicardial cells can be isolated from the polymer prior to implantation or such that the scaffold degrades over time in a subject and does not require removal. Thus, in one embodiment, the scaffold provides a temporary structure for growth and/or delivery of the cells of the invention or mixtures thereof (optionally with cardiomyocytes) to a subject in need thereof.
[0069] In some embodiments, the scaffold permits human cells to be grown in a shape suitable for transplantation or administration into a subject in need thereof, thereby permitting removal of the scaffold prior to implantation and reducing the risk of rejection or allergic response initiated by the scaffold itself.
[0070] Preferably the first population (TCF21.sup.high) of in vitro-differentiated human epicardial cells expresses at least 5, at least 8, at least 10 times more transcription factor 21 than basonuclin 1.
[0071] Preferably the second population (BCN1.sup.high) of in vitro-differentiated human epicardial cells expresses at least 5, at least 8, at least 10 times more basonuclin 1 than transcription factor 21.
[0072] The cell sorting method may preferably be magnetic-activated cell sorting and fluorescence-activated cell sorting, which are both well-known methods of separating cells for the skilled person in the art. Briefly, in magnetic-activated cell sorting, the cells are treated with magnetic nanoparticles conjugated to antibodies which target specific cell surface proteins. The treated cells are then passed through a column subject to a magnetic field and the cells comprising the specific cell surface proteins are retained in the column and hence are separated from those cells which simply pass through the column. In fluorescence-activated cell sorting, the cells are treated with a fluorescent moiety conjugated to an antibody which targets specific cell surface proteins. The treated cells are entrained in droplets which are then charged with a positive or negative charge depending on whether the cell fluoresces or not. Electrostatic deflection apparatus then diverts each cell into separate pots depending on the charge. Both methods rely on an antibody which targets specific cell surface proteins.
[0073] Preferably the cell surface protein marker for the first population (TCF21.sup.high) of in vitro-differentiated epicardial cells is selected from the group consisting of THY1, SIPR3, PDGFRA, BAMBI, PLD3, ADAM12, TGFBR3, STRA6, SLC12A8, BEST1, SMIM3, NRP1, ITGA1, TEK, IGDCC4, CD99, ABCA1, CD9, NDRG2, IFITM1 and ACVR2A.
[0074] Most preferably the cell surface marker for the first population (TCF21.sup.high) of in vitro-differentiated epicardial cells is THY1. This marker is highly expressed, optionally about at least 5, at least 8, at least 10 times higher, or 13 times higher, when compared to the second population (BNC1.sup.high) of in vitro-differentiated epicardial cells (
[0075] The cell surface protein marker for the second population (BNC1.sup.high) of in vitro-differentiated epicardial cells is preferably selected from the group consisting of PODXL, LRP2, ITGA6, TMEM98, CDH3, CDH1, LEPROTL1, SLC34A2, PKHD1L1, AQP1, GPNMB, SLC7A7, CNTN6, CXADR, SLC4A8, PTPRF, ATP7B, ACKR3, SLC2A1, SLC16A3, OLR1, TMEM88, S100A10, CD82, PARM1, PLXNB2 and APLP2.
[0076] More preferably the cell surface marker for the second population (BNC1.sup.high) of in vitro-differentiated epicardial cells is PODXL. This marker is highly expressed, optionally about at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or 55 times higher, or about 53 times higher, when compared to the first population of cells (
[0077] As previously mentioned, it has been observed that under cardiac fibroblast differentiation conditions more cells in the first population (TCF21.sup.high) of in vitro-differentiated epicardial cells differentiate forming cardiac fibroblasts than cells in the second population (BNC1.sup.high) of in vitro-differentiated epicardial cells. Preferably, more than 50, more than 60, more than 70, more than 80% of the cells in the first population of in vitro-differentiated epicardial cells differentiate forming cardiac fibroblasts. In contrast, it is preferred that less than 50, less than 40, less than 30, less than 20 or less than 10 or 5% of the cells in the second population of human in vitro-differentiated epicardial cells differentiate forming cardiac fibroblasts.
[0078] In a second aspect of the invention, an isolated first population (TCF21.sup.high) of in vitro-differentiated epicardial cells characterised by higher expression of transcription factor 21 when compared to basonuclin 1 is provided. The in vitro-differentiated epicardial cells are derived from or differentiated from human pluripotent stem cells. Preferably the first population expresses at least 5, at least 8, at least 10 times more transcription factor 21 than basonuclin 1. In addition or alternatively, when under cardiac fibroblast differentiation conditions, preferably more than 50, more than 60, more than 70, more than 80% of the cells in the first population of in vitro-differentiated epicardial cells differentiate forming cardiac fibroblasts.
[0079]
[0080] In a third aspect of the invention, an isolated second population (BNC1.sup.high) of in vitro-differentiated epicardial cells characterised by higher expression of basonuclin 1 when compared to transcription factor 21 is provided. The in vitro-differentiated epicardial cells are derived from or differentiated from human pluripotent stem cells. When under cardiac fibroblast differentiation conditions, preferably less than 50, less than 40, less than 30, less than 20% of the cells and most preferably less than 10% in the second population of human epicardial cells differentiate forming cardiac fibroblasts.
[0081] In a fourth aspect of the invention, a mixture of first (TCF21.sup.high) and second (BNC1.sup.high) populations of in vitro-differentiated epicardial cells is provided, wherein the first population is characterised by higher levels of expression of transcription factor 21 when compared to basonuclin 1 and the second population is characterised by higher levels of expression of basonuclin 1 when compared to transcription factor 21, wherein the mixture is enriched with either the first or second populations.
[0082] Preferably the mixture is formed by the combination of unseparated in vitro-differentiated epicardial cells and either the first or second populations. Alternatively the isolated populations can be mixed in the desired proportions. The first population (TCF21.sup.high) of in vitro-differentiated epicardial cells preferably expresses at least 5, at least 8, at least 10 times more transcription factor 21 than basonuclin 1. Alternatively or in addition, when under cardiac fibroblast differentiation conditions, preferably more than 50, more than 60, more than 70, more than 80% of the cells in the first population differentiate forming cardiac fibroblasts. In contrast, when under cardiac fibroblast differentiation conditions, preferably less than 50, less than 40, less than 30, less than 20% of the cells in the second population (BNC1.sup.high) of in vitro-differentiated epicardial cells differentiate forming cardiac fibroblasts.
[0083] In a fifth aspect of the invention, the isolated first population (TCF21.sup.high) of in vitro-differentiated epicardial cells according to the second aspect of the invention or the isolated second population (BNC1.sup.high) of in vitro-differentiated epicardial cells according to the third aspect of the invention or the mixture of first and second populations according to the fourth aspect of the invention is provided for use as a medicament.
[0084] More particularly and in a sixth aspect of the invention, the isolated first population (TCF21.sup.high) of in vitro-differentiated epicardial cells according to the second aspect of the invention or the isolated second population (BNC1.sup.high) of in vitro-differentiated epicardial cells according to the third aspect of the invention or the mixture of first and second populations according to the fourth aspect of the invention is provided for use in treating and/or repairing cardiac tissue damage.
[0085] In a seventh aspect of the invention, the isolated first population (TCF21.sup.high) of in vitro-differentiated epicardial cells according to the second aspect of the invention or the mixture of first and second populations of in vitro-differentiated epicardial cells according to the fourth aspect of the invention is provided wherein the mixture is enriched with the first population of in vitro-differentiated epicardial cells for use in treating and/or repairing cardiac blood vessel, smooth muscle fibre or cardiac fibroblast damage.
[0086] In an eighth aspect of the invention, the isolated second population (BNC1.sup.high) of in vitro-differentiated epicardial cells according to the third aspect of the invention or the mixture of first and second populations of in vitro-differentiated epicardial cells according to the fourth aspect of the invention is provided wherein the mixture is enriched with the second population of in vitro-differentiated epicardial cells for use in treating and/or repairing smooth muscle fibre damage, preferably with reduced fibrosis.
[0087] In one embodiment, the fifth to eighth aspects of the invention are methods of treating a person in need thereof with the isolated first population (TCF21.sup.high) of in vitro-differentiated epicardial cells according to the second aspect of the invention or the isolated second population (BNC1.sup.high) of in vitro-differentiated epicardial cells according to the third aspect of the invention or the mixture of first and second populations of in vitro-differentiated epicardial cells according to the fourth aspect of the invention.
[0088] In another embodiment of the invention, the fifth to eighth aspects of the invention are uses of the first population (TCF21.sup.high) of in vitro-differentiated epicardial cells according to the second aspect of the invention or the isolated second population (BNC1.sup.high) of in vitro-differentiated epicardial cells according to the third aspect of the invention or the mixture of first and second populations of in vitro-differentiated epicardial cells according to the fourth aspect of the invention for the manufacture of a medicament for the therapeutic application. Such medicaments may include cells on a scaffold to facilitate transfer to a patient in need thereof. The invention will now be described with reference to several non-limiting Examples:
[0089] Materials and Methods
[0090] Tissue Culture
[0091] hPSC-derived cells and separation of the THY1.sup.+ and THY1.sup.− hPSC-epi cells
[0092] hPSC (H9 line, Wicell, Madison, Wis.) were maintained as previously described (Iyer et al., 2015) and tested every two months for Mycoplasma contamination. hPSC differentiation was performed in CDM-PVA (Iscove's modified Dulbecco's medium (Gibco) plus Ham's F12 NUT-MIX (Gibco) medium in a 1:1 ratio, supplemented with Glutamax-I, chemically defined lipid concentrate (Life Technologies), transferrin (15 μg/ml, Roche Diagnostics), insulin (7 μg/ml, Roche Diagnostics), monothioglycerol (450 μM, Sigma) and polyvinyl alcohol (PVA, 1 mg/ml, Sigma) on gelatin-coated plates. The cells were first differentiated into early mesoderm with FGF-2 (20 ng/ml), LY294002 (10 μM, Sigma) and BMP4 (10 ng/ml, R&D systems) for 36 h. Then, they were treated with FGF-2 (20 ng/ml) and BMP4 (50 ng/ml) for 3.5 days to generate lateral plate mesoderm. The differentiation of lateral plate mesoderm into epicardium (hPSC-epi) was induced by exposure to Wnt-3A (25 ng/ml, R&D systems), BMP4 (50 ng/ml) and Retinoic Acid (4 μM, Sigma) for 8 to 10 days after dissociation and re-plating of the lateral plate mesoderm cells at a density of 24 000 cells per cm.sup.2.
[0093] In the first set of experiments magnetic separation of the THY1.sup.+ and THY1.sup.− hPSC-epi cells was performed using mouse anti-THY1 antibody clone 5E10 (14-0909-82, Thermofisher) diluted 1 in 100, biotinylated horse anti-mouse IgG antibody from Vector Laboratories (BA-2000) diluted 1 in 500 and MACS Streptavidin MicroBeads from Miltenyi Biotec following their instructions.
[0094] In a second purification scheme (see example 8) Magnetic separations of the THY1.sup.+ or PODXL.sup.+ hPSC-epi populations were performed using mouse anti-THY1 antibody clone 5E10 (14-0909-82, Thermofisher) or mouse anti-human PODXL (MAB1658, R&D) diluted 1 in 100, with goat anti-mouse microbeads (130-048-402, Miltenyi) and LD columns as described by the manufacturer (Miltenyi, 130-042-901) and the eluted cells utilised for further experiments.
[0095] hPSC-epi-SMC and hPSC-epi-CF were derived from hPSC-epi following Iyer et al, 2015. Briefly, after splitting, the hPSC-epi cells were cultured for 12 days in CDM-PVA supplemented with PDGF-BB (10 ng/ml, Peprotech) and TGFβ1 (2 ng/ml, Peprotech) to obtain hPSC-epi-SMC and with VEGFB (50 ng/ml, Peprotech) and FGF-2 (50 ng/ml) to get hPSC-epi-CF.
[0096] Primary Human Cultures
[0097] Human embryonic and foetal tissues were obtained following therapeutic pregnancy interruptions performed at Cambridge University Hospitals NHS Foundation Trust with ethical approval (East of England Research Ethics Committee) and informed consent in all instances.
[0098] For embryonic epicardial explants, 8-week post-conception embryonic hearts were harvested and set up under coverslip on gelatin coated plates (0.1% gelatin for 20 minutes at RT, followed by advanced DMEM F12+10% FBS for storage at 37° C.) and primary epicardium medium [1:1 mixture of Dulbecco's modified Eagle's medium (DMEM, Sigma) and Medium 199 (M199, Sigma) containing 100 U/ml penicillin, 100 μg/ml streptomycin, 10% heat-inactivated foetal bovine serum (FBS, Sigma)]. After a few days, when epicardial cells had started to explant, SB-435142 (Sigma Aldrich), 10 μM final concentration, was added to the medium.
[0099] For primary foetal epicardial cultures, the heart was removed from foetuses over 10-weeks post-conception. Several patches of the epicardial layer were peeled off with fine dissecting tweezers and set up to grow in a gelatin-coated 12-well tissue culture plate in primary epicardial medium. After 5 days in a humidified incubator at 37° C. and 5% CO2, the growing cells were dissociated with TrypLE™ Express Enzyme and re-plated in primary epicardial medium supplemented with SB-435142 10 μM final. Cells were maintained in the same conditions and passaged 1:2 when confluent.
[0100] For primary human foetal fibroblasts, the foetal hearts were harvested 8-9 weeks post-conception, cut in small pieces and digested with collagenase (collagenase IV, Life Technologies, cat no 17104019) at 0.25% in DPBS, for 30 minutes at 37° C. with occasional resuspension. Digested tissue was smashed through a 40 μm cell strainer, washed twice in DPBS and then incubated a further 10 minutes at 37° C. in TrypLE™ Express Enzyme to get a cell suspension. Cells were seeded at 1.2 10.sup.7 cells per 75-cm.sup.2 on gelatin coated plates in DMEM (Sigma) supplemented with 10% FCS (Sigma)+1 ng/ml FGF-2 for 20 min at 37° C. At that stage, only fibroblasts had time to adhere. The medium was refreshed removing all the other cell types.
[0101] RNA Sequencing
[0102] Single Cell Sequencing
[0103] Single cells were sorted by flow cytometry into individual wells of a 96-well plate containing lysis buffer (0.2% (v/v) Triton X-100 and 2 U/μl SUPERaseIn RNase Inhibitor (Invitrogen)) and stored at −80° C. Single-cell libraries for RNA sequencing were prepared using the Smart-seq2 protocol (Picelli et al., 2014), whereby 21 cycles were used for the cDNA library preamplification. Illumina Nextera XT DNA sample preparation kit and Index Kit (Illumina Chesterford UK) was used for cDNA tagmentation and indexing. Library size and quality were checked using Agilent High-Sensitivity DNA chip with Agilent Bioanalyser (Agilent Technologies Stockport UK). The pooled libraries of 96 cells were sequenced at the Babraham Institute sequencing facility on an Illumina HiSeq2500 at 100 bp per read. We used one lane per plate, resulting in 250 000 to 5 800 000 reads per sample. The quality of the raw data were assessed using FastQC [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/] for common issues including low quality of base calling, presence of adaptors among the sequenced reads or any other overrepresented sequences, and abnormal per base nucleotide percentage. FASTQ files were mapped to the H sapiens genome GRCh38 using HISAT2 (Kim et al., 2015). We removed the 22 samples (over 384) for which either most of the reads (above 97%) were mapped to the ERCC spike-in, probably representing empty wells, without cells, or for which less than 80% of reads were in genes, or for which less than 2% genes were detected. This represented 2 to 13 samples per 96 wells plate. Over the remaining 362 cells, 130 were from the lateral plate mesoderm stage (hPSC-LM) and the 232 others from hPSC-epi.
[0104] Preliminary analysis using Principal Component Analysis showed that a few cells were isolated, far from most of their grouped siblings. Those cells had less reads than others and a low gene count. We therefore removed 36 cells with less than 500 000 reads, and expressing less than 7 000 genes. The expression of genes was quantified using SeqMonk's RNA-Seq pipeline [https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/]. Raw read counts aligned with all exons were summed up for each gene.
[0105] Bulk Sequencing
[0106] Total RNA was extracted from cultures using the RNeasy mini from Qiagen. DNA contamination was removed from the samples using the DNA-free™ DNA Removal Kit from Ambion (Thermofisher). cDNA synthesis and IIlumina libraries were performed using SMARTer Stranded Total RNA-Seq Kit v2—Pico Input Mammalian kit from TAKARA. Except otherwise stated, the data from bulk cultures was produced as for the single cell libraries (see above). We sequenced the 21 libraries on two lanes. The two BAM files of each samples were then merged, resulting in 10 million to 25 million reads per sample.
[0107] The expression of genes was quantified with SeqMonk's RNA-Seq pipeline using a further DNA contamination correction since a sample exhibited homogeneous read coverage in introns and intergenic regions.
[0108] Exploration of Transcriptomes
[0109] For all data analysis except differential expression, the counts were corrected for library size (counts per million reads). Genes displaying less than 1 read per million in all samples were discarded, as were genes which expression varied by less than twofold across all samples. Counts were then normalised using the rlog function of the DESeq2 R package. hPCS-epis came from two different experiments, and we found a clear batch effect, while there was none between the cells coming from two different plates sequenced on different lane. We corrected for the culture batch effect with the combat function or the sva R package.
[0110] Principal Component Analysis were performed using the prcomp function of the stats R package. t-Distributed Stochastic Neighbor Embedding (t-SNE) was done using the rtsne R package. Parameters were explored systematically, and the better results were obtained with a perplexity of 30, and a maximum of 2000 iterations. Varying the acceleration parameter theta between 0 and 0.5 did not change the results significantly. Clusters were defined by the partitioning around medoids algorithm using the pam function of the cluster R package.
[0111] Differential expression analyses were performed with the DESeq2 package. Significance was set at a p-value adjusted for multiple testing of 0.01. Over-representation analyses were performed using Webgestalt and the non-redundant version of Gene Ontology Biological Process branch. The background for DESeq2-related enrichment was the list of all genes expressed in at least one cell. We retained all the terms with a p-value adjusted for multiple testing (FDR) under 0.05. The z-score for each GO term was computed as the difference between the number of genes—annotated with this term—upregulated in TCF21.sub.high) and those upregulated in in BNC1.sup.high divided by the square root of their sum.
[0112] Network Inference
[0113] Following the conclusions of the DREAMS Challenges analysis (Marbach, D., Costello, J., Kiffner, R., Vega, N., Prill, R., Camacho, D. & Allison, K. (2012) Wisdom of crowds for robust gene network inference. Nature Methods), we used a combination of methods based on different algorithms to infer regulatory networks. We combined the results of CLR, a mutual-information-based approach providing undirected edges, and GENIE3, a tree-based regression approach providing directed edges. Both methods were the best performers in their category at DREAMS. We applied the two methods to transcription factor gene expression coming from the bulk sequencing samples, using filtered CPM as described above. Since CLR only provides undirected edges while GENIE3 provides directed ones, the results of CLR were all mirrored with an identical score on edges in both directions. Only edges with a positive score in GENIE3's results were used. The intersect between edges present in CLR and GENIE3 results were then ranked according to the product of both algorithms' scores. This only retains edges that have either an extremely high score with one method, or consistent scores with both methods. Subnetworks were extracted using gene lists as seeds, retaining only the first neighbours above a threshold. Visualisation and analysis of the resulting networks was done using Cytoscape.
[0114] Inducible Knockdown (psOPTIkd)
[0115] Design and Annealing of shRNA Oligonucleotides
[0116] Oligonucleotides were designed by using the TRC sequence from Sigma. Hairpin A was selected as a validating hairpin as it was demonstrated to work previously in downregulating B2M expression. The oligonucleotides were annealed according to the protocol supplied by Bertero et al, (Development, 2016, 143:4405-4418) and then ligated into the cut psOPTIkd vector using T4 ligase for two hours at room temperature. The ligation mix was transformed into alpha select competent cells (BioLine) according to manufacturers' directions. The transformations were plated onto LB agar plates containing ampicillin before colony PCR screening of transformants.
[0117] Colony PCR screening of transformants
[0118] Transformants grown on LB agar plates were picked in the morning after plating for colony PCR. AAVsingiKD forward (CGAACGCTGACGTCATCAACC) and reverse (GGGCTATGAACTAATGACCCCG) primers were used; thermocycling conditions were as follows: 95° C. for five minutes, then 35 cycles of: 95° C. for 30 seconds, 63° C. for 30 s and 72° C. for 1 minute. These PCR reactions were run on a 1.5% agarose gel, with positive colonies running at 520 bp. Positive colonies were mini prepped (Qiagen mini prep kit, used according to manufacturers' directions) before Sanger sequencing through Source BioScience, using the protocol for strong hairpin structures. Miniprepped vectors which showed correct insertion of our shRNA sequence were selected for midiprep (Qiagen) and restriction digest with BamHI to check vector fragment size.
[0119] Vector Digestion
[0120] Briefly, the psOPTIkd vector (kindly supplied by Ludovic Vallier laboratory) was digested using restriction enzymes BgI II and Sal I (ThermoFisher) in FastDigest buffer (ThermoFisher) for 30 minutes at 37° C. to allow insertion of different shRNA sequences against BNC1. The digested vector product was purified with the QIAquick PCR purification kit (QIAGEN) and run on a 0.8% agarose gel before extraction using the QIAEX II Gel Extraction Kit (QIAGEN).
[0121] Gene Targeting by Lipofection
[0122] For psOPTiKD of hPSC, AAVS1 targeting was performed by lipofection. hPSCs were transfected 24-48 h following cell passaging with 4 μg of DNA and 10 μl per well of Lipofectamine 2000 in Opti-MEM media (Gibco), according to manufacturer's instructions. Briefly, cells were washed twice in PBS before incubation at room temperature for up to 45 minutes in 1 ml OptiMEM (Gibco). While cells were incubated in OptiMEM, DNA-OptiMEM mixtures were prepared. Mix 1 comprised 4 μg DNA (equally divided between the two AAVS1 ZFN plasmids, a kind gift from Ludovic Vallier laboratory, and our shRNA targeting vector) in 250 μl OptiMEM per well of a six-well plate. Mixture 2 comprised 10 μl lipofectamine in 250 μl OptiMEM per well. Mixtures 1 and 2 were prepared and mixed gently before incubation at room temperature for five minutes. 250 μl of Mixture 2 was then added to 250 μl Mixture 1 before incubation at room temperature for 20 minutes. 500 μl transfection mix of 1:1 Mixture 1:Mixture 2 was added in a drop-wise spiral manner around the well of hPSC. Cells were incubated in transfection mix at 37° C. overnight before washing in CDM-BSA II media the next day approximately 18 hours post-transfection. After 2 days, 1 μg ml.sup.−1 of puromycin was added to the CDM-BSA II culture media. Individual hPSC clones were picked and expanded in culture in CDM-BSA II following 7-10 days of puromycin selection.
[0123] Genotyping siKD hPSC Clones
[0124] Clones from gene targeting were screened by genomic PCR to verify site-specific targeting, determine whether allele targeting was heterozygous or homozygous, and check for off-target integrations of the targeting plasmid. All PCRs were performed using 100 ng of genomic DNA as template in a 25 μl reaction volume using LongAmp Taq DNA Polymerase (NEB) according to manufacturers' instructions, including 2.5% volume dimethyl sulphoxide (DMSO). DNA was extracted using the genomic DNA extraction kit from Sigma Aldrich according to manufacturers' instructions.
[0125] Inducible BNC1 Knockdown
[0126] One homozygous-targeted clone for each vector transfection was selected for subsequent differentiation into hPSC-epi with or without the addition of 1 μg/ml tetracycline (Sigma) to culture media with the aim of mediating BNC1 knockdown. hPSC-epi was successfully differentiated from each clone in the presence and absence of tetracycline. qPCR analysis indicated that clone 1Ei had a very pronounced reduction in BNC1. Another clone was generated with the vector BNC1-E (1E17) and showed the same level of efficiency at downregulating BNC1.
[0127] Retroviral Transduction
[0128] Production of the Lentiviral Particles
[0129] The lentiviral particle supernatant was obtained from transfection of 293T cells with the lentiviral vector of interest using Mirus TransIT-LT1 transfection reagent and the HIV-1 helper plasmid psPAX2 (Addgene 12260) and HIV-1 envelope plasmid pMD2.G (Addgene 12259).
[0130] Production of Fluorescent hPSC Lines
[0131] While splitting, the H9 cells were transduced with a lentivirus expressing a EGFP reporter under the control of Ef-1α promoter. We used the lentiviral vector PLVTHM (Addgene #12247).
[0132] Immunofluorescence
[0133] Primary Antibodies were as Follows:
[0134] Unconjugated or Alexa Fluor-488 conjugated Rabbit Anti-WT1 [CAN-R9(IHC)-56-2] (Abcam, ab89901 or ab202635; 1/100); Rabbit anti-BNC1 (Atlas Antibodies, HPA063183; 1/200); Rabbit anti-TCF21 (Atlas Antibodies, HPA013189; 1/100); Mouse Anti-THY1 clone 5E10 (ThermoFisher, 14-0909-82; 1/100); Mouse Anti-CNN1 (Sigma, C2687; 1/1000); Rabbit Anti-periostin (Abcam, ab14041; 1/500); Mouse anti-synaptotagmin 4 (Abcam, ab57473; 1/100)
[0135] Cultured Cells
[0136] Cells were fixed using 4% PFA, permeabilised and blocked with 0.5% Triton-X100/3% BSA/PBS for 60 min at room temperature. Unless otherwise stated, primary antibody incubations were performed at 4° C. overnight and Alexa Fluor-tagged secondary antibodies (Invitrogen) were applied for 1 hour at room temperature. Nuclei were counterstained with DAPI (10 μg/ml, Sigma).
[0137] For the double stain TCF21/WT1 and BNC1/WT1, TCF21 (or BNC1) and WT1 were detected sequentially. Anti-TCF21 or anti-BNC1 were first applied overnight and detected with a Rhodamin-FAB fragment goat anti-Rabbit IgG (H+L) from Abcam during 1 hour at RT. Then the anti-WT1 conjugated to alexa Fluor-488 was incubated for 2 hours at RT. For the double stain THY1/WT1 or THY1/BNC1, the cells were first blocked without permeabilisation and THY1 was first detected with the mouse anti-THY1 followed by incubation with anti-mouse conjugated antibody. The cells were briefly post-fixed in PFA 4% and then permeabilised with 0.5% Triton-X100/3% BSA/PBS before being incubated as normally with anti-WT1 or anti-BNC1.
[0138] Images were acquired on a Zeiss LSM 700 confocal microscope and analysed with ImageJ software. For the quantification of the number of GFP.sup.+ cells also positive for CF or SMC markers, the number of GFP.sup.+ cells was first measured in the green channel. Then the double positive or double negative (depending on the size of the populations) were counted using the merge images. When few GFP.sup.+ cells were present in the image, the cells were manually counted using the Analyse ImageJ pluggin called ‘cell counter’ (https://imagej.nih.gov/ij/plugins/cell-counter.html). When too many GFP.sup.+ cells were present to count manually, we used the function ‘Analyse particles’ after adjustment of the threshold and binary transformation of the image. The double positive or double negative were counted using ‘cell counter’.
[0139] Cryostat Sections
[0140] Foetal human heart was harvested as described for primary human culture of epicardium. The whole heart was snap-frozen in liquid nitrogen and stored at −80C before sectioning in a cryostat after embedding in OCT. 10 μm thick sections were collected onto SuperfrostPlus slides and stored at −80° C. until staining. Staining was performed as described above.
[0141] THY1 Flow Cytometry
[0142] Each sample of 10{circumflex over ( )}6 cells was divided into two tubes. One tube received a mouse isotype control antibody and the other tube was incubated with the mouse anti-THY1 antibody, clone 5E10 (both at 5 μg/ml final concentration) for 1 hour at RT. After a rinse in 1×PBS, the cells were resuspended in chicken anti-mouse 488 or donkey anti-mouse 647 antibody diluted 1 in 500.
[0143] Quantitative Real-Time Polymerase Chain Reaction
[0144] Total RNA was extracted using the RNeasy mini kit (Qiagen). cDNA was synthesised from 250 ng RNA using the Maxima First Strand cDNA Synthesis kit (Fermentas). Quantitative real-time polymerase chain reaction (qRT-PCR) reaction mixtures were prepared with SYBR green PCR master mix (Applied Biosystems) and run on the 7500 Fast Real-time PCR system by the quantitative relative standard curve protocol against standards prepared from pooled cDNA from each experiment. Melt curves were checked for each experimental run. CT values were normalised to housekeeper genes porphobilinogen deaminase (PBGD) or GAPDH. Primers were supplied by Sigma Aldrich and sequences were as follows:
TABLE-US-00001 GAPDH Forward: AACAGCCTCAAGATCATCAGC; GAPDH Reverse: GGATGATGTTCTGGAGAGCC; WT1 Forward: CACAGCACAGGGTACGAGAG; WT1 Reverse: CAAGAGTCGGGGCTACTCCA; TCF21 Forward: TCCTGGCTAACGACAAATACGA; TCF21 Reverse: TTTCCCGGCCACCATAAAGG; BNC1 Forward: GGCCGAGGCTATCAGCTGTACT; BNC1 Reverse: GCCTGGGTCCCATAGAGCAT
[0145] Western Blotting
[0146] To assess BNC1 levels by immunoblotting, lysate from one confluent well of hpsc-epi cells in a six-well plate was separated by SDS PAGE on an 8% acrylamide gel and transferred overnight onto a PVDF membrane. The protein was detected using a rabbit anti-BNC1 antibody (Atlas antibodies) at 1 in 100 dilution followed by chemiluminescence detection via HRP conjugated secondary antibody, diluted 1 in 10,000 (cat no. 7074S, NEB). Mouse anti-α/βtubulin antibody (Cell Signaling Technology) was used at 1 in 1000 as the housekeeping protein.
Example 1: Molecular Cell Heterogeneity in hPSC-Epi and Human Foetal Epicardial Explant Culture
[0147] First we determined the extent of epicardial marker heterogeneity in hPSC-epi cultures. Since both antibodies suitable for the detection of TCF21 and WT1 in human cells were rabbit in origin, we were previously limited to a flow cytometry strategy in which the presence of double positive cells in the hPSC-epi was indirectly estimated Oyer et al., 2015). In the present study, we differentiated the hPSC-epi according to the protocol previously published (
Example 2: scRNA-Seq Revealed WT1, TCF21 and BNC1 as Indicators of the hPSC-Epi Functional Heterogeneity
[0148] Using a Smart-Seq2 based protocol previously used to analyse mouse embryonic cells (Scialdone et al., 2016), we obtained high quality transcriptomes for a total of 232 hPSC-epi single cells. We examined the variation of TCF21 and WT1 expression in the population using scRNA-seq. As we were using a monolayer of cells obtained from a simple in vitro differentiation protocol, we expected subtle levels of heterogeneity in the sequencing data. Indeed, in a principal component analysis, the first two components only absorbed 2.5 and 2.4% of the variance respectively. Moreover, the subsequent Eigen-values were much smaller, and 195 components were needed to absorb 90% of the variance. The strongest loadings of TCF21 and WT1 were on the second component (PC2). Over-representation analyses using the 100 genes with strongest negative and positive PC2 loadings defined two different molecular signatures on the TCF21 and WT1 sides. Among the top genes on the TCF21 side (
[0149] The distribution of expression for TCF21, WT1 and BNC1 was bimodal, with a large population of cells showing no expression at all (106, 154 and 45 cells respectively) (
[0150] BNC1 and TCF21 are not just markers of two sub-populations; they also reflect the state of the entire transcriptome. We computed the Pearson correlation of BNC1, WT1 and TCF21 expression with all the expressed and variable genes. Comparing these correlations, we observe that if the expression of a gene correlates with TCF21 expression, it does not correlate with BNC1 expression (Pearson correlation of −0.454). On the contrary, if the expression of a gene correlates with that of WT1, it also tends to correlate with BNC1 expression (Pearson correlation of 0.293).
Example 3: The hPSC-Epi is Composed of a BNC1 and a TCF21 Population
[0151] Cell subpopulations of hPSC-epis cannot be solely based on the expression of TCF21 and BNC1 due to dropouts—genes which expression is measured as 0 not because there is no mRNA, but because the mRNA was not reverse-transcribed —. Instead we generated cell similarities using t-SNE, exploring different parameter values. The lowest Kullback-Leibler divergence (a measure of how well the t-SNE distances represents the actual distances in genome space) corresponded with final distributions in 3 groups of cells. We attributed cells to each group using a partition around medoid approach, resulting in three clusters of different sizes (146, 62 and 24 cells,
Example 4: Molecular Signature of BCN1.SUP.high .and TCF21.SUP.high .Populations
[0152] Differential gene expression analysis revealed that 2494 genes were differentially expressed between the largest clusters (
[0153] The top transcription factors, plasma membrane proteins and secreted factors upregulated in BNC1.sup.high and TCF21.sup.high populations are listed in Table 1. Some of these genes encode for proteins which had already been flagged in the literature as potential regulators of epicardial function in the embryonic or adult diseased heart. The most overexpressed diffusible factor in BNC1high cells was Nephronectin (NPNT). Nephronectin is the functional ligand of Integrin alpha-8/beta-1, which is overexpressed in the TCF21.sup.high population, suggesting cross-talk between the two populations.
TABLE-US-00002 TABLE 1 differentially expressed transcription factors, plasma membrane, and secreted proteins (only the most significant hits with a mean expression above a given level are displayed, ranked by increasing adjusted p-value). Upregulated in BNClhigh Upregulated inTCF21high Transcription 113 (BNC1, TOX3, MEOX1,1D4, 67 (HOPX, ZNF469, NROB1, factors ID2, NFATC2, ARNT2 SMAD6, TCF21, TCF19, NR4A1, TBX3, (base mean > 10) MYCN, WT1, DPF3, ID1, ELF3, MYBL2, KLF7, AHR, MBNL3, ID3, MAF, TBX18, ASH2L, ETS1, ETV4, HIF1A, ZNF564, SOX6, ZNF415, ZNF624, TSC22D3, JUNB, MLLT11, ZFPM2, ZNF20, CUX1, NCOR2 NFKBIZ, MYC, HOXA13, . . . ) HOXB9, ZNF167, CAMTA2 . . . ) Plasma membrane 356 (PODXL, LRP2, ITGA6, 225 (THYl, S1PR3, PDGFRA, proteins TMEM98, CDH3, CDH1, BAMBI, PLD3, ADAM12, (base mean > 50) LEPROTL1, SLC34A2, TGFBR3, STRA6, SLC12A8, PKHD1L1, AQP1,GPNMB, BEST1, SMIM3, NRP1, ITGA1, SLC7A7, CNTN6, CXADR, TEK, IGDCC4, CD99, ABCA1, SLC4A8, PTPRF, ATP7B, CD9, NDRG2, IFITM1, ACKR3, SLC2A1, SLC16A3, ACVR2A, . . . ) OLR1,TMEM88, S100A10, CD82, PARM1, PLXNB2, APLP2 . . . ) Secreted factors 229 (SERPINE3, SEMA3E, 187 (THBSI, TGFBI, FN1, (base mean > 50) NPNT, EDN3, PLTP, OLFML1, DKKI, FRZB, SEMA3C, SBSPON, FREM1, IGFBP3, COL1A1, MFGE8, APLP2, GAS6, LAMA5, MGP, LAMB1, COL21A1, FBN2, CXCL14, SERPINE2, VCAN, LAMC1 . . . ) LUM, COL3A1, MFAP4, CHI3L1, ADAM12, COL6A2, PRSS23, CCL2 . . . )
Example 5: Gene Ontology Analysis Predicts Different Functions for BNC1.SUP.high .and TCF21.SUP.high .Populations
[0154] Gene Ontology (GO) over-representation analyses suggested a different phenotypic signature for each population, favouring migration and muscle differentiation for BNC1.sup.high and adhesion/angiogenesis for TCF21.sup.high. Using the genes differentially expressed between the two populations we ran GO over-representation analyses using Web Gestalt.
Example 6: THY1 is a Membrane Marker of the TCF21.SUP.high .Population Enriched in CF Potential
[0155] In order to separate the two populations, we searched for specific membrane-associated proteins and cell surface receptors. THY1 was 13 times more expressed in TCF21.sup.high cells (Table 1). Immunofluorescence confirmed that the distribution of the protein THY1 was indeed negatively-correlated with WT1 in our system (Data not shown) and to WT1 and BNC1 in primary human foetal epicardial explants (Data not shown). As THY1 had not been reported before in the epicardium, we validated its expression on cryosections of human embryonic hearts at 8 weeks pc. The immunofluorescence confirmed a heterogeneous expression of THY1 in the human developing epicardium (Data not shown). We used an anti-THY1 antibody to magnetically separate the two epicardial populations from constitutive GFP-expressing (GFP+) hPSC-epi and analyse their capacity to respond to differentiation signals. To analyse the developmental potential of each population under normal conditions, we mixed each fraction with non-fractionated GFP-negative (GFP−) hPSC-epi cells in equal proportions and recorded the exact percentage of GFP.sup.+ cells at DO by flow cytometry. The two mixes made of [unfractionated GFP-hPSC-epi and GFP.sup.+ THY1.sup.+hPSC-epi] or [GFP− hPSC-epi and GFP.sup.+ THY1− hPSC-epi] were separately cultured in differentiation medium for SMC and CF. The SMC and CF differentiation media, established previously (Iyer et al., 2015), were made of CDM supplemented with TGFβ and PDGF-BB or VEGFB and FGF-2 respectively. When subjected to SMC differentiation, the proportion of GFP.sup.+ cells remained unchanged with both THY1 fractions (
[0156] Furthermore, we immunostained the cultures for synaptotagmin 4 (SYT4) and periostin (POSTN) (Data not shown). SYT4 has been identified in our in vitro differentiation system as up-regulated Furthermore, we immunostained the cultures for synaptotagmin 4 (SYT4 and periostin (POSTN) (Data not shown). SYT4 has been identified in our in vitro differentiation system as up-regulated in the hPSC-epi CF compared to the hPSC-epi or hPSC-epi SMC (Data not shown). POSTN is a well-established marker of CF. To assess if the surviving GFP.sup.+ hPSC-epi cells coming from the THY1.sup.− origin could acquire a CF signature, we quantified amongst the GFP.sup.+ cells, the % of SYT4 or POSTN positive cells. There were equivalent numbers of SYT4.sup.+ regardless of THY1 status (
Example 7: A Core Epicardial Transcriptional Network is Coordinated by BNC1, TCF21 and WT1
[0157] Network inference methods applied to our system positioned BNC1 as a master regulator, sitting on top of an epicardial regulatory network. To better understand the implications of BNC1, TCF21 and WT1 in the regulation of the epicardial development and function, we inferred a directed transcriptional regulatory network using a combination of methods, CLR and GENIE3, as described in the materials and methods. The variation in the system was generated by using the bulk sequencing transcriptomic data from different stages of cell development including SMC differentiated from hPSC-derived lateral plate mesoderm (pre-epicardial stage in our system), hPSC-epi, hPSC-epi-CF and hPSC-epi-SMC. We retained the top 100 predicted functional interactions between any TF and each of BNC1, TCF21 and WT1. BNC1 and TCF21 shared 3 interactors, BNC1 and WT1 shared 17 interactors, and WT1 and TCF21 shared 21 interactors. 11 TFs are interacting with the three baits. The top 100 influences involving TCF21 showed a balanced picture with 48 influences originating from TCF21, and 52 targeting TCF21, many influences being bidirectional. The image was similar for WT1. On the contrary 68% of influences involving BNC1 originated from this gene (
TABLE-US-00003 TABLE 2 top 100 influences between one of TCF21, WT1, BNC1 and any transcription factor (genes are ranked by decreasing likelihood of influences as computed by the combination of CLR score and GENIE3 rank). Influencing Influenced by BNC1 ZFPM2, GATA6, ZNF160, ZNF35, ZNF777, AR, SMAD9, ZFPM2, ZFPM1, PURB, TCF3, ZFHX3, TBX2, SOX4, RARB, IRF9, CEBPB, SMAD6, GATA6, PHB, GCFC2, ZNF428, ELF3, ZNF48, ZBED4, CAMTA2, E2F3, ZNF791, NCOA4, NFE2L2, ZNF644, MEF2A, ARNT, ZFPM1, TCF7L1, ZBTB20, RBM22, AEBP1, USF1, MTA2, MAFB, TP53, NCOA3, SMAD9, ZNF385A, TEAD1, HOXC8, SMARCC1, PURA, HIVEP1, NR2F6, ETV1, ZNF423, DPF3, ZFP36L2, SMAD3, SOX4, ZNF114, ZNFXI, ZBED4, ZBTB47, HES6, ZNF81, PHB, ZNF574, TCF4, SNAI2, ZNF627, SALL4, ZSCAN2, MTF1 SMARCC1, WT1, THAP6, PURA, GLIS2, OSR1, SMAD7, NFE2L2, EPASI, ZNF114, SMARCA4, ZFHX4, ZBTB4, ZNF275, NKX3-2, EZH2, HIC1, FOXP1, ZHX1, CUX1, PKNOX2, CSRNP2, ZNF708, RFXANK, ZNF608, YEATS4, PHTF1, IFI16, ZBTB33 WTI TCF21, ZNF778, ARNT, GATA3, CUX1, ZNF83, NROB1, GATA6, ZNF778, HLX, TCF21, ISX, SMAD6, MLLT11, TFE3, AEBP1, SMAD9, ZNF616, ZNF83, NFATC4, NR2C2, ISX, IRF9, L3MBTL2, MTA2, IRX6, ZBTB20, NR2F6, SMAD9, GAT A3, ID2, MTA2, ZSCAN30, CREM, HMGA2, ZC3H6, ZFPM1, ZNF827, ZFPM2, RFXANK, IRX6, HMGA2, ZFPM1, ZNF616, TSHZ3, ZFHX3, CBFB, ZNF514, ARNT2, MLLT11, ZFHX3, CEBPD, BNC1, ZNF783, ZBTB4, SMAD7, GATA6, ZNF320, RXRB, EZH1, MEISI, ANKZF1, PHB, ARNT, GCFC2, ZNF160, HLX, TOX3, GLIS2, NROB1, ZSCAN18, ETV1, HIC1, RERE, ZNF85, L3MBTL2, PPARA, ZNF846, MAFB, ID4, ZP41, THAP6, ZNF644, ZBTB1, DPF3 RBM22, SALL1, FOXO3, EZH1, CREM, ZNF514, ZNF428, THAP6, DPF3, IRF1, AHRR, RXRB, ZNF248, ELF1 TCF21 MEISI, ZNF778, TSHZ3, CUX1, NR1D2, GATA3, GATA3, MEISI, WTI, HLX, IRF9, PHB, SHZ3, IRF9, WTI, ZNF616, ZEB2, IRF1, ARID5B, NROBI, ARID5B, ZFHX4, CREM, NFATC4, ZBTB20, ZNF827, ETV1, CREM, RXRB, L3MBTL2, ZNF827, MTA2, ZBTB20, MLLT11, ZNF616, PHB, NR2C2, ZNF83, AHRR, PHF5A, ARNT, ETV1, TRPS1, NR2C2, FOSL2, ARNT, DDIT3, AEBP1, IFI16, MLLT11, ZC3H6, ZNF337, L3MBTL2, ZNF83, ZEB2, STAT6, AEBP1, SMAD9, ZNF277, TRPS1, ZNF787, SALL1, ATF4, NOC4L, ZNF460, EGR2, HIC1, SOX9, ZNF248, ETV5, ZNF581, ZNF706, JUNB, NFATC4, ZNF639, AHRR, ZKSCAN1, SMAD9, GABPB2, ETV5, HIC1, ZKSCAN1, ZNF133, ZFP64, GATA4, ZNF625 ATRX, HOXB3, NFAT5, CEBPB, ZNF25, JUN, ZNF581, ZFPM1, ID2, BCL11A, LRRFIP2, ZNF70, ZNF641, JUNB
Example 8: BNC1 is Necessary for Epicardial Heterogeneity
[0158] To investigate the function of BNC1 in hPSC-epi, we generated hPSCs which were genetically modified with tetracycline (TET)-inducible shRNA for BNC1 knock-down. The cells were treated with TET from the last day of the lateral plate mesoderm stage and during the entire differentiation to hPSC-epi. QPCR, Western-blotting and immunofluorescence showed robust BNC1 silencing under TET treatment (more than 90% by RT-PCR) (
[0159] We also tested the effect of BNC1 knock-down in human foetal samples by transfecting primary epicardial cultures derived from foetuses over 10 weeks with small interfering RNA. In line with the results obtained in the hPSC-epi, the silencing of BNC1 induced a significant (p=0.02) five-fold increase in in TCF21 expression (
[0160] In conclusion in the absence of BNC1, the hPSC-epi behaves as a TCF21.sup.high population. Therefore, by suppressing the expression of a single transcription factor, we have modified the cell heterogeneity of the hPSC-epi. Thus we are able to generate a pure TCF21.sup.high epicardial population, without requiring sorting methods, as an important step to generate fine-tuned sub-populations of epicardial cells with more specific biological activities.
Example 8: Epicardial Subtype Isolation
[0161] Both the anti-THY1 antibody and anti-PODXL antibody based selection processes are improved further by the use of high stringency depleting columns. Previously, THY1.sup.lowPODXL.sup.low (double-positive) epicardial cells, which express both markers at a low frequency, were present in the negatively selected cell population due to low affinity interactions with the low stringency depleting column. The use of high stringency depleting columns mitigates this, as the double-positive cells are retained in the positively selected population, producing a pure population of negatively selected cells. Where an anti-PODXL antibody is combined with a high-stringency depleting column, a pure population of PODXL-(i.e. THY1+ and TCF21.sup.high) cells, absent of antibody activation can be isolated. Where an anti-THY1 antibody is combined with a high-stringency depleting column, a pure population of THY-cells (i.e. PODXL+ and BNC1.sup.high), absent of antibody activation can be isolated.
[0162]
Example 9: To Test the Ability of the Two Specified Subpopulations to Support Endothelial Network Formation
[0163] We will seed HUVECs together with the sorted epicardial subtypes on Matrigel and measure network formation as previously reported (Bargehr et al. Stem Cells Trans Med 2016). We will also test the ability of the sorted epicardial subtypes to support angiogenesis in a chick chorioallantoic membrane assay (Bargehr et al Nature Biotech 2019).
[0164] We expect that different subpopulations of epicardial cells will have different effects on endothelial network formation, survival and mural cell recruitment, showing the utility of the separation protocol for developing better cell therapy reagents.
[0165] Experiment 2. To Determine the Ability of Sorted Epicardial Subtypes to Improve Cardiomyocyte Function in 3D-Engineered Heart Tissues (3D-EHT) In Vitro.
[0166] Using our previously described methods (Bargehr et al Nature Biotech 2019) we will seed human pluripotent stem cell derived cardiomyocytes in a collagen gel together with epicardial cell subtypes. The constructs will be allowed to mature and then measured for contraction, Ca2+ flux, cardiomyocyte maturity and electrical integration.