INHIBITION OF BMI1 ELIMINATES CANCER STEM CELLS AND ACTIVATES ANTITUMOR IMMUNITY
20230233566 · 2023-07-27
Assignee
Inventors
Cpc classification
A61K31/519
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/1135
CHEMISTRY; METALLURGY
A61K39/3955
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
A61K31/4406
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
A61K31/519
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61K31/4406
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure reports that pharmacological or genetic inhibition of Moloney murine leukemia virus insertion site 1 (BMI1) not only helped to eliminate BMI1+ cancer stem cells (CSCs), but can also augment PD1 blockade by strongly induced tumor cell-intrinsic immune responses by recruiting and activating CD8+ T cells. Taken together, the results indicate that in addition to purging CSCs, targeting BMI1 would enable immune checkpoint blockade to inhibit metastatic tumor growth and prevent tumor relapse by activating cell-intrinsic immunity.
Claims
1. A method of treating cancer in a patient in need thereof, comprising the steps of i) administering to said patient an agent that blocks signaling through programmed cell death protein 1 (PD-1); and ii) administering to said patient an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1).
2. The method of claim 1, wherein said cancer is head and neck squamous cell carcinoma, melanoma, lymphoma, leukemia, breast cancer, ovarian cancer, colon cancer, cervical cancer, prostate cancer, nasopharyngeal carcinoma, non-Hodgkin lymphoma, small cell lung cancer, or non-small cell lung cancer, or any combination thereof.
3. The method of claim 1, wherein said method reduces metastasis of said cancer in said patient.
4. The method of claim 1, wherein said method reduces the number of BMI-1.sup.+ cancer stem cells.
5. The method of claim 1, wherein said agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1.
6. The method of claim 5, wherein said anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, cemiplimab, avelumab, durvalumab, and atezolizumab.
7. The method of claim 5, wherein said ligand of PD-1 is PD-L1 or PD-L2.
8. The method of claim 1, wherein said agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA).
9. The method of claim 8, wherein said BMI-1 inhibitor is PTC209, PTC596, PRT4165, PTC-209 HBr, or PTC-028.
10. The method of claim 1, wherein said agent of (i) is administered to the patient before, after, or concurrently as said agent of (ii) is administered to the patient.
11. A method of increasing anti-tumor T cell activities in a patient having a cancer, comprising the steps of i) administering to said patient an agent that blocks signaling through programmed cell death protein 1 (PD-1); and ii) administering to said patient an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1).
12. The method of claim 11, wherein said cancer is head and neck squamous cell carcinoma, melanoma, lymphoma, leukemia, breast cancer, ovarian cancer, colon cancer, cervical cancer, prostate cancer, nasopharyngeal carcinoma, non-Hodgkin lymphoma, small cell lung cancer, or non-small cell lung cancer, or any combination thereof.
13. The method of claim 11, wherein said anti-tumor T cell activities are mediated by CD8.sup.+ T cells.
14. The method of claim 11, wherein said agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1.
15. The method of claim 14, wherein said anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, cemiplimab, avelumab, durvalumab, and atezolizumab.
16. The method of claim 14, wherein said ligand of PD-1 is PD-L1 or PD-L2.
17. The method of claim 11, wherein said agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA).
18. The method of claim 17, wherein said BMI-1 inhibitor is PTC209, PTC596, PRT4165, PTC-209 HBr, or PTC-028.
19. The method of claim 11, wherein said agent of (i) is administered to the patient before, after, or concurrently as said agent of (ii) is administered to the patient.
20. A method of reducing the number of cancer stem cells in a cancer patient in need thereof, comprising the steps of i) administering to said patient an agent that blocks signaling through programmed cell death protein 1 (PD-1); and ii) administering to said patient an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1).
21. The method of claim 20, wherein said cancer is head and neck squamous cell carcinoma, melanoma, lymphoma, leukemia, breast cancer, ovarian cancer, colon cancer, cervical cancer, prostate cancer, nasopharyngeal carcinoma, non-Hodgkin lymphoma, small cell lung cancer, or non-small cell lung cancer, or any combination thereof.
22. The method of claim 20, wherein said cancer stem cells are BMI-1.sup.+.
23. The method of claim 20, wherein said agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1.
24. The method of claim 23, wherein said anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, cemiplimab, avelumab, durvalumab, and atezolizumab.
25. The method of claim 23, wherein said ligand of PD-1 is PD-L1 or PD-L2.
26. The method of claim 20, wherein said agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA).
27. The method of claim 26, wherein said BMI-1 inhibitor is PTC209, PTC596, PRT4165, PTC-209 HBr, or PTC-028.
28. The method of claim 20, wherein said agent of (i) is administered to the patient before, after, or concurrently as said agent of (ii) is administered to the patient.
29. A composition for treating cancer in a patient, comprising (i) a composition of an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) a composition of an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1).
30. The composition of claim 29, wherein said agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1.
31. The composition of claim 30, wherein said anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, cemiplimab, avelumab, durvalumab, and atezolizumab.
32. The composition of claim 30, wherein said ligand of PD-1 is PD-L1 or PD-L2.
33. The composition of claim 29, wherein said agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA).
34. The composition of claim 33, wherein said BMI-1 inhibitor is PTC209, PTC596, PRT4165, PTC-209 HBr, or PTC-028.
35. A therapeutic combination of compositions formulated for treating cancer in a patient, comprising (i) a composition of an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) a composition of an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1).
36. The therapeutic combination of compositions of claim 35, wherein said agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1.
37. The therapeutic combination of compositions of claim 36, wherein said anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, cemiplimab, avelumab, durvalumab, and atezolizumab.
38. The therapeutic combination of compositions of claim 36, wherein said ligand of PD-1 is PD-L1 or PD-L2.
39. The therapeutic combination of compositions of claim 35, wherein said agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA).
40. The therapeutic combination of compositions of claim 39, wherein said BMI-1 inhibitor is PTC209, PTC596, PRT4165, PTC-209 HBr, or PTC-028.
41. The compositions of claim 29 or 35 for use in treating cancer in a patient.
42. The compositions for use according to claim 41, wherein the cancer is head and neck squamous cell carcinoma, melanoma, lymphoma, leukemia, breast cancer, ovarian cancer, colon cancer, cervical cancer, prostate cancer, nasopharyngeal carcinoma, non-Hodgkin lymphoma, small cell lung cancer, non-small cell lung cancer, or any combination thereof.
43. The compositions for use according to claim 41, wherein treatment with said composition reduces metastasis of said cancer in said patient.
44. The compositions for use according to claim 41, wherein treatment with said composition reduces the number of BMI-1.sup.+ cancer stem cells in said patient.
45. The compositions for use according to claim 41, wherein said composition of (i) is administered to the patient before, after, or concurrently as said composition of (ii) is administered to the patient.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present disclosure shows that combination treatment of anti-PD1 and cisplatin significantly enriched BMI1.sup.+ cancer stem cells (CSCs) in head and neck squamous cell carcinoma (HNSCC) by in vivo lineage tracing while inhibiting HNSCC growth in a mouse model of HNSCC, suggesting that BMI1.sup.+ CSCs formed a fundamental basis for HNSCC relapse. In contrast, pharmacological and genetic inhibition of BMI1 eliminated BMI1.sup.+ CSCs and enabled PD1 blockade therapy, resulting in potent inhibition of metastatic HNSCC and prevention of HNSCC relapses. Unexpectedly, BMI1 inhibition strongly induced tumor cell-intrinsic immune responses by recruiting and activating CD8+ T cells in addition to eliminating BMI1.sup.+ CSCs. Mechanistically, BMI1 inhibition induced CD8+ T cell-recruiting chemokines by two interrelated mechanisms: 1) stimulating the cGAS-STING signaling to activate IRF3-mediated transcription and 2) erasing repressive H2A ubiquitination on their promoters. Taken together, these results indicate that in addition to purging CSCs, targeting BMI1 would enable immune checkpoint blockade to inhibit metastatic tumor growth and prevent tumor relapse by activating cell-intrinsic immunity.
[0035] As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0036] As used herein, the terms “treat”, “treatment”, or “therapy” (as well as different forms thereof) refer to therapeutic treatment, including prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change associated with a disease or condition. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of the extent of a disease or condition, stabilization of a disease or condition (i.e., where the disease or condition does not worsen), delay or slowing of the progression of a disease or condition, amelioration or palliation of the disease or condition, and remission (whether partial or total) of the disease or condition, whether detectable or undetectable. Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in which the disease or condition is to be prevented.
[0037] As used herein, the terms “component,” “composition,” “formulation”, “composition of compounds,” “compound,” “drug,” “pharmacologically active agent,” “active agent,” “therapeutic,” “therapy,” “treatment,” or “medicament,” are used interchangeably herein, as context dictates, to refer to a compound or compounds or composition of matter which, when administered to a subject (human or animal) induces a desired pharmacological and/or physiologic effect by local and/or systemic action. A personalized composition or method refers to a product or use of the product in a regimen tailored or individualized to meet specific needs identified or contemplated in the subject.
[0038] The terms “subject,” “individual,” and “patient” are used interchangeably herein, and refer to an animal, for example a human, to whom treatment with a composition or formulation in accordance with the present invention, is provided. The term “subject” as used herein refers to human and non-human animals. The terms “non-human animals” and “non-human mammals” are used interchangeably herein and include all vertebrates, e.g., mammals, such as non-human primates. The compositions described herein can be used to treat any suitable mammal, including primates, such as monkeys and humans, or rodents such as rats and mice. In one embodiment, the mammal to be treated is human. The human can be any human of any age. In an embodiment, the human is an adult. In another embodiment, the human is a child. The human can be male, female, pregnant, middle-aged, adolescent, or elderly.
[0039] Effective doses of the compositions of the present invention, for treatment of conditions or diseases vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Usually, the patient is a human, but non-human mammals including transgenic mammals can also be treated. Treatment dosages may be titrated using routine methods known to those of skill in the art to optimize safety and efficacy. The pharmaceutical compositions of the invention thus may include a “therapeutically effective amount.” A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of a molecule may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the molecule to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the molecule are outweighed by the therapeutically beneficial effects.
[0040] Furthermore, a skilled artisan would appreciate that the term “therapeutically effective amount” may encompass total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
[0041] The amount of a compound of the invention that will be effective in the treatment of a particular disorder or condition, including cancer, will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test bioassays or systems.
[0042] Moreover, suitable doses may also be influenced by permissible daily exposure limits of any compound included in a formulation or method as described herein. Such limits are readily available, including, for example, from industry guidance recommendations provided periodically from the U.S. Food and Drug Administration, and the evaluation of these limits are within the knowledge and understanding of one of ordinary skill in the art.
[0043] The composition of the invention may be administered only once, or it may be administered multiple times. For multiple dosages, the composition may be, for example, administered three times a day, twice a day, once a day, once every two days, twice a week, weekly, once every two weeks, or monthly.
[0044] It is to be noted that dosage values may vary with the type and severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition.
[0045] As used herein, the term “administering” refers to bringing in contact with a compound of the present invention. Administration can be accomplished to cells or tissue cultures, or to living organisms, for example humans. In one embodiment, the present invention encompasses administering the compositions of the present invention to a human subject.
[0046] In one embodiment, any of the therapeutic or prophylactic drugs or compositions described herein may be administered simultaneously. In another embodiment, they may be administered at different time point than one another. In one embodiment, they may be administered within a few minutes of one another. In another embodiment, they may be administered within a few hours of one another. In another embodiment, they may be administered within 1 hour of one another. In another embodiment, they may be administered within 2 hours of one another. In another embodiment, they may be administered within 5 hours of one another. In another embodiment, they may be administered within 12 of one another. In another embodiment, they may be administered within 24 hours of one another.
[0047] In one embodiment, any of the therapeutic or prophylactic drugs or compositions described herein may be administered at the same site of administration. In another embodiment, they may be administered at different sites of administration.
[0048] In one embodiment, the present disclosure provides a method of treating cancer in a patient in need thereof, comprising the steps of (i) administering to the patient an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) administering to the patient an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1). In one embodiment, the agent in step (i) is administered to the patient before the agent in step (ii) is administered to the patient. In another embodiment, the agent in step (i) is administered to the patient after the agent in step (ii) is administered to the patient. In yet another embodiment, the agent in step (i) is administered to the patient concurrently with the agent in step (ii).
[0049] Representative examples of cancers that can be treated by the above method include, but are not limited to, carcinoma, sarcoma, lymphoma, leukemia, germ cell tumor, blastoma, chondrosarcoma, Ewing's sarcoma, malignant fibrous histiocytoma of bone, osteosarcoma, rhabdomyosarcoma, heart cancer, brain cancer, astrocytoma, glioma, medulloblastoma, neuroblastoma, breast cancer, medullary carcinoma, adrenocortical carcinoma, thyroid cancer, Merkel cell carcinoma, eye cancer, gastrointestinal cancer, colon cancer, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, hepatocellular cancer, pancreatic cancer, rectal cancer, bladder cancer, cervical cancer, endometrial cancer, ovarian cancer, renal cell carcinoma, prostate cancer, testicular cancer, urethral cancer, uterine sarcoma, vaginal cancer, head cancer, neck cancer, nasopharyngeal carcinoma, hematopoietic cancer, non-Hodgkin lymphoma, skin cancer, basal-cell carcinoma, melanoma, small cell lung cancer, non-small cell lung cancer, or any combination thereof.
[0050] In one embodiment, the above method can reduce cancer metastasis in the patient. In another embodiment, the above method reduces the number of BMI-1+ cancer stem cells in the patient.
[0051] In one embodiment, the agent that blocks signaling through programmed cell death protein 1 (PD-1) is an anti-PD-1 antibody. The PD-1 pathway has received considerable attention due to its role in eliciting immune checkpoint response of T cells, resulting in tumor cells capable of evading immune surveillance and being highly refractory to conventional chemotherapy. Application of anti-PD-1/PD-L1 antibodies as checkpoint inhibitors is rapidly becoming a promising therapeutic approach in treating tumors. The present disclosure encompasses anti-PD-1 antibodies that are currently in use, in development, or those that will be developed in the future. Examples of anti-PD-1 antibodies include, but are not limited to, nivolumab (OPDIVO), pembrolizumab (KEYTRUDA), cemiplimab (LIB TAYO), avelumab (BAVENCIO), durvalumab (IMFINZI), and atezolizumab (TECENTRIQ).
[0052] In another embodiment, the agent that blocks signaling through PD-1 is an antibody that binds a ligand of PD-1. The present disclosure encompasses ligands of PD-1 that are currently known or those that will be discovered in the future. The present disclosure also encompasses anti-PD-1 ligand antibodies that are currently known or those that will be developed in the future. Examples of ligands of PD-1 include, but are not limited to, PD-L1 and PD-L2.
[0053] In one embodiment, the agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor. The present disclosure encompasses BMI-1 inhibitors that are currently in use, in development, or those that will be developed in the future. Examples of BMI-1 inhibitors include, but are not limited to, PTC209, PTC596, PRT4165, PTC-209 HBr, and PTC-028. PTC-209 is a potent and selective BMI-1 inhibitor with IC.sub.50 of 0.5 μM in HEK293T cell line, and results in irreversible reduction of cancer-initiating cells. PTC596 is a second-generation BMI-1 inhibitor that accelerates BMI-1 degradation. Upon oral administration, PTC596 targets BMI1 expressed by both tumor cells and cancer stem cells, and induces hyper-phosphorylation of BMI1, leading to its degradation. IC.sub.50 values for PTC596 at 72 hours ranged from 68 to 340 nM in mantle cell lymphoma (MCL) cell lines. PRT4165 is a BMI-1 inhibitor with an IC.sub.50 of 3.9 μM in cell-free assay. PTC-209 HBr is the hydrobromide salt of PTC-209. PTC-028 is an orally bioavailable compound that decreases BMI-1 levels by posttranslational modification.
[0054] In one embodiment, the BMI-1 inhibitor is PTC209, N-(2,6-dibromo-4-methoxyphenyl)-4-(2-methylimidazo[1,2-a]pyrimidin-3-yl)thiazol-2-amine, CAS number 315704-66-6, as described in Kreso A., Van Galen P., Pedley N. M., Lima-Fernandes E., Frelin C., Davis T., et al. (2014), Self-renewal as a therapeutic target in human colorectal cancer. Nat. Med. 20, 29-36, and has the following structure:
##STR00001##
[0055] In one embodiment, the BMI-1 inhibitor is PTC596, 5-fluoro-2-(6-fluoro-2-methyl-1H-benzimidazol-1-yl)-N-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine, also called unesbulin, CAS number 1610964-64-1, as described by Nishida Y, Maeda A, Kim M J, Cao L, Kubota Y, Ishizawa J, AlRawi A, Kato Y, Iwama A, Fujisawa M, Matsue K, Weetall M, Dumble M, Andreeff M, Davis T W, Branstrom A, Kimura S, Kojima K. The novel BMI-1 inhibitor PTC596 downregulates MCL-1 and induces p53-independent mitochondrial apoptosis in acute myeloid leukemia progenitor cells. Blood Cancer J. 2017 Feb. 17; 7(2):e527, and by Maeda A, Nishida Y, Weetall M, Cao L, Branstrom A, Ishizawa J, Nii T, Schober W D, Abe Y, Matsue K, Yoshimura M, Kimura S, Kojima K. Targeting of BMI-1 expression by the novel small molecule PTC596 in mantle cell lymphoma. Oncotarget. 2018 Jun. 19; 9(47):28547-28560, and has the following structure:
##STR00002##
[0056] In one embodiment, the BMI-1 inhibitor is PTC-209 hydrobromide, N-(2,6-dibromo methoxyphenyl)-4-(2-methylimidazo[1,2-a]pyrimidin-3-yl)-1,3-thiazol-2-amine hydrobromide, CAS number 1217022-63-3, is the hydrobromide salt of PTC209 described above, and has the following structure:
##STR00003##
[0057] In one embodiment, the BMI-1 inhibitor is PTC-028, 6-(5,6-difluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N-(4-(trifluoromethyl)phenyl)pyrazin-2-amine, CAS number 1782970-28-8, such as described in Bolomsky A, Muller J, Stangelberger K, Lejeune M, Duray E, Breid H, Vrancken L, Pfeiffer C, Hübl W, Willheim M, Weetall M, Branstrom A, Zojer N, Caers J, Ludwig H. The anti-mitotic agents PTC-028 and PTC596 display potent activity in pre-clinical models of multiple myeloma but challenge the role of BMI-1 as an essential tumour gene. Br J Haematol. 2020 September; 190(6):877-890, and has the following structure:
##STR00004##
[0058] In one embodiment, the BMI-1 inhibitor PRT4165, 2-(3-pyridinylmethylene)-1H-indene-1,3(2H)-dione or 2-(3-pyridylmethylene)-1,3-indandione, CAS number 31083-55-3, such as described in Ismail I H, McDonald D, Strickfaden H, Xu Z, Hendzel M J. A small molecule inhibitor of polycomb repressive complex 1 inhibits ubiquitin signaling at DNA double-strand breaks. J Biol Chem. 2013 Sep. 13; 288(37):26944-54, and has the following structure:
##STR00005##
[0059] In one embodiment, the agent that reduces expression or function of BMI-1 is a small interfering RNA (siRNA). One of ordinary skill in the art would readily construct and use siRNA against a target such as BMI-1.
[0060] In another embodiment, there is provided a method of increasing anti-tumor T cell activities in a patient having a cancer, comprising the steps of (i) administering to the patient an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) administering to the patient an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1). The agent in step (i) can be administered to the patient before, after, or at the same time as the agent in step (ii) is administered to the patient. Examples of cancer that can be treated have been discussed above. In one embodiment, the anti-tumor T cell activities are mediated by CD8+ T cells.
[0061] In one embodiment, the agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1. Examples of anti-PD-1 antibodies or ligands of PD-1 have been discussed above.
[0062] In one embodiment, the agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA). Examples of BMI-1 inhibitors have been discussed above.
[0063] In another embodiment, there is provided a method of reducing the number of cancer stem cells in a cancer patient in need thereof, comprising the steps of (i) administering to the patient an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) administering to the patient an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1). The agent in step (i) can be administered to the patient before, after, or at the same time as the agent in step (ii) is administered to the patient. Examples of cancer that can be treated have been discussed above. In one embodiment, the cancer stem cells are BMI-1+.
[0064] In one embodiment, the agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1. Examples of anti-PD-1 antibodies or ligands of PD-1 have been discussed above.
[0065] In one embodiment, the agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA). Examples of BMI-1 inhibitors have been discussed above.
[0066] In another embodiment, there is provided a composition for treating cancer in a patient, comprising (i) a composition of an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) a composition of an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1). In one embodiment, the agent that blocks signaling through PD-1 is anti-PD-1 antibody or antibody that binds a ligand of PD-1. Examples of anti-PD-1 antibodies include, but are not limited to, nivolumab (OPDIVO), pembrolizumab (KEYTRUDA), cemiplimab (LIB TAYO), avelumab (BAVENCIO), durvalumab (IMFINZI), and atezolizumab (TECENTRIQ). In another embodiment, the antibodies bind to ligands of PD-1 such as PD-L1 or PD-L2. In another embodiment, the agent that reduces expression or function of BMI-1 is a BMI-1 inhibitor or small interfering RNA (siRNA). Examples of BMI-1 inhibitors include, but are not limited to, PTC209, PTC596, PRT4165, PTC-209 HBr, or PTC-028. One of ordinary skill in the art could readily employ standard techniques to determine desirable doses for the agents in this composition for cancer treatment. For example, current or previous clinical trials or clinical uses of BMI-1 inhibitors and anti-PD-1 antibodies would provide reference data for determining the suitable doses. In one embodiment, BMI-1 inhibitors (e.g. PTC596) can be administered at 200 mg orally twice weekly. In another embodiment, anti-PD-1 antibodies such as nivolumab can be administered at 240 mg IV over 30 minutes every 2 weeks, or 480 mg IV over 30 minutes every 4 weeks, or 1 mg/kg IV over 30 minutes every 3 weeks. Alternatively, anti-PD-1 antibodies such as pembrolizumab can be administered at 200 mg IV over 30 minutes every 3 weeks. In yet another embodiment, anti-PD-1 antibodies such as cemiplimab can be administered at 350 mg IV over 30 minutes every 3 weeks.
[0067] In another embodiment, there is provided a therapeutic combination of compositions formulated for treating cancer in a patient, comprising (i) a composition of an agent that blocks signaling through programmed cell death protein 1 (PD-1); and (ii) a composition of an agent that reduces expression or function of B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1). Examples of agents in the composition of (i) and composition of (ii) have been described above.
[0068] In one embodiment, there is provided uses of the above composition or therapeutic combination of composition in treating cancer in a patient. Examples of cancers, as well as agents in the composition of (i) and composition of (ii) have been described above. Examples of methods of administering the composition to the patient have been discussed above. One of ordinary skill in the art would determine the doses of the agents in the compositions by standard techniques generally known in the art. In one embodiment, composition of (i) is administered to the patient before, after, or concurrently as the composition of (ii) is administered to the patient.
[0069] The terms “comprise”, “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.
[0070] As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an enzyme” or “at least one enzyme” may include a plurality of enzymes, including mixtures thereof.
[0071] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting. Each literature reference or other citation referred to herein is incorporated herein by reference in its entirety.
[0072] In the description presented herein, each of the steps of the invention and variations thereof are described. This description is not intended to be limiting and changes in the components, sequence of steps, and other variations would be understood to be within the scope of the present invention.
[0073] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0074] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
Example 1
BMI1 Ablation Eliminates Cancer Stem Cells and Activates Antitumor Immunity
Materials and Methods
Mice
[0075] Bmi1.sup.CreER (JAX:010531) and R26.sup.tdTomato (JAX:007908) mouse strains were cross-mated to generate Bmi1.sup.CreER;R26.sup.tdTomato. K14.sup.CreER (JAX:005107) and Bmi1.sup.flox/flox (JAX: 028974) mouse strains were cross-mated to generate K14.sup.CreER; Bmi1.sup.flox/flox. All of these above mice were purchased from The Jackson Laboratory and housed under specific-pathogen-free (SPF) conditions in the UCLA animal facility. All mouse experiments were performed per protocols approved by UCLA Animal Research Committee. For induction of HNSCC, six-week-old mice were treated with drinking water containing 50 ug/ml 4NQO (Santa Cruz, Cat #256815) for 16 weeks and then given normal drinking water for tumor formation and lymph node metastasis. For lineage tracing and Bmi1 knock out studies, mice were intraperitoneally injected with tamoxifen (9 mg per 40 g body weight; Sigma-Aldrich, Cat #T5648) to activate Cre.
Cell Lines
[0076] Human HNSCC cell lines SCC23 and SCC1 were from the University of Michigan. B16 cells were from American Type Culture Collection (ATCC, Manassas, Va.). Cells were maintained in DMEM containing 10% FBS and antibiotics (streptomycin and penicillin) at 37° C. in 5% CO2 atmosphere.
Human HNSCC Samples
[0077] The use of human HNSCC samples for immunostaining was approved by the UCLA Institutional Review Board. Human HNSCC paraffin-embedded blocks were obtained from the UCLA Translational Pathological Core Laboratory and processed as described previously (Chen et al., Cell stem cell 20:621-634 (2017); Ding et al., Science signaling 6, ra28.21-13, S20-15 (2013)).
4NQO Mouse Model of HNSCC, Treatment And Histology
[0078] Cisplatin (Sigma-Aldrich, Cat #479306) was dissolved in saline. PTC209 (MedChem Express, Cat #HY-15888) was dissolved in 14% DMSO, 36% polyethylene glycol 400 (Sigma-Aldrich, Cat #202304) and 50% polypropylene glycol (Sigma-Aldrich Cat #4347). For treatment, tumor-bearing mice were randomly divided into 4 groups and given: 1) control vehicle and antibody InVivoPlus rat IgG2a isotype (BioXcell Cat #BP0089, 200 μg/mouse); 2) anti-PD1 (BioXcell, Cat #BE0146, 200 μg/mouse twice/week); 3) cisplatin (5 mg/kg body weight once a week) or PTC209 (60 mg/kg body weight twice/week); and 4) anti-PD1 plus cisplatin or anti-PD1 plus PTC-209. The cisplatin dose and frequency chosen was the weekly tolerated dose that did not have severe side effects on mice based on previous studies. For depletion of CD8+ T cells, mice were given anti-mouse CD8 (InVivoPlus, BioXcell Cat #BP0061, 100 μg/mouse twice/week). For the inhibition of CXCR3 and CXCR5, mice were given TAK779 (Sigma-Aldrich, Cat #SML0911, 150 μg/mouse twice/week).
[0079] Tumor growth and cervical lymph node metastasis were examined as described before (Chen et al., 2017). Briefly, mice were sacrificed, and tongues and cervical lymph nodes were harvested immediately and the lesion surface areas were measured. For histological analysis and immunostaining, longitudinally cut tongues (dorsal/ventral) and intact lymph nodes were fixed overnight in 10% buffered formalin and paraffin-embedded. Tissue blocks were cut into 10-15 sections in 4 μm thickness and stained with hematoxylin and eosin (H&E). The SCC number was counted and areas were measured as described before (Chen et al., 2017). The HNSCC invasiveness was scored based on the following criteria: showing signs of normal or epithelial dysplasia appearance (grade 1); distinct invasion, unclearness of basement membrane, drop and diffuse infiltration into the superficial portion of the muscle layer (grade 2); loss of the basement membrane, extensive invasion into deep muscle layer (grade 3). To assess lymph node metastasis, the sections of cervical lymph nodes were immunostained with anti-PCK antibodies which specifically detected epithelial tumor cells in lymph nodes (Santa Cruz, Cat #sc-8018). The percentage of lymph nodes with metastasis and their metastatic areas were measured.
Mouse B16 Melanoma Tumor Models
[0080] C57/6J mice were injected in the flank subcutaneously with B16 melanoma cells (250,000 cells per site). Tumors were measured every 3 days once palpable (long diameter and short diameter) with a caliper. Tumor volume was determined using the volume formula for an ellipsoid: ½×D×d.sup.2 where D is the longer diameter and d is the shorter diameter. Mice were sacrificed when tumors reached 1000 mm.sup.3 or upon ulceration/bleeding. For treatment, tumor-bearing mice were randomly divided into 4 groups and given the same treatment strategy as 4NQO-induced HNSCC model.
Immunostaining
[0081] Mouse HNSCC and cervical lymph nodes were harvested and cytosections were prepared and processed as previously described (Chen et al., 2017). For immunofluorescent staining, sections were stained with the following primary antibodies: anti-PCK (Abcam Cat #ab9377; 1:200), anti-Ac-casp3 (Cell Signaling Technology, Cat #9661; 1:200), anti-CD8 (Cell Signaling Technology Cat #98941; 1:200), anti-Granzyme-B, (R&D Systems, Cat #AF1865; 1:100), and anti-S100 (Abcam Cat #ab4066; 1:200). The immunocomplexes were detected and visualized using related secondary antibodies conjugated with Cy2 or Cy3 (Jackson ImmunoResearch Laboratories). Sections were then counterstained with 4′6′-diamidino-2-phenilindole (DAPI; Sigma-Aldrich Cat #D9542) and mounted with SlowFade Antifade Reagents (Thermo Fisher Scientific Cat #536937) for imaging and analysis. For the quantification of CD8+, Ac-casp3.sup.+ and Tomato.sup.+ cells, the methods described previously (Miao et al., Cell 177:1172-1186 (2019)) were used with some modifications. At least three sections from each HNSCC lesions were immunostained and analyzed. Tumor cells (>150) and CD8+, Ac-casp3+ and Tomato.sup.+ cells of these tumor cell areas were counted manually in each section. The percentage of CD8+, Ac-casp3.sup.+ and Tomato.sup.+ cells were calculated by dividing those cells with tumor cells and averaged from the sections.
[0082] For immunohistochemistry of human or murine HNSCC samples, sections were incubated with the following primary antibodies at 4° C. overnight: anti-BMI1 (Cell Signaling Technology, Cat #5856; 1:50), anti-CD8a (Cell Signaling Technology Cat #85336; 1:100), anti-CCL5 (Abcam Cat #ab9679; 1:100), and anti-CXCL10 (Santa Cruz, Cat #sc-101500; 1:100). The sections were then incubated with horseradish perioxidase-labeled polymer for 60 min. The signals were detected with AEC+ chromogen (Dako EnVision System Cat #MP-6401-15) and counterstained with hematoxylin. The intensity of immunostaining was scored as follows: 0, no staining; 1, weak staining; 2, moderate staining; 3, strong staining; and 4, very strong staining as described before (Chen et al., 2017). The Spearman or Pearson correlation coefficient of liner regression was used to determine the correlation between different proteins in human HNSCC samples.
Flow Cytometry Analysis
[0083] PBMCs were isolated from blood using Ficoll-Paque Plus density gradient centrifugation (GE Healthcare Life Sciences, Cat #17-1440). Cervical lymph nodes and spleens were collected and processed into single-cell suspensions through mechanical separation. The isolated or dissociated cells were stained with the specific surface marker antibodies, anti-CD3-FITC (eBioscience, Cat #11-0031), anti-CD4-APC (eBioscience, Cat #17-0041), and anti-CD8-PerCP-Cy5.5 (eBioscience, Cat #45-0081) in PBS with FBS for 30 min at 4° C. Intracellular staining of IFNγ was performed as follows: cells were stimulated with PMA and ionomysin cocktail (eBioscience, Cat #00-4970) for 5 h at 37° C. with 5% CO.sub.2. Cells were washed and stained with surface marker antibodies, then fixed and permeabilized with a fixation/permeabilization kit (BD Bioscience, Cat #554715) and intracellularly stained with anti-IFNγ-PE (eBioscience, Cat #12-7311). For proper compensation of flow cytometry channels, single-stain samples were utilized, and for gating, isotype controls were applied. The stained cells were analyzed on the BD FACS flow cytometer, and data analyzed using Flowjo software.
Cell Culture and BMI1 Knockdown by shRNA
[0084] Human SCC23 and SCC1 cells were grown in DMEM containing 10% FBS and antibiotics (streptomycin and penicillin) at 37° C. in a 5% CO.sub.2 atmosphere. To generate lentiviruses, scramble control (shCtrl, Addgene, Cat #1864; see Sarbassov et al Science 2005 Feb. 18; 307(5712):1098-101) and BMI1 specific shRNA lentiviral plasmids (shBmi1, Sigma-Aldrich, Cat #TRCN0000020156, comprising CCGGCCTAATACTTTCCAGATTGATCTCGAGATCAATCTGGAAAGTATTAGGTTTTT, SEQ ID NO:35) were transfected into HEK293T cells with two helper plasmids psPAX2 (Addgene, Cat #12260) and pMD2.G (Addgene, Cat #12259). Viral supernatant was harvested 72 h after transfection and passed through a 0.45 μm filter to remove cell debris and live cells. Collected lentiviruses were used directly to infect cells with the addition of polybrene (Sigma-Aldrich, Cat #H9268), or frozen at −80° C. for later use. Twenty four hours after infection, cells were selected with puromycin (Sigma-Aldrich, Cat #P9620) at 1 μg/ml for 5 days and then expanded before being used for subsequent assays. The knockdown of BMI1 was confirmed by Western blot analysis.
qRT-PCR and ChIP-qPCR
[0085] For qRT-PCR, total RNA was prepared using TRIzol reagent (Thermo Fisher Scientific Cat #15596026), and 1 μg of RNA was reversely transcribed with random primer (Thermo Fisher Scientific Cat #48190011), dNTP mix (Thermo Fisher Scientific, Cat #18427013), and M-MuLV Reverse Transcriptase (New England Biolabs, Cat #M0253L). The levels of mRNA were qualitatively measured using a SYBRGreen supermix (Bio-Rad, Cat #1708880). GAPDH was used as an internal control.
[0086] ChIP-qPCR assays were performed as previously described (Ding et al, 2013). Briefly, SCC cells were sequentially treated with dimethyl 3,3′-dithiobispropionimidate-HCl (DTBP; Cat #20665, Thermo Fisher Scientific) solution and formaldehyde, and harvested with a cell scraper. The cell pellet was lysed with ChIP lysis buffer and sonicated to generate 200-500 bp DNA fragments with a sonicator. The fragmented chromatins were immunoprecipitated with anti-BMI1 (Cell Signaling Technology, Cat #6964), anti-Ubiquityl-Histone H2A (Lys119) (Cell Signaling Technology, Cat #8240) overnight at 4° C. The precipitated DNA-chromatin products were purified with ChIP DNA clean & concentrator kit (Cat #D5205, Zymo Research) and the DNA levels were quantified by qPCR. Data is presented as the percentage of input DNA. The primer sequences used for qRT-PCR and ChIP-qPCR were listed in Table 1.
Western Blot and ELISA Assays
[0087] Cells were lysed using the radioimmunoprecipitation assay (RIPA) buffer (Sigma-Aldrich, Cat #R0278) added with a cocktail of protease inhibitors (Thermo Fisher Scientific, Cat ##78430) and phosphatase inhibitors (Sigma-Aldrich, Cat #4906845001). Protein extracts were resolved on a 10% or 15% SDS polyacrylamide gel and then transferred to a polyvinylidene difluoride membrane. Membranes were blocked with 5% milk for 1 h and incubated with primary antibodies overnight at 4° C. Primary antibodies used in this study were: anti-phospho-STING (Ser366) (1:1,000; Cell Signaling Technology, Cat #19781), anti-STING (1:1,000; Cell Signaling Technology, Cat #13647), anti-phospho-TBK1 (Ser172) (1:1,000; Cell Signaling Technology, Cat #5483), anti-TBK1 (1:1,000; Cell Signaling Technology, Cat #3504), anti-phospho-IRF3 (Ser396) (1:1,000; Cell Signaling Technology, Cat #29047), anti-IRF3 (1:1,000; Cell Signaling Technology, Cat #4302), anti-BMI1 (1:1,000; Cell Signaling Technology, Cat #6964), anti-Ubiquityl-Histone H2A (Lys119) (1:1000, Cell Signaling Technology, Cat #8240), anti-phospho Histone H2A.X (Ser139) (1:1000; Cell Signaling Technology, Cat #9718), and anti-GAPDH (1:1000; Cell Signaling Technology, Cat #5174), anti-Histone H3 (1:2,000; Cell Signaling Technology, Cat #4499). The signals were detected using the Clarity Western ECL kit (Bio-Rad, Cat #1705060). To measure the protein levels of CCL5, CXCL9, CXCL10 and CXCL11, cells were treated with PTC209 or shBMI1 knockdown for 48 hr. After treatment, supernatants were collected, and the protein levels of CCL5, CXCL9, CXCL10 and CXCL11 were measured with ELISA (R&D Systems, Cat #DRN00B, DCX900, DIP100, DCX110) according to the manufacturer's instructions.
RNA-Seq And Pathway Enrichment Analysis
[0088] Total RNA was isolated from PTC209-treated or shBMI1 knockdown SCC cells using a RNeasy Micro Kit (QIAGEN, Cat #74004). RNA quality was examined using an Agilent 2100 Bioanalyzer. Library preparation using the KAPA RNA-Seq Library Preparation Kits (KAPA Biosystems, Cat #07960140001) was performed at the UCLA sequencing core facility, and RNAs were single-end sequenced on Illumina HiSeq 3000 machines. The online DAVID bioinformatics resources were used to analyze the differentially expressed genes under the category of GOTERM_BP_DIRECT. The heatmap was generated with Heatmap Builder. The raw data was deposited at the Gene Expression Omnibus (GEO) under the subseries entry GSE140433.
Cytosolic dsDNA Staining
[0089] Following the treatment, SCC23 and SCC1 cells were incubated with culture media containing PicoGreen (dsDNA stain, 200-fold dilution, Thermo Fisher Scientific, Cat #P11496) and MitoTracker (mitochondrial dsDNA stain, 100 nM, Thermo Fisher Scientific, Cat #M7512). One hour after incubation, cells were fixed with 4% paraformaldehyde for 10 min. Cells were then washed twice with PBS and stained with DAPI (Sigma-Aldrich, Cat #D9542) and mounted with SlowFade Antifade Reagents (Thermo Fisher Scientific, Cat #536937). Staining was imaged and assessed using a Leica SP5X laser scanning confocal microscope.
Comet Assays
[0090] Single cell gel electrophoresis comet assays were performed using the SCGE assay Kit (Enzo Life Sciences, Cat #ADI-900-166). Following the treatment, cells were mixed with low melting point agarose at a volume ratio of 1:50, and 100 μl of aliquots were loaded onto pre-warmed slides. Slides were incubated in pre-chilled lysis solution for 1 h and then in pre-chilled alkaline solution for 1 h. Electrophoresis was run at 22 V in the TBE buffer for 30 min. Comets were stained with CYGREEN dye for 30 min and imaged. 50 individual cells at least per sample were evaluated in duplicates by the CASP Version 1.2.2 analysis tool.
Statistical Analyses
[0091] Statistical parameters of the analyses are reported in the Figure Legends. All in vitro experiments were repeated at least twice, and in vivo experiments were repeated at least once. Statistical analyses were performed using GraphPad Prism 6.0 for windows (GraphPad software, Inc.). Statistical parameters of the analyses are reported in the Figure Legends. To compare HNSCC lesion size, number and area in control and knockout mice, the differences were assessed using two-way ANOVA. For comparison of treatment in same stain of mouse, the differences were evaluated by one-way ANOVA followed by the Tukey's HSD post-hoc tests to minimize type I errors. For ANOVA analyses, we utilized Shapiro-Wilk test to validate normal distribution of data and that all data met the assumptions of no significant outliers. A total of 60 human HNSCC samples were used in this study, and the parameters for scores was reported in the Figure legends (
TABLE-US-00001 TABLE 1 Sequences for qRT-PCR and ChIP-qPCR primers Target Genes Forward (5′-3′) Reverse (5′-3′) Primers for qRT-PCR human GAPDH AACGGGAAGCTTGTCATCAA TGGACTCCACGACGTACTCA (SEQ ID NO: 1) (SEQ ID NO: 2) human CCL5 CAGTGGCAAGTGCTCCAACC CCATCCTAGCTCATCTCCAAAGAGT (SEQ ID NO: 3) (SEQ ID NO: 4) human CXCL9 GTGGTGTTCTTTTCCTCTTGGG ACAGCGACCCTTTCTCACTAC (SEQ ID NO: 5) (SEQ ID NO: 6) human CXCL10 GCAAGCCAATTTTGTCCACG ACATTTCCTTGCTAACTGCTTTCAG (SEQ ID NO: 7) (SEQ ID NO: 8) human CXCL11 CAGAATTCCACTGCCCAAAGG GTAAACTCCGATGGTAACCAGCC (SEQ ID NO: 9) (SEQ ID NO: 10) human IFNβ GCCATCAGTCACTTAAACAGC GAAACTGAAGATCTCCTAGCCT (SEQ ID NO: 11) (SEQ ID NO: 12) mouse GAPDH CTCATGACCACAGTCCATGC CACATTGGGGGTAGGAACAC (SEQ ID NO: 13) (SEQ ID NO: 14) mouse CCL5 CACCACTCCCTGCTGCTT ACACTTGGCGGTTCCTTC (SEQ ID NO: 15) (SEQ ID NO: 16) mouse CXCL9 TTTTGGGCATCATCTTCCTGG GAGGTCTTTGAGGGATTTGTAGTGG (SEQ ID NO: 17) (SEQ ID NO: 18) mouse CXCL10 CTTCTGAAAGGTGACCAGCC GTCGCACCTCCACATAGCTT (SEQ ID NO: 19) (SEQ ID NO: 20) mouse CXCL11 AACAGGAAGGTCACAGCCATAGC TTTGTCGCAGCCGTTACTCG (SEQ ID NO: 21) (SEQ ID NO: 22) mouse IFNβ GGTGGAATGAGACTATTGTTG AGGACATCTCCCACGTC (SEQ ID NO: 23) (SEQ ID NO: 24) mouse IFNβ GGTGGAATGAGACTATTGTTG AGGACATCTCCCACGTC (SEQ ID NO: 25) (SEQ ID NO: 26) Primers for ChIP human CCL5 Forward (−215) CACCATTGGTGCTTGGTCAAAGAGG (SEQ ID NO: 27) Reverse (+115) GCAGTAGCAATGAGGATGACAGCGA (SEQ ID NO: 28) human CXCL9 Forward (−219) TGTGCCAAAGGCTATCAGTG (SEQ ID NO: 29) Reverse (−117) CAGATCCAAGGGAATTTCTGC (SEQ ID NO: 30) human CXCL10 Forward (−363) TAGGTTTACCTATAAAGGATGAA (SEQ ID NO: 31) Reverse (−92) ACTCGAAGGTATTATTTATTGTAG (SEQ ID NO: 32) human CXCL11 Forward (−264) GGTTTTCACAGTGCTTTCAC (SEQ ID NO: 33) Reverse (−154) TTTCCCTCTTTGAGTCATGC (SEQ ID NO: 34)
Results
[0092] BMI1.sup.+ CSCs Enriched after Combination of Cisplatin and Anti-PD1
[0093] To examine whether anti-PD1 plus cisplatin could eliminate BMI1.sup.+ CSCs of HNSCC, Bmi1CreER;RosatdTomato mice were treated with 4NQO in their drinking water for 16 weeks and then provided them with normal drinking water. At 22 weeks, the tumor-bearing mice were randomly divided into four groups and treated with cisplatin, anti-PD1, anti-PD1 plus cisplatin, or IgG control for 4 weeks. A single dose of tamoxifen was administered 1 day prior to sacrificing the mice in order to label Tomato.sup.+ BMI1.sup.+ CSCs (
[0094] Next, the effect of the combination treatment on anti-tumor T cell immunity was investigated. Anti-PD1 or cisplatin alone did not significantly increase CD8+ T cell infiltration in HNSCC. However, immunostaining showed that anti-PD1 plus cisplatin significantly increased CD8+ T cell infiltration (
BMI1 Inhibitor Plus Anti-PD1 Eliminates CSCs and Inhibits HNSCC Progression
[0095] To explore whether targeting BMI1.sup.+ CSCs augmented PD1 blockade therapy, the specific Bmi1 inhibitor PTC209, which has be shown to effectively destroy BMI1.sup.+ CSCs, was used. Reduction of BMI1 expression by PTC209 in tumors was confirmed by immunostaining (
Requirement of Intratumoral CD8.SUP.+ T Cells for Anti-Tumor Immunity Induced by BMI1 Inhibitor Plus Anti-PD1
[0096] To test whether intratumoral CD8.sup.+ cells were required for PTC209 plus anti-PD1-mediated anti-tumor immunity, we concurrently treated tumor-bearing mice with anti-CD8 antibodies to immunodeplete CD8.sup.+ cells. Immunostaining showed that anti-CD8 significantly abrogated CD8.sup.+ T cells infiltration in HNSCC induced by PTC-209 plus anti-PD1 (
[0097] To further determine whether targeting tumor cell-intrinsic BMI1 promoted CD8.sup.+ T cells infiltration, Bmi1.sup.flox/flox (Bmi1.sup.f/f) mice were crossed with keratin 14-Cre/ERT2 mice (K14CreER) to generate K14.sup.CreER;Bmi1.sup.f/f mice in which epithelial BMI1 can be inducibly deleted by tamoxifen treatment. To achieve efficient recombination activity, three successive applications of tamoxifen were applied to both K14.sup.CreER;Bmi1.sup.f/f and the control Bmi1.sup.f/f mice 22 weeks after the initial 4NQO treatment (
Activating Tumor Cell-Intrinsic Immune Response by BMI1 Inhibition
[0098] To further elucidate the molecular and epigenetic mechanisms by which BMI1 inhibition recruited CD8+ T cells to augment PD1 blockade therapy, BMI1 expression was knocked down in SCC23 and SCC1 cells using the lentivirus-based short-hairpin RNA for BMI1 (shBMI1). Western blot analysis confirmed that shBMI1 reduced the expression of BMI1. Since BMI1 is required for H2AUb, the level of H2AUb was reduced in SCC23 and SCC1 cells (
[0099] BMI1 has been found to play a regulatory role in DNA damage response and repair. Upon DNA damage, BMI1 is recruited to sites of double-stranded DNA breaks (DSBs) where they promote the ubiquitylation of pH2A.X, thereby facilitating the repair of DSBs by stimulating homologous recombination and non-homologous end joining. To explore how BMI1 inhibition induced IFN-regulated chemokines, pH2A.X (a specific marker for DNA damage) was found to be significantly increased in PTC209-treated HNSCC (
[0100] To examine whether DNA damages induced by BMI1 inhibition caused the accumulation of cytosolic double strand DNA (dsDNA) in SCC cells, SCC cells were stained with PicoGreen, a dsDNA-specific vital dye. Since PicoGreen also stains mitochondrial DNA, mitochondrial dsDNA was also stained with MitoTracker simultaneously. Multiple PicoGreen staining areas in the cytoplasm of SCC23 and SCC1 cells, which were not overlapped with MitoTracker, were detected upon PTC209 or shBMI1 treatment, indicating that PTC209 and shBMI1 induced the accumulation of cytosolic dsDNA (
[0101] Recently, PRC1 was found to activate CCL2 transcription to promote cancer stemness and bone metastasis in prostate cancers by recruiting macrophages and regulatory T cells. However, RNA-seq analysis did not detect BMI inhibition regulated CCL2 transcription in HNSCC. In contrast, BMI1 inhibition induced the transcription of chemokines associated with CD8+ T cell recruitments. Whether BMI1 could repress the transcription of chemokines by H2AUb and whether BMI1 inhibition might erase the repressive H2AUb were further explored by chromatin immunoprecipitation-qPCR (ChIP-qPCR). ChIP-qPCR revealed that BMI1 specifically occupied the promoters of CCL5, CXCL9, CXCL10 and CXCL11. PTC209 treatment significantly reduced the levels of BMI1 on these promoters in SCC23 cells (
[0102] To test whether IFN-regulated chemokines and the recruitment of CD8+ T cells were required for anti-PD1 plus PTC209-mediated anti-tumor immunity, tumor-bearing mice were concurrently treated with TAK779, an inhibitor of CCR5 and CXCR3, which are the receptors for CCL5, CXCL9, CXCL10 and CXCL11, respectively. Immunostaining showed that TAK779 significantly abrogated CD8+ T cells infiltration in HNSCC induced by anti-PD1 plus PTC209 (
BMI1 Inhibitor Plus Anti-PD1 Prevents Relapse of HNSCC
[0103] HNSCC frequently relapse although they initially respond to chemotherapies. In vivo labeling revealed that BMI1.sup.+ CSCs were enriched after anti-PD1 plus cisplatin while PTC209 plus anti-PD1 efficiently eliminated BMI1.sup.+ CSCs. To determine whether BMI1.sup.+ CSCs were responsible for HNSCC relapse, in vivo lineage tracing was performed. Tumor-bearing Bmi1.sup.CreER;Rosa.sup.tdTomato mice were treated with anti-PD1 plus cisplatin, anti-PD1 plus PTC209, or control vehicle for 4 weeks and then given tamoxifen to trace Tomato+ cells derived from BMI1.sup.+ CSCs in HNSCC over a period of 4 weeks (
[0104] To further confirm whether HNSCC treated with anti-PD1 plus PTC209 had less relapse compared with anti-PD1 plus cisplatin, the combination treatment was extended for additional 4 weeks in order to obtain recurrent HNSCC (
DISCUSSION
[0105] Treating or preventing recurrent and metastatic HNSCC remains a great therapeutic challenge regardless of the promising progress in immune checkpoint therapy. In this study, it is showed that the combination treatment of anti-PD1 and cisplatin enriched BMI1.sup.+ CSCs, although the combination could inhibit HNSCC growth by recruiting CD8.sup.+ T cells. Not surprisingly, dwindling HNSCC after treatment with anti-PD1 plus cisplatin regrew and eventually relapsed. In contrast, the combination treatment of anti-PD1 and PTC209 not only potently inhibited HNSCC invasive growth, but also significantly reduced HNSCC relapse and lymph node metastasis compared with anti-PD1 plus cisplatin. Mechanistically, while BMI1 inhibition destroyed CSCs, it also induced tumor cell-intrinsic immune responses and augmented PD1 blockade to kill non-stem tumor cells in HNSCC by recruiting and activating CD8.sup.+ T cells (
[0106] HNSCC has an immunosuppressive tumor microenvironment with low tumor-infiltrating lymphocytes. Previous studies have shown that cisplatin could enhance antitumor immunity by increasing the expression of antigen-processing machinery components or impair anti-tumor immunity by inducing the expression of PD-L1. In results presented herein, cisplatin did collaborate with anti-PD1 to recruit CD8.sup.+ T cells into HNSCC although cisplatin alone could not. However, it is found that anti-PD1 plus cisplatin could not effectively kill BMI1.sup.+ CSCs based on in vivo lineage tracing. Supporting these results, it was recently reported that CSCs selectively acquired the expression of CD80 to inhibit cytotoxic T cell activity. Interestingly, CD80 was highly expressed in BMI1.sup.+ CSCs based on RNA-seq results. Therefore, it is possible that CSCs in HNSCC might be intrinsically resistant to CD8.sup.+ T cell killing. Although conventional therapy combined with PD-1 blockade has been approved for treating HNSCC, the durable response is limited, indicating that PD-1 blockade combined with the conventional therapy may be unable to eliminate CSCs in HNSCC.
[0107] It is demonstrated that combination therapy of BMI1 inhibitor and anti-PD1 effectively inhibited tumor growth metastasis by eliminating CSCs. Although use of the BMI1 inhibitor alone also suppressed HNSCC growth and metastasis, it was not as effective as the combination therapy. Previously, it has been reported that PTC209 inhibited colorectal tumor growth and reduced the frequency of CSCs in mouse xenograft models. PTC-209 has also been shown to inhibit xenografted HNSCC growth. However, because these studies transplanted human tumor cells into immunodeficient mice, the potential impact of anti-tumor immune responses could not be observed. In the present disclosure, it is found unexpectedly that BMI1 inhibitor not only inhibited CSC self-renewal, but also activated CSC-intrinsic immune response. These results showed that CD8.sup.+ T cells recruited to tumor tissues were significantly increased by PTC209 treatment. BMI1 inhibitor could boost the immunotherapy effect of anti-PD1 in addition to targeting BMI1.sup.+ CSCs, thereby sensitizing non-stem tumor cells to immunotherapy-induced apoptosis.
[0108] SCC cells frequently metastasize to cervical lymph nodes which are enriched with immune cells, indicating that immune evasion plays a critical role in HNSCC progression and metastasis. Growing evidence demonstrates that targeting tumor cell-intrinsic genetic and epigenetic alterations is crucial to unleash anti-tumor immunity, thereby inhibiting tumor growth and metastasis. Inhibition of PRC2-mediated histone H3 lysine 27 trimethylation leads to increased responses to cancer immunotherapy. BMI1 is a core component of the PRC1 that mediates gene silencing via H2Aub. PRC1 also cooperates with PRC2 to control chromatin compaction and repress gene expression. BMI1, as an important epigenetic factor, regulates cancer invasive growth and progression in addition to cancer stemness. BMI1 is also associated with DNA damage response and repair. BMI1 ablation impairs the recruitment of DNA repair factors to DSBs which are dependent on ubiquitin signaling, thereby promoting DNA damage. Here, it is found that BMI1 inhibition induced chemokines by two interconnected mechanisms: 1) stimulating cGAS-STING signaling to activate IRF3-mediated transcription by induction of DNA damage, and 2) erasing repressive H2AUb markers epigenetically. It is observed that pH2A.X, a known hallmark of DNA double strand break and DNA damage response activation, was increased in SCC cells upon BMI1 inhibition in vitro and in vivo. Consistent with ongoing DNA damage, cytosolic dsDNA was accumulated which subsequently activated the STING-TBK1-IRF3 pathway to induce the expression of the type I IFN chemokines (CCL5, CXCL9, CXCL10, and CXCL11). The removal of repressive H2Aub marks on the promoters of type I IFN chemokines may further facilitate the trans activation of IRF3 upon BMI1 inhibition.
[0109] While Tomato.sup.+ BMI1.sup.+ CSCs might represent a rare population of CSCs in HNSCC which have high BMI1 transcription, it has been previously found that the basal level of BMI1 was also increased in non-stem tumor cells. Immunostaining found that human HNSCC tumor samples had a more broad expression pattern because BMI1 proteins could also be post-translationally regulated. Therefore, BMI1 inhibition in these tumor cells should also intrinsically activate their immune response and recruit CD8.sup.+ T cells. Targeting BMI1 could also sensitize non-stem tumor cells to anti-PD1 by recruiting CD8.sup.+ T cells in addition to purging CSCs. The combination of PD1 blockade and BMI1 inhibition not only inhibited metastatic HNSCC growth, but also efficiently prevented HNSCC relapses. PTC596, an analog of PTC209 has been in clinical trials to treat advanced solid tumors. The phase 1 study suggested that PTC596 is tolerable with manageable gastrointestinal side effects. In the future, it will be interesting to perform a clinical trial to determine whether anti-PD1 and PTC596 collaboratively inhibit human HNSCC growth and lymph node metastasis. Taken together, the results presented herein have important implications in developing a new combination treatment for advanced cancer by targeting CSCs and activating tumor cell-intrinsic immune responses.
[0110] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.