METHODS AND COMPOSITIONS FOR SCREENING AND TREATING DEVELOPMENTAL DISORDERS
20200199674 ยท 2020-06-25
Inventors
- Eli Hatchwell (Winchester, GB)
- Peggy S. Eis (Fitchburg, MA)
- Stephen Scherer (Toronto, CA)
- Aparna Prasad (Rochester, NY)
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
G01N33/6845
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
This document provides methods and materials related to genetic variations of developmental disorders. For example, this document provides methods for using such genetic variations to assess susceptibility of developing Autism Spectrum Disorder.
Claims
1.-210. (canceled)
211. A method of hybridizing a nucleic acid probe or synthesizing a nucleic acid product comprising: (a) hybridizing a nucleic acid probe to a polynucleic acid by nucleic acid hybridization or microarray analysis, or synthesizing a nucleic acid product from a polynucleic acid by PCR or sequencing wherein the polynucleic acid is from a sample from a human subject that has Autism Spectrum Disorder (ASD); and (b) detecting a genetic variation in (i) the polynucleic acid by nucleic acid hybridization or microarray analysis or (ii) the nucleic acid product by PCR or sequencing, wherein the genetic variation is a copy number variant (CNV), wherein the CNV is in a TBCK gene.
212. The method of claim 211, wherein the genetic variation is a loss in the TICK gene.
213. The method of claim 211, wherein the genetic variation results in a loss of function of TBCK gene.
214. The method of claim 211, wherein the nucleic acid product synthesized from the polynucleic acid comprises cDNA.
215. The method of claim 211, wherein the CNV comprises SEQ ID NO: 420 or a complement thereof.
216. The method of claim 211, wherein the polynucleic acid comprises a nucleic acid from blood, saliva, urine, serum, tears, skin, tissue, or hair from the subject.
217. The method of claim 211, wherein the method comprises isolating polynucleotides; and performing a microarray analysis of the polynucleotides.
218. The method of claim 211, wherein the microarray analysis is selected from the group consisting of a Comparative Genomic Hybridization (CGH) array analysis and an SNP array analysis.
219. The method of claim 211, wherein the sequencing comprises high throughput sequencing.
220. The method of claim 211, wherein the whole genome of the subject is analyzed.
221. The method of claim 211, wherein the whole exome of the subject is analyzed.
222. The method of claim 211, wherein the detecting comprises detecting a first genetic variation that is the CNV with a sequence of SEQ ID NO: 420 or a complement thereof, wherein the first genetic variation and a second genetic variation are in a panel comprising two or more genetic variations.
223. The method of claim 222, wherein the panel comprises 50 or more genetic variations.
224. The method of claim 222, wherein the panel comprises 100 or more genetic variations.
225. The method of claim 211, wherein the detecting comprises detecting two or more genetic variations.
226. The method of claim 211, wherein the analysis comprises an in-silico analysis.
227. The method of claim 217, wherein the microarray analysis comprises Comparative Genomic Hybridization (CGH) array analysis.
228. The method of claim 211, wherein the detection of the genetic variation is followed by identifying an agent having a therapeutic benefit for treatment of ASD, wherein the agent modulates TBCK gene or expression products thereof.
229. The method of claim 211, further comprising administering an agent having a therapeutic benefit for treatment of ASD, wherein the agent modulates TBCK gene or expression products thereof.
230. The method of claim 211, wherein the method further comprises selecting a therapy to be administered to the human subject that targets the TBCK gene, or an RNA transcript or polypeptide encoded by the TBCK gene.
231. A method of treatment comprising administering an agent having a therapeutic benefit for treatment of ASD, to a subject in need thereof, wherein the subject has been identified as having the genetic variation according to the method of claim 211.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings.
[0064]
[0065]
DETAILED DESCRIPTION OF THE DISCLOSURE
[0066] The details of one or more inventive embodiments are set forth in the accompanying drawings, the claims, and in the description herein. Other features, objects, and advantages of inventive embodiments disclosed and contemplated herein will be apparent from the description and drawings, and from the claims. As used herein, unless otherwise indicated, the article a means one or more unless explicitly otherwise provided for. As used herein, unless otherwise indicated, terms such as contain, containing, include, including, and the like mean comprising. As used herein, unless otherwise indicated, the term or can be conjunctive or disjunctive. As used herein, unless otherwise indicated, any embodiment can be combined with any other embodiment. As used herein, unless otherwise indicated, some inventive embodiments herein contemplate numerical ranges. When ranges are present, the ranges include the range endpoints. Additionally, every subrange and value within the range is present as if explicitly written out.
[0067] Described herein are methods of identifying variations in nucleic acids and genes associated with one or more developmental conditions. Described herein are methods of screening for determining a subject's susceptibility to developing or having, one or more developmental disorders, for example, Autism Spectrum Disorder (ASD), based on identification and detection of genetic nucleic acid variations. Also described herein, are methods and compositions for treating and/or preventing one or more developmental conditions using a therapeutic modality. The present disclosure encompasses methods of assessing an individual for probability of response to a therapeutic agent for a developmental disorder, methods for predicting the effectiveness of a therapeutic agent for a developmental disorder, nucleic acids, polypeptides and antibodies and computer-implemented functions. Kits for screening a sample from a subject to detect or determine susceptibility to a developmental disorder are also encompassed by the disclosure.
Genetic Variations Associated with Developmental Disorders
[0068] Genomic sequences within populations exhibit variability between individuals at many locations in the genome. For example, the human genome exhibits sequence variations that occur on average every 1,000 base pairs. Such genetic variations in nucleic acid sequences are commonly referred to as polymorphisms or polymorphic sites. In some embodiments, these genetic variations can be found to be associated with one or more disorders and/or diseases using the methods disclosed herein. In some embodiments the one or more disorders and/or diseases comprise one or more developmental disorders. In some embodiments the one or more developmental disorders comprise one or more Pervasive Developmental Disorders (PDD). In some embodiments, the one or more PDDs comprise ASD. ASD can refer to autism. In another embodiment, the one or more developmental disorders comprise Pervasive Developmental Disorder-Not Otherwise Specified (PDD-NOS). In some embodiments, PDD-NOS can comprise Asperger Syndrome, Rett Syndrome, fragile X syndrome and/or Childhood Disintegrative Disorder. In some embodiments genetic variations can be associated with one or more PDDs. In some embodiments genetic variations can be associated with one or more PDD-NOSs.
[0069] Scientific evidence suggests there is a potential for various combinations of factors causing ASD, such as multiple genetic variations that may cause autism on their own or when combined with exposure to as yet undetermined environmental factors. Timing of exposure during the child's development, such as before, during, or after birth, may also play a role in the development or final presentation of the disorder. A small number of cases can be linked to genetic disorders such as Fragile X, Tuberous Sclerosis, and Angelman's Syndrome, as well as exposure to environmental agents such as infectious ones (maternal rubella or cytomegalovirus) or chemical ones (thalidomide or valproate) during pregnancy.
[0070] In some embodiments, these genetic variations comprise point mutations, polymorphisms, translocations, insertions, deletions, amplifications, inversions, interstitial deletions, copy number variations (CNVs), loss of heterozygosity, or any combination thereof. In some embodiments polymorphisms (e.g. polymorphic markers), can comprise any nucleotide position at which two or more sequences are possible in a subject population. In some embodiments, each version of a nucleotide sequence with respect to the polymorphism can represent a specific allele, of the polymorphism. In some embodiments, genomic DNA from a subject can contain two alleles for any given polymorphic marker, representative of each copy of the marker on each chromosome. In some embodiments, an allele can be a nucleotide sequence of a given location on a chromosome. Polymorphisms can comprise any number of specific alleles. In some embodiments of the disclosure, a polymorphism can be characterized by the presence of two or more alleles in a population. In some embodiments, the polymorphism can be characterized by the presence of three or more alleles. In some embodiments, the polymorphism can be characterized by four or more alleles, five or more alleles, six or more alleles, seven or more alleles, nine or more alleles, or ten or more alleles. In some embodiments an allele can be associated with one or more diseases or disorders, for example, a developmental disorder risk allele can be an allele that is associated with increased or decreased risk of developing a developmental disorder. In some embodiments, genetic variations and alleles can be used to associate an inherited phenotype, for example, a developmental disorder, with a responsible genotype. In some embodiments, a developmental disorder risk allele can be a variant allele that is statistically associated with a screening of one or more developmental disorders. In some embodiments, genetic variations can be of any measurable frequency in the population, for example, a frequency higher than 10%, a frequency between 5-10%, a frequency between 1-5%, or frequency below 1%. As used herein, variant alleles can be alleles that differ from a reference allele. As used herein, a variant can be a segment of DNA that differs from the reference DNA, such as a genetic variation. In some embodiments, genetic variations can be used to track the inheritance of a gene that has not yet been identified, but whose approximate location is known.
[0071] As used herein, a haplotype can be information regarding the presence or absence of one or more genetic markers in a given chromosomal region in a subject. In some embodiments, a haplotype can be a segment of DNA characterized by one or more alleles arranged along the segment, for example, a haplotype can comprise one member of the pair of alleles for each genetic variation or locus. In some embodiments, the haplotype can comprise two or more alleles, three or more alleles, four or more alleles, five or more alleles, or any combination thereof, wherein, each allele can comprise one or more genetic variations along the segment.
[0072] In some embodiments, a genetic variation can be a functional aberration that can alter gene function, gene expression, protein expression, protein function, or any combination thereof. In some embodiments, a genetic variation can be a loss-of-function mutation, gain-of-function mutation, dominant negative mutation, or reversion. In some embodiments, a genetic variation can be part of a gene's coding region or regulatory region. Regulatory regions can control gene expression and thus protein expression. In some embodiments, a regulatory region can be a segment of DNA wherein regulatory proteins, for example, transcription factors, can bind. In some embodiments a regulatory region can be positioned near the gene being regulated, for example, positions upstream of the gene being regulated.
[0073] In some embodiments, variants can include changes that affect a polypeptide, such as a change in expression level, sequence, function, localization, binding partners, or any combination thereof. In some embodiments, a genetic variation can be a frameshift mutation, nonsense mutation, missense mutation, neutral mutation, or silent mutation. For example, sequence differences, when compared to a reference nucleotide sequence, can include the insertion or deletion of a single nucleotide, or of more than one nucleotide, resulting in a frame shift; the change of at least one nucleotide, resulting in a change in the encoded amino acid; the change of at least one nucleotide, resulting in the generation of a premature stop codon; the deletion of several nucleotides, resulting in a deletion of one or more amino acids encoded by the nucleotides; the insertion of one or several nucleotides, such as by unequal recombination or gene conversion, resulting in an interruption of the coding sequence of a reading frame; duplication of all or a part of a sequence; transposition; or a rearrangement of a nucleotide sequence. Such sequence changes can alter the polypeptide encoded by the nucleic acid, for example, if the change in the nucleic acid sequence causes a frame shift, the frame shift can result in a change in the encoded amino acids, and/or can result in the generation of a premature stop codon, causing generation of a truncated polypeptide. In some embodiments, a genetic variation associated with a developmental disorder can be a synonymous change in one or more nucleotides, for example, a change that does not result in a change in the amino acid sequence. Such a polymorphism can, for example, alter splice sites, affect the stability or transport of mRNA, or otherwise affect the transcription or translation of an encoded polypeptide. In some embodiments, a synonymous mutation can result in the protein product having an altered structure due to rare codon usage that impacts protein folding during translation, which in some cases may alter its function and/or drug binding properties if it is a drug target. In some embodiments, the changes that can alter DNA to increase the possibility that structural changes, such as amplifications or deletions, occur at the somatic level. A polypeptide encoded by the reference nucleotide sequence can be a reference polypeptide with a particular reference amino acid sequence, and polypeptides encoded by variant nucleotide sequences can be variant polypeptides with variant amino acid sequences.
[0074] In some embodiments, one or more variant polypeptides or proteins can be associated with one or more diseases or disorders, such as ASD. In some embodiments, variant polypeptides and changes in expression, localization, and interaction partners thereof, can be used to associate an inherited phenotype, for example, a developmental disorder, with a responsible genotype. In some embodiments, a developmental disorder associated variant polypeptide can be statistically associated with a diagnosis, prognosis, or theranosis of one or more developmental disorders.
[0075] The most common sequence variants comprise base variations at a single base position in the genome, and such sequence variants, or polymorphisms, are commonly called single nucleotide polymorphisms (SNPs) or single nucleotide variants (SNVs). In some embodiments, a SNP represents a genetic variant present at greater than or equal to 1% occurrence in a population and in some embodiments a SNP can represent a genetic variant present at any frequency level in a population. A SNP can be a nucleotide sequence variation occurring when a single nucleotide at a location in the genome differs between members of a species or between paired chromosomes in a subject. SNPs can include variants of a single nucleotide, for example, at a given nucleotide position, some subjects can have a G, while others can have a C. SNPs can occur in a single mutational event, and therefore there can be two possible alleles possible at each SNP site; the original allele and the mutated allele. SNPs that are found to have two different bases in a single nucleotide position are referred to as biallelic SNPs, those with three are referred to as triallelic, and those with all four bases represented in the population are quadallelic. In some embodiments, SNPs can be considered neutral. In some embodiments SNPs can affect susceptibility to developmental disorders. SNP polymorphisms can have two alleles, for example, a subject can be homozygous for one allele of the polymorphism wherein both chromosomal copies of the individual have the same nucleotide at the SNP location, or a subject can be heterozygous wherein the two sister chromosomes of the subject contain different nucleotides. The SNP nomenclature as reported herein is the official Reference SNP (rs) ID identification tag as assigned to each unique SNP by the National Center for Biotechnological Information (NCBI).
[0076] Another genetic variation of the disclosure can be copy number variations (CNVs). CNVs can be alterations of the DNA of a genome that results an abnormal number of copies of one or more sections of DNA. CNVs can be inherited or caused by de novo mutation and can be responsible for a substantial amount of human phenotypic variability, behavioral traits, and disease susceptibility. In a preferred embodiment, CNVs of the current disclosure can be associated with susceptibility to one or more developmental disorders, for example, ASD. In some embodiments, CNVs can be a single gene or include a contiguous set of genes. In some embodiments, CNVs can be caused by structural rearrangements of the genome, for example, unbalanced translocations, insertions, deletions, amplifications, inversions and interstitial deletions. In some embodiments, these structural rearrangements occur on one or more chromosomes. Low copy repeats (LCRs), which are region-specific repeat sequences, can be susceptible to these structural rearrangements, resulting in CNVs. Factors such as size, orientation, percentage similarity and the distance between the copies can influence the susceptibility of LCRs to genomic rearrangement. In some embodiments, CNVs are referred to as structural variants. In some embodiments, structural variants can be a broader class of variant that can also includes copy number neutral alterations such as inversions and balanced translocations.
[0077] CNVs can account for genetic variation affecting a substantial proportion of the human genome, for example, known CNVs can cover over 15% of the human genome sequence (Estivill, X Armengol; L., PLoS Genetics 3: 1787-99 (2007)). CNVs can affect gene expression, phenotypic variation and adaptation by disrupting gene dosage, and can cause disease, for example, microdeletion and microduplication disorders, and can confer susceptibility to diseases and disorders. Updated information about the location, type, and size of known CNVs can be found in one or more databases, for example, the Database of Genomic Variants (http://projects.tcag.ca/variation/), which currently contains data for over 66,000 CNVs (as of Nov. 2, 2010).
Other types of sequence variants can be found in the human genome and can be associated with a disease or disorder, including but not limited to, microsatellites. Microsatellite markers are stable, polymorphic, easily analyzed, and can occur regularly throughout the genome, making them especially suitable for genetic analysis. A polymorphic microsatellite can comprise multiple small repeats of bases, for example, CA repeats, at a particular site wherein the number of repeat lengths varies in a population. In some embodiments, microsatellites, for example, variable number of tandem repeats (VNTRs), can be short segments of DNA that have one or more repeated sequences, for example, about 2 to 5 nucleotides long, that can occur in non-coding DNA. In some embodiments, changes in microsatellites can occur during genetic recombination of sexual reproduction, increasing or decreasing the number of repeats found at an allele, or changing allele length.
Developmental Disorders
[0078] Developmental disorders are disorders that occur at some stage in a child's development, often retarding the development, including psychological or physical disorders. In some embodiments, they can be distinguished into specific developmental disorders including Pervasive Developmental Disorders (PDDs) and Pervasive Developmental Disorder-Not Otherwise Specified (PDD-NOS). A PDD can comprise ASD. Generally, symptoms that may be present to some degree in a subject of the present disclosure with a PDD can include difficulty with verbal communication, including problems using and understanding language, difficulty with non-verbal communication, such as gestures and facial expressions such as smiling, difficulty with social interaction, including relating to people and to his or her surroundings, unusual ways of playing with toys and other objects, difficulty adjusting to changes in routine or familiar surroundings, repetitive body movements or patterns of behavior, such as hand flapping, spinning, and head banging, changing response to sound, temper tantrums, difficulty sleeping, aggressive behavior, and/or fearfulness or anxiety. ASD can be defined by a certain set of behaviors that can range from the very mild to the severe. Possible indicators of ASDs include a subject whom does not babble, point, or make meaningful gestures by 1 year of age; does not speak one word by 16 months, does not combine two words by 2 years, does not respond to their name, and/or loses language or social skills. Other symptoms include qualitative impairment in social interaction, as manifested by marked impairments in the use of multiple nonverbal behaviors such as eye-to-eye gaze, facial expression, body posture, and gestures to regulate social interaction, failure to develop peer relationships appropriate to developmental level, a lack of spontaneous seeking to share enjoyment, interests, or achievements with other people, (e.g., by a lack of showing, bringing, or pointing out objects of interest to other people), or lack of social or emotional reciprocity (note: in the description, it gives the following as examples: not actively participating in simple social play or games, preferring solitary activities, or involving others in activities only as tools or mechanical aids). Symptoms of Autism can also include qualitative impairments in communication as manifested by delay in, or total lack of, the development of spoken language (not accompanied by an attempt to compensate through alternative modes of communication such as gesture or mime), in individuals with adequate speech, marked impairment in the ability to initiate or sustain a conversation with others, stereotyped and repetitive use of language or idiosyncratic language, or lack of varied, spontaneous make-believe play or social imitative play appropriate to developmental level. Other symptoms of Autism include restricted repetitive and stereotyped patterns of behavior, interests and activities, as manifested by encompassing preoccupation with one or more stereotyped and restricted patterns of interest that is abnormal either in intensity or focus, apparently inflexible adherence to specific, nonfunctional routines or rituals, stereotyped and repetitive motor mannerisms (e.g hand or finger flapping or twisting, or complex whole-body movements), or persistent preoccupation with parts of objects. Other symptoms of Autism include delays or abnormal functioning in at areas, with onset prior to age 3 years including social interaction, language as used in social communication and symbolic or imaginative play
As described herein, Pervasive Developmental Disorders-Not Otherwise Specified (PDD-NOS) can comprise Asperger Syndrome, Rett Syndrome, fragile X syndrome, and/or Childhood Disintegrative Disorder. In some embodiments a screening of PDD-NOS can be a screening of being on the autism spectrum, but not falling within any of the existing specific categories of autism. PDD-NOS is a pervasive developmental disorder (PDD)/autism spectrum disorder (ASD) and is often referred to as atypical autism.
[0079] Symptoms of Asperger Syndrome can include qualitative impairment in social interaction, marked impairments in the use of multiple nonverbal behaviors such as eye-to-eye gaze, facial expression, body posture, and gestures to regulate social interaction, failure to develop peer relationships appropriate to developmental level a lack of spontaneous seeking to share enjoyment, interest or achievements with other people, (e.g., by a lack of showing, bringing, or pointing out objects of interest to other people) and lack of social or emotional reciprocity. Other symptoms can include restricted repetitive & stereotyped patterns of behavior, interests and activities, encompassing preoccupation with one or more stereotyped and restricted patterns of interest that is abnormal either in intensity or focus apparently inflexible adherence to specific, nonfunctional routines or rituals stereotyped and repetitive motor mannerisms (e g hand or finger flapping or twisting, or complex whole-body movements) and persistent preoccupation with parts of objects and clinically significant impairments in social, occupational, or other important areas of functioning. There may be no clinically significant general delay in language (for example, single words used by age 2 years, communicative phrases used by age 3 years). There may be no clinically significant delay in cognitive development or in the development of age-appropriate self help skills, adaptive behavior (other than in social interaction) and curiosity about the environment in childhood.
[0080] Although apparently normal prenatal and perinatal development, apparently normal psychomotor development through the first 5 months after birth, normal head circumference at birth are observed, symptoms of Rett Syndrome begin after the period of normal development and include deceleration of head growth between ages 5 and 48 months, loss of previously acquired purposeful hand skills between ages 5 and 30 months with the subsequent development of stereotyped hand movements (i e, hand-wringing or hand washing), loss of social engagement early in the course (although often social interaction develops later), appearance of poorly coordinated gait or trunk movements, and severely impaired expressive and receptive language development with severe psychomotor retardation.
[0081] Although apparently normal development occurs for at least the first 2 years after birth, Childhood Disintegrative Disorder symptoms manifest by the presence of age-appropriate verbal and nonverbal communication, social relationships, play, and adaptive behavior. Symptoms include clinically significant loss of previously acquired skills (before age 10 years) including expressive or receptive language, social skills or adaptive behavior, bowel or bladder control, play, and motor skills. Other symptoms include abnormalities of functioning in areas including qualitative impairment in social interaction (e.g., impairment in nonverbal behaviors, failure to develop peer relationships, lack of social or emotional reciprocity), qualitative impairments in communication (e.g., delay or lack of spoken language, inability to initiate or sustain a conversation, stereotyped and repetitive use of language, lack of varied make-believe play), and restricted, repetitive, and stereotyped patterns of behavior, interests, and activities, including motor stereotypies and mannerisms.
Subjects
[0082] A subject, as used herein, can be an individual of any age or sex from whom a sample containing nucleotides is obtained for analysis by one or more methods described herein so as to obtain genetic data, for example, a male or female adult, child, newborn, or fetus. In some embodiments, a subject can be any target of therapeutic administration. In some embodiments, a subject can be a test subject or a reference subject. In some embodiments, a subject can be associated with a condition or disease or disorder, asymptomatic or symptomatic, have increased or decreased susceptibility to a disease or disorder, be associated or unassociated with a treatment or treatment regimen, or any combination thereof. As used in the present disclosure a cohort can represent an ethnic group, a patient group, a particular age group, a group not associated with a particular disease or disorder, a group associated with a particular disease or disorder, a group of asymptomatic subjects, a group of symptomatic subjects, or a group or subgroup of subjects associated with a particular response to a treatment regimen or clinical trial. In some embodiments, a patient can be a subject afflicted with a disease or disorder. In some embodiments, a patient can be a subject not afflicted with a disease or disorder. In some embodiments, a subject can be a test subject, a patient or a candidate for a therapeutic, wherein genomic DNA from said subject, patient, or candidate is obtained for analysis by one or more methods of the present disclosure herein, so as to obtain genetic variation information of said subject, patient or candidate.
[0083] In some embodiments, the sample can be obtained prenatally from a fetus or embryo or from the mother, for example, from fetal or embryonic cells in the maternal circulation. In some embodiments, the sample can be obtained with the assistance of a health care provider, for example, to draw blood. In some embodiments, the sample can be obtained without the assistance of a health care provider, for example, where the sample is obtained non-invasively, such as a sample comprising buccal cells that is obtained using a buccal swab or brush, or a mouthwash sample.
[0084] The present disclosure also provides methods for assessing genetic variations in subjects who are members of a target population. Such a target population is in some embodiments a population or group of subjects at risk of developing the disease, based on, for example, other genetic factors, biomarkers, biophysical parameters, family history of a developmental disorder, previous screening or medical history, or any combination thereof.
[0085] Although ASD is known to affect children to a higher extent than adults, subjects of all ages are contemplated in the present disclosure. In some embodiments subjects can be from specific age subgroups, such as those over the age of 1, over the age of 2, over the age of 3, over the age of 4, over the age of 5, over the age of 6, over the age of 7, over the age of 8, over the age of 9, over the age of 10, over the age of 15, over the age of 20, over the age of 25, over the age of 30, over the age of 35, over the age of 40, over the age of 45, over the age of 50, over the age of 55, over the age of 60, over the age of 65, over the age of 70, over the age of 75, over the age of 80, or over the age of 85. Other embodiments of the disclosure pertain to other age groups, such as subjects aged less than 85, such as less than age 80, less than age 75, less than age 70, less than age 65, less than age 60, less than age 55, less than age 50, less than age 45, less than age 40, less than age 35, less than age 30, less than age 25, less than age 20, less than age 15, less than age 10, less than age 9, less than age 8, less than age 6, less than age 5, less than age 4, less than age 3, less than age 2, or less than age 1. Other embodiments relate to subjects with age at onset of the disease in any of particular age or age ranges defined by the numerical values described in the above or other numerical values bridging these numbers. It is also contemplated that a range of ages can be relevant in certain embodiments, such as age at onset at more than age 15 but less than age 20. Other age ranges are however also contemplated, including all age ranges bracketed by the age values listed in the above.
[0086] The genetic variations of the present disclosure found to be associated with a developmental disorder can show similar association in other human populations. Particular embodiments comprising subject human populations are thus also contemplated and within the scope of the disclosure. Such embodiments relate to human subjects that are from one or more human populations including, but not limited to, Caucasian, European, American, Eurasian, Asian, Central/South Asian, East Asian, Middle Eastern, African, Hispanic, and Oceanic populations. European populations include, but are not limited to, Swedish, Norwegian, Finnish, Russian, Danish, Icelandic, Irish, Kelt, English, Scottish, Dutch, Belgian, French, German, Spanish, Portuguese, Italian, Polish, Bulgarian, Slavic, Serbian, Bosnian, Czech, Greek and Turkish populations. The racial contribution in subject subjects can also be determined by genetic analysis, for example, genetic analysis of ancestry can be carried out using unlinked microsatellite markers such as those set out in Smith et al. (Am J Hum Genet 74, 1001-13 (2004))
[0087] It is also well known to the person skilled in the art that certain genetic variations have different population frequencies in different populations, or are polymorphic in one population but not in another. A person skilled in the art can however apply the methods available and as thought herein to practice the present disclosure in any given human population. This can include assessment of genetic variations of the present disclosure, so as to identify those markers that give strongest association within the specific population. Thus, the at-risk variants of the present disclosure can reside on different haplotype background and in different frequencies in various human populations.
Samples
[0088] Samples that are suitable for use in the methods described herein can be from a subject and can contain genetic or proteinaceous material, for example, genomic DNA (gDNA). Genetic material can be extracted from one or more biological samples including but not limited to, blood, saliva, urine, mucosal scrapings of the lining of the mouth, expectorant, serum, tears, skin, tissue, or hair.
[0089] In some embodiments, the sample can comprise cells or tissue, for example, cell lines. Exemplary cell types from which genetic material can be obtained using the methods described herein and include but are not limited to, a blood cell; such as a B lymphocyte, T lymphocyte, leukocyte, erythrocyte, macrophage, or neutrophil; a muscle cell such as a skeletal cell, smooth muscle cell or cardiac muscle cell; a germ cell, such as a sperm or egg; an epithelial cell; a connective tissue cell, such as an adipocyte, chondrocyte; fibroblast or osteoblast; a neuron; an astrocyte; a stromal cell; an organ specific cell, such as a kidney cell, pancreatic cell, liver cell, or a keratinocyte; a stem cell; or any cell that develops there from. A cell from which gDNA is obtained can be at a particular developmental level including, for example, a hematopoietic stem cell or a cell that arises from a hematopoietic stem cell such as a red blood cell, B lymphocyte, T lymphocyte, natural killer cell, neutrophil, basophil, eosinophil, monocyte, macrophage, or platelet. Generally any type of stem cell can be used including, without limitation, an embryonic stem cell, adult stem cell, or pluripotent stem cell.
[0090] In some embodiments, a sample can be processed for DNA isolation, for example, DNA in a cell or tissue sample can be separated from other components of the sample. Cells can be harvested from a biological sample using standard techniques known in the art, for example, by centrifuging a cell sample and resuspending the pelleted cells, for example, in a buffered solution, for example, phosphate-buffered saline (PBS). In some embodiments, after centrifuging the cell suspension to obtain a cell pellet, the cells can be lysed to extract DNA. In some embodiments, the sample can be concentrated and/or purified to isolate DNA. All samples obtained from a subject, including those subjected to any sort of further processing, are considered to be obtained from the subject. In some embodiments, standard techniques and kits known in the art can be used to extract genomic DNA from a biological sample, including, for example, phenol extraction, a QIAamp Tissue Kit (Qiagen, Chatsworth, Calif.), a Wizard Genomic DNA purification kit (Promega), or a Qiagen Autopure method using Puregene chemistry, which can enable purification of highly stable DNA well-suited for archiving.
[0091] In some embodiments, determining the identity of an allele or determining copy number can, but need not, include obtaining a sample comprising DNA from a subject, and/or assessing the identity, copy number, presence or absence of one or more genetic variations and their chromosomal locations in the sample. The individual or organization that performs the determination need not actually carry out the physical analysis of a sample from a subject. In some embodiments, the methods can include using information obtained by analysis of the sample by a third party. In some embodiments, the methods can include steps that occur at more than one site. For example, a sample can be obtained from a subject at a first site, such as at a health care provider or at the subject's home in the case of a self-testing kit. The sample can be analyzed at the same or a second site, for example, at a laboratory or other testing facility.
Methods of Screening
[0092] As used herein, screening a subject comprises diagnosing or determining, theranosing, or determining the susceptibility to developing (prognosing) a developmental disorder, for example, ASD. In particular embodiments, the disclosure is a method of determining a presence of, or a susceptibility to, a developmental disorder, by detecting at least one genetic variation in a sample from a subject as described herein. In some embodiments, detection of particular alleles, markers, variations, or haplotypes is indicative of a presence or susceptibility to a developmental disorder. Although there can be many concerns about screening a subject with an ASD, the earlier the screening of ASD is made, the earlier needed interventions can begin. Evidence over the last 15 years indicates that intensive early intervention in optimal educational settings for at least 2 years during the preschool years results in improved outcomes in most young children with ASD. In evaluating a child, clinicians rely on behavioral characteristics to make a diagnosis, prognosis, or theranosis. Some of the characteristic behaviors of ASD may be apparent in the first few months of a child's life, or they may appear at any time during the early years. For the screening problems in at least one of the areas of communication, socialization, or restricted behavior must be present before the age of 3. The screening requires a two-stage process. The first stage involves developmental screening during well-child check-ups; the second stage entails a comprehensive evaluation by a multidisciplinary team. A well child check-up should include a developmental screening test. Several screening instruments have been developed to quickly gather information about a child's social and communicative development within medical settings. Among them are the Checklist of Autism in Toddlers (CHAT), the modified Checklist for Autism in Toddlers (M-CHAT), the Screening Tool for Autism in Two-Year-Olds (STAT), and the Social Communication Questionnaire (SCQ) for children 4 years of age and older. Some screening instruments rely solely on parent responses to a questionnaire, and some rely on a combination of parent report and observation. Key items on these instruments that appear to differentiate children with autism from other groups before the age of 2 include pointing and pretend play. Screening instruments do not provide individual diagnosis, prognosis, or theranosis, but serve to assess the need for referral for possible screening of ASD. These screening methods may not identify children with mild ASD, such as those with high-functioning autism or Asperger syndrome. The second stage of screening must be comprehensive in order to accurately rule in or rule out an ASD or other developmental problem. This evaluation may be done by a multidisciplinary team that includes a psychologist, a neurologist, a psychiatrist, a speech therapist, or other professionals who screen children with ASD. Because ASDs are complex disorders and may involve other developmental or genetic problems, a comprehensive evaluation should entail developmental and genetic assessment, along with in-depth cognitive and language testing. In addition, measures developed specifically for screening autism are often used. These include the Autism Diagnosis Interview-Revised (ADI-R) and the Autism Diagnostic Observation Schedule (ADOS-G). The ADI-R is a structured interview that contains over 100 items and is conducted with a caregiver. It consists of four main factors including the child's communication, social interaction, repetitive behaviors, and age-of-onset symptoms. The ADOS-G is an observational measure used to press for socio-communicative behaviors that are often delayed, abnormal, or absent in children with ASD. Still another instrument often used by professionals is the Childhood Autism Rating Scale (CARS). It can aid in evaluating the child's body movements, adaptation to change, listening response, verbal communication, and relationship to people. It is suitable for use with children over 2 years of age. The examiner observes the child and also obtains relevant information from the parents. The child's behavior is rated on a scale based on deviation from the typical behavior of children of the same age. Two other tests that can be used to assess any child with a developmental delay are a formal audiologic hearing evaluation and a lead screening. Although some hearing loss can co-occur with ASD, some children with ASD may be incorrectly thought to have such a loss. In addition, if the child has suffered from an ear infection, transient hearing loss can occur. Lead screening is essential for children who remain for a long period of time in the oral-motor stage in which they put any and everything into their mouths. Children with an autistic disorder usually have elevated blood lead levels. Customarily, an expert screening team has the responsibility of thoroughly evaluating the child, assessing the child's unique strengths and weaknesses, and determining a formal screen. The team will then meet with the parents to explain the results of the evaluation.
[0093] PDD-NOS is typically screened by psychologists and Pediatric Neurologists. No singular specific test can be administered to determine whether or not a child is on the spectrum. Screening can be made through observations, questionnaires, and tests. A parent will usually initiate the quest into the screening with questions for their child's pediatrician about their child's development after noticing abnormalities. From there, doctors will ask questions to gauge the child's development in comparison to age-appropriate milestones. One test that measures this is the Modified Checklist of Autism in Toddlers (MCHAT). This is a list of questions whose answers will determine whether or not the child should be referred to a specialist such as a developmental pediatrician, a neurologist, a psychiatrist, or a psychologist. Another checklist, the DSM-IV is a series of characteristics and criteria to qualify for an autism diagnosis. Because PDD-NOS is a spectrum disorder, not every child shows the same signs. The two main characteristics of the disorder are difficulties with social interaction skills and communication. Signs are often visible in babies but a diagnosis is usually not made until around age 4. Even though PDD-NOS is considered milder than typical autism, this is not always true. While some characteristics may be milder, others may be more severe. Once a child with PDD-NOS enters school, he or she will often be very eager to interact with classmates, but may act socially different to peers and be unable to make genuine connections. As they age, the closest connections they make are typically with their parents. Children with PDD-NOS have difficulty reading facial expressions and relating to feelings of others. They may not know how to respond when someone is laughing or crying. Literal thinking is also characteristic of PDD-NOS. They will most likely have difficulty understanding figurative speech and sarcasm Inhibited communication skills are a sign of PDD-NOS that begins immediately after birth. As an infant, they will not babble, and as they age, they do not speak when age appropriate. Once verbal communication begins, their vocabulary is often limited. Some characteristics of language-based patterns are: repetitive or rigid language, narrow interests, uneven language development, and poor nonverbal communication. A very common characteristic of PDD-NOS is severe difficulty grasping the difference between pronouns, particularly between you and me when conversing. During the last few years, screening instruments have been devised to screen for Asperger syndrome and higher functioning autism. The Autism Spectrum Screening Questionnaire (ASSQ), the Australian Scale for Asperger's Syndrome, and the most recent, the Childhood Asperger Syndrome Test (CAST), are some of the instruments that are reliable for identification of school-age children with Asperger syndrome or higher functioning autism. These tools concentrate on social and behavioral impairments in children without significant language delay. If, following the screening process or during a routine well child check-up, a subject's doctor sees any of the possible indicators of ASD, further evaluation is indicated.
[0094] While means for screening ASDs exist, many times symptoms go unnoticed until late in childhood or symptoms are so minor they are left unnoticed. Thus there exists a need for an improved ASD screening test. Described herein are methods of screening an individual for one or more developmental disorders, including but not limited to, determining the identity and location of genetic variations, such as variations in nucleotide sequence and copy number, and the presence or absence of alleles or genotypes in one or more samples from one or more subjects using any of the methods described herein. In some embodiments, determining an association to having or developing a developmental disorder can be performed by detecting particular variations that appear more frequently in test subjects compared to reference subjects and analyzing the molecular and physiological pathways these variations can affect.
[0095] Within any given population, there can be an absolute susceptibility of developing a disease or trait, defined as the chance of a person developing the specific disease or trait over a specified time-period. Susceptibility (e.g. being at-risk) is typically measured by looking at very large numbers of people, rather than at a particular individual. As described herein, certain copy number variations (genetic variations) are found to be useful for susceptibility assessment of a developmental disorder. Susceptibility assessment can involve detecting particular genetic variations in the genome of individuals undergoing assessment. Particular genetic variations are found more frequently in individuals with a developmental disorder, than in individuals without screening of a developmental disorder. Therefore, these genetic variations have predictive value for detecting a developmental disorder, or a susceptibility to a developmental disorder, in an individual. Without intending to be limited by theory, it is believed that the genetic variations described herein to be associated with susceptibility of a developmental disorder represent functional variants predisposing to the disease. In some embodiments, a genetic variation can confer a susceptibility of the condition, for example, carriers of the genetic variation are at a different risk of the condition than non-carriers. In a preferred embodiment, the presence of a genetic variation is indicative of increased susceptibility to a developmental disorder, such as ASD.
[0096] In some embodiments, screening can be performed using any of the methods disclosed, alone or in combination. In some embodiments, screening can be performed using Polymerase Chain Reaction (PCR). In a preferred embodiment screening can be performed using Array Comparative Genomic Hybridization (aCGH). In some embodiments, the genetic variation information as it relates to the current disclosure can be used in conjunction with any of the above mentioned symptomatic screening tests to screen a subject for ASD, for example, using a combination of aCGH and a childhood screening test, such as the Checklist of Autism in Toddlers (CHAT).
[0097] In some embodiments, information from any of the above screening methods (e.g. specific symptoms, scoring matrix, or genetic variation data) can be used to define a subject as a test subject or reference subject. In some embodiments, information from any of the above screening methods can be used to associate a subject with a test or reference population, for example, a subject in a population. In the present study, for example, all the probands in Tables 1 and 5 met the criteria for autism on one or both of the screening measures including the Autism Diagnostic Interview-Revised (ADI-R) training and the Autism Diagnostic Observation Schedule (ADOS) training.
[0098] In one embodiment, an association with a developmental disorder can determined by the statistical likelihood of the presence of a genetic variation in a subject with a developmental disorder, for example, an unrelated individual or a first or second-degree relation of the subject. In some embodiments, an association with a developmental disorder can be determined by determining the statistical likelihood of the absence of a genetic variation in an unaffected reference subject, for example, an unrelated individual or a first or second-degree relation of the subject. The methods described herein can include obtaining and analyzing a sample from one or more suitable reference subjects.
[0099] In the present context, the term screening comprises diagnosis, prognosis, and theranosis. Screening can refer to any available screening method, including those mentioned herein. As used herein, susceptibility can be proneness of a subject towards the development of a developmental condition, or towards being less able to resist a particular developmental condition than one or more control subjects. In some embodiments, susceptibility can encompass increased susceptibility. For example, particular nucleic acid variations of the disclosure as described herein can be characteristic of increased susceptibility to development of a developmental disorder. In some embodiments, susceptibility can encompass decreased susceptibility, for example, particular nucleic variations of the disclosure as described herein can be characteristic of decreased susceptibility to development of a developmental disorder.
[0100] As described herein, a genetic variation predictive of susceptibility to or presence of a developmental disorder can be one where the particular genetic variation is more frequently present in a subject with the condition (affected), compared to the frequency of its presence in a reference group (control), such that the presence of the genetic variation is indicative of susceptibility to or presence of the developmental disorder. In some embodiments, the reference group can be a population sample, for example, a random sample from the general population or a mixture of two or more samples from a population. In some embodiments, disease-free controls can be characterized by the absence of one or more specific disease-associated symptoms, for example, individuals who have not experienced symptoms associated with a developmental disorder. In another embodiment, the disease-free control group is characterized by the absence of one or more disease-specific risk factors, for example, at least one genetic and/or environmental risk factor. In some embodiments, a reference sequence can be referred to for a particular site of genetic variation. In some embodiments, a reference allele can be a wild-type allele and can be chosen as either the first sequenced allele or as the allele from a control individual. In some embodiments, one or more reference subjects can be characteristically matched with one or more affected subjects, for example, with matched aged, gender or ethnicity.
[0101] A person skilled in the art will appreciate that for genetic variations with two alleles present in the population being studied, and wherein one allele can found in increased frequency in a group of individuals with a developmental disorder in the population, compared with controls, the other allele of the marker can be found in decreased frequency in the group of individuals with the trait or disease, compared with controls. In such a case, one allele of the marker, for example, the allele found in increased frequency in individuals with a developmental disorder, can be the at-risk allele, while the other allele can be a neutral or protective allele.
[0102] A genetic variant associated with a developmental disorder can be used to predict the susceptibility of the disease for a given genotype. For any genetic variation, there can be one or more possible genotypes, for example, homozygote for the at-risk variant (e.g., in autosomal recessive disorders), heterozygote, and non-carrier of the at-risk variant. In some embodiments, susceptibility associated with variants at multiple loci can be used to estimate overall susceptibility. For multiple genetic variants, there can be k (k=3{umlaut over ()}n*2{circumflex over ()}P) possible genotypes; wherein n can be the number of autosomal loci and p can be the number of gonosomal (sex chromosomal) loci. Overall susceptibility assessment calculations can assume that the relative susceptibilities of different genetic variants multiply, for example, the overall susceptibility associated with a particular genotype combination can be the product of the susceptibility values for the genotype at each locus. If the susceptibility presented is the relative susceptibility for a person, or a specific genotype for a person, compared to a reference population, then the combined susceptibility can be the product of the locus specific susceptibility values and can correspond to an overall susceptibility estimate compared with a population. If the susceptibility for a person is based on a comparison to non-carriers of the at-risk allele, then the combined susceptibility can correspond to an estimate that compares the person with a given combination of genotypes at all loci to a group of individuals who do not carry at-risk variants at any of those loci. The group of non-carriers of any at-risk variant can have the lowest estimated susceptibility and can have a combined susceptibility, compared with itself, for example, non-carriers, of 1.0, but can have an overall susceptibility, compared with the population, of less than 1.0.
[0103] Overall risk for multiple risk variants can be performed using standard methodology. Genetic variations described herein can form the basis of risk analysis that combines other genetic variations known to increase risk of a developmental disorder, or other genetic risk variants for a developmental disorder. In certain embodiments of the disclosure, a plurality of variants (genetic variations, variant alleles, and/or haplotypes) can be used for overall risk assessment. These variants are in some embodiments selected from the genetic variations as disclosed herein. Other embodiments include the use of the variants of the present disclosure in combination with other variants known to be useful for screening a susceptibility to a developmental disorder. In such embodiments, the genotype status of a plurality of genetic variations, markers and/or haplotypes is determined in an individual, and the status of the individual compared with the population frequency of the associated variants, or the frequency of the variants in clinically healthy subjects, such as age-matched and sex-matched subjects.
[0104] Methods known in the art, such as the use of available algorithms and software can be used to identify, or call, significant genetic variations, including but not limited to, algorithms of DNA Analytics or DNAcopy, iPattern and/or QuantiSNP. For example, an Aberration Detection Module 2 (ADM2) algorithm, such as that of DNA Analytics 4.0.85 can be used to identify, or call, significant genetic variations. In some embodiments, two or more algorithms can be used to identify, or call, significant genetic variations. For example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more algorithms can be used to identify, or call, significant genetic variations. In some embodiments, significant genetic variations can be CNVs.
[0105] CNVs detected by 2 or more algorithms can be defined as stringent and can be utilized for further analyses. In some embodiments, the information and calls from two or more of the methods described herein can be compared to each other to identify significant genetic variations more or less stringently. For example, CNV calls generated by both Aberration Detection Module 2 (ADM2) algorithms and DNAcopy algorithms can be defined as stringent CNVs. In some embodiments, significant or stringent genetic variations can be tagged as identified or called if it can be found to have a minimal reciprocal overlap to a genetic variation detected by one or more platforms and/or methods described herein. For example, significant or stringent genetic variations can be tagged as identified or called if it can be found to have a reciprocal overlap of more than about 50%, 55% 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, 99%, or equal to 100%, to a genetic variation detected by one or more platforms and/or methods described herein. For example, significant or stringent genetic variations can be tagged as identified or called if it can be found to have a reciprocal overlap of more than about 50% reciprocal overlap to a genetic variation detected by one or more platforms and/or methods described herein.
[0106] In some embodiments, a threshold log ratio value can be used to determine losses and gains. A log ratio value can be any log ratio value; for example, a log ratio value can be a log 2 ratio or a log 10 ratio. In some embodiments, a CNV segment whose median log 2 ratio is less than or equal to a log 2 ratio threshold value can be classified as a loss. For example, any segment whose median log 2 ratio is less than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or less, can be classified as a loss.
[0107] In some embodiments, one algorithm can be used to call or identify significant genetic variations, wherein any segment whose median log 2 ratio was less than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or less, can be classified as a loss. For example, any CNV segment whose median log 2 ratio is less than 0.35 as determined by DNAcopy can be classified as a loss. For example, losses can be determined according to a threshold log 2 ratio, which can be set at 0.35.
[0108] In some embodiments, two algorithms can be used to call or identify significant genetic variations, wherein any segment whose median log 2 ratio is less than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or less, as determined by one algorithm, and wherein any segment whose median log 2 ratio is less than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or less, as determined by the other algorithm can be classified as a loss. For example, CNV calling can comprise using the Aberration Detection Module 2 (ADM2) algorithm and the DNAcopy algorithm, wherein losses can be determined according to a two threshold log 2 ratios, wherein the Aberration Detection Module 2 (ADM2) algorithm log 2 ratio can be 0.25 and the DNAcopy algorithm log 2 ratio can be 0.41.
[0109] In some embodiments, the use of two algorithms to call or identify significant genetic variations can be a stringent method. In some embodiments, the use of two algorithms to call or identify significant genetic variations can be a more stringent method compared to the use of one algorithm to call or identify significant genetic variations.
[0110] In some embodiments, any CNV segment whose median log 2 ratio is greater than a log 2 ratio threshold value can be classified as a gain. For example, any segment whose median log 2 ratio is greater than 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, or more can be classified as a gain.
[0111] In some embodiments, one algorithm can be used to call or identify significant genetic variations, wherein any segment whose median log 2 ratio is greater than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, or more can be classified as a gain. For example, any CNV segment whose median log 2 ratio is greater than 0.35 as determined by DNAcopy can be classified as a gain. For example, gains can be determined according to a threshold log 2 ratio, which can be set at 0.35.
[0112] In some embodiments, two algorithms can be used to call or identify significant genetic variations, wherein any segment whose median log 2 ratio is greater than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3 or more, as determined by one algorithm, and wherein any segment whose median log 2 ratio is greater than or equal to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, or more, as determined by the other algorithm the can be classified as a gain. For example, CNV calling can comprise using the Aberration Detection Module 2 (ADM2) algorithm and the DNAcopy algorithm, wherein gains can be determined according to a two threshold log 2 ratios, wherein the Aberration Detection Module 2 (ADM2) algorithm log 2 ratio can be 0.25 and the DNAcopy algorithm log 2 ratio can be 0.32.
[0113] Any CNV segment whose absolute (median log-ratio/mad) value is less than 2 can be excluded (not identified as a significant genetic variation). For example, any CNV segment whose absolute (median log-ratio/mad) value is less than 2, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1, 0.9, 0.8, 0.7, 0.6, or 0.5 or less can be excluded.
[0114] In some embodiments, multivariate analyses or joint risk analyses, including the use of multiplicative model for overall risk assessment, and can subsequently be used to determine the overall risk conferred based on the genotype status at the multiple loci. Use of a multiplicative model, for example, assuming that the risk of individual risk variants multiply to establish the overall effect, allows for a straight-forward calculation of the overall risk for multiple markers. The multiplicative model is a parsimonious model that usually fits the data of complex traits reasonably well. Deviations from multiplicity have been rarely described in the context of common variants for common diseases, and if reported are usually only suggestive since very large sample sizes are usually required to be able to demonstrate statistical interactions between loci. Assessment of risk based on such analysis can subsequently be used in the methods, uses and kits of the disclosure, as described herein.
[0115] In some embodiments, the significance of increased or decreased susceptibility can be measured by a percentage. In some embodiments, a significant increased susceptibility can be measured as a relative susceptibility of at least 1.2, including but not limited to: at least 1.5, at least 1.3, at least 1.4, at least 1.5, at least 1.6, at least 1.7, 1.8, at least 1.9, at least 2.0, at least 2.5, at least 3.0, at least 4.0, at least 5.0, at least 6.0, at least 7.0, at least 8.0, at least 9.0, at least 10.0, and at least 15.0. In some embodiments, a relative susceptibility of at least 2.0, at least 3.0, at least 4.0, at least, 5.0, at least 6.0, or at least 10.0 is significant. Other values for significant susceptibility are also contemplated, for example, at least 2.5, 3.5, 4.5, 5.5, or any suitable other numerical values, wherein said values are also within scope of the present disclosure. In some embodiments, a significant increase in susceptibility is at least about 20%, including but not limited to about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, and 1500%. In one particular embodiment, a significant increase in susceptibility is at least 100%. In other embodiments, a significant increase in susceptibility is at least 200%, at least 300%, at least 400%, at least 500%, at least 700%, at least 800%, at least 900% and at least 1000%. Other cutoffs or ranges as deemed suitable by the person skilled in the art to characterize the disclosure are also contemplated, and those are also within scope of the present disclosure. In certain embodiments, a significant increase in susceptibility is characterized by a p-value, such as a p-value of less than 0.5, less than 0.4, less than 0.3, less than 0.2, less than 0.1, less than 0.05, less than 0.01, less than 0.001, less than 0.0001, less than 0.00001, less than 0.000001, less than 0.0000001, less than 0.00000001, or less than 0.000000001.
[0116] In some embodiments, an individual who is at a decreased susceptibility for or the lack of presence of a developmental condition can be an individual in whom at least one genetic variation, conferring decreased susceptibility for or the lack of presence of the developmental disorder is identified. In some embodiments, the genetic variations conferring decreased susceptibility are also said to be protective. In one aspect, the genetic variations can confer a significant decreased susceptibility of or lack of presence of the developmental disorder.
[0117] In some embodiments, significant decreased susceptibility can be measured as a relative susceptibility of less than 0.9, including but not limited to less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2 and less than 0.1. In another embodiment, the decrease in susceptibility is at least 20%, including but not limited to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and at least 98%. Other cutoffs or ranges as deemed suitable by the person, skilled in the art to characterize the disclosure are however also contemplated, and those are also within scope of the present disclosure. In certain embodiments, a significant decrease in susceptibility is characterized by a p-value, such as a p-value of less than 0.05, less than 0.01, less than 0.001, less than 0.0001, less than 0.00001, less than 0.000001, less than 0.0000001, less than 0.00000001, or less than 0.000000001. Other tests for significance can be used, for example, a Fisher-exact test. Other statistical tests of significance known to the skilled person are also contemplated and are also within scope of the disclosure.
[0118] In some preferred embodiments, the significance of increased or decreased susceptibility can be determined according to the ratio of measurements from a test subject to a reference subject. In a preferred embodiment, losses or gains of one or more CNVs can be determined according to a threshold log.sub.2 ratio determined by these measurements. In some embodiments, a log.sub.2 ratio value greater than 0.35 is indicative of a gain of one or more CNVs. In some embodiments, a log.sub.2 ratio value less than 0.35 is indicative of a loss of one or more CNVs. In some embodiments, the ratio of measurements from a test subject to a reference subject may be inverted such that the log 2 ratios of copy number gains are negative and the log 2 ratios of copy number losses are positive.
[0119] In some embodiments, the combined or overall susceptibility associated with a plurality of variants associated with a developmental disorder can also be assessed; for example, the genetic variations described herein to be associated with susceptibility to a developmental disorder can be combined with other common genetic risk factors. Combined risk for such genetic variants can be estimated in an analogous fashion to the methods described herein.
[0120] Calculating risk conferred by a particular genotype for the individual can be based on comparing the genotype of the individual to previously determined risk expressed, for example, as a relative risk (RR) or an odds ratio (OR), for the genotype, for example, for a heterozygous carrier of an at-risk variant for a developmental disorder. An odds ratio can be a statistical measure used as a metric of causality. For example, in genetic disease research it can be used to convey the significance of a variant in a disease cohort relative to an unaffected/normal cohort. The calculated risk for the individual can be the relative risk for a subject, or for a specific genotype of a subject, compared to the average population. The average population risk can be expressed as a weighted average of the risks of different genotypes, using results from a reference population, and the appropriate calculations to calculate the risk of a genotype group relative to the population can then be performed. Alternatively, the risk for an individual can be based on a comparison of particular genotypes, for example, heterozygous carriers of an at-risk allele of a marker compared with non-carriers of the at-risk allele. Using the population average can, in certain embodiments, be more convenient, since it provides a measure which can be easy to interpret for the user, such as a measure that gives the risk for the individual, based on his/her genotype, compared with the average in the population.
[0121] In certain embodiments of the disclosure, a genetic variation is correlated to a developmental disorder by referencing genetic variation data to a look-up table that comprises correlations between the genetic variation and a developmental disorder. The genetic variation in certain embodiments comprises at least one indication of the genetic variation. In some embodiments, the table comprises a correlation for one genetic variation. In other embodiments, the table comprises a correlation for a plurality of genetic variations In both scenarios, by referencing to a look-up table that gives an indication of a correlation between a genetic variation and a developmental disorder, a risk for a developmental disorder, or a susceptibility to a developmental disorder, can be identified in the individual from whom the sample is derived.
[0122] The present disclosure also pertains to methods of clinical screening, for example, diagnosis, prognosis, or theranosis of a subject performed by a medical professional using the methods disclosed herein. In other embodiments, the disclosure pertains to methods of screening performed by a layman. The layman can be a customer of a genotyping service. The layman can also be a genotype service provider, who performs genotype analysis on a DNA sample from an individual, in order to provide service related to genetic risk factors for particular traits or diseases, based on the genotype status of the subject obtained from use of the methods described herein. The resulting genotype information can be made available to the individual and can be compared to information about developmental disorder or risk of developing a developmental disorder associated with various genetic variations, including but not limited to, information from public literature and scientific publications. The screening applications of developmental disorder-associated genetic variations, as described herein, can, for example, be performed by an individual, a health professional, or a third party, for example, a service provider who interprets genotype information from the subject.
[0123] The information derived from analyzing sequence data can be communicated to any particular body, including the individual from which the sample or sequence data is derived, a guardian or representative of the individual, clinician, research professional, medical professional, service provider, and medical insurer or insurance company. Medical professionals can be, for example, doctors, nurses, medical laboratory technologists, and pharmacists. Research professionals can be, for example, principle investigators, research technicians, postdoctoral trainees, and graduate students.
[0124] In some embodiments, a professional can be assisted by determining whether specific genetic variants are present in a biological sample from a subject, and communicating information about genetic variants to a professional. After information about specific genetic variants is reported, a medical professional can take one or more actions that can affect subject care. For example, a medical professional can record information in the subject's medical record regarding the subject's risk of developing a developmental disorder. In some embodiments, a medical professional can record information regarding risk assessment, or otherwise transform the subject's medical record, to reflect the subject's current medical condition. In some embodiments, a medical professional can review and evaluate a subject's entire medical record and assess multiple treatment strategies for clinical intervention of a subject's condition.
[0125] A medical professional can initiate or modify treatment after receiving information regarding a subject's screening of a developmental disorder, for example. In some embodiments, a medical professional can recommend a change in therapy. In some embodiments, a medical professional can enroll a subject in a clinical trial for, by way of example, detecting correlations between a haplotype as described herein and any measurable or quantifiable parameter relating to the outcome of the treatment as described above.
[0126] In some embodiments, a medical professional can communicate information regarding a subject's screening of developing a developmental disorder to a subject or a subject's family. In some embodiments, a medical professional can provide a subject and/or a subject's family with information regarding a developmental disorder and risk assessment information, including treatment options, and referrals to specialists. In some embodiments, a medical professional can provide a copy of a subject's medical records to a specialist. In some embodiments, a research professional can apply information regarding a subject's risk of developing a developmental disorder to advance scientific research. In some embodiments, a research professional can obtain a subject's haplotype as described herein to evaluate a subject's enrollment, or continued participation, in a research study or clinical trial. In some embodiments, a research professional can communicate information regarding a subject's screening of a developmental disorder to a medical professional. In some embodiments, a research professional can refer a subject to a medical professional.
[0127] Any appropriate method can be used to communicate information to another person. For example, information can be given directly or indirectly to a professional and laboratory technician can input a subject's genetic variation as described herein into a computer-based record. In some embodiments, information is communicated by making a physical alteration to medical or research records. For example, a medical professional can make a permanent notation or flag a medical record for communicating the risk assessment to other medical professionals reviewing the record. In addition, any type of communication can be used to communicate the risk assessment information. For example, mail, e-mail, telephone, and face-to-face interactions can be used. The information also can be communicated to a professional by making that information electronically available to the professional. For example, the information can be communicated to a professional by placing the information on a computer database such that the professional can access the information. In addition, the information can be communicated to a hospital, clinic, or research facility serving as an agent for the professional.
[0128] Results of these tests, and optionally interpretive information, can be returned to the subject, the health care provider or to a third party. The results can be communicated to the tested subject, for example, with a prognosis and optionally interpretive materials that can help the subject understand the test results and prognosis; used by a health care provider, for example, to determine whether to administer a specific drug, or whether a subject should be assigned to a specific category, for example, a category associated with a specific disease endophenotype, or with drug response or non-response; used by a third party such as a healthcare payer, for example, an insurance company or HMO, or other agency, to determine whether or not to reimburse a health care provider for services to the subject, or whether to approve the provision of services to the subject. For example, the healthcare payer can decide to reimburse a health care provider for treatments for a developmental disorder if the subject has a developmental disorder or has an increased risk of developing a developmental disorder.
[0129] Also provided herein are databases that include a list of genetic variations as described herein, and wherein the list can be largely or entirely limited to genetic variations identified as useful for screening a developmental disorder as described herein. The list can be stored, for example, on a flat file or computer-readable medium. The databases can further include information regarding one or more subjects, for example, whether a subject is affected or unaffected, clinical information such as endophenotype, age of onset of symptoms, any treatments administered and outcomes, for example, data relevant to pharmacogenomics, diagnostics, prognostics or theranostics, and other details, for example, data about the disorder in the subject, or environmental or other genetic factors. The databases can be used to detect correlations between a particular haplotype and the information regarding the subject.
[0130] The methods described herein can also include the generation of reports for use, for example, by a subject, care giver, or researcher, that include information regarding a subject's genetic variations, and optionally further information such as treatments administered, treatment history, medical history, predicted response, and actual response. The reports can be recorded in a tangible medium, e.g., a computer-readable disk, a solid state memory device, or an optical storage device.
Methods of Screening Using Variations in Polypeptides
[0131] In another embodiment of the disclosure, screening of a developmental disorder can be made by examining or comparing changes in expression, localization, binding partners, and composition of a polypeptide encoded by a nucleic acid associated with a developmental disorder, for example, in those instances where the genetic variations of the present disclosure results in a change in the composition or expression of the polypeptide. Thus, screening of a developmental disorder can be made by examining expression and/or composition of one of these polypeptides, or another polypeptide encoded by a nucleic acid associated with a developmental disorder, in those instances where the genetic variation of the present disclosure results in a change in the expression, localization, binding partners, and/or composition of the polypeptide. In some embodiments, screening can comprise diagnosing a subject. In some embodiments, screening can comprise determining a prognosis of a subject, for example, determining the susceptibility of developing a developmental disorder. In some embodiments, screening can comprise theranosing a subject.
[0132] The genetic variations described herein that show association to a developmental disorder can play a role through their effect on one or more of these nearby genes. For example, while not intending to be limited by theory, it is generally expected that a deletion of a chromosomal segment comprising a particular gene, or a fragment of a gene, can either result in an altered composition or expression, or both, of the encoded protein. Likewise, duplications, or high number copy number variations, are in general expected to result in increased expression of encoded polypeptide. Other possible mechanisms affecting genes within a genetic variation region include, for example, effects on transcription, effects on RNA splicing, alterations in relative amounts of alternative splice forms of mRNA, effects on RNA stability, effects on transport from the nucleus to cytoplasm, and effects on the efficiency and accuracy of translation. Thus, DNA variations can be detected directly, using the subjects unamplified or amplied genomic DNA, or indirectly, using RNA or DNA obtained from the subject's tissue(s) that are present in an aberrant form or expression level as a result of the genetic variations of the disclosure showing association to ASD.
[0133] In some embodiments, the genetic variations of the disclosure showing association to a developmental disorder can affect the expression of a gene within the genetic variation region. In some embodiments, a genetic variation affecting an exonic region of a gene can affect, disrupt, or modulate the expression of the gene. In some embodiments, a genetic variation affecting an intergenic region of a gene can affect, disrupt, or modulate the expression of the gene. Certain genetic variation regions can have flanking duplicated segments, and genes within such segments can have altered expression and/or composition as a result of such genomic alterations. Regulatory elements affecting gene expression can be located far away, even as far as tens or hundreds of kilobases away, from the promoter region of a gene. Thus, in some embodiments, regulatory elements for genes that are located outside the genetic variation region can be located within the genetic variation, and can be affected by the genetic variation. It is thus contemplated that the detection of the genetic variations described herein, can be used for assessing expression for one or more of associated genes not directly impacted by the genetic variations. In some embodiments, a genetic variation affecting an intergenic region of a gene can affect, disrupt, or modulate the expression of a gene located elsewhere in the genome, such as described above. For example, a genetic variation affecting an intergenic region of a gene can affect, disrupt, or modulate the expression of a transcription factor, located elsewhere in the genome, which regulates the gene.
[0134] In some embodiments, genetic variations of the disclosure showing association to ASD can affect protein expression at the translational level. It can be appreciated by those skilled in the art that this can occur by increased or decreased expression of one or more microRNAs (miRNAs) that regulates expression of a protein known to be important, or implicated, in the cause, onset, or progression of ASD. Increased or decreased expression of the one or more miRNAs can result from gain or loss of the whole miRNA gene, disruption of a portion of the gene (e.g., by an indel or CNV), or even a single base change (SNP or SNV) that produces an altered, non-functional or aberrant functioning miRNA sequence. It can also be appreciated by those skilled in the art that the expression of protein, for example, one known to cause ASD by increased or decreased expression, can result due to a genetic variation that results in alteration of an existing miRNA binding site within the protein's mRNA transcript, or even creates a new miRNA binding site that leads to aberrant protein expression.
[0135] A variety of methods can be used for detecting protein composition and/or expression levels, including but not limited to enzyme linked immunosorbent assays (ELISA), Western blots, spectroscopy, mass spectrometry, peptide arrays, colorimetry, electrophoresis, isoelectric focusing, immunoprecipitations, immunoassays, and immunofluorescence and other methods well-known in the art. A test sample from a subject can be assessed for the presence of an alteration in the expression and/or an alteration in composition of the polypeptide encoded by a nucleic acid associated with a developmental disorder. An alteration in the polypeptide expression or composition, as used herein, refers to an alteration in expression or composition in a test sample, as compared to the expression or composition of the polypeptide in a control sample. Such alteration can, for example, be an alteration in the quantitative polypeptide expression or can be an alteration in the qualitative polypeptide expression, for example, expression of a mutant polypeptide or of a different splicing variant, or a combination thereof. In some embodiments, screening of a developmental disorder can be made by detecting a particular splicing variant encoded by a nucleic acid associated with a developmental disorder, or a particular pattern of splicing variants.
[0136] Antibodies can be polyclonal or monoclonal and can be labeled or unlabeled. An intact antibody, or a fragment thereof can be used. The term labeled, with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled as previously described herein. Other non-limiting examples of indirect labeling include detection of a primary antibody using a labeled secondary antibody, for example, a fluorescently-labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently-labeled streptavidin.
Detecting Genetic Variations Associated with Autism Spectrum Disorder
[0137] Described herein, are methods that can be used to detect genetic variations. Detecting specific genetic variations, for example, polymorphic markers and/or haplotypes, copy number, absence or presence of an allele, or genotype associated with a developmental disorder as described herein, can be accomplished by methods known in the art for analyzing nucleic acids and/or detecting sequences at polymorphic or genetically variable sites, for example, amplification techniques, hybridization techniques, sequencing, arrays, or any combination thereof. Thus, by use of these methods disclosed herein or other methods available to the person skilled in the art, one or more alleles at polymorphic markers, including microsatellites, SNPs, CNVs, or other types of genetic variations, can be identified in a sample obtained from a subject.
Nucleic Acids
[0138] The nucleic acids and polypeptides described herein can be used in methods and kits of the present disclosure. In some embodiments, aptamers that specifically bind the nucleic acids and polypeptides described herein can be used in methods and kits of the present disclosure. As used herein, a nucleic acid can comprise a deoxyribonucleotide (DNA) or ribonucleotide (RNA), whether singular or in polymers, naturally occurring or non-naturally occurring, double-stranded or single-stranded, coding, for example, a translated gene, or non-coding, for example, a regulatory region, or any fragments, derivatives, mimetics or complements thereof. In some embodiments, nucleic acids can comprise oligonucleotides, nucleotides, polynucleotides, nucleic acid sequences, genomic sequences, antisense nucleic acids, DNA regions, probes, primers, genes, regulatory regions, introns, exons, open-reading frames, binding sites, target nucleic acids and allele-specific nucleic acids.
[0139] Isolated nucleic acids, as used herein, are separated from nucleic acids that normally flank the gene or nucleotide sequence (as in genomic sequences) and/or has been completely or partially purified from other transcribed sequences (e.g., as in an RNA library). For example, isolated nucleic acids of the disclosure can be substantially isolated with respect to the complex cellular milieu in which it naturally occurs, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. In some instances, the isolated material can form part of a composition, for example, a crude extract containing other substances, buffer system or reagent mix. In some embodiments, the material can be purified to essential homogeneity using methods known in the art, for example, by polyacrylamide gel electrophoresis (PAGE) or column chromatography (e.g., HPLC). With regard to genomic DNA (gDNA), the term isolated also can refer to nucleic acids that are separated from the chromosome with which the genomic DNA is naturally associated. For example, the isolated nucleic acid molecule can contain less than about 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb, 25 kb, 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of the nucleotides that flank the nucleic acid molecule in the gDNA of the cell from which the nucleic acid molecule is derived.
[0140] Nucleic acids can be fused to other coding or regulatory sequences can be considered isolated. For example, recombinant DNA contained in a vector is included in the definition of isolated as used herein. In some embodiments, isolated nucleic acids can include recombinant DNA molecules in heterologous host cells or heterologous organisms, as well as partially or substantially purified DNA molecules in solution. Isolated nucleic acids also encompass in vivo and in vitro RNA transcripts of the DNA molecules of the present disclosure. An isolated nucleic acid molecule or nucleotide sequence can be synthesized chemically or by recombinant means. Such isolated nucleotide sequences can be useful, for example, in the manufacture of the encoded polypeptide, as probes for isolating homologous sequences (e.g., from other mammalian species), for gene mapping (e.g., by in situ hybridization with chromosomes), or for detecting expression of the gene, in tissue (e.g., human tissue), such as by Northern blot analysis or other hybridization techniques disclosed herein. The disclosure also pertains to nucleic acid sequences that hybridize under high stringency hybridization conditions, such as for selective hybridization, to a nucleotide sequence described herein. Such nucleic acid sequences can be detected and/or isolated by allele- or sequence-specific hybridization (e.g., under high stringency conditions). Stringency conditions and methods for nucleic acid hybridizations are well known to the skilled person (see, e.g., Current Protocols in Molecular Biology, Ausubel, F. et al., John Wiley & Sons, (1998), and Kraus, M. and Aaronson, S., Methods Enzymol., 200:546-556 (1991), the entire teachings of which are incorporated by reference herein.
[0141] Calculations of identity or percent identity between two or more nucleotide or amino acid sequences can be determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first sequence). The nucleotides at corresponding positions are then compared, and the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=# of identical positions/total # of positions100). For example, a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. In some embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%, of the length of the reference sequence. The actual comparison of the two sequences can be accomplished by well-known methods, for example, using a mathematical algorithm. A non-limiting example of such a mathematical algorithm is described in Karlin, S. and Altschul, S., Proc. Natl. Acad. Sci. USA, 90-5873-5877 (1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0), as described in Altschul, S. et al., Nucleic Acids Res., 25:3389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, any relevant parameters of the respective programs (e.g., NBLAST) can be used. For example, parameters for sequence comparison can be set at score=100, word length=12, or can be varied (e.g., W=5 or W=20). Other examples include the algorithm of Myers and Miller, CABIOS (1989), ADVANCE, ADAM, BLAT, and FASTA. In another embodiment, the percent identity between two amino acid sequences can be accomplished using, for example, the GAP program in the GCG software package (Accelrys, Cambridge, UK).
[0142] Probes or primers can be oligonucleotides that hybridize in a base-specific manner to a complementary strand of a nucleic acid molecule. Probes can include primers, which can be a single-stranded oligonucleotide probe that can act as a point of initiation of template-directed DNA synthesis using methods including but not limited to, polymerase chain reaction (PCR) and ligase chain reaction (LCR) for amplification of a target sequence. Oligonucleotides, as described herein, can include segments or fragments of nucleic acid sequences, or their complements. In some embodiments, DNA segments can be between 5 and 10,000 contiguous bases, and can range from 5, 10, 12, 15, 20, or 25 nucleotides to 10, 15, 20, 25, 30, 40, 50, 100, 200, 500, 1000 or 10,000 nucleotides. In addition to DNA and RNA, probes and primers can include polypeptide nucleic acids (PNA), as described in Nielsen, P. et al., Science 254: 1497-1500 (1991). A probe or primer can comprise a region of nucleotide sequence that hybridizes to at least about 15, typically about 20-25, and in certain embodiments about 40, 50 or 75, consecutive nucleotides of a nucleic acid molecule.
[0143] The present disclosure also provides isolated nucleic acids, for example, probes or primers, that contain a fragment or portion that can selectively hybridize to a nucleic acid that comprises, or consists of, a nucleotide sequence, wherein the nucleotide sequence can comprise at least one polymorphism or polymorphic allele contained in the genetic variations described herein or the wild-type nucleotide that is located at the same position, or the compliments thereof. In some embodiments, the probe or primer can be at least 70% identical, at least 80% identical, at least 85% identical, at least 90% identical, or at least 95% identical, to the contiguous nucleotide sequence or to the complement of the contiguous nucleotide sequence.
[0144] In a preferred embodiment, a nucleic acid probe can be an oligonucleotide capable of hybridizing with a complementary regions of a gene associated with a developmental disorder containing a genetic variation described herein. The nucleic acid fragments of the disclosure can be used as probes or primers in assays such as those described herein.
[0145] The nucleic acids of the disclosure, such as those described above, can be identified and isolated using standard molecular biology techniques well known to the skilled person. In some embodiments, DNA can be amplified and/or can be labeled (e.g., radiolabeled, fluorescently labeled) and used as a probe for screening, for example, a cDNA library derived from an organism. cDNA can be derived from mRNA and can be contained in a suitable vector. For example, corresponding clones can be isolated, DNA obtained following in vivo excision, and the cloned insert can be sequenced in either or both orientations by art-recognized methods to identify the correct reading frame encoding a polypeptide of the appropriate molecular weight. Using these or similar methods, the polypeptide and the DNA encoding the polypeptide can be isolated, sequenced and further characterized.
[0146] In some embodiments, nucleic acid can comprise one or more polymorphisms, variations, or mutations, for example, single nucleotide polymorphisms (SNPs), copy number variations (CNVs), for example, insertions, deletions, inversions, and translocations. In some embodiments, nucleic acids can comprise analogs, for example, phosphorothioates, phosphoramidates, methyl phosphonate, chiralmethyl phosphonates, 2-O-methyl ribonucleotides, or modified nucleic acids, for example, modified backbone residues or linkages, or nucleic acids combined with carbohydrates, lipids, protein or other materials, or peptide nucleic acids (PNAs), for example, chromatin, ribosomes, and transcriptosomes. In some embodiments nucleic acids can comprise nucleic acids in various structures, for example, A DNA, B DNA, Z-form DNA, siRNA, tRNA, and ribozymes. In some embodiments, the nucleic acid may be naturally or non-naturally polymorphic, for example, having one or more sequence differences, for example, additions, deletions and/or substitutions, as compared to a reference sequence. In some embodiments, a reference sequence can be based on publicly available information, for example, the U.C. Santa Cruz Human Genome Browser Gateway (genome.ucsc.edu/cgi-bin/hgGateway) or the NCBI website (www.ncbi.nlm.nih.gov). In another embodiment, a reference sequence can be determined by a practitioner of the present invention using methods well known in the art, for example, by sequencing a reference nucleic acid.
[0147] In some embodiment a probe can hybridize to an allele, SNP, or CNV as described herein. In some embodiments, the probe can bind to another marker sequence associated with a developmental disorder as described herein.
[0148] One of skill in the art would know how to design a probe so that sequence specific hybridization will occur only if a particular allele is present in a genomic sequence from a test sample. The disclosure can also be reduced to practice using any convenient genotyping method, including commercially available technologies and methods for genotyping particular genetic variations
[0149] Control probes can also be used, for example, a probe that binds a less variable sequence, for example, a repetitive DNA associated with a centromere of a chromosome, can be used as a control. In some embodiments, probes can be obtained from commercial sources. In some embodiments, probes can be synthesized, for example, chemically or in vitro, or made from chromosomal or genomic DNA through standard techniques. In some embodiments sources of DNA that can be used include genomic DNA, cloned DNA sequences, somatic cell hybrids that contain one, or a part of one, human chromosome along with the normal chromosome complement of the host, and chromosomes purified by flow cytometry or microdissection. The region of interest can be isolated through cloning, or by site-specific amplification using PCR.
[0150] One or more nucleic acids for example, a probe or primer, can also be labeled, for example, by direct labeling, to comprise a detectable label. A detectable label can comprise any label capable of detection by a physical, chemical, or a biological process for example, a radioactive label, such as .sup.32P or .sup.3H, a fluorescent label, such as FITC, a chromophore label, an affinity-ligand label, an enzyme label, such as alkaline phosphatase, horseradish peroxidase, or 12 galactosidase, an enzyme cofactor label, a hapten conjugate label, such as digoxigenin or dinitrophenyl, a Raman signal generating label, a magnetic label, a spin label, an epitope label, such as the FLAG or HA epitope, a luminescent label, a heavy atom label, a nanoparticle label, an electrochemical label, a light scattering label, a spherical shell label, semiconductor nanocrystal label, such as quantum dots (described in U.S. Pat. No. 6,207,392), and probes labeled with any other signal generating label known to those of skill in the art, wherein a label can allow the probe to be visualized with or without a secondary detection molecule. A nucleotide can be directly incorporated into a probe with standard techniques, for example, nick translation, random priming, and PCR labeling.
[0151] Non-limiting examples of label moieties useful for detection in the invention include, without limitation, suitable enzymes such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; members of a binding pair that are capable of forming complexes such as streptavidin/biotin, avidin/biotin or an antigen/antibody complex including, for example, rabbit IgG and anti-rabbit IgG; fluorophores such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, tetramethyl rhodamine, eosin, green fluorescent protein, erythrosin, coumarin, methyl coumarin, pyrene, malachite green, stilbene, lucifer yellow, Cascade Blue, Texas Red, dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin, fluorescent lanthanide complexes such as those including Europium and Terbium, cyanine dye family members, such as Cy3 and Cy5, molecular beacons and fluorescent derivatives thereof, as well as others known in the art as described, for example, in Principles of Fluorescence Spectroscopy, Joseph R. Lakowicz (Editor), Plenum Pub Corp, 2nd edition (July 1999) and the 6th Edition of the Molecular Probes Handbook by Richard P. Hoagland; a luminescent material such as luminol; light scattering or plasmon resonant materials such as gold or silver particles or quantum dots; or radioactive material include .sup.14C, .sup.123I, .sup.124I, .sup.125I, Tc99m, .sup.32P, .sup.33P, .sup.35S or .sup.3H.
[0152] Other labels can also be used in the methods of the present disclosure, for example, backbone labels. Backbone labels comprise nucleic acid stains that bind nucleic acids in a sequence independent manner. Non-limiting examples include intercalating dyes such as phenanthridines and acridines (e.g., ethidium bromide, propidium iodide, hexidium iodide, dihydroethidium, ethidium homodimer-1 and -2, ethidium monoazide, and ACMA); some minor grove binders such as indoles and imidazoles (e.g., Hoechst 33258, Hoechst 33342, Hoechst 34580 and DAPI); and miscellaneous nucleic acid stains such as acridine orange (also capable of intercalating), 7-AAD, actinomycin D, LDS751, and hydroxystilbamidine. All of the aforementioned nucleic acid stains are commercially available from suppliers such as Molecular Probes, Inc. Still other examples of nucleic acid stains include the following dyes from Molecular Probes: cyanine dyes such as SYTOX Blue, SYTOX Green, SYTOX Orange, POPO-1, POPO-3, YOYO-1, YOYO-3, TOTO-1, TOTO-3, JOJO-1, LOLO-1, BOBO-1, BOBO-3, PO-PRO-1, PO-PRO-3, BO-PRO-1, BO-PRO-3, TO-PRO-1, TO-PRO-3, TO-PRO-5, JO-PRO-1, LO-PRO-1, YO-PRO-1, YO-PRO-3, PicoGreen, OliGreen, RiboGreen, SYBR Gold, SYBR Green I, SYBR Green II, SYBR DX, SYTO-40, -41, -42, -43, -44, -45 (blue), SYTO-13, -16, -24, -21, -23, -12, -11, -20, -22, -15, -14, -25 (green), SYTO-81, -80, -82, -83, -84, -85 (orange), SYTO-64, -17, -59, -61, -62, -60, -63 (red).
[0153] In some embodiments, fluorophores of different colors can be chosen, for example, 7-amino-4-methylcoumarin-3-acetic acid (AMCA), 5-(and-6)-carboxy-X-rhodamine, lissamine rhodamine B, 5-(and-6)-carboxyfluorescein, fluorescein-5-isothiocyanate (FITC), 7-diethylaminocoumarin-3-carboxylic acid, tetramethylrhodamine-5-(and-6)-isothiocyanate, 5-(and-6)-carboxytetramethylrhodamine, 7-hydroxycoumarin-3-carboxylic acid, 6-[fluorescein 5-(and-6)-carboxamido]hexanoic acid, N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a diaza-3-indacenepropionic acid, eosin-5-isothiocyanate, erythrosin-5-isothiocyanate, TRITC, rhodamine, tetramethylrhodamine, R-phycoerythrin, Cy-3, Cy-5, Cy-7, Texas Red, Phar-Red, allophycocyanin (APC), and CASCADE blue acetylazide, such that each probe in or not in a set can be distinctly visualized. In some embodiments, fluorescently labeled probes can be viewed with a fluorescence microscope and an appropriate filter for each fluorophore, or by using dual or triple band-pass filter sets to observe multiple fluorophores. In some embodiments, techniques such as flow cytometry can be used to examine the hybridization pattern of the probes.
[0154] In other embodiments, the probes can be indirectly labeled, for example, with biotin or digoxygenin, or labeled with radioactive isotopes such as .sup.32P and/or .sup.3H. As a non-limiting example, a probe indirectly labeled with biotin can be detected by avidin conjugated to a detectable marker. For example, avidin can be conjugated to an enzymatic marker such as alkaline phosphatase or horseradish peroxidase. In some embodiments, enzymatic markers can be detected using colorimetric reactions using a substrate and/or a catalyst for the enzyme. In some embodiments, catalysts for alkaline phosphatase can be used, for example, 5-bromo-4-chloro-3-indolylphosphate and nitro blue tetrazolium. In some embodiments, a catalyst can be used for horseradish peroxidase, for example, diaminobenzoate.
Methods of Detecting Genetic Variations
[0155] In some embodiments, standard techniques for genotyping for the presence genetic variations, for example, amplification, can be used. Amplification of nucleic acids can be accomplished using methods known in the art. Generally, sequence information from the region of interest can be used to design oligonucleotide primers that can be identical or similar in sequence to opposite strands of a template to be amplified. In some embodiments, amplification methods can include but are not limited to, fluorescence-based techniques utilizing PCR, for example, ligase chain reaction (LCR), Nested PCR, transcription amplification, self-sustained sequence replication, and nucleic acid based sequence amplification (NASBA), and multiplex ligation-dependent probe amplification (MLPA). Guidelines for selecting primers for PCR amplification are well known in the art. In some embodiments, a computer program can be used to design primers, for example, Oligo (National Biosciences, Inc, Plymouth Minn.), MacVector (Kodak/IBI), and GCG suite of sequence analysis programs.
[0156] In some embodiments, commercial methodologies available for genotyping, for example, SNP genotyping, can be used, but are not limited to, TaqMan genotyping assays (Applied Biosystems), SNPlex platforms (Applied Biosystems), gel electrophoresis, capillary electrophoresis, size exclusion chromatography, mass spectrometry, for example, MassARRAY system (Sequenom), minisequencing methods, real-time Polymerase Chain Reaction (PCR), Bio-Plex system (BioRad), CEQ and SNPstream systems (Beckman), array hybridization technology, for example, Affymetrix GeneChip (Perlegen), BeadArray Technologies, for example, Illumina GoldenGate and Infinium assays, array tag technology, Multiplex Ligation-dependent Probe Amplification (MLPA), and endonuclease-based fluorescence hybridization technology (Invader; Third Wave). PCR can be a procedure in which target nucleic acid is amplified in a manner similar to that described in U.S. Pat. No. 4,683,195 and subsequent modifications of the procedure described therein. In some embodiments, real-time quantitative PCR can be used to determine genetic variations, wherein quantitative PCR can permit both detection and quantification of a DNA sequence in a sample, for example, as an absolute number of copies or as a relative amount when normalized to DNA input or other normalizing genes. In some embodiments, methods of quantification can include the use of fluorescent dyes that can intercalate with double-stranded DNA, and modified DNA oligonucleotide probes that can fluoresce when hybridized with a complementary DNA.
[0157] In some embodiments of the disclosure, a sample containing genomic DNA obtained from the subject can be collected and PCR can used to amplify a fragment of nucleic acid that comprises one or more genetic variations that can be indicative of a susceptibility to a developmental disorder. In another embodiment, detection of genetic variations can be accomplished by expression analysis, for example, by using quantitative PCR. In some embodiments, this technique can assess the presence of an alteration in the expression or composition of one or more polypeptides or splicing variants encoded by a nucleic acid associated with a developmental disorder.
[0158] In a preferred embodiment, the DNA template of a sample from a subject containing a SNP can be amplified by PCR prior to detection with a probe. In such an embodiment, the amplified DNA serves as the template for a detection probe and, in some embodiments, an enhancer probe. Certain embodiments of the detection probe, the enhancer probe, and/or the primers used for amplification of the template by PCR can comprise the use of modified bases, for example, modified A, T, C, G, and U, wherein the use of modified bases can be useful for adjusting the melting temperature of the nucleotide probe and/or primer to the template DNA. In a preferred embodiment, modified bases are used in the design of the detection nucleotide probe. Any modified base known to the skilled person can be selected in these methods, and the selection of suitable bases is well within the scope of the skilled person based on the teachings herein and known bases available from commercial sources as known to the skilled person.
[0159] In some embodiments, identification of genetic variations can be accomplished using hybridization methods. The presence of a specific marker allele or a particular genomic segment comprising a genetic variation, or representative of a genetic variation, can be indicated by sequence-specific hybridization of a nucleic acid probe specific for the particular allele or the genetic variation in a nucleic acid containing sample that has or has not been amplified but methods described herein. The presence of more than one specific marker allele or several genetic variations can be indicated by using two or more sequence-specific nucleic acid probes, wherein each is specific for a particular allele and/or genetic variation.
[0160] Hybridization can be performed by methods well known to the person skilled in the art, for example, hybridization techniques such as fluorescent in situ hybridization (FISH), Southern analysis, Northern analysis, or in situ hybridization. In some embodiments, hybridization refers to specific hybridization, wherein hybridization can be performed with no mismatches. Specific hybridization, if present, can be using standard methods. In some embodiments, if specific hybridization occurs between a nucleic acid probe and the nucleic acid in the sample, the sample can contain a sequence that can be complementary to a nucleotide present in the nucleic acid probe. In some embodiments, if a nucleic acid probe can contain a particular allele of a polymorphic marker, or particular alleles for a plurality of markers, specific hybridization is indicative of the nucleic acid being completely complementary to the nucleic acid probe, including the particular alleles at polymorphic markers within the probe. In some embodiments a probe can contain more than one marker alleles of a particular haplotype, for example, a probe can contain alleles complementary to 2, 3, 4, 5 or all of the markers that make up a particular haplotype. In some embodiments detection of one or more particular markers of the haplotype in the sample is indicative that the source of the sample has the particular haplotype.
[0161] In some embodiments, PCR conditions and primers can be developed that amplify a product only when the variant allele is present or only when the wild type allele is present, for example, allele-specific PCR. In some embodiments of allele-specific PCR, a method utilizing a detection oligonucleotide probe comprising a fluorescent moiety or group at its 3 terminus and a quencher at its 5 terminus, and an enhancer oligonucleotide, can be employed, as described by Kutyavin et al. (Nucleic Acid Res. 34:e128 (2006)).
[0162] An allele-specific primer/probe can be an oligonucleotide that is specific for particular a polymorphism can be prepared using standard methods. In some embodiments, allele-specific oligonucleotide probes can specifically hybridize to a nucleic acid region that contains a genetic variation. In some embodiments, hybridization conditions can be selected such that a nucleic acid probe can specifically bind to the sequence of interest, for example, the variant nucleic acid sequence.
[0163] In some embodiments, allele-specific restriction digest analysis can be used to detect the existence of a polymorphic variant of a polymorphism, if alternate polymorphic variants of the polymorphism can result in the creation or elimination of a restriction site. Allele-specific restriction digests can be performed, for example, with the particular restriction enzyme that can differentiate the alleles. In some embodiments, PCR can be used to amplify a region comprising the polymorphic site, and restriction fragment length polymorphism analysis can be conducted. In some embodiments, for sequence variants that do not alter a common restriction site, mutagenic primers can be designed that can introduce one or more restriction sites when the variant allele is present or when the wild type allele is present.
[0164] In some embodiments, fluorescence polarization template-directed dye-terminator incorporation (FP-TDI) can be used to determine which of multiple polymorphic variants of a polymorphism can be present in a subject. Unlike the use of allele-specific probes or primers, this method can employ primers that can terminate adjacent to a polymorphic site, so that extension of the primer by a single nucleotide can result in incorporation of a nucleotide complementary to the polymorphic variant at the polymorphic site.
[0165] In some embodiments, DNA containing an amplified portion can be dot-blotted, using standard methods and the blot contacted with the oligonucleotide probe. The presence of specific hybridization of the probe to the DNA can then be detected. The methods can include determining the genotype of a subject with respect to both copies of the polymorphic site present in the genome, wherein if multiple polymorphic variants exist at a site, this can be appropriately indicated by specifying which variants are present in a subject. Any of the detection means described herein can be used to determine the genotype of a subject with respect to one or both copies of the polymorphism present in the subject's genome.
[0166] In some embodiments, a peptide nucleic acid (PNA) probe can be used in addition to, or instead of, a nucleic acid probe in the methods described herein. A PNA can be a DNA mimic having a peptide-like, inorganic backbone, for example, N-(2-aminoethyl) glycine units with an organic base (A, G, C, T or U) attached to the glycine nitrogen via a methylene carbonyl linker.
[0167] Nucleic acid sequence analysis can also be used to detect genetic variations, for example, genetic variations can be detected by sequencing exons, introns, 5 untranslated sequences, or 3 untranslated sequences. One or more methods of nucleic acid analysis that are available to those skilled in the art can be used to detect genetic variations, including but not limited to, direct manual sequencing, automated fluorescent sequencing, single-stranded conformation polymorphism assays (SSCP); clamped denaturing gel electrophoresis (CDGE); denaturing gradient gel electrophoresis (DGGE), two-dimensional gel electrophoresis (2DGE or TDGE); conformational sensitive gel electrophoresis (CSGE); denaturing high performance liquid chromatography (DHPLC), infrared matrix-assisted laser desorption/ionization (IR-MALDI) mass spectrometry, mobility shift analysis, quantitative real-time PCR, restriction enzyme analysis, heteroduplex analysis; chemical mismatch cleavage (CMC), RNase protection assays, use of polypeptides that recognize nucleotide mismatches, allele-specific PCR, real-time pyrophosphate DNA sequencing, PCR amplification in combination with denaturing high performance liquid chromatography (dHPLC), and combinations of such methods.
[0168] Sequencing can be accomplished through classic Sanger sequencing methods, which are known in the art. In a preferred embodiment sequencing can be performed using high-throughput sequencing methods some of which allow detection of a sequenced nucleotide immediately after or upon its incorporation into a growing strand, for example, detection of sequence in substantially real time or real time. In some cases, high throughput sequencing generates at least 1,000, at least 5,000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, at least 50,000, at least 100,000 or at least 500,000 sequence reads per hour; with each read being at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120 or at least 150 bases per read (or 500-1,000 bases per read for 454).
[0169] High-throughput sequencing methods can include but are not limited to, Massively Parallel Signature Sequencing (MPSS, Lynx Therapeutics), Polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, SOLiD sequencing, on semiconductor sequencing, DNA nanoball sequencing, Helioscope single molecule sequencing, Single Molecule SMRT sequencing, Single Molecule real time (RNAP) sequencing, Nanopore DNA sequencing, and/or sequencing by hybridization, for example, a non-enzymatic method that uses a DNA microarray, or microfluidic Sanger sequencing.
[0170] In some embodiments, high-throughput sequencing can involve the use of technology available by Helicos BioSciences Corporation (Cambridge, Mass.) such as the Single Molecule Sequencing by Synthesis (SMSS) method. SMSS is unique because it allows for sequencing the entire human genome in up to 24 hours. This fast sequencing method also allows for detection of a SNP/nucleotide in a sequence in substantially real time or real time. Finally, SMSS is powerful because, like the MIP technology, it does not use a pre-amplification step prior to hybridization. SMSS does not use any amplification. SMSS is described in US Publication Application Nos. 20060024711; 20060024678; 20060012793; 20060012784; and 20050100932. In some embodiments, high-throughput sequencing involves the use of technology available by 454 Life Sciences, Inc. (a Roche company, Branford, Conn.) such as the PicoTiterPlate device which includes a fiber optic plate that transmits chemiluminescent signal generated by the sequencing reaction to be recorded by a CCD camera in the instrument. This use of fiber optics allows for the detection of a minimum of 20 million base pairs in 4.5 hours.
[0171] In some embodiments, PCR-amplified single-strand nucleic acid can be hybridized to a primer and incubated with a polymerase, ATP sulfurylase, luciferase, apyrase, and the substrates luciferin and adenosine 5 phosphosulfate. Next, deoxynucleotide triphosphates corresponding to the bases A, C, G, and T (U) can be added sequentially. A base incorporation can be accompanied by release of pyrophosphate, which can be converted to ATP by sulfurylase, which can drive synthesis of oxyluciferin and the release of visible light. Since pyrophosphate release can be equimolar with the number of incorporated bases, the light given off can be proportional to the number of nucleotides adding in any one step. The process can repeat until the entire sequence can be determined. In some embodiments, pyrosequencing can be utilized to analyze amplicons to determine whether breakpoints are present. In another embodiment, pyrosequencing can map surrounding sequences as an internal quality control.
[0172] Pyrosequencing analysis methods are known in the art. Sequence analysis can include a four-color sequencing by ligation scheme (degenerate ligation), which involves hybridizing an anchor primer to one of four positions. Then an enzymatic ligation reaction of the anchor primer to a population of degenerate nonamers that are labeled with fluorescent dyes can be performed. At any given cycle, the population of nonamers that is used can be structured such that the identity of one of its positions can be correlated with the identity of the fluorophore attached to that nonamer. To the extent that the ligase discriminates for complementarily at that queried position, the fluorescent signal can allow the inference of the identity of the base. After performing the ligation and four-color imaging, the anchor primer: nonamer complexes can be stripped and a new cycle begins. Methods to image sequence information after performing ligation are known in the art.
[0173] In some embodiments, analysis by restriction enzyme digestion can be used to detect a particular genetic variation if the genetic variation results in creation or elimination of one or more restriction sites relative to a reference sequence. In some embodiments, restriction fragment length polymorphism (RFLP) analysis can be conducted, wherein the digestion pattern of the relevant DNA fragment indicates the presence or absence of the particular genetic variation in the sample.
[0174] In some embodiments, arrays of oligonucleotide probes that can be complementary to target nucleic acid sequence segments from a subject can be used to identify genetic variations. In some embodiments, an array of oligonucleotide probes comprises an oligonucleotide array, for example, a microarray. In some embodiments, the present disclosure features arrays that include a substrate having a plurality of addressable areas, and methods of using them. At least one area of the plurality includes a nucleic acid probe that binds specifically to a sequence comprising a genetic variation, and can be used to detect the absence or presence of said genetic variation, for example, one or more SNPs, microsatellites, or CNVs, as described herein, to determine or identify an allele or genotype. For example, the array can include one or more nucleic acid probes that can be used to detect a genetic variation such as those listed in Tables 1 and 5. In some embodiments, the array can further comprise at least one area that includes a nucleic acid probe that can be used to specifically detect another marker associated with a developmental disorder, for example, ASD, as described herein.
[0175] Microarray hybridization can be performed by hybridizing a nucleic acid of interest; for example, a nucleic acid encompassing a genetic variation, with the array and detecting hybridization using nucleic acid probes. In some embodiments, the nucleic acid of interest is amplified prior to hybridization. Hybridization and detecting can be carried out according to standard methods described in Published PCT Applications: WO 92/10092 and WO 95/11995, and U.S. Pat. No. 5,424,186. For example, an array can be scanned to determine the position on the array to which the nucleic acid hybridizes. The hybridization data obtained from the scan can be, for example, in the form of fluorescence intensities as a function of location on the array.
[0176] Arrays can be formed on substrates fabricated with materials such as paper; glass; plastic, for example, polypropylene, nylon, or polystyrene; polyacrylamide; nitrocellulose; silicon; optical fiber; or any other suitable solid or semisolid support; and can be configured in a planar, for example, glass plates or silicon chips); or three dimensional, for example, pins, fibers, beads, particles, microtiter wells, and capillaries, configuration.
[0177] Methods for generating arrays are known in the art and can include for example; photolithographic methods (U.S. Pat. Nos. 5,143,854, 5,510,270 and 5,527,681); mechanical methods, for example, directed-flow methods (U.S. Pat. No. 5,384,261); pin-based methods (U.S. Pat. No. 5,288,514); bead-based techniques (PCT US/93/04145); solid phase oligonucleotide synthesis methods; or by other methods known to a person skilled in the art (see, e.g., Bier, F. F., et al. Adv Biochem Eng Biotechnol 109:433-53 (2008); Hoheisel, J. D., Nat Rev Genet 7: 200-10 (2006); Fan, J. B., et al. Methods Enzymol 410:57-73 (2006); Raqoussis, J. & Elvidge, G., Expert Rev Mol Design 6: 145-52 (2006); Mockler, T. C., et al. Genomics 85: 1-15 (2005), and references cited therein, the entire teachings of each of which are incorporated by reference herein). Many additional descriptions of the preparation and use of oligonucleotide arrays for detection of polymorphisms can be found, for example, in U.S. Pat. Nos. 6,858,394, 6,429,027, 5,445,934, 5,700,637, 5,744,305, 5,945,334, 6,054,270, 6,300,063, 6,733,977, 7,364,858, EP 619 321, and EP 373 203, the entire teachings of which are incorporated by reference herein. Methods for array production, hybridization, and analysis are also described in Snijders et al., Nat. Genetics 29:263-264 (2001); Klein et al., Proc. Natl. Acad. Sci. USA 96:4494-4499 (1999); Albertson et al., Breast Cancer Research and Treatment 78:289-298 (2003); and Snijders et al., BAC microarray based comparative genomic hybridization, in: Zhao et al. (eds), Bacterial Artificial Chromosomes: Methods and Protocols, Methods in Molecular Biology, Humana Press, 2002.
[0178] In some embodiments, oligonucleotide probes forming an array can be attached to a substrate by any number of techniques, including, but not limited to, in situ synthesis, for example, high-density oligonucleotide arrays, using photolithographic techniques; spotting/printing a medium to low density on glass, nylon, or nitrocellulose; by masking; and by dot-blotting on a nylon or nitrocellulose hybridization membrane. In some embodiments, oligonucleotides can be immobilized via a linker, including but not limited to, by covalent, ionic, or physical linkage. Linkers for immobilizing nucleic acids and polypeptides, including reversible or cleavable linkers, are known in the art (U.S. Pat. No. 5,451,683 and WO98/20019). In some embodiments, oligonucleotides can be non-covalently immobilized on a substrate by hybridization to anchors, by means of magnetic beads, or in a fluid phase, for example, in wells or capillaries.
[0179] An array can comprise oligonucleotide hybridization probes capable of specifically hybridizing to different genetic variations. In some embodiments, oligonucleotide arrays can comprise a plurality of different oligonucleotide probes coupled to a surface of a substrate in different known locations. In some embodiments, oligonucleotide probes can exhibit differential or selective binding to polymorphic sites, and can be readily designed by one of ordinary skill in the art, for example, an oligonucleotide that is perfectly complementary to a sequence that encompasses a polymorphic site, for example, a sequence that includes the polymorphic site, within it, or at one end, can hybridize preferentially to a nucleic acid comprising that sequence, as opposed to a nucleic acid comprising an alternate polymorphic variant.
[0180] In some embodiments, arrays can include multiple detection blocks, for example, multiple groups of probes designed for detection of particular polymorphisms. In some embodiments, these arrays can be used to analyze multiple different polymorphisms. In some embodiments, detection blocks can be grouped within a single array or in multiple, separate arrays, wherein varying conditions, for example, conditions optimized for particular polymorphisms, can be used during hybridization. General descriptions of using oligonucleotide arrays for detection of polymorphisms can be found, for example, in U.S. Pat. Nos. 5,858,659 and 5,837,832. In addition to oligonucleotide arrays, cDNA arrays can be used similarly in certain embodiments.
[0181] The methods described herein can include but are not limited to providing an array as described herein; contacting the array with a sample, and detecting binding of a nucleic acid from the sample to the array. In some embodiments, the method can comprise amplifying nucleic acid from the sample, for example, a region associated with a developmental disorder or a region that includes another region associated with a developmental disorder. In some embodiments, the methods described herein can include using an array that can identify differential expression patterns or copy numbers of one or more genes in samples from control and affected individuals. For example, arrays of probes to a marker described herein can be used to identify genetic variations between DNA from an affected subject, and control DNA obtained from an individual that does not have a developmental disorder. Since the nucleotides on the array can contain sequence tags, their positions on the array can be accurately known relative to the genomic sequence.
[0182] In some embodiments, it can be desirable to employ methods that can detect the presence of multiple genetic variations, for example, polymorphic variants at a plurality of polymorphic sites, in parallel or substantially simultaneously. In some embodiments, these methods can comprise oligonucleotide arrays and other methods, including methods in which reactions, for example, amplification and hybridization, can be performed in individual vessels, for example, within individual wells of a multi-well plate or other vessel.
[0183] Determining the identity of a genetic variation can also include or consist of reviewing a subject's medical history, where the medical history includes information regarding the identity, copy number, presence or absence of one or more alleles or SNPs in the subject, e.g., results of a genetic test.
[0184] In some embodiments extended runs of homozygosity (ROH) may be useful to map recessive disease genes in outbred populations. Furthermore, even in complex disorders, a high number of affected individuals may have the same haplotype in the region surrounding a disease mutation. Therefore, a rare pathogenic variant and surrounding haplotype can be enriched in frequency in a group of affected individuals compared with the haplotype frequency in a cohort of unaffected controls. Homozygous haplotypes (HH) that are shared by multiple affected individuals can be important for the discovery of recessive disease genes in complex disorders such as ASD. In some embodiments, the traditional homozygosity mapping method can be extended by analysing the haplotype within shared ROH regions to identify homozygous segments of identical haplotype that are present uniquely or at a higher frequency in ASD probands compared to parental controls. Such regions are termed risk homozygous haplotypes (rHH), which may contain low-frequency recessive variants that contribute to ASD risk in a subset of ASD patients.
[0185] Genetic variations can also be identified using any of a number of methods well known in the art. For example, genetic variations available in public databases, which can be searched using methods and custom algorithms or algorithms known in the art, can be used. In some embodiments, a reference sequence can be from, for example, the human draft genome sequence, publicly available in various databases, or a sequence deposited in a database such as GenBank.
Methods of Detecting CNVs
[0186] Detection of genetic variations, specifically CNVs, can be accomplished by one or more suitable techniques described herein. Generally, techniques that can selectively determine whether a particular chromosomal segment is present or absent in an individual can be used for genotyping CNVs. Identification of novel copy number variations can be done by methods for assessing genomic copy number changes.
[0187] In some embodiments, methods include but are not limited to, methods that can quantitatively estimate the number of copies of a particular genomic segment, but can also include methods that indicate whether a particular segment is present in a sample or not. In some embodiments, the technique to be used can quantify the amount of segment present, for example, determining whether a DNA segment is deleted, duplicated, or triplicated in subject, for example, Fluorescent In Situ Hybridization (FISH) techniques, and other methods described herein. In some embodiments, methods include detection of copy number variation from array intensity and sequencing read depth using a stepwise Bayesian model (Zhang Z. D., et al. BMC Bioinformatics. 2010 Oct. 31; 11:539). In some embodiments, methods include detecting copy number variations using shotgun sequencing, CNV-seq (Xie C., et al. BMC Bioinformatics. 2009 Mar. 6; 10:80). In some embodiments, methods include analyzing next-generation sequencing (NGS) data for CNV detection using any one of several algorithms developed for each of the four broad methods for CNV detection using NGS, namely the depth of coverage (DOC), read-pair (RP), split-read (SR) and assembly-based (AS) methods. (Teo S. M., et al. Bioinformatics. 2012 Aug. 31). In some embodiments, methods include combining coverage with map information for the identification of deletions and duplications in targeted sequence data (Nord A. S., et al. BMC Genomics. 2011 Apr. 12; 12:184).
[0188] In some embodiments, other genotyping technologies can be used for detection of CNVs, including but not limited to, karyotype analysis, Molecular Inversion Probe array technology, for example, Affymetrix SNP Array 6.0, and BeadArray Technologies, for example, Illumina GoldenGate and Infinium assays, as can other platforms such as NimbleGen HD2.1 or HD4.2, High-Definition Comparative Genomic Hybridization (CGH) arrays (Agilent Technologies), tiling array technology (Affymetrix), multiplex ligation-dependent probe amplification (MLPA), Invader assay, fluorescence in situ hybridization, and, in one preferred embodiment, Array Comparative Genomic Hybridization (aCGH) methods. As described herein, karyotype analysis can be a method to determine the content and structure of chromosomes in a sample. In some embodiments, karyotyping can be used, in lieu of aCGH, to detect translocations, which can be copy number neutral, and, therefore, not detectable by aCGH. Information about amplitude of particular probes, which can be representative of particular alleles, can provide quantitative dosage information for the particular allele, and by consequence, dosage information about the CNV in question, since the marker can be selected as a marker representative of the CNV and can be located within the CNV. In some embodiments, if the CNV is a deletion, the absence of particular marker allele is representative of the deletion. In some embodiments, if the CNV is a duplication or a higher order copy number variation, the signal intensity representative of the allele correlating with the CNV can represent the copy number. A summary of methodologies commonly used is provided in Perkel (Perkel J Nature Methods 5:447-453 (2008)).
[0189] PCR assays can be utilized to detect CNVs and can provide an alternative to array analysis. In particular, PCR assays can enable detection of precise boundaries of gene/chromosome variants, at the molecular level, and which boundaries are identical in different individuals. PCR assays can be based on the amplification of a junction fragment present only in individuals that carry a deletion. This assay can convert the detection of a loss by array CGH to one of a gain by PCR.
[0190] Examples of PCR techniques that can be used in the present invention include, but are not limited to quantitative PCR, real-time quantitative PCR (qPCR), quantitative fluorescent PCR (QF-PCR), multiplex fluorescent PCR (MF-PCR), real time PCR (RT-PCR), single cell PCR, PCR-RFLP/RT-PCR-RFLP, hot start PCR and Nested PCR. Other suitable amplification methods include the ligase chain reaction (LCR), ligation mediated PCR (LM-PCR), degenerate oligonucleotide probe PCR (DOP-PCR), transcription amplification, self-sustained sequence replication, selective amplification of target polynucleotide sequences, consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR) and nucleic acid based sequence amplification (NABSA).
[0191] Alternative methods for the simultaneous interrogation of multiple regions include quantitative multiplex PCR of short fluorescent fragments (QMPSF), multiplex amplifiable probe hybridization (MAPH) and multiplex ligation-dependent probe amplification (MLPA), in which copy-number differences for up to 40 regions can be scored in one experiment. Another approach can be to specifically target regions that harbor known segmental duplications, which are often sites of copy-number variation. By targeting the variable nucleotides between two copies of a segmental duplication (called paralogous sequence variants) using a SNP-genotyping method that provides independent fluorescence intensities for the two alleles, it is possible to detect an increase in intensity of one allele compared with the other.
[0192] In another embodiment, the amplified piece of DNA can be bound to beads using the sequencing element of the nucleic acid tag under conditions that favor a single amplified piece of DNA molecule to bind a different bead and amplification occurs on each bead. In some embodiments, such amplification can occur by PCR. Each bead can be placed in a separate well, which can be a picoliter-sized well. In some embodiments, each bead is captured within a droplet of a PCR-reaction-mixture-in-oil-emulsion and PCR amplification occurs within each droplet. The amplification on the bead results in each bead carrying at least one million, at least 5 million, or at least 10 million copies of the single amplified piece of DNA molecule.
[0193] In embodiments where PCR occurs in oil-emulsion mixtures, the emulsion droplets are broken, the DNA is denatured and the beads carrying single-stranded nucleic acids clones are deposited into a well, such as a picoliter-sized well, for further analysis according to the methods described herein. These amplification methods allow for the analysis of genomic DNA regions. Methods for using bead amplification followed by fiber optics detection are described in Margulies et al. 2005, Nature. 15; 437(7057):376-80, and as well as in US Publication Application Nos. 20020012930; 20030068629; 20030100102; 20030148344; 20040248161; 20050079510, 20050124022; and 20060078909.
[0194] Another variation on the array-based approach can be to use the hybridization signal intensities that are obtained from the oligonucleotides employed on Affymetrix SNP arrays or in Illumina Bead Arrays. Here hybridization intensities are compared with average values that are derived from controls, such that deviations from these averages indicate a change in copy number. As well as providing information about copy number, SNP arrays have the added advantage of providing genotype information. For example, they can reveal loss of heterozygosity, which could provide supporting evidence for the presence of a deletion, or might indicate segmental uniparental disomy (which can recapitulate the effects of structural variation in some genomic regionsPrader-Willi and Angelman syndromes, for example).
[0195] Many of the basic procedures followed in microarray-based genome profiling are similar, if not identical, to those followed in expression profiling and SNP analysis, including the use of specialized microarray equipment and data-analysis tools. Since microarray-based expression profiling has been well established in the last decade, much can be learned from the technical advances made in this area. Examples of the use of microarrays in nucleic acid analysis that can be used are described in U.S. Pat. Nos. 6,300,063, 5,837,832, 6,969,589, 6,040,138, 6,858,412, U.S. application Ser. No. 08/529,115, U.S. application Ser. No. 10/272,384, U.S. application Ser. No. 10/045,575, U.S. application Ser. No. 10/264,571 and U.S. application Ser. No. 10/264,574. It should be noted that there are also distinct differences such as target and probe complexity, stability of DNA over RNA, the presence of repetitive DNA and the need to identify single copy number alterations in genome profiling.
[0196] In a preferred embodiment, the genetic variations detected comprise CNVs and can be detected using array CGH. In some embodiments, array CGH can be been implemented using a wide variety of techniques. The initial approaches used arrays produced from large-insert genomic clones such as bacterial artificial chromosomes (BACs). Producing sufficient BAC DNA of adequate purity to make arrays is arduous, so several techniques to amplify small amounts of starting material have been employed. These techniques include ligation-mediated PCR (Snijders et al, Nat. Genet. 29:263-64), degenerate primer PCR using one or several sets of primers, and rolling circle amplification. BAC arrays that provide complete genome tiling paths are also available. Arrays made from less complex nucleic acids such as cDNAs, selected PCR products, and oligonucleotides can also be used. Although most CGH procedures employ hybridization with total genomic DNA, it is possible to use reduced complexity representations of the genome produced by PCR techniques. Computational analysis of the genome sequence can be used to design array elements complementary to the sequences contained in the representation. Various SNP genotyping platforms, some of which use reduced complexity genomic representations, can be useful for their ability to determine both DNA copy number and allelic content across the genome. In some embodiments, small amounts of genomic DNA can be amplified with a variety of whole genome amplification methods prior to CGH analysis of the sample.
[0197] The different basic approaches to array CGH provide different levels of performance, so some are more suitable for particular applications than others. The factors that determine performance include the magnitudes of the copy number changes, their genomic extents, the state and composition of the specimen, how much material is available for analysis, and how the results of the analysis can be used. Many applications use reliable detection of copy number changes of much less than 50%, a more stringent requirement than for other microarray technologies. Note that technical details are extremely important and different implementations of methods using the same array CGH approach can yield different levels of performance. Various CGH methods are known in the art and are equally applicable to one or more methods of the present invention. For example, CGH methods are disclosed in U.S. Pat. Nos. 7,034,144; 7,030,231; 7,011,949; 7,014,997; 6,977,148; 6,951,761; and 6,916,621, the disclosure from each of which is incorporated by reference herein in its entirety.
[0198] The data provided by array CGH are quantitative measures of DNA sequence dosage. Array CGH provides high-resolution estimates of copy number aberrations, and can be performed efficiently on many samples. The advent of array CGH technology makes it possible to monitor DNA copy number changes on a genomic scale and many projects have been launched for studying the genome in specific diseases.
[0199] In a preferred embodiment, whole genome array-based comparative genome hybridization (array CGH) analysis, or array CGH on a subset of genomic regions, can be used to efficiently interrogate human genomes for genomic imbalances at multiple loci within a single assay. The development of comparative genomic hybridization (CGH) (Kallioniemi et al, 1992, Science 258: 818-21) provided the first efficient approach to scanning entire genomes for variations in DNA copy number. The importance of normal copy number variation involving large segments of DNA has been unappreciated. Array CGH is a breakthrough technique in human genetics, which is attracting interest from clinicians working in fields as diverse as cancer and IVF (In Vitro Fertilization). The use of CGH microarrays in the clinic holds great promise for identifying regions of genomic imbalance associated with disease. Advances from identifying chromosomal critical regions associated with specific phenotypes to identifying the specific dosage sensitive genes can lead to therapeutic opportunities of benefit to patients. Array CGH is a specific, sensitive and rapid technique that can enable the screening of the whole genome in a single test. It can facilitate and accelerate the screening process in human genetics and is expected to have a profound impact on the screening and counseling of patients with genetic disorders. It is now possible to identify the exact location on the chromosome where an aberration has occurred and it is possible to map these changes directly onto the genomic sequence.
[0200] An array CGH approach provides a robust method for carrying out a genome-wide scan to find novel copy number variants (CNVs). The array CGH methods can use labeled fragments from a genome of interest, which can be competitively hybridized with a second differentially labeled genome to arrays that are spotted with cloned DNA fragments, revealing copy-number differences between the two genomes. Genomic clones (for example, BACs), cDNAs, PCR products and oligonucleotides, can all be used as array targets. The use of array CGH with BACs was one of the earliest employed methods and is popular, owing to the extensive coverage of the genome it provides, the availability of reliable mapping data and ready access to clones. The last of these factors is important both for the array experiments themselves, and for confirmatory FISH experiments.
[0201] In a typical CGH measurement, total genomic DNA is isolated from control and reference subjects, differentially labeled, and hybridized to a representation of the genome that allows the binding of sequences at different genomic locations to be distinguished. More than two genomes can be compared simultaneously with suitable labels. Hybridization of highly repetitive sequences is typically suppressed by the inclusion of unlabeled Cot-1 DNA in the reaction. In some embodiments of array CGH, it is beneficial to mechanically shear the genomic DNA sample, for example, with sonication, prior to its labeling and hybridization step. In another embodiment, array CGH may be performed without use of Cot-1 DNA or a sonication step in the preparation of the genomic DNA sample. The relative hybridization intensity of the test and reference signals at a given location can be proportional to the relative copy number of those sequences in the test and reference genomes. If the reference genome is normal then increases and decreases in signal intensity ratios directly indicate DNA copy number variation within the genome of the test cells. Data are typically normalized so that the modal ratio for the genome is set to some standard value, typically 1.0 on a linear scale or 0.0 on a logarithmic scale. Additional measurements such as FISH or flow cytometry can be used to determine the actual copy number associated with a ratio level.
[0202] In some embodiments, an array CGH procedure can include the following steps. First, large-insert clones, for example, BACs can be obtained from a supplier of clone libraries. Then, small amounts of clone DNA can be amplified, for example, by degenerate oligonucleotide-primed (DOP) PCR or ligation-mediated PCR in order to obtain sufficient quantities needed for spotting. Next, PCR products can be spotted onto glass slides using, for example, microarray robots equipped with high-precision printing pins. Depending on the number of clones to be spotted and the space available on the microarray slide, clones can either be spotted once per array or in replicate. Repeated spotting of the same clone on an array can increase precision of the measurements if the spot intensities are averaged, and allows for a detailed statistical analysis of the quality of the experiments. Subject and control DNAs can be labeled, for example, with either Cy3 or Cy5-dUTP using random priming and can be subsequently hybridized onto the microarray in a solution containing an excess of Cot1-DNA to block repetitive sequences. Hybridizations can either be performed manually under a coverslip, in a gasket with gentle rocking or, automatically using commercially available hybridization stations. These automated hybridization stations can allow for an active hybridization process, thereby improving the reproducibility as well as reducing the actual hybridization time, which increases throughput. The hybridized DNAs can detected through the two different fluorochromes using standard microarray scanning equipment with either a scanning confocal laser or a charge coupled device (CCD) camera-based reader, followed by spot identification using commercially or freely available software packages.
[0203] The use of CGH with arrays that comprise long oligonucleotides (60-100 bp) can improve the detection resolution (in some embodiments, as small as 3-5 kb sized CNVs on arrays designed for interrogation of human whole genomes) over that achieved using BACs (limited to 50-100 kb or larger sized CNVs due to the large size of BAC clones). In some embodiments, the resolution of oligonucleotide CGH arrays is achieved via in situ synthesis of 1-2 million unique features/probes per microarray, which can include microarrays available from Roche NimbleGen and Agilent Technologies. In addition to array CGH methods for copy number detecton, other embodiments for partial or whole genome analysis of CNVs within a genome include, but are not limited to, use of SNP genotyping microarrays and sequencing methods.
[0204] Another method for copy number detection that uses oligonucleotides can be representational oligonucleotide microarray analysis (ROMA). It is similar to that applied in the use of BAC and CGH arrays, but to increase the signal-to-noise ratio, the complexity of the input DNA is reduced by a method called representation or whole-genome sampling. Here, the DNA that is to be hybridized to the array can be treated by restriction digestion and then ligated to adapters, which results in the PCR-based amplification of fragments in a specific size-range. As a result, the amplified DNA can make up a fraction of the entire genomic sequencethat is, it is a representation of the input DNA that has significantly reduced complexity, which can lead to a reduction in background noise. Other suitable methods available to the skilled person can also be used, and are within scope of the present disclosure.
[0205] A comparison of one or more genomes relative to one or more other genomes with array CGH, or a variety of other CNV detection methods, can reveal the set of CNVs between two genomes, between one genome in comparison to multiple genomes, or between one set of genomes in comparison to another set of genomes. In some embodiments, an array CGH experiment can be performed by hybrizing a single test genome against a pooled sample of two or more genomes, which can result in minimizing the detection of higher frequency variants in the experiment. In some embodiments, a test genome can be hybridized alone (i.e., one-color detetion) to a microarray, for example, using array CGH or SNP genotyping methods, and the comparison step to one or more reference genomes can be performed in silico to reveal the set of CNVs in the test genome relative to the one or more reference genomes. In one preferred embodiment, a single test genome is compared to a single reference genome in a 2-color experiment wherein both genomes are cohybridized to the microarray.
[0206] Array CGH can be used to identify genes that are causative or associated with a particular phenotype, condition, or disease by comparing the set of CNVs found in the affected cohort to the set of CNVs found in an unaffected cohort. An unaffected cohort may consist of any individual unaffected by the phenotype, condition, or disease of interest, but in one preferred embodiment is comprised of individuals or subjects that are apparently healthy (normal). Methods employed for such analyses are described in U.S. Pat. Nos. 7,702,468 and 7,957,913. In some embodiments of CNV comparison methods, candidate genes that are causative or associated (i.e., potentially serving as a biomarker) with a phenotype, condition, or disease will be identified by CNVs that occur in the affected cohort but not in the unaffected cohort. In some embodiments of CNV comparison methods, candidate genes that are causative or associated (i.e., potentially serving as a biomarker) with a phenotype, condition, or disease will be identified by CNVs that occur at a statistically significant higher frequency in the affected cohort as compared their frequency in the unaffected cohort. Thus, CNVs preferentially detected in the affected cohort as compared to the unaffected cohort can serve as beacons of genes that are causative or associated with a particular phenotype, condition, or disease. In some embodiments, CNV detection and comparison methods can result in direct identification of the gene that is causative or associated with phenotype, condition, or disease if the CNVs are found to overlap with or encompass the gene(s). In some embodiments, CNV detection and comparison methods can result in identification of regulatory regions of the genome (e.g., promoters, enhancers, transcription factor binding sites) that regulate the expression of one or more genes that are causative or associated with the phenotype, condition, or disease of interest.
[0207] Due to the large amount of genetic variation between any two genomes, or two sets (cohorts) of genomes, being compared, one preferred embodiment is to reduce the genetic variation search space by interrogating only CNVs, as opposed to the full set of genetic variants that can be identified in an individual's genome or exome. The set of CNVs that occur only, or at a statistically higher frequency, in the affected cohort as compared to the unaffected cohort can then be further investigated in targeted sequencing experiments to reveal the full set of genetic variants (of any size or type) that are causative or associated (i.e., potentially serving as a biomarker) with a phenotype, condition, or disease. It can be appreciated to those skilled in the art that the targeted sequencing experiments are performed in both the affected and unaffected cohorts in order to identify the genetic variants (e.g., SNVs and indels) that occur only, or at a statistically significant higher frequency, in the affected individual or cohort as compared to the unaffected cohort.
[0208] When investigating a particular phenotype, condition, or disease, such as ASD, it can be appreciated by those skilled in the art that the number of ASD candidate genes (or regulatory sequences) identified via CNV (or other variant types) detection methods may increase or decrease when additional ASD cohorts are analyzed. Similarly, the number of ASD candidate genes (or regulatory sequences), for example, identified via CNV (or other variant types) detection methods may increase or decrease when additional unaffected cohorts are used to interpret the affected cohort CNVs (or other variat types). For very rare CNVs (e.g., <0.1% frequency in the general population), only a single case may be observed in a given ASD cohort (e.g., 100 cases) but further statistical significance or evidence for the gene (or regulatory sequence/locus in the genome) can be established by: 1) CNV analysis of additional ASD cohorts, 2) CNV analysis of additional Normal cohorts, 3) targeted gene sequencing of both ASD and Normal cohorts, and/or 4) functional characterization of the ASD candidate gene (e.g., in silico analysis of the predicted impact of the candidate mutation on the gene product, RNAi knockdown experiments, biochemical assays on ASD patient tissue, gene expression analysis of disease-relevant tissues or of induced pluripotent stem cells (iPSCs) created from the ASD patient(s) harboring the candidate ASD-causing genetic variant).
[0209] It can be appreciated by those skilled in the art that a candidate gene may validate as causative of the phenotype, condition, or disease (e.g., ASD), which may, for example, be confirmed via mechanisms of action experiments, or it may serve as a biomarker of the phenotype, condition, or disease. Thus, in the example of ASD, in some embodiments, the ASD-specific gene (or regulatory sequence/locus) may be a biomarker of age-of-onset for ASD and disease severity, and thus have diagnostic utility for monitoring patients known to be at risk for ASD or as a general screening test in the population for early diagnosis of the disease. In some embodiments, the ASD-specific gene/biomarker may be an indicator of drug response (e.g., a particular subtype of ASD may respond best to a therapeutic targeting a particular phenotype, causative gene, or other gene in the same pathway as the causative gene) and thus have utility during drug development in clinical trials. For example, clinical trials for a therapeutic that targets a ASD genetic subtype comprising only 10% of all patients exhibiting symptoms of ASD, can be designed to comprise only those 10% of patients with a specific genotype(s) in order to reduce the time and cost of such clinical trials (e.g., smaller number of patients in the clinical trial). It can be appreciated by those skilled in the art that such patient stratification methods (i.e., specific genotypes correlated with the disease or drug response) can be employed not only for targeted therapeutics, but in general for any drug that is approved or in development (i.e., the mechanism of action may or may not be known). For example, drugs in development or approved to treat, for example, cancer, may have utility in being repurposed to treat ASD. Such patient stratification methods can also be utilized to develop a companion diagnostic test (e.g., comprising the specific genes/genotypes found in patients that are indicative of drug response) for a particular drug, either concurrently during the clinical trials for the drug or after drug approval (e.g., as a new indication or for the physician to use in guiding medical decisions for the patient).
[0210] Further neurodevelopmental and/or links to ASD pathology can be established via pathway analysis of the genes, which may take into consideration binding interactions (e.g., via yeast 2-hybrid screen) and molecular events (e.g., kinase activity or other enzymatic processes) if such information is available for the gene(s) of interest (i.e., specified in the analysis). Both commercial (e.g., Ingenuity's IPA software and Thomson Reuter's GeneGo software) and open source software (e.g., String: string-db.org/) are available for such analyses. To assess connections to established ASD biology, analyses can be performed for the set of candidate ASD genes independently or against known causative ASD genes singly or as a group. In some embodiments, ASD candidate genes can be distributed into 5 main categories: 1) genes with neuroprotective function, 2) neuropsychiatric genes, some of which are known drug targets 3) genes linked to a known causative ASD gene (e.g., binding partner) or a novel gene family member of a known ASD gene, 4) genes linked to neurodevelopmental regulation, neurogenesis, and G-protein signaling pathways, and 5) other (e.g., established role in other diseases with no obvious neurodevelopmental biology, such as cancer) or unknown gene function (e.g., limited or no gene information presently annotated for the ASD-specific gene).
[0211] A method of screening a subject for a disease or disorder can comprise assaying a nucleic acid sample from the subject to detect sequence information for more than one genetic locus and comparing the sequence information to a panel of nucleic acid biomarkers and screening the subject for the presence or absence of the disease or disorder if one or more of low frequency biomarkers in the panel are present in the sequence information.
[0212] The panel can comprise at least one nucleic acid biomarker for each of the more than one genetic loci. For example, the panel can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 3, 14, 15, 15, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200 or more nucleic acid biomarkers for each of the more than one genetic loci. The panel can comprise at least 25 low frequency biomarkers. For example, the panel can comprise at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 135, 150, 175, 200, 250, 500, or 1000 or more low frequency biomarkers. In some embodiments, the panel can comprise from about 2-1000 nucleic acid biomarkers. For example, the panel can comprise from about 2-900, 2-800, 2-700, 2-600, 2-500, 2-400, 2-300, 2-200, 2-100, 25-900, 25-800, 25-700, 25-600, 25-500, 25-400, 25-300, 25-200, 25-100, 100-1000, 100-900, 100-800, 100-700, 100-600, 100-500, 100-400, 100-300, 100-200, 200-1000, 200-900, 200-800, 200-700, 200-600, 200-500, 200-400, 200-300, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-1000, 400-900, 400-800, 400-700, 400-600, 400-500, 500-1000, 500-900, 500-800, 500-700, 500-600, 600-1000, 600-900, 600-800, 600-700, 700-1000, 700-900, 700-800, 800-1000, 800-900, or 900-1000 nucleic acid biomarkers.
[0213] The panel can comprise at least 2 low frequency biomarkers. For example, the panel can comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 3, 14, 15, 15, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 250, 500, or 1000 or more low frequency biomarkers. In some embodiments, the panel can comprise from about 2-1000 low frequency biomarkers. For example, the panel can comprise from about 2-900, 2-800, 2-700, 2-600, 2-500, 2-400, 2-300, 2-200, 2-100, 25-900, 25-800, 25-700, 25-600, 25-500, 25-400, 25-300, 25-200, 25-100, 100-1000, 100-900, 100-800, 100-700, 100-600, 100-500, 100-400, 100-300, 100-200, 200-1000, 200-900, 200-800, 200-700, 200-600, 200-500, 200-400, 200-300, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-1000, 400-900, 400-800, 400-700, 400-600, 400-500, 500-1000, 500-900, 500-800, 500-700, 500-600, 600-1000, 600-900, 600-800, 600-700, 700-1000, 700-900, 700-800, 800-1000, 800-900, or 900-1000 1000 low frequency biomarkers. In some embodiments, a low frequency biomarker can occur at a frequency of 0.1% or less in a population of subjects without a diagnosis of the disease or disorder. For example, a low frequency biomarker can occur at a frequency of 0.05%, 0.01%, 0.005%, 0.001%, 0.0005%, 0.0001%, 0.00005%, or 0.00001% or less in a population of subjects without a diagnosis of the disease or disorder. In some embodiments, a low frequency biomarker can occur at a frequency from about 0.00001%-0.1% in a population of subjects without a diagnosis of the disease or disorder. For example, a low frequency biomarker can occur at a frequency of from about 0.00001%-0.00005%, 0.00001%-0.0001%, 0.00001%-0.0005%, 0.00001%-0.001%, 0.00001%-0.005%, 0.00001%-0.01%, 0.00001%-0.05%, 0.00005%-0.0001%, 0.00005%-0.0005%, 0.00005%-0.001%, 0.00005%-0.005%, 0.00005%-0.01%, 0.00005%-0.05%, 0.00005%-0.1%, 0.0001%-0.0005%, 0.0001%-0.001%, 0.0001%-0.005%, 0.0001%-0.01%, 0.0001%-0.05%, 0.0001%-0.1%, 0.0005%-0.001%, 0.0005%-0.005%, 0.0005%-0.01%, 0.0005%-0.05%, 0.0005%-0.1%, 0.001%-0.005%, 0.001%-0.01%, 0.001%-0.05%, 0.001%-0.1%, 0.005%-0.01%, 0.005%-0.05%, 0.005%-0.1%, 0.01%-0.05%, 0.01%-0.1%, or 0.05%-0.1% in a population of subjects without a diagnosis of the disease or disorder
[0214] In some embodiments, the presence or absence of the disease or disorder in the subject can be determined with at least 50% confidence. For example, the presence or absence of the disease or disorder in the subject can be determined with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% confidence. In some embodiments, the presence or absence of the disease or disorder in the subject can be determined with a 50%-100% confidence. For example, the presence or absence of the disease or disorder in the subject can be determined with a 60%-100%, 70%-100%, 80%-100%, 90%-100%, 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-90%, 60%-80%, 60%-70%, 70%-90%, 70%-80%, or 80%-90%. In one embodiment, ASD candidate CNV-subregions and genes associated with these regions can be determined or identified by comparing genetic data from a cohort of normal individuals (NVE) to that of a cohort of individuals known to have, or be susceptible to a developmental disorder such as ASD.
[0215] In some embodiments, genomic DNA samples from individuals within an NVE (reference) and an ASD (test) can be hybridized against one or more sex-matched reference individuals. For example, reference DNA samples can be labeled with a fluorophore such as Cy5, using methods described herein, and test subject DNA samples can be labeled with a different fluorophore, such as Cy3. After labeling, samples can be combined and can be co-hybridized to a microarray and analyzed using any of the methods described herein, such as aCGH.
[0216] Arrays can then be scanned and the data can be analyzed with software. Genetic alterations, such as CNVs, can be called using any of the methods described herein. A list of the genetic alterations, such as CNVs, can be generated for each cohort. The list of CNVs can be used to generate a master list of non-redundant CNVs and/or CNV-subregions for each cohort. The list can be based on the presence or absence of the CNV-subregion in individuals within the cohort. In this manner, the master list can contain a number of distinct CNV-subregions, some of which are uniquely present in a single individual and some of which are present in multiple individuals.
[0217] In some embodiments, CNV-subregions of interest can be obtained by annotation of each CNV-subregion with relevant information, such as overlap with known genes and/or exons. In some embodiments, CNV-subregions of interest can be obtained bycalculating the OR for a CNV-subregion according to the following formula: OR=(ASD/((# individuals in ASD cohort)ASD))/(NVE/((# individuals in NVE cohort)NVE)), where: ASD=number of ASD individuals with a CNV-subregion of interest and NVE=number of NVE individuals with the CNV-subregion of interest. If NVE=0, it can be set to 1 to avoid dealing with infinities in cases where no CNVs are seen in the NVE. In some embodiments, a set of publicly available CNVs (e.g., the Database of Genomic Variants, http://projects.tcag.ca/variation/) can be used as the Normal cohort for comparison to the affected cohort CNVs. In another embodiment, the set of Normal cohort CNVs may comprise a private database generated by the same CNV detection method, such as array CGH, or by a plurality of CNV detection methods that include, but are not limited to, array CGH, SNP genotyping arrays, custom CGH arrays, custom genotyping arrays, exome sequencing, whole genome sequencing, targeted sequencing, FISH, q-PCR, or MLPA.
[0218] The number of individuals in any given cohort can be at least about 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2500, 5000, 7500, 10,000, 100,000, or more. In some embodiments, the number of individuals in any given cohort can be from 25-900, 25-800, 25-700, 25-600, 25-500, 25-400, 25-300, 25-200, 25-100, 100-1000, 100-900, 100-800, 100-700, 100-600, 100-500, 100-400, 100-300, 100-200, 200-1000, 200-900, 200-800, 200-700, 200-600, 200-500, 200-400, 200-300, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-1000, 400-900, 400-800, 400-700, 400-600, 400-500, 500-1000, 500-900, 500-800, 500-700, 500-600, 600-1000, 600-900, 600-800, 600-700, 700-1000, 700-900, 700-800, 800-1000, 800-900, or 900-1000.
[0219] Different categories for CNVs of interest can be defined. In some embodiments, CNVs can be of interest if the CNVs are rare in the general population or in a cohort of individuals without the disease or condition of interest. In another embodiment, CNVs can be of interest if they are found only in those affected by a disease or condition and not in those without the disease or condition. In another embodiment, CNVs can be of interest if they are found at much greater frequency in those affected by the disease or condition as compared to those without the disease or condition.
[0220] Different categories for CNVs of interest can be defined. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions occur in the offspring of two parents, neither of whom has the relevant CNV. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions affect exons only, introns only, or exons and/or introns. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions are overlapping and/or non-overlapping within the same gene or regulatory locus. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions include regions present at high frequency in the ASD cohort compared to the normal cohort. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions occur in 2 or more ASD individuals affecting different exons of the same gene. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions occur in 2 or more ASD individuals affecting the same exon of a gene. In some embodiments, CNVs/CNV-subregions can be of interest if the CNVs/CNV-subregions have a relationship to genes with strong biological evidence in ASD. In some embodiments, CNVs can be of interest if the CNVs are associated with an OR greater than 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, or more. In some embodiments, CNVs can be of interest if the CNVs are associated with an OR from about 2.8-100, 2.8-50, 2.8-40, 2.8-30, 2.8-20, 2.8-10, 2.8-9, 2.8-8, 2.8-7, 5-100, 5-50, 5-40, 5-30, 5-20, 5-10, 10-100, 10-50, 10-40, 10-30, 10-20, 20-100, 20-50, 20-40, 20-30, 30-100, 30-50, 30-40, 40-100, 40-50, or 50-100.
[0221] The data presented herein was generated on the basis of a comparison of CNVs/CNV-subregions identified in an ASD cohort. CNV/CNV-subregion genome locations are provided using the Human March 2006 (NCBI36/hg18) assembly. It can be appreciated by those skilled in the art that a CNV/CNV-subregion found in an affected individual may have one or more CNVs/CNV-subregions that are preferentially found in the affected cohort as compared to the unaffected cohort and, similarly, other CNVs/CNV-subregions that are found at comparable frequencies, or not statistically significant different frequencies, in the affected and unaffected cohorts. In a preferred embodiment, CNV/CNV-subregion detection and analysis methods are employed that enable comparison of CNVs/CNV-subregions to facilitate identification of genes (or regulatory loci) that are causative or associated with the phenotype, condition, or disease being investigated (or detected for diagnostic purposes). In Tables 1 and 5, SEQ IDs 1-643 and 2418-2557 refer to the CNV sequences (full sequence obtained for the whole CNV). In Tables 4 and 7, SEQ IDs 644-2417 and 2558-2739 refer to the genomic sequences over which the relevant transcripts extend (full genomic extent of the transcripts, not just the short sequence associated with the mRNA).
TABLE-US-00001 TABLE 1 SEQ ID No Chr Orig CNV Start Orig CNV Stop Orig CNV Size CNV type ASD Case ID(s) RefSeq Gene Symbol(s) Category OR SEQ ID 1 17 77787243 77847938 60695 Loss 1891 SLC16A3, CSNK1D De Novo NA SEQ ID 2 17 76954271 77777066 822795 Gain 1891 C17orf70, ACTG1, TSPAN10, DCXR, C17orf90, STRA13, De Novo NA ARL16, MIR3186, NPLOC4, PYCR1, SLC25A10, GPS1, DUS1L, ANAPC11, LOC92659, FASN, ARHGDIA, MAFG, BAHCC1, DYSFIP1, MRPL12, SIRT7, RAC3, CCDC57, P4HB, PCYT2, HGS, RFNG, MYADML2, FSCN2, THOC4, ASPSCR1, CCDC137, NOTUM, NPB, PDE6G, LRRC45 SEQ ID 3 5 180189516 180362342 172826 loss 1229 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 3 5 180189516 180362342 172826 loss 1548 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 4 5 180189516 180365977 176461 loss 1532 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 5 5 180346557 180365977 19420 Loss 1540 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 5 5 180346557 180365977 19420 Loss 1754 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 5 5 180346557 180365977 19420 Loss 1755 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1261 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1265 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1438 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1467 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1568 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1570 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1662 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1671 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1726 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1769 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 6 5 180344964 180365977 21013 Loss 1799 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 7 5 180346557 180378586 32029 Loss 1942 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 8 5 180344964 180378586 33622 Loss 1268 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 8 5 180344964 180378586 33622 Loss 1354 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 8 5 180344964 180378586 33622 Loss 1463 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 8 5 180344964 180378586 33622 Loss 1849 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 9 5 180344964 180379663 34699 Loss 1277 BTNL3 Ctrl pos High OR 59.24223602 SEQ ID 10 5 180189516 180357210 167694 loss 1861 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 11 5 180192214 180362342 170128 gain 1316 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 11 5 180192214 180362342 170128 loss 1580 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 11 5 180192214 180362342 170128 loss 1641 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 12 5 180194323 180365977 171654 Loss 1546 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 12 5 180194323 180365977 171654 Loss 1696 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 12 5 180194323 180365977 171654 Loss 1792 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 12 5 180194323 180365977 171654 Loss 1927 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 13 5 180192214 180365977 173763 loss 1606 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 4 5 180189516 180365977 176461 loss 1612 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 4 5 180189516 180365977 176461 loss 1686 BTNL8, BTNL3, LOC729678, ZFP62 Exon + ve, 2 cases 59.24223602 SEQ ID 14 5 180194323 180378586 184263 Loss 1429 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 14 5 180194323 180378586 184263 Loss 1634 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 14 5 180194323 180378586 184263 Loss 1851 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 14 5 180194323 180378586 184263 Loss 1902 BTNL8, BTNL3, LOC729678, ZFP62 Ctrl pos High OR 59.24223602 SEQ ID 15 7 147704200 147708382 4182 Loss 1371 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 15 7 147704200 147708382 4182 Loss 1617 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 15 7 147704200 147708382 4182 Loss 1803 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1227 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1346 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1517 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1621 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1636 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1639 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1645 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1670 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1727 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1753 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1754 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1761 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1792 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1806 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1820 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1826 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1836 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1854 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1867 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1872 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1916 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1918 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 1960 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 2003 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 2028 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 16 7 147704200 147710037 5837 Loss 2041 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 17 7 147702365 147710037 7672 Loss 1728 CNTNAP2 Ctrl pos High OR 46.19631902 SEQ ID 18 15 99632987 99635701 2714 gain 1404 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 19 15 99632987 99636724 3737 gain 1728 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1389 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 gain 1401 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1413 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1416 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 gain 1434 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1446 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1449 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1461 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1477 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1505 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1529 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1548 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1559 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1572 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 gain 1576 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1584 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 gain 1596 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1609 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 gain 1633 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1672 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1687 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1829 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 gain 1842 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1913 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 20 15 99634434 99635701 1267 loss 1964 SELS Exon + ve, 2 cases 41.38625954 SEQ ID 21 X 43458232 43465307 7075 Loss 1800 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1842 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1848 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1855 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1859 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1898 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1907 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1916 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1921 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1935 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1946 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1958 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1960 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1961 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1965 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1966 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1967 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1969 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1993 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 2033 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 2035 MAOA Intronic 38.20395738 SEQ ID 22 X 43457175 43465307 8132 Loss 1369 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1300 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1697 MAOA Intronic 38.20395738 SEQ ID 21 X 43458232 43465307 7075 Loss 1751 MAOA Intronic 38.20395738 SEQ ID 23 17 41506317 41710400 204083 loss 1319 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 24 17 41504832 41710400 205568 loss 1320 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 25 17 41508943 42142363 633420 loss 1542 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 26 17 41508943 41566540 57597 loss 1656 KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 27 17 41508943 41579322 70379 loss 1861 KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 28 17 41514481 41710400 195919 loss 1655 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1530 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1533 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1535 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1537 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1539 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1586 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 29 17 41512318 41710400 198082 loss 1684 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 30 17 41508943 41710400 201457 loss 1587 LOC644246, KIAA1267 Exon + ve, 2 cases 31.89712557 SEQ ID 31 17 41706870 42147225 440355 gain 1991 NSF, ARL17B, NSFP1, LRRC37A2, LRRC37A, ARL17A Exon + ve, 2 cases 31.89712557 SEQ ID 32 17 41568539 42147225 578686 gain 2032 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 33 17 41568539 42151941 583402 gain 1800 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 34 17 41521544 42148637 627093 gain 1671 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 34 17 41521544 42148637 627093 gain 1751 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 35 17 41512318 42142363 630045 loss 1662 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 36 17 41512318 42151941 639623 loss 1536 NSFP1, NSF, ARL17B, LOC644246, LRRC37A2, ARL17A, Exon + ve, 2 cases 31.89712557 LRRC37A, KIAA1267 SEQ ID 37 7 147704200 147707161 2961 Gain 1808 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 37 7 147704200 147707161 2961 Gain 1877 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 37 7 147704200 147707161 2961 Gain 1895 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 37 7 147704200 147707161 2961 Gain 1907 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 37 7 147704200 147707161 2961 Gain 1951 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 37 7 147704200 147707161 2961 Gain 1994 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 37 7 147704200 147707161 2961 Gain 2006 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1220 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1223 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1230 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1234 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1240 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1252 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1281 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1282 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1284 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1286 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1290 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1307 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1308 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1309 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1318 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1320 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1345 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1389 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1405 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1415 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1421 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1422 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1425 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1432 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1434 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1438 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1440 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1442 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1463 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1466 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1472 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1473 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1490 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1492 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1495 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1496 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1497 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1498 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1502 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1504 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1506 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1508 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1512 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1513 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1514 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1515 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1519 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1520 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1528 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1534 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1543 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1544 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1556 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1557 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1558 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1559 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1560 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1565 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1570 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1571 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1573 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1584 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1586 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1592 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1597 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1601 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1602 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1603 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1610 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1618 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1619 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1620 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1622 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1624 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1626 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1632 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1640 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1641 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1647 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1650 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1653 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1654 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1662 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1667 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1688 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1707 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1708 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1710 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1715 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1720 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1755 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1760 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1774 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1779 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1782 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1783 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1784 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1796 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1804 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1805 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1811 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1813 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1814 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1815 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1818 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1831 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1832 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1835 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1838 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1839 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1845 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1851 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1861 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1874 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1881 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1883 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1893 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1905 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1927 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1930 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1944 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1948 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1970 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 1997 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 2024 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 2026 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 15 7 147704200 147708382 4182 Gain 2034 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 38 7 147704200 147711471 7271 Gain 1423 CNTNAP2 Ctrl pos High OR 30.75754113 SEQ ID 39 1 85964576 85967615 3039 loss 1266 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1283 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1284 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1308 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1309 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1354 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1413 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1418 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1433 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1449 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1451 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1640 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1781 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1815 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1818 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1929 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 1994 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 2031 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 39 1 85964576 85967615 3039 loss 2040 COL24A1 Exon + ve, 2 cases 28.77224736 SEQ ID 40 6 35853209 35862502 9293 loss 1940 C6orf127, C6orf126 Exon + ve, 2 cases 28.77224736 SEQ ID 41 6 35855652 35873335 17683 loss 1301 C6orf127, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 41 6 35855652 35873335 17683 loss 1837 C6orf127, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 41 6 35855652 35873335 17683 loss 1839 C6orf127, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 41 6 35855652 35873335 17683 loss 1952 C6orf127, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 41 6 35855652 35873335 17683 loss 1959 C6orf127, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 42 6 35853209 35873335 20126 loss 1958 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 42 6 35853209 35873335 20126 loss 1961 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 42 6 35853209 35873335 20126 loss 1962 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 42 6 35853209 35873335 20126 loss 2005 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 43 6 35851495 35872078 20583 loss 1852 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 44 6 35851495 35873335 21840 loss 1965 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 44 6 35851495 35873335 21840 loss 2018 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 45 6 35853209 35875112 21903 loss 1946 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 46 6 35851495 35875112 23617 loss 1950 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 47 6 35851495 35878656 27161 loss 2006 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 48 6 35849860 35878656 28796 loss 1680 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 49 6 35848099 35878656 30557 loss 1718 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 50 6 35846772 35878656 31884 loss 1694 C6orf127, C6orf126, CLPS Exon + ve, 2 cases 28.77224736 SEQ ID 51 12 130944468 130946248 1780 gain 1448 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1471 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1474 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1492 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1493 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1496 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1497 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1498 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1500 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1505 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1517 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1566 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1579 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1580 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 51 12 130944468 130946248 1780 loss 1582 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 52 12 130944468 130947790 3322 loss 1416 ULK1 Exon + ve, 2 cases 24.12012012 SEQ ID 53 14 22946615 22947034 419 Loss 1820 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1718 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1802 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1816 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1817 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1819 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1850 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1895 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 1993 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 54 14 22946615 22947639 1024 Loss 2043 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 55 14 22943262 22951086 7824 Loss 1577 MYH6 Ctrl pos High OR 22.57871064 SEQ ID 56 14 22946615 22955470 8855 Loss 2032 MYH6, MYH7 Ctrl pos High OR 22.57871064 SEQ ID 57 14 22943262 22955470 12208 Loss 1856 MYH6, MYH7 Ctrl pos High OR 22.57871064 SEQ ID 58 14 22929952 22958797 28845 Loss 1537 MIR208B, MYH6, MYH7 Ctrl pos High OR 22.57871064 SEQ ID 59 14 22929952 22959469 29517 Loss 1669 MIR208B, MYH6, MYH7 Ctrl pos High OR 22.57871064 SEQ ID 60 7 142027745 142152205 124460 loss 1568 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 60 7 142027745 142152205 124460 loss 1753 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 61 7 142021348 142152205 130857 loss 1347 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 62 7 142009000 142140540 131540 loss 2018 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 63 7 142018368 142152205 133837 loss 1349 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 63 7 142018368 142152205 133837 loss 1374 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 63 7 142018368 142152205 133837 loss 1697 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 64 7 142007171 142152205 145034 loss 1242 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 65 7 142005505 142152205 146700 loss 1601 PRSS1, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 66 7 142041787 142205830 164043 loss 1837 PRSS1, TRY6, PRSS2, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 67 7 142018368 142202274 183906 loss 1784 PRSS1, TRY6, PRSS2, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 68 7 142009000 142205830 196830 loss 2024 PRSS1, TRY6, PRSS2, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 69 7 141993718 142207147 213429 loss 1930 PRSS1, TRY6, PRSS2, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 70 7 141989750 142205830 216080 loss 1803 PRSS1, TRY6, PRSS2, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 71 7 141953817 142205830 252013 loss 1232 PRSS1, TRY6, PRSS2, MTRNR2L6 Exon + ve, 2 cases 22.57871064 SEQ ID 72 19 14666403 14667646 1243 loss 1677 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 1738 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 1775 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 1826 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 1837 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 1957 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 1968 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 2004 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 72 19 14666403 14667646 1243 loss 2031 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 73 19 14665135 14667646 2511 loss 1416 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 73 19 14665135 14667646 2511 loss 1578 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 73 19 14665135 14667646 2511 loss 1881 ZNF333 Exon + ve, 2 cases 17.98208955 SEQ ID 74 5 122534134 122535395 1261 loss 1224 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1548 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1552 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1681 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1740 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1763 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1786 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1807 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1880 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1881 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 74 5 122534134 122535395 1261 loss 1915 PRDM6 Exon + ve, 2 cases 16.45901639 SEQ ID 75 2 10263146 10272211 9065 loss 1256 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 75 2 10263146 10272211 9065 loss 1285 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 75 2 10263146 10272211 9065 loss 1370 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 75 2 10263146 10272211 9065 loss 1396 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 76 6 33495074 33505974 10900 loss 1824 SYNGAP1 Exon + ve, 2 cases 14.94047619 SEQ ID 76 6 33495074 33505974 10900 loss 1840 SYNGAP1 Exon + ve, 2 cases 14.94047619 SEQ ID 77 2 10263146 10274556 11410 loss 1307 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 77 2 10263146 10274556 11410 loss 1415 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 77 2 10263146 10274556 11410 loss 1616 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 77 2 10263146 10274556 11410 loss 1654 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 77 2 10263146 10274556 11410 loss 1830 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 77 2 10263146 10274556 11410 loss 1931 C2orf48 Exon + ve, 2 cases 14.94047619 SEQ ID 78 6 33491109 33504619 13510 loss 1718 SYNGAP1, CUTA, PHF1 Exon + ve, 2 cases 14.94047619 SEQ ID 78 6 33491109 33504619 13510 loss 2032 SYNGAP1, CUTA, PHF1 Exon + ve, 2 cases 14.94047619 SEQ ID 79 6 33492394 33505974 13580 loss 1872 SYNGAP1, CUTA Exon + ve, 2 cases 14.94047619 SEQ ID 79 6 33492394 33505974 13580 loss 1967 SYNGAP1, CUTA Exon + ve, 2 cases 14.94047619 SEQ ID 80 6 33491109 33505974 14865 loss 1905 SYNGAP1, CUTA, PHF1 Exon + ve, 2 cases 14.94047619 SEQ ID 80 6 33491109 33505974 14865 loss 2031 SYNGAP1, CUTA, PHF1 Exon + ve, 2 cases 14.94047619 SEQ ID 81 6 33491109 33507587 16478 loss 1297 SYNGAP1, CUTA, PHF1 Exon + ve, 2 cases 14.94047619 SEQ ID 82 11 5742476 5774108 31632 gain 1394 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 82 11 5742476 5774108 31632 gain 1536 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 82 11 5742476 5774108 31632 gain 1821 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 82 11 5742476 5774108 31632 gain 1825 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 82 11 5742476 5774108 31632 gain 1902 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 83 11 5742476 5775970 33494 gain 1538 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 83 11 5742476 5775970 33494 gain 1551 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 83 11 5742476 5775970 33494 gain 1727 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 83 11 5742476 5775970 33494 gain 1823 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 83 11 5742476 5775970 33494 gain 1824 OR52N5, OR52N1 Exon + ve, 2 cases 14.94047619 SEQ ID 84 6 33400195 33511247 111052 loss 1841 SYNGAP1, PHF1, CUTA, KIFC1 Exon + ve, 2 cases 14.94047619 SEQ ID 85 19 59174756 59183718 8962 loss 1859 CACNG8, MIR935 Exon + ve, 2 cases 13.42644874 SEQ ID 86 10 131651597 131652807 1210 loss 1572 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 gain 1597 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 gain 1644 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 loss 1691 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 loss 1703 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 loss 1704 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 gain 1709 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 86 10 131651597 131652807 1210 loss 1724 EBF3 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1237 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1347 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1441 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1456 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1494 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1496 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 87 15 54513726 54522863 9137 loss 1997 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 88 15 54513726 54523657 9931 loss 1497 TEX9, MNS1 Exon + ve, 2 cases 11.91691395 SEQ ID 89 5 10683077 10691335 8258 loss 1438 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 89 5 10683077 10691335 8258 loss 1619 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 89 5 10683077 10691335 8258 loss 1629 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 89 5 10683077 10691335 8258 loss 1630 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 89 5 10683077 10691335 8258 loss 1998 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 89 5 10683077 10691335 8258 loss 2026 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 90 6 143693693 143705189 11496 gain 1372 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 91 6 143692365 143705189 12824 gain 1281 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 92 5 10677114 10699881 22767 loss 1666 ANKRD33B Exon + ve, 2 cases 11.91691395 SEQ ID 93 5 9279249 12716482 3437233 loss 1850 TAG, CMBL, SEMA5A, FAM173B, ROPN1L, CCT5, Exon + ve, 2 cases 11.91691395 LOC285692, MARCH6, DAP, CTNND2, SNORD123, ANKRD33B, TAS2R1 SEQ ID 94 6 143697902 143705189 7287 gain 1905 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 95 6 143696259 143705189 8930 gain 1429 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 95 6 143696259 143705189 8930 gain 1926 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 90 6 143693693 143705189 11496 gain 1409 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 90 6 143693693 143705189 11496 gain 1619 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 90 6 143693693 143705189 11496 gain 1639 AIG1 Exon + ve, 2 cases 11.91691395 SEQ ID 96 16 5047987 5049746 1759 loss 1419 C16orf89 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1447 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1728 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1742 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1957 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1961 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1965 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 97 12 95110503 95112470 1967 loss 1967 ELK3 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 gain 1324 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 loss 1396 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 gain 1530 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 loss 1829 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 gain 1860 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 loss 1874 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 98 11 43920001 43921971 1970 gain 1996 C11orf96 Exon + ve, 2 cases 10.41185185 SEQ ID 99 16 3868512 3870705 2193 loss 1590 CREBBP Exon + ve, 2 cases 10.41185185 SEQ ID 100 16 3868512 3872218 3706 loss 1533 CREBBP Exon + ve, 2 cases 10.41185185 SEQ ID 100 16 3868512 3872218 3706 loss 1539 CREBBP Exon + ve, 2 cases 10.41185185 SEQ ID 101 14 73058103 73061942 3839 loss 1676 HEATR4 Exon + ve, 2 cases 10.41185185 SEQ ID 102 14 73010755 73015309 4554 loss 1806 HEATR4 Exon + ve, 2 cases 10.41185185 SEQ ID 103 16 4187745 4192873 5128 loss 1442 SRL Exon + ve, 2 cases 10.41185185 SEQ ID 104 16 79735089 79744613 9524 loss 1275 PKD1L2 Exon + ve, 2 cases 10.41185185 SEQ ID 104 16 79735089 79744613 9524 loss 1998 PKD1L2 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 1798 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 1852 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 1854 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 1855 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 1857 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 1936 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 105 11 47142460 47155662 13202 loss 2031 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases 10.41185185 SEQ ID 106 14 73058103 73071404 13301 loss 1687 HEATR4 Exon + ve, 2 cases 10.41185185 SEQ ID 107 16 79747298 79761753 14455 gain 1252 PKD1L2 Exon + ve, 2 cases 10.41185185 SEQ ID 108 16 79730151 79744613 14462 loss 1404 PKD1L2 Exon + ve, 2 cases 10.41185185 SEQ ID 109 14 73051686 73071404 19718 loss 1237 HEATR4 Exon + ve, 2 cases 10.41185185 SEQ ID 110 X 2768213 2788489 20276 loss 1654 GYG2 Exon + ve, 2 cases 10.41185185 SEQ ID 111 16 79684548 79713478 28930 gain 1763 PKD1L2, LOC100329108, GCSH Exon + ve, distinct 10.41185185 CNVs, same Gene SEQ ID 112 16 4554395 4588011 33616 loss 1689 LOC342346 Exon + ve, 2 cases 10.41185185 SEQ ID 113 14 73058103 73092112 34009 loss 1721 HEATR4, ACOT1 Exon + ve, 2 cases 10.41185185 SEQ ID 114 2 73732303 73770615 38312 gain 1533 ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 114 2 73732303 73770615 38312 loss 1738 ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 115 2 73732303 73785403 53100 gain 1887 NAT8B, ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 116 14 73058103 73112042 53939 loss 1718 HEATR4, ACOT2, ACOT1 Exon + ve, 2 cases 10.41185185 SEQ ID 117 2 73706727 73764497 57770 gain 1369 NAT8, ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 117 2 73706727 73764497 57770 gain 1626 NAT8, ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 118 2 73706727 73766459 59732 loss 1551 NAT8, ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 118 2 73706727 73766459 59732 loss 1728 NAT8, ALMS1P Exon + ve, 2 cases 10.41185185 SEQ ID 119 16 79735089 79817743 82654 loss 1917 PKD1L2 Exon + ve, 2 cases 10.41185185 SEQ ID 120 14 72995201 73092112 96911 gain 1291 HEATR4, C14orf169, ACOT1 Exon + ve, 2 cases 10.41185185 SEQ ID 121 X 2705378 2814330 108952 gain 1509 XG, GYG2 Exon + ve, 2 cases 10.41185185 SEQ ID 121 X 2705378 2814330 108952 gain 1732 XG, GYG2 Exon + ve, 2 cases 10.41185185 SEQ ID 121 X 2705378 2814330 108952 gain 1825 XG, GYG2 Exon + ve, 2 cases 10.41185185 SEQ ID 122 X 2705374 2814330 108956 gain 1434 XG, GYG2 Exon + ve, 2 cases 10.41185185 SEQ ID 123 16 79758150 79903976 145826 gain 1459 PKD1L2, BCMO1 Exon + ve, 2 cases 10.41185185 SEQ ID 124 X 2554044 2747802 193758 gain 1917 XGPY2, CD99P1, XG, CD99 Exon + ve, 2 cases 10.41185185 SEQ ID 125 X 2749116 3191663 442547 gain 1917 ARSD, ARSE, ARSF, ARSH, GYG2 Exon + ve, 2 cases 10.41185185 SEQ ID 126 16 3361009 5067233 1706224 gain 1567 CLUAP1, NAGPA, CORO7-PAM16, GLIS2, ALG1, ROGDI, Exon + ve, 2 cases 10.41185185 SEC14L5, C16orf5, ZNF597, NUDT16L1, GLYR1, LOC440335, UBN1, CORO7, C16orf89, LOC342346, SLX4, TRAP1, DNASE1, PPL, ZNF434, PAM16, ANKS3, FAM100A, NLRC3, MTRNR2L4, C16orf71, VASN, NMRAL1, SRL, NAT15, DNAJA3, TFAP4, ZNF174, ADCY9, HMOX2, C16orf90, ZNF500, SEPT12, MGRN1, CREBBP SEQ ID 127 15 73680498 73686655 6157 loss 1773 SNUPN Exon + ve, 2 cases 8.911242604 SEQ ID 128 15 73443782 73460290 16508 gain 1301 MAN2C1, SIN3A Exon + ve, 2 cases 8.911242604 SEQ ID 129 15 73661881 73759785 97904 gain 2018 IMP3, SNX33, SNUPN, CSPG4 Exon + ve, 2 cases 8.911242604 SEQ ID 130 15 72804753 72806259 1506 gain 1309 CYP1A1 Exon + ve, 2 cases 8.911242604 SEQ ID 131 10 25049572 25051425 1853 loss 1548 ARHGAP21 Exon + ve, 2 cases 8.911242604 SEQ ID 131 10 25049572 25051425 1853 loss 1699 ARHGAP21 Exon + ve, 2 cases 8.911242604 SEQ ID 131 10 25049572 25051425 1853 loss 1724 ARHGAP21 Exon + ve, 2 cases 8.911242604 SEQ ID 131 10 25049572 25051425 1853 loss 1961 ARHGAP21 Exon + ve, 2 cases 8.911242604 SEQ ID 132 10 25049572 25057232 7660 gain 1401 ARHGAP21 Exon + ve, 2 cases 8.911242604 SEQ ID 132 10 25049572 25057232 7660 gain 1820 ARHGAP21 Exon + ve, 2 cases 8.911242604 SEQ ID 133 15 71247339 71258333 10994 gain 1293 NEO1 Exon + ve, 2 cases 8.911242604 SEQ ID 134 6 139638465 139651247 12782 loss 1387 TXLNB Exon + ve, 2 cases 8.911242604 SEQ ID 134 6 139638465 139651247 12782 loss 1396 TXLNB Exon + ve, 2 cases 8.911242604 SEQ ID 134 6 139638465 139651247 12782 loss 1696 TXLNB Exon + ve, 2 cases 8.911242604 SEQ ID 135 6 139635466 139648318 12852 loss 1403 TXLNB Exon + ve, 2 cases 8.911242604 SEQ ID 135 6 139635466 139648318 12852 loss 1895 TXLNB Exon + ve, 2 cases 8.911242604 SEQ ID 136 6 139635466 139651247 15781 loss 1401 TXLNB Exon + ve, 2 cases 8.911242604 SEQ ID 137 7 100166257 100183859 17602 loss 1896 ZAN Exon + ve, 2 cases 8.911242604 SEQ ID 138 1 151028700 151047260 18560 gain 1587 LCE1D, LCE1C Exon + ve, 2 cases 8.911242604 SEQ ID 138 1 151028700 151047260 18560 gain 1695 LCE1D, LCE1C Exon + ve, 2 cases 8.911242604 SEQ ID 139 7 100162851 100183859 21008 loss 1227 ZAN Exon + ve, 2 cases 8.911242604 SEQ ID 139 7 100162851 100183859 21008 loss 1236 ZAN Exon + ve, 2 cases 8.911242604 SEQ ID 139 7 100162851 100183859 21008 loss 1803 ZAN Exon + ve, 2 cases 8.911242604 SEQ ID 139 7 100162851 100183859 21008 loss 1824 ZAN Exon + ve, 2 cases 8.911242604 SEQ ID 139 7 100162851 100183859 21008 loss 2034 ZAN Exon + ve, 2 cases 8.911242604 SEQ ID 140 1 151028700 151050046 21346 gain 1223 LCE1D, LCE1C Exon + ve, 2 cases 8.911242604 SEQ ID 140 1 151028700 151050046 21346 gain 1664 LCE1D, LCE1C Exon + ve, 2 cases 8.911242604 SEQ ID 140 1 151028700 151050046 21346 gain 1740 LCE1D, LCE1C Exon + ve, 2 cases 8.911242604 SEQ ID 141 1 151026228 151050046 23818 gain 1936 LCE1D, LCE1E, LCE1C Exon + ve, 2 cases 8.911242604 SEQ ID 142 15 69592364 73892403 4300039 loss 1415 PKM2, C15orf59, PPCDC, CELF6, UBL7, HCN4, C15orf39, Exon + ve, 2 cases 8.911242604 EDC3, ADPGK, MAN2C1, C15orf34, COX5A, LOXL1, CYP11Al, NPTN, CSK, TBC1D21, MIR631, MIR630, COMMD4, GRAMD2, TMEM202, NEO1, CCDC33, PML, SNX33, PARP6, SIN3A, ULK3, SCAMP5, SCAMP2, ARIH1, SENP8, PTPN9, STRA6, THSD4, SNUPN, RPP25, CPLX3, C15orf60, GOLGA6D, GOLGA6C, GOLGA6B, GOLGA6A, NR2E3, MIR4313, C15orf17, DNMlP35, SEMA7A, LOC283731, IMP3, CYP1A1, CYP1A2, ARID3B, ISLR, CSPG4, HEXA, HIGD2B, CD276, BBS4, STOML1, MPI, ODF3L1, NEIL1, MYO9A, LMAN1L, CLK3, ISLR2 SEQ ID 143 17 35072083 35073438 1355 loss 1665 STARD3 Exon + ve, 2 cases 7.41506647 SEQ ID 144 17 35069605 35073438 3833 loss 2045 STARD3 Exon + ve, 2 cases 7.41506647 SEQ ID 145 9 21321182 21330461 9279 loss 1687 KLHL9 Exon + ve, 2 cases 7.41506647 SEQ ID 146 9 21422879 21434788 11909 loss 1777 IFNA1 Exon + ve, 2 cases 7.41506647 SEQ ID 147 10 116949327 116971507 22180 gain 1292 ATRNL1 Exon + ve, 2 cases 7.41506647 SEQ ID 147 10 116949327 116971507 22180 gain 1880 ATRNL1 Exon + ve, 2 cases 7.41506647 SEQ ID 148 9 21245159 21274020 28861 gain 2020 IFNA22P Exon + ve, 2 cases 7.41506647 SEQ ID 149 10 116940096 116971507 31411 gain 1394 ATRNL1 Exon + ve, 2 cases 7.41506647 SEQ ID 149 10 116940096 116971507 31411 gain 1834 ATRNL1 Exon + ve, 2 cases 7.41506647 SEQ ID 149 10 116940096 116971507 31411 gain 1924 ATRNL1 Exon + ve, 2 cases 7.41506647 SEQ ID 150 4 20161068 20161847 779 loss 1426 SLIT2 Exon + ve, 2 cases 7.41506647 SEQ ID 150 4 20161068 20161847 779 loss 1528 SLIT2 Exon + ve, 2 cases 7.41506647 SEQ ID 150 4 20161068 20161847 779 loss 1665 SLIT2 Exon + ve, 2 cases 7.41506647 SEQ ID 150 4 20161068 20161847 779 loss 1667 SLIT2 Exon + ve, 2 cases 7.41506647 SEQ ID 151 14 60551981 60553070 1089 loss 1269 SLC38A6 Exon + ve, 2 cases 7.41506647 SEQ ID 151 14 60551981 60553070 1089 gain 1281 SLC38A6 Exon + ve, 2 cases 7.41506647 SEQ ID 151 14 60551981 60553070 1089 gain 1773 SLC38A6 Exon + ve, 2 cases 7.41506647 SEQ ID 152 X 15463254 15464663 1409 loss 1234 BMX Exon + ve, 2 cases 7.41506647 SEQ ID 152 X 15463254 15464663 1409 loss 1320 BMX Exon + ve, 2 cases 7.41506647 SEQ ID 152 X 15463254 15464663 1409 loss 1822 BMX Exon + ve, 2 cases 7.41506647 SEQ ID 152 X 15463254 15464663 1409 loss 1827 BMX Exon + ve, 2 cases 7.41506647 SEQ ID 152 X 15463254 15464663 1409 loss 1876 BMX Exon + ve, 2 cases 7.41506647 SEQ ID 153 21 27260832 27262559 1727 loss 1442 ADAMTS5 Exon + ve, 2 cases 7.41506647 SEQ ID 153 21 27260832 27262559 1727 loss 1522 ADAMTS5 Exon + ve, 2 cases 7.41506647 SEQ ID 153 21 27260832 27262559 1727 loss 1714 ADAMTS5 Exon + ve, 2 cases 7.41506647 SEQ ID 153 21 27260832 27262559 1727 loss 1828 ADAMTS5 Exon + ve, 2 cases 7.41506647 SEQ ID 153 21 27260832 27262559 1727 loss 1915 ADAMTS5 Exon + ve, 2 cases 7.41506647 SEQ ID 154 19 15420954 15422784 1830 loss 1471 MIR1470, WIZ Exon + ve, 2 cases 7.41506647 SEQ ID 154 19 15420954 15422784 1830 loss 1687 MIR1470, WIZ Exon + ve, 2 cases 7.41506647 SEQ ID 154 19 15420954 15422784 1830 loss 1887 MIR1470, WIZ Exon + ve, 2 cases 7.41506647 SEQ ID 155 19 15420382 15422978 2596 loss 1676 MIR1470, WIZ Exon + ve, 2 cases 7.41506647 SEQ ID 156 10 5985730 5988631 2901 loss 2024 FBXO18 Exon + ve, 2 cases 7.41506647 SEQ ID 157 6 159234892 159238587 3695 loss 1419 C6orf99 Exon + ve, 2 cases 7.41506647 SEQ ID 144 17 35069605 35073438 3833 loss 1316 STARD3 Exon + ve, 2 cases 7.41506647 SEQ ID 144 17 35069605 35073438 3833 loss 1318 STARD3 Exon + ve, 2 cases 7.41506647 SEQ ID 144 17 35069605 35073438 3833 loss 1676 STARD3 Exon + ve, 2 cases 7.41506647 SEQ ID 158 4 20157798 20161847 4049 loss 1671 SLIT2 Exon + ve, 2 cases 7.41506647 SEQ ID 159 19 15418682 15422978 4296 loss 1726 MIR1470, WIZ Exon + ve, 2 cases 7.41506647 SEQ ID 160 2 206586117 206590636 4519 gain 1220 INO80D Exon + ve, 2 cases 7.41506647 SEQ ID 161 9 132916080 132921442 5362 loss 1897 LAMC3 Exon + ve, 2 cases 7.41506647 SEQ ID 162 6 105298061 105303833 5772 loss 1426 HACE1 Exon + ve, 2 cases 7.41506647 SEQ ID 162 6 105298061 105303833 5772 loss 1458 HACE1 Exon + ve, 2 cases 7.41506647 SEQ ID 162 6 105298061 105303833 5772 loss 1490 HACE1 Exon + ve, 2 cases 7.41506647 SEQ ID 162 6 105298061 105303833 5772 loss 1492 HACE1 Exon + ve, 2 cases 7.41506647 SEQ ID 163 2 206586117 206592116 5999 gain 1803 INO80D Exon + ve, 2 cases 7.41506647 SEQ ID 163 2 206586117 206592116 5999 gain 1988 INO80D Exon + ve, 2 cases 7.41506647 SEQ ID 163 2 206586117 206592116 5999 gain 2028 INO80D Exon + ve, 2 cases 7.41506647 SEQ ID 164 19 56882602 56889437 6835 loss 1965 MIR99B, MIRLET7E, MIR125A, NCRNA00085 Exon + ve, 2 cases 7.41506647 SEQ ID 164 19 56882602 56889437 6835 loss 2032 MIR99B, MIRLET7E, MIR125A, NCRNA00085 Exon + ve, 2 cases 7.41506647 SEQ ID 165 3 64479002 64486008 7006 loss 1428 ADAMTS9 Exon + ve, 2 cases 7.41506647 SEQ ID 165 3 64479002 64486008 7006 loss 1434 ADAMTS9 Exon + ve, 2 cases 7.41506647 SEQ ID 165 3 64479002 64486008 7006 loss 1572 ADAMTS9 Exon + ve, 2 cases 7.41506647 SEQ ID 165 3 64479002 64486008 7006 loss 1592 ADAMTS9 Exon + ve, 2 cases 7.41506647 SEQ ID 165 3 64479002 64486008 7006 loss 1763 ADAMTS9 Exon + ve, 2 cases 7.41506647 SEQ ID 166 2 135704927 135712021 7094 loss 1512 ZRANB3 Exon + ve, 2 cases 7.41506647 SEQ ID 166 2 135704927 135712021 7094 loss 1574 ZRANB3 Exon + ve, 2 cases 7.41506647 SEQ ID 166 2 135704927 135712021 7094 loss 1757 ZRANB3 Exon + ve, 2 cases 7.41506647 SEQ ID 166 2 135704927 135712021 7094 gain 1970 ZRANB3 Exon + ve, 2 cases 7.41506647 SEQ ID 167 19 56881984 56889437 7453 loss 1859 MIR99B, MIRLET7E, MIR125A, NCRNA00085 Exon + ve, 2 cases 7.41506647 SEQ ID 168 4 74504402 74511880 7478 loss 1373 ALB Exon + ve, 2 cases 7.41506647 SEQ ID 168 4 74504402 74511880 7478 loss 1464 ALB Exon + ve, 2 cases 7.41506647 SEQ ID 168 4 74504402 74511880 7478 loss 1798 ALB Exon + ve, 2 cases 7.41506647 SEQ ID 168 4 74504402 74511880 7478 loss 1959 ALB Exon + ve, 2 cases 7.41506647 SEQ ID 169 9 19775974 19783547 7573 loss 1511 SLC24A2 Exon + ve, 2 cases 7.41506647 SEQ ID 170 2 206584487 206592116 7629 gain 1921 INO80D Exon + ve, 2 cases 7.41506647 SEQ ID 171 10 5985730 5993423 7693 loss 1307 FBXO18 Exon + ve, 2 cases 7.41506647 SEQ ID 171 10 5985730 5993423 7693 loss 1409 FBXO18 Exon + ve, 2 cases 7.41506647 SEQ ID 171 10 5985730 5993423 7693 loss 1619 FBXO18 Exon + ve, 2 cases 7.41506647 SEQ ID 172 14 60544757 60553070 8313 loss 1470 SLC38A6 Exon + ve, 2 cases 7.41506647 SEQ ID 172 14 60544757 60553070 8313 loss 2000 SLC38A6 Exon + ve, 2 cases 7.41506647 SEQ ID 173 2 135704927 135713556 8629 gain 1451 ZRANB3 Exon + ve, 2 cases 7.41506647 SEQ ID 174 19 56880318 56889437 9119 loss 1232 MIR99B, MIRLET7E, MIR125A, NCRNA00085 Exon + ve, 2 cases 7.41506647 SEQ ID 175 10 5984217 5993423 9206 loss 1654 FBXO18 Exon + ve, 2 cases 7.41506647 SEQ ID 176 9 132912215 132921442 9227 loss 1345 LAMC3 Exon + ve, 2 cases 7.41506647 SEQ ID 177 6 159234892 159244475 9583 loss 1742 C6orf99 Exon + ve, 2 cases 7.41506647 SEQ ID 177 6 159234892 159244475 9583 loss 1900 C6orf99 Exon + ve, 2 cases 7.41506647 SEQ ID 178 9 132910836 132921442 10606 loss 1621 LAMC3 Exon + ve, 2 cases 7.41506647 SEQ ID 178 9 132910836 132921442 10606 loss 1639 LAMC3 Exon + ve, 2 cases 7.41506647 SEQ ID 179 4 74504402 74515385 10983 loss 1852 ALB Exon + ve, 2 cases 7.41506647 SEQ ID 180 9 132907202 132921442 14240 loss 1720 LAMC3 Exon + ve, 2 cases 7.41506647 SEQ ID 181 19 56880318 56895839 15521 loss 1993 MIR99B, MIRLET7E, MIR125A, NCRNA00085 Exon + ve, 2 cases 7.41506647 SEQ ID 182 6 159184210 159203355 19145 loss 1582 OSTCL Exon + ve, 2 cases 7.41506647 SEQ ID 183 6 105291227 105311034 19807 loss 1500 HACE1 Exon + ve, 2 cases 7.41506647 SEQ ID 184 7 153742206 153792779 50573 loss 1885 DPP6 Exon + ve, 2 cases 7.41506647 SEQ ID 185 6 159190838 159251696 60858 loss 1468 OSTCL, C6orf99 Exon + ve, 2 cases 7.41506647 SEQ ID 186 7 153775546 153845854 70308 loss 1949 DPP6 Exon + ve, 2 cases 7.41506647 SEQ ID 187 7 153134693 153290833 156140 gain 1486 DPP6 Exon + ve, 2 cases 7.41506647 SEQ ID 188 7 153158956 153384745 225789 gain 1755 DPP6 Exon + ve, 2 cases 7.41506647 SEQ ID 189 7 152883490 154689863 1806373 gain 1730 HTR5A, LOC100132707, LOC202781, DPP6, PAXIP1 Exon + ve, 2 cases 7.41506647 SEQ ID 190 9 19677387 24675102 4997715 loss 1418 MIR31, ELAVL2, PTPLAD2, CDKN2B-AS1, MIR491, MLLT3, Exon + ve, 2 cases 7.41506647 IFNW1, IFNB1, C9orf53, IFNA22P, IFNA13, IFNA10, IFNA17, IFNA16, IFNA14, CDKN2B, CDKN2A, IFNE, SLC24A2, KIAA1797, MTAP, KLHL9, IFNA8, IFNA2, IFNA1, DMRTA1, IFNA7, IFNA6, IFNA5, IFNA4, IFNA21, LOC554202 SEQ ID 191 6 160246670 160248266 1596 gain 1870 MAS1 Exon + ve, 2 cases 5.923303835 SEQ ID 192 14 70273290 70276007 2717 loss 2002 MAP3K9 Exon + ve, 2 cases 5.923303835 SEQ ID 193 19 11448975 11452390 3415 gain 1864 ELAVL3 Exon + ve, 2 cases 5.923303835 SEQ ID 194 2 218849164 218852974 3810 gain 2024 PNKD, TMBIM1 Exon + ve, 2 cases 5.923303835 SEQ ID 195 15 42365660 42371493 5833 loss 1662 CASC4 Exon + ve, 2 cases 5.923303835 SEQ ID 196 14 102447536 102455572 8036 loss 1800 TRAF3 Exon + ve, 2 cases 5.923303835 SEQ ID 197 10 55580662 55589321 8659 loss 1475 PCDH15 Exon + ve, 2 cases 5.923303835 SEQ ID 197 10 55580662 55589321 8659 loss 1537 PCDH15 Exon + ve, 2 cases 5.923303835 SEQ ID 198 8 22631429 22641498 10069 loss 1849 PEBP4 Exon + ve, 2 cases 5.923303835 SEQ ID 199 10 55328218 55339243 11025 gain 1309 PCDH15 Exon + ve, 2 cases 5.923303835 SEQ ID 200 6 134622620 134635779 13159 loss 1708 SGK1 Exon + ve, 2 cases 5.923303835 SEQ ID 201 7 45079997 45096030 16033 loss 1907 NACAD, CCM2 Exon + ve, 2 cases 5.923303835 SEQ ID 202 17 18814921 18869072 54151 gain 1717 GRAP, SLC5A10, FAM83G Exon + ve, 2 cases 5.923303835 SEQ ID 203 13 22317487 22381531 64044 loss 1919 BASP1P1 Exon + ve, 2 cases 5.923303835 SEQ ID 204 8 43057445 43647063 589618 gain 1695 HGSNAT, FNTA, POTEA, SGK196 Exon + ve, 2 cases 5.923303835 SEQ ID 205 12 20859893 20860186 293 loss 1225 SLCO1B3 Exon + ve, 2 cases 5.923303835 SEQ ID 205 12 20859893 20860186 293 loss 1577 SLCO1B3 Exon + ve, 2 cases 5.923303835 SEQ ID 205 12 20859893 20860186 293 loss 1581 SLCO1B3 Exon + ve, 2 cases 5.923303835 SEQ ID 206 1 91632025 91632374 349 loss 1582 HFM1 Exon + ve, 2 cases 5.923303835 SEQ ID 206 1 91632025 91632374 349 loss 1687 HFM1 Exon + ve, 2 cases 5.923303835 SEQ ID 206 1 91632025 91632374 349 loss 1929 HFM1 Exon + ve, 2 cases 5.923303835 SEQ ID 206 1 91632025 91632374 349 loss 2045 HFM1 Exon + ve, 2 cases 5.923303835 SEQ ID 207 6 160247865 160248266 401 gain 1242 MAS1 Exon + ve, 2 cases 5.923303835 SEQ ID 208 1 94115122 94116506 1384 loss 1782 DNTTIP2 Exon + ve, 2 cases 5.923303835 SEQ ID 209 14 70274601 70276007 1406 loss 1910 MAP3K9 Exon + ve, 2 cases 5.923303835 SEQ ID 209 14 70274601 70276007 1406 loss 2001 MAP3K9 Exon + ve, 2 cases 5.923303835 SEQ ID 210 2 201713188 201714627 1439 gain 1344 CFLAR Exon + ve, 2 cases 5.923303835 SEQ ID 210 2 201713188 201714627 1439 gain 1824 CFLAR Exon + ve, 2 cases 5.923303835 SEQ ID 210 2 201713188 201714627 1439 gain 1841 CFLAR Exon + ve, 2 cases 5.923303835 SEQ ID 210 2 201713188 201714627 1439 gain 1927 CFLAR Exon + ve, 2 cases 5.923303835 SEQ ID 211 19 11450908 11452390 1482 gain 1637 ELAVL3 Exon + ve, 2 cases 5.923303835 SEQ ID 212 1 3752549 3754045 1496 loss 1426 KIAA0562 Exon + ve, 2 cases 5.923303835 SEQ ID 212 1 3752549 3754045 1496 loss 1439 KIAA0562 Exon + ve, 2 cases 5.923303835 SEQ ID 212 1 3752549 3754045 1496 loss 1441 KIAA0562 Exon + ve, 2 cases 5.923303835 SEQ ID 212 1 3752549 3754045 1496 loss 1912 KIAA0562 Exon + ve, 2 cases 5.923303835 SEQ ID 191 6 160246670 160248266 1596 gain 1571 MAS1 Exon + ve, 2 cases 5.923303835 SEQ ID 213 12 20858372 20860186 1814 loss 1488 SLCO1B3 Exon + ve, 2 cases 5.923303835 SEQ ID 214 1 94113132 94115122 1990 loss 1904 DNTTIP2 Exon + ve, 2 cases 5.923303835 SEQ ID 215 7 147734925 147737360 2435 loss 1346 CNTNAP2 Exon + ve, 2 cases 5.923303835 SEQ ID 215 7 147734925 147737360 2435 loss 1403 CNTNAP2 Exon + ve, 2 cases 5.923303835 SEQ ID 215 7 147734925 147737360 2435 loss 1988 CNTNAP2 Exon + ve, 2 cases 5.923303835 SEQ ID 216 15 93669003 93671527 2524 gain 1309 LOC400456 Exon + ve, 2 cases 5.923303835 SEQ ID 216 15 93669003 93671527 2524 gain 1825 LOC400456 Exon + ve, 2 cases 5.923303835 SEQ ID 216 15 93669003 93671527 2524 gain 1837 LOC400456 Exon + ve, 2 cases 5.923303835 SEQ ID 217 9 15655922 15658483 2561 loss 1386 C9orf93 Exon + ve, 2 cases 5.923303835 SEQ ID 217 9 15655922 15658483 2561 loss 1477 C9orf93 Exon + ve, 2 cases 5.923303835 SEQ ID 217 9 15655922 15658483 2561 loss 1594 C9orf93 Exon + ve, 2 cases 5.923303835 SEQ ID 217 9 15655922 15658483 2561 loss 1881 C9orf93 Exon + ve, 2 cases 5.923303835 SEQ ID 192 14 70273290 70276007 2717 loss 1314 MAP3K9 Exon + ve, 2 cases 5.923303835 SEQ ID 218 1 94113132 94116506 3374 loss 1802 DNTTIP2 Exon + ve, 2 cases 5.923303835 SEQ ID 193 19 11448975 11452390 3415 gain 1780 ELAVL3 Exon + ve, 2 cases 5.923303835 SEQ ID 193 19 11448975 11452390 3415 gain 1788 ELAVL3 Exon + ve, 2 cases 5.923303835 SEQ ID 219 2 218971708 218975318 3610 loss 1913 CTDSP1 Exon + ve, 2 cases 5.923303835 SEQ ID 194 2 218849164 218852974 3810 gain 1284 PNKD, TMBIM1 Exon + ve, 2 cases 5.923303835 SEQ ID 194 2 218849164 218852974 3810 gain 1728 PNKD, TMBIM1 Exon + ve, 2 cases 5.923303835 SEQ ID 220 2 214582921 214586936 4015 loss 1512 SPAG16 Exon + ve, 2 cases 5.923303835 SEQ ID 221 6 29653815 29658113 4298 loss 1275 SNORD32B Exon + ve, 2 cases 5.923303835 SEQ ID 221 6 29653815 29658113 4298 loss 1862 SNORD32B Exon + ve, 2 cases 5.923303835 SEQ ID 222 1 94113132 94117960 4828 loss 1233 DNTTIP2 Exon + ve, 2 cases 5.923303835 SEQ ID 223 2 218972428 218978243 5815 loss 1718 MIR26B, CTDSP1 Exon + ve, 2 cases 5.923303835 SEQ ID 224 6 29653815 29659892 6077 loss 1440 SNORD32B Exon + ve, 2 cases 5.923303835 SEQ ID 224 6 29653815 29659892 6077 loss 1750 SNORD32B Exon + ve, 2 cases 5.923303835 SEQ ID 225 8 43288182 43294454 6272 loss 1549 POTEA Exon + ve, 2 cases 5.923303835 SEQ ID 226 17 57329783 57336509 6726 loss 1784 INTS2 Exon + ve, 2 cases 5.923303835 SEQ ID 227 19 53896677 53903470 6793 loss 1227 FUT2 Exon + ve, 2 cases 5.923303835 SEQ ID 227 19 53896677 53903470 6793 loss 1448 FUT2 Exon + ve, 2 cases 5.923303835 SEQ ID 228 2 218844854 218852974 8120 gain 1660 PNKD, TMBIM1 Exon + ve, 2 cases 5.923303835 SEQ ID 229 14 102447174 102455572 8398 loss 1820 TRAF3 Exon + ve, 2 cases 5.923303835 SEQ ID 230 14 102401445 102409996 8551 gain 1838 TRAF3 Exon + ve, 2 cases 5.923303835 SEQ ID 231 17 57327446 57336509 9063 loss 1439 INTS2 Exon + ve, 2 cases 5.923303835 SEQ ID 231 17 57327446 57336509 9063 loss 1601 INTS2 Exon + ve, 2 cases 5.923303835 SEQ ID 232 19 53892641 53901719 9078 loss 1697 FUT2 Exon + ve, 2 cases 5.923303835 SEQ ID 233 17 57327446 57336828 9382 loss 1641 INTS2 Exon + ve, 2 cases 5.923303835 SEQ ID 234 1 226061846 226072012 10166 loss 1371 PRSS38 Exon + ve, 2 cases 5.923303835 SEQ ID 234 1 226061846 226072012 10166 loss 1653 PRSS38 Exon + ve, 2 cases 5.923303835 SEQ ID 235 19 53891467 53901719 10252 loss 1694 FUT2 Exon + ve, 2 cases 5.923303835 SEQ ID 236 X 8463131 8473482 10351 loss 1298 KAL1 Exon + ve, 2 cases 5.923303835 SEQ ID 236 X 8463131 8473482 10351 loss 1432 KAL1 Exon + ve, 2 cases 5.923303835 SEQ ID 237 2 218967950 218978839 10889 loss 1721 MIR26B, CTDSP1, SLC11A1 Exon + ve, 2 cases 5.923303835 SEQ ID 237 2 218967950 218978839 10889 loss 1993 MIR26B, CTDSP1, SLC11A1 Exon + ve, 2 cases 5.923303835 SEQ ID 238 6 134624093 134635779 11686 loss 1576 SGK1 Exon + ve, 2 cases 5.923303835 SEQ ID 238 6 134624093 134635779 11686 loss 1667 SGK1 Exon + ve, 2 cases 5.923303835 SEQ ID 239 8 22629771 22641498 11727 loss 1293 PEBP4 Exon + ve, 2 cases 5.923303835 SEQ ID 239 8 22629771 22641498 11727 loss 1296 PEBP4 Exon + ve, 2 cases 5.923303835 SEQ ID 239 8 22629771 22641498 11727 loss 1842 PEBP4 Exon + ve, 2 cases 5.923303835 SEQ ID 200 6 134622620 134635779 13159 loss 1224 SGK1 Exon + ve, 2 cases 5.923303835 SEQ ID 240 1 179250547 179263983 13436 loss 1950 STX6 Exon + ve, 2 cases 5.923303835 SEQ ID 241 1 226061846 226075375 13529 loss 1234 PRSS38 Exon + ve, 2 cases 5.923303835 SEQ ID 242 15 42357661 42371493 13832 loss 1659 CASC4 Exon + ve, 2 cases 5.923303835 SEQ ID 243 2 213922938 213938010 15072 loss 1870 SPAG16 Exon + ve, distinct 5.923303835 CNVs, same Gene SEQ ID 244 1 179248755 179263983 15228 loss 1662 STX6 Exon + ve, 2 cases 5.923303835 SEQ ID 201 7 45079997 45096030 16033 loss 1642 NACAD, CCM2 Exon + ve, 2 cases 5.923303835 SEQ ID 201 7 45079997 45096030 16033 loss 1819 NACAD, CCM2 Exon + ve, 2 cases 5.923303835 SEQ ID 201 7 45079997 45096030 16033 loss 1825 NACAD, CCM2 Exon + ve, 2 cases 5.923303835 SEQ ID 245 2 214582921 214599105 16184 loss 1636 SPAG16 Exon + ve, 2 cases 5.923303835 SEQ ID 246 1 179250547 179269450 18903 loss 1638 MR1, STX6 Exon + ve, 2 cases 5.923303835 SEQ ID 247 15 42356510 42378169 21659 loss 1638 CASC4 Exon + ve, 2 cases 5.923303835 SEQ ID 248 2 213900382 213922938 22556 loss 1832 SPAG16 Exon + ve, distinct 5.923303835 CNVs, same Gene SEQ ID 249 1 179250547 179274160 23613 loss 1659 MR1, STX6 Exon + ve, 2 cases 5.923303835 SEQ ID 250 15 93669003 93697249 28246 gain 1841 LOC400456 Exon + ve, 2 cases 5.923303835 SEQ ID 251 1 226061846 226091036 29190 loss 1344 PRSS38 Exon + ve, 2 cases 5.923303835 SEQ ID 252 15 42354464 42395549 41085 loss 1660 CASC4 Exon + ve, 2 cases 5.923303835 SEQ ID 253 11 5848930 5892024 43094 gain 1593 OR52E4 Exon + ve, 2 cases 5.923303835 SEQ ID 253 11 5848930 5892024 43094 gain 1920 OR52E4 Exon + ve, 2 cases 5.923303835 SEQ ID 254 11 5839924 5892024 52100 gain 1333 OR52E4 Exon + ve, 2 cases 5.923303835 SEQ ID 255 11 5848930 5902760 53830 gain 1301 OR52E4 Exon + ve, 2 cases 5.923303835 SEQ ID 203 13 22317487 22381531 64044 loss 1714 BASP1P1 Exon + ve, 2 cases 5.923303835 SEQ ID 256 17 18769179 18864625 95446 gain 1596 SLC5A10, FAM83G, PRPSAP2 Exon + ve, 2 cases 5.923303835 SEQ ID 257 6 160237631 160371016 133385 gain 1574 IGF2R, MAS1 Exon + ve, 2 cases 5.923303835 SEQ ID 258 13 22250683 22404389 153706 gain 1662 BASP1P1 Exon + ve, 2 cases 5.923303835 SEQ ID 259 X 8397974 8677639 279665 gain 1566 KAL1 Exon + ve, 2 cases 5.923303835 SEQ ID 260 13 22140379 22523807 383428 gain 1744 BASP1P1 Exon + ve, 2 cases 5.923303835 SEQ ID 261 X 8397974 8790795 392821 gain 1901 KAL1, FAM9A Exon + ve, 2 cases 5.923303835 SEQ ID 262 8 43170238 43647063 476825 gain 1316 HGSNAT, POTEA Exon + ve, 2 cases 5.923303835 SEQ ID 204 8 43057445 43647063 589618 gain 1406 HGSNAT, FNTA, POTEA, SGK196 Exon + ve, 2 cases 5.923303835 SEQ ID 263 10 55202411 57178733 1976322 gain 1429 MTRNR2L5, PCDH15 Exon + ve, 2 cases 5.923303835 SEQ ID 264 14 102008576 105330913 3322337 gain 1447 BAG5, SNORA28, TRMT61A, EIF5, MIR4309, RCOR1, Exon + ve, 2 cases 5.923303835 EXOC3L4, TMEM179, XRCC3, LOC100131366, INF2, ASPG, AMN, CKB, SIVA1, ANKRD9, MIR203, CDC42BPB, MARK3, JAG2, C14orf153, LOC647310, MTA1, TDRD9, TRAF3, TMEM121, CDCA4, TECPR2, KIF26A, NUDT14, AHNAK2, MGC23270, ADSSL1, BRF1, C14orf180, PACS2, C14orf79, PLD4, ZFYVE21, AKT1, C14orf80, KIAA0284, TNFAIP2, ZBTB42, PPP1R13B, GPR132, C14orf2, KLC1, BTBD6, CRIP1, CRIP2 SEQ ID 265 2 1469952 1472562 2610 loss 1564 TPO Exon + ve, 2 cases 4.435935199 SEQ ID 265 2 1469952 1472562 2610 loss 1639 TPO Exon + ve, 2 cases 4.435935199 SEQ ID 266 X 70057266 70062203 4937 gain 1346 SLC7A3 Exon + ve, 2 cases 4.435935199 SEQ ID 267 16 48955985 48960972 4987 loss 1395 BRD7 Exon + ve, 2 cases 4.435935199 SEQ ID 267 16 48955985 48960972 4987 loss 1409 BRD7 Exon + ve, 2 cases 4.435935199 SEQ ID 267 16 48955985 48960972 4987 loss 1428 BRD7 Exon + ve, 2 cases 4.435935199 SEQ ID 268 19 62343981 62349061 5080 loss 1995 ZIM3 Exon + ve, 2 cases 4.435935199 SEQ ID 268 19 62343981 62349061 5080 loss 1996 ZIM3 Exon + ve, 2 cases 4.435935199 SEQ ID 269 X 46832380 46837814 5434 loss 1675 RGN Exon + ve, 2 cases 4.435935199 SEQ ID 269 X 46832380 46837814 5434 gain 1896 RGN Exon + ve, 2 cases 4.435935199 SEQ ID 269 X 46832380 46837814 5434 gain 2040 RGN Exon + ve, 2 cases 4.435935199 SEQ ID 270 X 128775325 128780946 5621 gain 1459 ZDHHC9 Exon + ve, 2 cases 4.435935199 SEQ ID 271 X 123691710 123698719 7009 loss 1421 ODZ1 Exon + ve, 2 cases 4.435935199 SEQ ID 271 X 123691710 123698719 7009 loss 1428 ODZ1 Exon + ve, 2 cases 4.435935199 SEQ ID 271 X 123691710 123698719 7009 loss 1805 ODZ1 Exon + ve, 2 cases 4.435935199 SEQ ID 272 X 100665462 100673058 7596 gain 1269 ARMCX4 Exon + ve, 2 cases 4.435935199 SEQ ID 272 X 100665462 100673058 7596 gain 1857 ARMCX4 Exon + ve, 2 cases 4.435935199 SEQ ID 273 19 53590042 53598814 8772 loss 1901 GRIN2D Exon + ve, 2 cases 4.435935199 SEQ ID 273 19 53590042 53598814 8772 loss 1959 GRIN2D Exon + ve, 2 cases 4.435935199 SEQ ID 274 X 128772381 128782290 9909 gain 1824 ZDHHC9 Exon + ve, 2 cases 4.435935199 SEQ ID 275 X 70051128 70062203 11075 gain 1308 SLC7A3 Exon + ve, 2 cases 4.435935199 SEQ ID 276 X 70049036 70062203 13167 gain 1284 SLC7A3 Exon + ve, 2 cases 4.435935199 SEQ ID 277 19 53585489 53598814 13325 loss 1671 KDELR1, GRIN2D Exon + ve, 2 cases 4.435935199 SEQ ID 278 X 128768758 128782290 13532 gain 1806 ZDHHC9 Exon + ve, 2 cases 4.435935199 SEQ ID 279 X 100658130 100673058 14928 loss 1413 ARMCX4 Exon + ve, 2 cases 4.435935199 SEQ ID 280 19 23786448 23804481 18033 gain 1541 RPSAP58 Exon + ve, 2 cases 4.435935199 SEQ ID 280 19 23786448 23804481 18033 gain 1608 RPSAP58 Exon + ve, 2 cases 4.435935199 SEQ ID 281 22 16661122 16680825 19703 loss 1805 MICAL3 Exon + ve, 2 cases 4.435935199 SEQ ID 282 22 16661122 16685770 24648 loss 1780 MICAL3 Exon + ve, 2 cases 4.435935199 SEQ ID 283 22 16655966 16680825 24859 loss 2034 MICAL3 Exon + ve, 2 cases 4.435935199 SEQ ID 284 19 23776795 23805817 29022 gain 1783 RPSAP58 Exon + ve, 2 cases 4.435935199 SEQ ID 285 16 74099704 74137609 37905 gain 1879 TMEM231, CHST5 Exon + ve, 2 cases 4.435935199 SEQ ID 286 16 74097511 74144645 47134 gain 2032 TMEM231, CHST5 Exon + ve, 2 cases 4.435935199 SEQ ID 287 16 74097511 74146468 48957 gain 1993 TMEM231, CHST5 Exon + ve, 2 cases 4.435935199 SEQ ID 288 19 61823068 62665957 842889 loss 1461 TRAPPC2P1, ZNF835, USP29, ZNF17, ZNF71, ZNF749, Exon + ve, 2 cases 4.435935199 ZNF264, LOC147670, VN1R1, AURKC, PEG3-AS1, ZIM2, ZIM3, ZNF304, ZNF805, ZNF547, ZNF543, MIMT1, ZNF460, DUXA, ZNF548, PEG3 SEQ ID 289 9 98831789 98831814 25 gain 1629 CTSL2 Exon + ve, 2 cases 4.435935199 SEQ ID 289 9 98831789 98831814 25 loss 1715 CTSL2 Exon + ve, 2 cases 4.435935199 SEQ ID 289 9 98831789 98831814 25 loss 1718 CTSL2 Exon + ve, 2 cases 4.435935199 SEQ ID 290 X 12833576 12834706 1130 loss 1633 TLR8, LOC349408 Exon + ve, 2 cases 4.435935199 SEQ ID 290 X 12833576 12834706 1130 loss 1901 TLR8, LOC349408 Exon + ve, 2 cases 4.435935199 SEQ ID 290 X 12833576 12834706 1130 loss 2024 TLR8, LOC349408 Exon + ve, 2 cases 4.435935199 SEQ ID 291 1 22787161 22788440 1279 loss 1278 EPHA8 Exon + ve, 2 cases 4.435935199 SEQ ID 291 1 22787161 22788440 1279 loss 1687 EPHA8 Exon + ve, 2 cases 4.435935199 SEQ ID 291 1 22787161 22788440 1279 loss 1895 EPHA8 Exon + ve, 2 cases 4.435935199 SEQ ID 292 6 149109599 149110881 1282 loss 1369 UST Exon + ve, 2 cases 4.435935199 SEQ ID 292 6 149109599 149110881 1282 loss 1645 UST Exon + ve, 2 cases 4.435935199 SEQ ID 293 4 47358255 47359575 1320 gain 1658 CORIN Exon + ve, 2 cases 4.435935199 SEQ ID 294 1 91946409 91948225 1816 loss 1656 TGFBR3 Exon + ve, 2 cases 4.435935199 SEQ ID 294 1 91946409 91948225 1816 loss 2043 TGFBR3 Exon + ve, 2 cases 4.435935199 SEQ ID 295 13 42366568 42368413 1845 loss 1536 EPSTI1 Exon + ve, distinct 4.435935199 CNVs, same Gene SEQ ID 296 6 146912375 146914496 2121 loss 1291 RAB32 Exon + ve, 2 cases 4.435935199 SEQ ID 296 6 146912375 146914496 2121 loss 1309 RAB32 Exon + ve, 2 cases 4.435935199 SEQ ID 297 3 9720244 9722646 2402 gain 1264 CPNE9 Exon + ve, 2 cases 4.435935199 SEQ ID 297 3 9720244 9722646 2402 gain 1587 CPNE9 Exon + ve, 2 cases 4.435935199 SEQ ID 297 3 9720244 9722646 2402 gain 1618 CPNE9 Exon + ve, 2 cases 4.435935199 SEQ ID 298 14 51528998 51531503 2505 loss 1226 C14orf166 Exon + ve, 2 cases 4.435935199 SEQ ID 298 14 51528998 51531503 2505 loss 1253 C14orf166 Exon + ve, 2 cases 4.435935199 SEQ ID 298 14 51528998 51531503 2505 loss 1650 C14orf166 Exon + ve, 2 cases 4.435935199 SEQ ID 299 15 99236636 99239178 2542 loss 1544 ALDH1A3 Exon + ve, 2 cases 4.435935199 SEQ ID 299 15 99236636 99239178 2542 loss 1626 ALDH1A3 Exon + ve, 2 cases 4.435935199 SEQ ID 299 15 99236636 99239178 2542 gain 1644 ALDH1A3 Exon + ve, 2 cases 4.435935199 SEQ ID 300 15 87999026 88001610 2584 loss 1738 KIF7 Exon + ve, 2 cases 4.435935199 SEQ ID 265 2 1469952 1472562 2610 loss 1510 TPO Exon + ve, 2 cases 4.435935199 SEQ ID 301 19 59180503 59183718 3215 loss 1966 CACNG8 Exon + ve, 2 cases 4.435935199 SEQ ID 302 5 90081197 90084436 3239 gain 1489 GPR98 Exon + ve, 2 cases 4.435935199 SEQ ID 303 2 106174179 106177686 3507 loss 1505 UXS1 Exon + ve, 2 cases 4.435935199 SEQ ID 303 2 106174179 106177686 3507 loss 1611 UXS1 Exon + ve, 2 cases 4.435935199 SEQ ID 304 4 47358255 47361851 3596 gain 1252 CORIN Exon + ve, 2 cases 4.435935199 SEQ ID 305 3 33868917 33873484 4567 loss 1259 PDCD6IP Exon + ve, 2 cases 4.435935199 SEQ ID 305 3 33868917 33873484 4567 loss 1274 PDCD6IP Exon + ve, 2 cases 4.435935199 SEQ ID 305 3 33868917 33873484 4567 loss 1724 PDCD6IP Exon + ve, 2 cases 4.435935199 SEQ ID 306 19 59179146 59183718 4572 loss 1953 CACNG8 Exon + ve, 2 cases 4.435935199 SEQ ID 307 2 43857496 43862163 4667 loss 1688 DYNC2LI1 Exon + ve, 2 cases 4.435935199 SEQ ID 307 2 43857496 43862163 4667 loss 1786 DYNC2LI1 Exon + ve, 2 cases 4.435935199 SEQ ID 307 2 43857496 43862163 4667 loss 1790 DYNC2LI1 Exon + ve, 2 cases 4.435935199 SEQ ID 308 10 68606250 68611060 4810 loss 1970 CTNNA3 Exon + ve, distinct 4.435935199 CNVs, same Gene SEQ ID 309 15 87996761 88001610 4849 loss 1317 KIF7 Exon + ve, 2 cases 4.435935199 SEQ ID 310 19 59177873 59183718 5845 loss 1720 CACNG8 Exon + ve, 2 cases 4.435935199 SEQ ID 311 6 146908491 146914496 6005 loss 1535 RAB32 Exon + ve, 2 cases 4.435935199 SEQ ID 312 7 99028753 99035131 6378 gain 1411 LOC100289187 Exon + ve, 2 cases 4.435935199 SEQ ID 312 7 99028753 99035131 6378 gain 1755 LOC100289187 Exon + ve, 2 cases 4.435935199 SEQ ID 313 7 99028753 99037212 8459 gain 1799 LOC100289187 Exon + ve, 2 cases 4.435935199 SEQ ID 314 3 197848634 197857567 8933 loss 1285 LRRC33 Exon + ve, 2 cases 4.435935199 SEQ ID 315 3 197276556 197285789 9233 gain 1565 TFRC Exon + ve, 2 cases 4.435935199 SEQ ID 316 19 12026895 12036294 9399 loss 1333 ZNF878 Exon + ve, 2 cases 4.435935199 SEQ ID 316 19 12026895 12036294 9399 loss 1391 ZNF878 Exon + ve, 2 cases 4.435935199 SEQ ID 316 19 12026895 12036294 9399 loss 1742 ZNF878 Exon + ve, 2 cases 4.435935199 SEQ ID 317 9 73771180 73780717 9537 gain 1793 C9orf85 Exon + ve, 2 cases 4.435935199 SEQ ID 317 9 73771180 73780717 9537 gain 1883 C9orf85 Exon + ve, 2 cases 4.435935199 SEQ ID 318 16 73305631 73315221 9590 loss 1918 FA2H Exon + ve, 2 cases 4.435935199 SEQ ID 319 9 73771087 73780717 9630 gain 1893 C9orf85 Exon + ve, 2 cases 4.435935199 SEQ ID 320 3 58161589 58171419 9830 gain 1267 DNASE1L3 Exon + ve, 2 cases 4.435935199 SEQ ID 320 3 58161589 58171419 9830 gain 1268 DNASE1L3 Exon + ve, 2 cases 4.435935199 SEQ ID 320 3 58161589 58171419 9830 gain 1354 DNASE1L3 Exon + ve, 2 cases 4.435935199 SEQ ID 321 2 106174179 106184290 10111 loss 1697 UXS1 Exon + ve, 2 cases 4.435935199 SEQ ID 322 3 197848634 197859317 10683 loss 1909 LRRC33 Exon + ve, 2 cases 4.435935199 SEQ ID 323 16 73303266 73315221 11955 loss 1293 FA2H Exon + ve, 2 cases 4.435935199 SEQ ID 323 16 73303266 73315221 11955 loss 1297 FA2H Exon + ve, 2 cases 4.435935199 SEQ ID 324 3 197846987 197859317 12330 loss 2030 LRRC33 Exon + ve, 2 cases 4.435935199 SEQ ID 325 16 22071418 22084314 12896 gain 1946 VWA3A Exon + ve, 2 cases 4.435935199 SEQ ID 325 16 22071418 22084314 12896 gain 1962 VWA3A Exon + ve, 2 cases 4.435935199 SEQ ID 326 16 3047597 3065241 17644 loss 1585 MMP25, IL32 Exon + ve, 2 cases 4.435935199 SEQ ID 326 16 3047597 3065241 17644 loss 1919 MMP25, IL32 Exon + ve, 2 cases 4.435935199 SEQ ID 327 4 47314693 47335844 21151 loss 1308 CORIN Exon + ve, distinct 4.435935199 CNVs, same Gene SEQ ID 328 16 3044051 3065241 21190 loss 1804 MMP25, IL32 Exon + ve, 2 cases 4.435935199 SEQ ID 329 10 42318589 42340738 22149 gain 1299 ZNF37BP Exon + ve, 2 cases 4.435935199 SEQ ID 330 17 6673256 6695979 22723 gain 1600 TEKT1 Exon + ve, 2 cases 4.435935199 SEQ ID 331 6 149098235 149121186 22951 loss 1660 UST Exon + ve, 2 cases 4.435935199 SEQ ID 332 9 116122595 116146858 24263 loss 1301 ORM1, ORM2, AKNA Exon + ve, 2 cases 4.435935199 SEQ ID 333 9 5632749 5660083 27334 gain 1463 KIAA1432 Exon + ve, 2 cases 4.435935199 SEQ ID 334 9 5634019 5661740 27721 gain 1818 KIAA1432 Exon + ve, 2 cases 4.435935199 SEQ ID 335 3 48583014 48611409 28395 loss 1428 MIR711, COL7A1, UQCRC1 Exon + ve, 2 cases 4.435935199 SEQ ID 336 9 5632749 5661740 28991 gain 1667 KIAA1432 Exon + ve, 2 cases 4.435935199 SEQ ID 337 9 79037727 79067111 29384 gain 1782 VPS13A Exon + ve, 2 cases 4.435935199 SEQ ID 337 9 79037727 79067111 29384 gain 1897 VPS13A Exon + ve, 2 cases 4.435935199 SEQ ID 337 9 79037727 79067111 29384 gain 1938 VPS13A Exon + ve, 2 cases 4.435935199 SEQ ID 338 13 42369769 42423317 53548 gain 1502 EPSTI1 Exon + ve, 2 cases 4.435935199 SEQ ID 339 9 116088109 116142499 54390 gain 1406 COL27A1, ORM1, ORM2, AKNA Exon + ve, 2 cases 4.435935199 SEQ ID 340 9 116088109 116144225 56116 gain 2020 COL27A1, ORM1, ORM2, AKNA Exon + ve, 2 cases 4.435935199 SEQ ID 341 10 69018417 69100982 82565 gain 1780 CTNNA3 Exon + ve, distinct 4.435935199 CNVs, same Gene SEQ ID 342 3 48575894 48667744 91850 loss 2035 TMEM89, COL7A1, CELSR3, MIR711, SLC26A6, UCN2, Exon + ve, 2 cases 4.435935199 UQCRC1 SEQ ID 343 15 87901294 88001610 100316 gain 1548 KIF7, C15orf42 Exon + ve, 2 cases 4.435935199 SEQ ID 344 3 48575894 48677740 101846 loss 1969 TMEM89, COL7A1, CELSR3, MIR711, SLC26A6, UCN2, Exon + ve, 2 cases 4.435935199 UQCRC1 SEQ ID 345 17 6699298 6804062 104764 loss 1600 ALOX12P2 Exon + ve, 2 cases 4.435935199 SEQ ID 346 4 191041481 191153613 112132 gain 1230 FRG1, TUBB4Q Exon + ve, 2 cases 4.435935199 SEQ ID 346 4 191041481 191153613 112132 gain 1292 FRG1, TUBB4Q Exon + ve, 2 cases 4.435935199 SEQ ID 347 3 197289125 197410852 121727 gain 1565 LOC401109, TFRC, ZDHHC19 Exon + ve, 2 cases 4.435935199 SEQ ID 348 10 67627258 67751642 124384 loss 1835 CTNNA3 Exon + ve, distinct 4.435935199 CNVs, same Gene SEQ ID 349 4 190982421 191133609 151188 gain 1411 FRG1 Exon + ve, 2 cases 4.435935199 SEQ ID 350 17 6571330 6745640 174310 loss 1927 TEKT1, ALOX12P2, XAF1, FBXO39 Exon + ve, 2 cases 4.435935199 SEQ ID 351 1 91915756 92093883 178127 gain 1405 TGFBR3 Exon + ve, 2 cases 4.435935199 SEQ ID 352 13 42372718 42687363 314645 gain 1897 ENOX1, DNAJC15, EPSTI1 Exon + ve, 2 cases 4.435935199 SEQ ID 353 1 144099302 144458571 359269 loss 1874 RNF115, RBM8A, GNRHR2, CD160, HFE2, ANKRD34A, Exon + ve, 2 cases 4.435935199 LIX1L, POLR3GL, ANKRD35, ITGA10, PEX11B, NUDT17, TXNIP, PDZK1, POLR3C, PIAS3 SEQ ID 354 3 197135314 197531031 395717 gain 1227 PCYT1A, TM4SF19-TCTEX1D2, ZDHHC19, OSTalpha, TFRC, Exon + ve, 2 cases 4.435935199 LOC401109, TCTEX1D2, SDHAP1 SEQ ID 355 1 144099302 144544352 445050 gain 1599 RNF115, GPR89A, RBM8A, GNRHR2, CD160, HFE2, Exon + ve, 2 cases 4.435935199 ANKRD34A, LIX1L, POLR3GL, ANKRD35, ITGA10, PEX11B, NUDT17, TXNIP, PDZK1, POLR3C, PIAS3 SEQ ID 355 1 144099302 144544352 445050 gain 1968 RNF115, GPR89A, RBM8A, GNRHR2, CD160, HFE2, Exon + ve, 2 cases 4.435935199 ANKRD34A, LIX1L, POLR3GL, ANKRD35, ITGA10, PEX11B, NUDT17, TXNIP, PDZK1, POLR3C, PIAS3 SEQ ID 356 16 21858880 22338034 479154 gain 1426 EEF2K, CDR2, POLR3E, C16orf52, UQCRC2, PDZD9, Exon + ve, 2 cases 4.435935199 VWA3A SEQ ID 357 5 89477991 90142704 664713 gain 1786 LYSMD3, POLR3G, CETN3, MBLAC2, GPR98 Exon + ve, 2 cases 4.435935199 SEQ ID 357 5 89477991 90142704 664713 gain 1886 LYSMD3, POLR3G, CETN3, MBLAC2, GPR98 Exon + ve, 2 cases 4.435935199 SEQ ID 358 10 42601499 43277721 676222 gain 1968 RASGEF1A, BMS1, ZNF487P, FXYD4, RET, CSGALNACT2, Exon + ve, 2 cases 4.435935199 HNRNPF SEQ ID 359 10 41971605 43049635 1078030 gain 1746 RASGEF1A, BMS1, ZNF37BP, RET, LOC441666, ZNF33B, Exon + ve, 2 cases 4.435935199 LOC84856, CSGALNACT2 SEQ ID 360 4 149047165 149047423 258 loss 1498 ARHGAP10 Exon + ve, 2 cases 2.952941176 SEQ ID 360 4 149047165 149047423 258 loss 1916 ARHGAP10 Exon + ve, 2 cases 2.952941176 SEQ ID 361 11 95194789 95195561 772 loss 1349 CEP57 Exon + ve, 2 cases 2.952941176 SEQ ID 361 11 95194789 95195561 772 loss 1946 CEP57 Exon + ve, 2 cases 2.952941176 SEQ ID 362 22 45453176 45454102 926 gain 1660 GRAMD4 Exon + ve, 2 cases 2.952941176 SEQ ID 362 22 45453176 45454102 926 gain 1880 GRAMD4 Exon + ve, 2 cases 2.952941176 SEQ ID 363 X 13695016 13696059 1043 gain 1590 OFD1 Exon + ve, 2 cases 2.952941176 SEQ ID 364 14 99827183 99828301 1118 gain 1790 SLC25A29 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 365 1 206023028 206024152 1124 loss 1724 CD46 Exon + ve, 2 cases 2.952941176 SEQ ID 366 8 42134084 42135245 1161 loss 1251 AP3M2 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 367 19 58919358 58920523 1165 gain 1585 MIR516B2 Exon + ve, 2 cases 2.952941176 SEQ ID 368 1 156784465 156785660 1195 loss 1877 OR6Y1 Exon + ve, 2 cases 2.952941176 SEQ ID 369 4 56070868 56072259 1391 loss 1529 CLOCK Exon + ve, 2 cases 2.952941176 SEQ ID 370 X 13673158 13674550 1392 loss 1320 OFD1 Exon + ve, 2 cases 2.952941176 SEQ ID 371 2 179837050 179838443 1393 loss 1727 SESTD1 Exon + ve, 2 cases 2.952941176 SEQ ID 372 20 33633288 33634683 1395 loss 1774 FER1L4 Exon + ve, 2 cases 2.952941176 SEQ ID 373 14 99828301 99829704 1403 loss 1705 SLC25A29 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 374 X 40940810 40942301 1491 loss 1583 USP9X Exon + ve, 2 cases 2.952941176 SEQ ID 375 12 9777077 9778598 1521 loss 1264 CLECL1 Exon + ve, 2 cases 2.952941176 SEQ ID 375 12 9777077 9778598 1521 loss 1705 CLECL1 Exon + ve, 2 cases 2.952941176 SEQ ID 376 16 28073908 28075568 1660 loss 1295 XPO6 Exon + ve, 2 cases 2.952941176 SEQ ID 376 16 28073908 28075568 1660 loss 1917 XPO6 Exon + ve, 2 cases 2.952941176 SEQ ID 377 3 155353325 155355022 1697 gain 1371 ARHGEF26 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 378 5 14333156 14334923 1767 gain 1417 TRIO Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 379 11 22198120 22199909 1789 loss 2001 ANO5 Exon + ve, 2 cases 2.952941176 SEQ ID 380 11 125808845 125810734 1889 gain 1861 KIRREL3 Exon + ve, 2 cases 2.952941176 SEQ ID 381 2 30306530 30308506 1976 loss 1429 LBH Exon + ve, 2 cases 2.952941176 SEQ ID 381 2 30306530 30308506 1976 loss 1884 LBH Exon + ve, 2 cases 2.952941176 SEQ ID 382 X 29595687 29597689 2002 loss 1506 IL1RAPL1 Exon + ve, 2 cases 2.952941176 SEQ ID 382 X 29595687 29597689 2002 loss 1811 IL1RAPL1 Exon + ve, 2 cases 2.952941176 SEQ ID 383 11 127895094 127897121 2027 gain 1429 ETS1 Exon + ve, 2 cases 2.952941176 SEQ ID 383 11 127895094 127897121 2027 gain 1779 ETS1 Exon + ve, 2 cases 2.952941176 SEQ ID 384 X 105750701 105752733 2032 loss 1239 CXorf57 Exon + ve, 2 cases 2.952941176 SEQ ID 384 X 105750701 105752733 2032 loss 1372 CXorf57 Exon + ve, 2 cases 2.952941176 SEQ ID 385 14 30647372 30649432 2060 loss 1775 HECTD1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 386 2 106784966 106787143 2177 loss 1592 ST6GAL2 Exon + ve, 2 cases 2.952941176 SEQ ID 386 2 106784966 106787143 2177 loss 1720 ST6GAL2 Exon + ve, 2 cases 2.952941176 SEQ ID 387 20 30793762 30795954 2192 loss 1241 COMMD7 Exon + ve, 2 cases 2.952941176 SEQ ID 388 16 88409839 88412033 2194 gain 1877 FANCA Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 389 12 21514182 21516409 2227 gain 1465 RECQL, PYROXD1 Exon + ve, 2 cases 2.952941176 SEQ ID 389 12 21514182 21516409 2227 gain 1925 RECQL, PYROXD1 Exon + ve, 2 cases 2.952941176 SEQ ID 390 16 31485690 31487952 2262 gain 1524 CSDAP1 Exon + ve, 2 cases 2.952941176 SEQ ID 391 3 155389583 155391992 2409 gain 1446 ARHGEF26 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 392 20 33633288 33635789 2501 loss 1419 FER1L4 Exon + ve, 2 cases 2.952941176 SEQ ID 393 X 137525298 137527811 2513 gain 1223 LOC158696 Exon + ve, 2 cases 2.952941176 SEQ ID 393 X 137525298 137527811 2513 gain 2041 LOC158696 Exon + ve, 2 cases 2.952941176 SEQ ID 394 7 6004111 6006782 2671 gain 1266 PMS2 Exon + ve, 2 cases 2.952941176 SEQ ID 394 7 6004111 6006782 2671 gain 1938 PMS2 Exon + ve, 2 cases 2.952941176 SEQ ID 395 1 93492660 93495455 2795 gain 1832 CCDC18 Exon + ve, 2 cases 2.952941176 SEQ ID 395 1 93492660 93495455 2795 gain 2032 CCDC18 Exon + ve, 2 cases 2.952941176 SEQ ID 396 2 44403707 44406514 2807 gain 1826 PREPL Exon + ve, 2 cases 2.952941176 SEQ ID 397 1 156784465 156787318 2853 loss 1858 OR6Y1 Exon + ve, 2 cases 2.952941176 SEQ ID 398 14 22811680 22814547 2867 gain 1642 HOMEZ Exon + ve, 2 cases 2.952941176 SEQ ID 398 14 22811680 22814547 2867 gain 1875 HOMEZ Exon + ve, 2 cases 2.952941176 SEQ ID 399 15 41098343 41101310 2967 loss 1630 UBR1 Exon + ve, 2 cases 2.952941176 SEQ ID 399 15 41098343 41101310 2967 loss 2018 UBR1 Exon + ve, 2 cases 2.952941176 SEQ ID 400 22 37737241 37740258 3017 loss 1959 APOBEC3C Exon + ve, 2 cases 2.952941176 SEQ ID 400 22 37737241 37740258 3017 loss 1965 APOBEC3C Exon + ve, 2 cases 2.952941176 SEQ ID 401 10 118190679 118193786 3107 loss 1287 PNLIPRP3 Exon + ve, 2 cases 2.952941176 SEQ ID 402 9 32459710 32463040 3330 loss 2003 DDX58 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 403 8 67685665 67689015 3350 loss 1275 MYBL1 Exon + ve, 2 cases 2.952941176 SEQ ID 403 8 67685665 67689015 3350 loss 1650 MYBL1 Exon + ve, 2 cases 2.952941176 SEQ ID 404 12 108878848 108882203 3355 loss 1279 GIT2 Exon + ve, 2 cases 2.952941176 SEQ ID 404 12 108878848 108882203 3355 loss 1665 GIT2 Exon + ve, 2 cases 2.952941176 SEQ ID 405 8 54952820 54956193 3373 loss 1604 RGS20 Exon + ve, 2 cases 2.952941176 SEQ ID 406 3 46687043 46690457 3414 loss 1834 ALS2CL Exon + ve, 2 cases 2.952941176 SEQ ID 407 8 42145982 42149494 3512 gain 1634 AP3M2 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 408 11 110872005 110875598 3593 loss 1465 BTG4 Exon + ve, 2 cases 2.952941176 SEQ ID 409 X 8960105 8963721 3616 gain 1454 FAM9B Exon + ve, 2 cases 2.952941176 SEQ ID 410 7 48528408 48532031 3623 loss 1891 ABCA13 Exon + ve, 2 cases 2.952941176 SEQ ID 411 3 96161892 96165551 3659 loss 1619 LOC255025 Exon + ve, 2 cases 2.952941176 SEQ ID 411 3 96161892 96165551 3659 loss 1624 LOC255025 Exon + ve, 2 cases 2.952941176 SEQ ID 412 7 133906667 133910372 3705 gain 1783 AKR1B15 Exon + ve, 2 cases 2.952941176 SEQ ID 413 X 40938342 40942301 3959 loss 1415 USP9X Exon + ve, 2 cases 2.952941176 SEQ ID 414 9 6606637 6610662 4025 loss 1391 GLDC Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 415 17 38282993 38287021 4028 loss 1295 LOC388387 Exon + ve, 2 cases 2.952941176 SEQ ID 415 17 38282993 38287021 4028 loss 1470 LOC388387 Exon + ve, 2 cases 2.952941176 SEQ ID 416 4 68168394 68172597 4203 loss 1221 UBA6 Exon + ve, 2 cases 2.952941176 SEQ ID 416 4 68168394 68172597 4203 loss 1222 UBA6 Exon + ve, 2 cases 2.952941176 SEQ ID 417 6 166499289 166503493 4204 loss 1859 T Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 418 1 206019923 206024152 4229 loss 1843 CD46 Exon + ve, 2 cases 2.952941176 SEQ ID 419 17 37790601 37795135 4534 loss 1659 STAT3 Exon + ve, 2 cases 2.952941176 SEQ ID 419 17 37790601 37795135 4534 loss 1887 STAT3 Exon + ve, 2 cases 2.952941176 SEQ ID 420 4 107311633 107316223 4590 loss 1280 TBCK Exon + ve, 2 cases 2.952941176 SEQ ID 420 4 107311633 107316223 4590 loss 1933 TBCK Exon + ve, 2 cases 2.952941176 SEQ ID 421 4 39829776 39834522 4746 loss 1947 N4BP2 Exon + ve, 2 cases 2.952941176 SEQ ID 422 7 122051537 122056508 4971 loss 1354 CADPS2 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 423 9 36263984 36268995 5011 gain 1716 GNE Exon + ve, 2 cases 2.952941176 SEQ ID 423 9 36263984 36268995 5011 gain 1829 GNE Exon + ve, 2 cases 2.952941176 SEQ ID 424 18 17999811 18004912 5101 loss 1764 GATA6 Exon + ve, 2 cases 2.952941176 SEQ ID 424 18 17999811 18004912 5101 loss 1969 GATA6 Exon + ve, 2 cases 2.952941176 SEQ ID 425 5 128326107 128331280 5173 loss 1699 SLC27A6 Exon + ve, 2 cases 2.952941176 SEQ ID 426 1 243768850 243774213 5363 loss 1840 KIF26B Exon + ve, 2 cases 2.952941176 SEQ ID 427 11 63065110 63070503 5393 loss 1950 RARRES3 Exon + ve, 2 cases 2.952941176 SEQ ID 428 17 20154473 20159997 5524 loss 1988 SPECC1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 429 3 10249256 10254819 5563 loss 1920 IRAK2 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 430 8 134336459 134342059 5600 loss 1552 NDRG1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 431 17 26220790 26226519 5729 loss 1238 ATAD5 Exon + ve, 2 cases 2.952941176 SEQ ID 431 17 26220790 26226519 5729 loss 1831 ATAD5 Exon + ve, 2 cases 2.952941176 SEQ ID 432 14 30649432 30655206 5774 loss 1403 HECTD1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 433 6 74521789 74527607 5818 gain 1638 CD109 Exon + ve, 2 cases 2.952941176 SEQ ID 434 16 20861337 20867356 6019 loss 1230 DNAH3 Exon + ve, 2 cases 2.952941176 SEQ ID 435 3 10210951 10217019 6068 loss 1247 IRAK2 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 436 12 8173177 8179355 6178 gain 1246 POU5F1P3, CLEC4A Exon + ve, 2 cases 2.952941176 SEQ ID 436 12 8173177 8179355 6178 gain 1308 POU5F1P3, CLEC4A Exon + ve, 2 cases 2.952941176 SEQ ID 437 9 26919782 26925984 6202 loss 1539 PLAA Exon + ve, 2 cases 2.952941176 SEQ ID 438 5 95183456 95189721 6265 gain 1281 GLRX Exon + ve, 2 cases 2.952941176 SEQ ID 438 5 95183456 95189721 6265 gain 1824 GLRX Exon + ve, 2 cases 2.952941176 SEQ ID 439 8 54951684 54958115 6431 loss 1993 RGS20 Exon + ve, 2 cases 2.952941176 SEQ ID 440 22 48680818 48687314 6496 loss 1619 ALG12 Exon + ve, 2 cases 2.952941176 SEQ ID 440 22 48680818 48687314 6496 loss 1930 ALG12 Exon + ve, 2 cases 2.952941176 SEQ ID 441 8 134331224 134337808 6584 gain 1854 NDRG1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 442 22 22362348 22369101 6753 gain 1895 LOC91316, RGL4 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 443 6 165748837 165755595 6758 loss 1590 PDE10A Exon + ve, 2 cases 2.952941176 SEQ ID 444 12 97699965 97706725 6760 loss 1884 ANKS1B Exon + ve, 2 cases 2.952941176 SEQ ID 445 22 16366605 16373481 6876 loss 1694 CECR2 Exon + ve, 2 cases 2.952941176 SEQ ID 446 1 19054398 19061530 7132 loss 1940 TAS1R2 Exon + ve, 2 cases 2.952941176 SEQ ID 447 5 37398626 37405778 7152 loss 1426 NUP155 Exon + ve, 2 cases 2.952941176 SEQ ID 448 9 32490919 32498096 7177 loss 1645 DDX58 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 449 6 166487200 166494679 7479 gain 1392 T Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 450 1 47549912 47557441 7529 loss 1591 STIL Exon + ve, 2 cases 2.952941176 SEQ ID 450 1 47549912 47557441 7529 loss 1759 STIL Exon + ve, 2 cases 2.952941176 SEQ ID 451 4 99104657 99112516 7859 gain 1489 C4orf37 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 452 11 63062641 63070503 7862 loss 1776 RARRES3 Exon + ve, 2 cases 2.952941176 SEQ ID 453 4 186681553 186689469 7916 loss 1458 PDLIM3 Exon + ve, 2 cases 2.952941176 SEQ ID 454 7 122003026 122010979 7953 loss 1910 CADPS2 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 455 4 44319603 44327596 7993 loss 1487 YIPF7 Exon + ve, 2 cases 2.952941176 SEQ ID 455 4 44319603 44327596 7993 loss 1659 YIPF7 Exon + ve, 2 cases 2.952941176 SEQ ID 456 13 35691597 35699664 8067 gain 1803 C13orf38-SOHLH2, C13orf38 Exon + ve, 2 cases 2.952941176 SEQ ID 457 4 56070868 56079086 8218 loss 1738 CLOCK Exon + ve, 2 cases 2.952941176 SEQ ID 458 16 66830124 66838398 8274 loss 2023 PLA2G15 Exon + ve, 2 cases 2.952941176 SEQ ID 459 20 30787639 30795954 8315 loss 1901 COMMD7 Exon + ve, 2 cases 2.952941176 SEQ ID 460 1 201194532 201202914 8382 loss 1572 CYB5R1 Exon + ve, 2 cases 2.952941176 SEQ ID 460 1 201194532 201202914 8382 loss 1687 CYB5R1 Exon + ve, 2 cases 2.952941176 SEQ ID 461 19 12650727 12659347 8620 loss 1638 DHPS Exon + ve, 2 cases 2.952941176 SEQ ID 462 1 149957941 149966646 8705 loss 1867 RIIAD1 Exon + ve, 2 cases 2.952941176 SEQ ID 463 16 20861337 20870187 8850 loss 1760 DNAH3 Exon + ve, 2 cases 2.952941176 SEQ ID 464 19 12651862 12660732 8870 loss 1538 FBXW9, DHPS Exon + ve, 2 cases 2.952941176 SEQ ID 465 9 17347695 17356839 9144 loss 1502 CNTLN Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 466 8 82910933 82920255 9322 loss 1638 SNX16 Exon + ve, 2 cases 2.952941176 SEQ ID 466 8 82910933 82920255 9322 loss 1950 SNX16 Exon + ve, 2 cases 2.952941176 SEQ ID 467 1 177589995 177599597 9602 loss 1372 SOAT1 Exon + ve, 2 cases 2.952941176 SEQ ID 467 1 177589995 177599597 9602 loss 1635 SOAT1 Exon + ve, 2 cases 2.952941176 SEQ ID 468 7 86932062 86941683 9621 loss 1439 ABCB4 Exon + ve, 2 cases 2.952941176 SEQ ID 469 2 201773817 201783547 9730 loss 1534 CASP10 Exon + ve, 2 cases 2.952941176 SEQ ID 470 22 24636477 24646275 9798 gain 1348 MIR1302-1, MYO18B Exon + ve, 2 cases 2.952941176 SEQ ID 471 1 97937667 97947671 10004 loss 1221 DPYD Exon + ve, 2 cases 2.952941176 SEQ ID 472 2 48666246 48676336 10090 gain 1386 STON1-GTF2A1L, STON1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 473 9 17260655 17271186 10531 loss 1743 CNTLN Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 474 3 54504338 54514944 10606 gain 1293 CACNA2D3 Exon + ve, 2 cases 2.952941176 SEQ ID 474 3 54504338 54514944 10606 gain 1921 CACNA2D3 Exon + ve, 2 cases 2.952941176 SEQ ID 475 12 97694069 97704854 10785 loss 1872 ANKS1B Exon + ve, 2 cases 2.952941176 SEQ ID 476 22 16635762 16646613 10851 loss 1718 BID Exon + ve, 2 cases 2.952941176 SEQ ID 476 22 16635762 16646613 10851 loss 1859 BID Exon + ve, 2 cases 2.952941176 SEQ ID 477 17 19924055 19935009 10954 loss 2038 SPECC1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 478 5 150506984 150518075 11091 loss 1433 ANXA6 Exon + ve, 2 cases 2.952941176 SEQ ID 479 18 22717441 22728600 11159 loss 1442 C18orf16 Exon + ve, 2 cases 2.952941176 SEQ ID 480 7 100967884 100979053 11169 loss 1680 EMID2 Exon + ve, 2 cases 2.952941176 SEQ ID 481 22 16366605 16378078 11473 loss 1226 CECR2 Exon + ve, 2 cases 2.952941176 SEQ ID 482 1 110102580 110114121 11541 loss 1680 EPS8L3 Exon + ve, 2 cases 2.952941176 SEQ ID 483 4 39822903 39834522 11619 loss 1883 N4BP2 Exon + ve, 2 cases 2.952941176 SEQ ID 484 7 86930016 86941683 11667 loss 1579 ABCB4 Exon + ve, 2 cases 2.952941176 SEQ ID 485 14 69012378 69024166 11788 loss 1852 UPF0639 Exon + ve, 2 cases 2.952941176 SEQ ID 485 14 69012378 69024166 11788 loss 1871 UPF0639 Exon + ve, 2 cases 2.952941176 SEQ ID 486 18 22717441 22729467 12026 loss 1502 C18orf16 Exon + ve, 2 cases 2.952941176 SEQ ID 487 16 31384536 31396729 12193 gain 1232 TGFB1I1, ARMC5 Exon + ve, 2 cases 2.952941176 SEQ ID 487 16 31384536 31396729 12193 gain 1508 TGFB1I1, ARMC5 Exon + ve, 2 cases 2.952941176 SEQ ID 488 3 46677853 46690457 12604 loss 1318 ALS2CL Exon + ve, 2 cases 2.952941176 SEQ ID 489 3 38415026 38428090 13064 loss 1802 XYLB Exon + ve, 2 cases 2.952941176 SEQ ID 490 19 58910511 58923614 13103 gain 1606 MIR526A2, MIR517B, MIR516B2, MIR520G, MIR520D, Exon + ve, 2 cases 2.952941176 MIR521-2 SEQ ID 491 1 110102580 110115770 13190 loss 1802 EPS8L3 Exon + ve, 2 cases 2.952941176 SEQ ID 492 1 16578594 16591820 13226 loss 1315 C1orf144 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 493 19 63655893 63669151 13258 loss 1454 ZNF324B Exon + ve, 2 cases 2.952941176 SEQ ID 494 13 35690487 35703802 13315 gain 1564 C13orf38-SOHLH2, C13orG8 Exon + ve, 2 cases 2.952941176 SEQ ID 495 1 19050716 19064092 13376 gain 1502 TAS1R2 Exon + ve, 2 cases 2.952941176 SEQ ID 496 11 65847130 65860867 13737 loss 1993 RIN1 Exon + ve, 2 cases 2.952941176 SEQ ID 497 16 66828576 66842374 13798 loss 1858 PLA2G15 Exon + ve, 2 cases 2.952941176 SEQ ID 498 6 74517372 74531383 14011 gain 1894 CD109 Exon + ve, 2 cases 2.952941176 SEQ ID 499 19 57718358 57733017 14659 loss 1678 ZNF808 Exon + ve, 2 cases 2.952941176 SEQ ID 499 19 57718358 57733017 14659 loss 1855 ZNF808 Exon + ve, 2 cases 2.952941176 SEQ ID 500 5 128316373 128331280 14907 loss 1248 SLC27A6 Exon + ve, 2 cases 2.952941176 SEQ ID 501 4 101572938 101587882 14944 gain 1867 EMCN Exon + ve, 2 cases 2.952941176 SEQ ID 502 6 155530613 155545570 14957 loss 1347 TIAM2 Exon + ve, 2 cases 2.952941176 SEQ ID 502 6 155530613 155545570 14957 loss 1598 TIAM2 Exon + ve, 2 cases 2.952941176 SEQ ID 503 7 100967884 100982939 15055 loss 1820 EMID2 Exon + ve, 2 cases 2.952941176 SEQ ID 504 4 101572411 101587882 15471 gain 1752 EMCN Exon + ve, 2 cases 2.952941176 SEQ ID 505 20 52074911 52090393 15482 loss 1354 BCAS1 Exon + ve, 2 cases 2.952941176 SEQ ID 505 20 52074911 52090393 15482 loss 1860 BCAS1 Exon + ve, 2 cases 2.952941176 SEQ ID 506 9 127014097 127029947 15850 loss 1222 RABEPK Exon + ve, 2 cases 2.952941176 SEQ ID 507 16 86347096 86364664 17568 loss 2041 KLHDC4 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 508 17 72982885 73000459 17574 loss 1909 SEPT9 Exon + ve, 2 cases 2.952941176 SEQ ID 509 12 51132302 51150231 17929 loss 1844 KRT6C Exon + ve, 2 cases 2.952941176 SEQ ID 509 12 51132302 51150231 17929 loss 2037 KRT6C Exon + ve, 2 cases 2.952941176 SEQ ID 510 7 107049716 107067706 17990 loss 1321 BCAP29 Exon + ve, 2 cases 2.952941176 SEQ ID 510 7 107049716 107067706 17990 loss 1475 BCAP29 Exon + ve, 2 cases 2.952941176 SEQ ID 511 11 65842722 65860867 18145 loss 1958 RIN1 Exon + ve, 2 cases 2.952941176 SEQ ID 512 3 38415026 38433483 18457 loss 1725 XYLB Exon + ve, 2 cases 2.952941176 SEQ ID 513 16 86307080 86326794 19714 loss 1258 KLHDC4 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 514 1 233582552 233602295 19743 loss 1720 TBCE Exon + ve, 2 cases 2.952941176 SEQ ID 515 7 91585706 91605955 20249 loss 1856 CYP51A1 Exon + ve, 2 cases 2.952941176 SEQ ID 516 5 150504105 150524435 20330 loss 1942 ANXA6 Exon + ve, 2 cases 2.952941176 SEQ ID 517 9 92596909 92617806 20897 gain 1423 SYK Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 518 6 170680224 170701779 21555 gain 1954 PSMB1 Exon + ve, 2 cases 2.952941176 SEQ ID 519 9 134924325 134946471 22146 gain 1887 CEL Exon + ve, 2 cases 2.952941176 SEQ ID 520 11 110853365 110875598 22233 loss 1276 BTG4 Exon + ve, 2 cases 2.952941176 SEQ ID 521 3 197537870 197560934 23064 gain 1775 TM4SF19, TM4SF19-TCTEX1D2 Exon + ve, 2 cases 2.952941176 SEQ ID 522 1 149941641 149964885 23244 loss 2033 CELF3, RIIAD1 Exon + ve, 2 cases 2.952941176 SEQ ID 523 1 206053098 206076352 23254 loss 1638 LOC148696 Exon + ve, 2 cases 2.952941176 SEQ ID 524 17 423068 446585 23517 loss 1268 VPS53 Exon + ve, 2 cases 2.952941176 SEQ ID 525 9 6555187 6578755 23568 loss 1609 GLDC Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 526 3 197712985 197736785 23800 loss 1546 RNF168, C3orf43 Exon + ve, 2 cases 2.952941176 SEQ ID 527 2 48603879 48627703 23824 gain 1276 STON1-GTF2A1L, STON1 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 528 1 246138090 246162296 24206 gain 1798 OR2T8 Exon + ve, 2 cases 2.952941176 SEQ ID 529 X 32203770 32228244 24474 gain 2018 DMD Exon + ve, 2 cases 2.952941176 SEQ ID 530 1 206054159 206078819 24660 loss 1659 LOC148696 Exon + ve, 2 cases 2.952941176 SEQ ID 531 22 24624566 24649785 25219 loss 1833 MIR1302-1, MYO18B Exon + ve, 2 cases 2.952941176 SEQ ID 532 2 125058391 125084599 26208 gain 1803 CNTNAP5 Exon + ve, 2 cases 2.952941176 SEQ ID 533 X 8931895 8958319 26424 loss 1496 FAM9B Exon + ve, 2 cases 2.952941176 SEQ ID 534 X 48688957 48716140 27183 loss 1639 KCND1, OTUD5, GRIPAP1 Exon + ve, 2 cases 2.952941176 SEQ ID 535 2 143888582 143915868 27286 gain 1750 ARHGAP15 Exon + ve, 2 cases 2.952941176 SEQ ID 536 9 26919782 26947140 27358 loss 1656 PLAA, IFT74 Exon + ve, 2 cases 2.952941176 SEQ ID 537 9 127001024 127028444 27420 loss 1669 RABEPK Exon + ve, 2 cases 2.952941176 SEQ ID 538 7 89824673 89852155 27482 gain 1864 GTPBP10 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 539 4 70523201 70551081 27880 loss 1285 UGT2A2, UGT2A1 Exon + ve, 2 cases 2.952941176 SEQ ID 539 4 70523201 70551081 27880 loss 1433 UGT2A2, UGT2A1 Exon + ve, 2 cases 2.952941176 SEQ ID 540 2 125058391 125088012 29621 gain 1532 CNTNAP5 Exon + ve, 2 cases 2.952941176 SEQ ID 541 6 30021908 30052053 30145 loss 1244 HCG9 Exon + ve, 2 cases 2.952941176 SEQ ID 542 6 26539830 26571434 31604 loss 1968 BTN2A1, BTN3A3 Exon + ve, 2 cases 2.952941176 SEQ ID 543 17 72976383 73008700 32317 loss 1825 SEPT9 Exon + ve, 2 cases 2.952941176 SEQ ID 544 22 34940309 34973305 32996 loss 1724 APOL2 Exon + ve, 2 cases 2.952941176 SEQ ID 544 22 34940309 34973305 32996 loss 2035 APOL2 Exon + ve, 2 cases 2.952941176 SEQ ID 545 22 22324940 22358386 33446 loss 1549 LOC91316 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 546 2 179804969 179838443 33474 loss 1425 SESTD1 Exon + ve, 2 cases 2.952941176 SEQ ID 547 X 154395845 154429912 34067 gain 1724 TMLHE Exon + ve, 2 cases 2.952941176 SEQ ID 548 16 88355436 88389622 34186 loss 1274 FANCA Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 549 6 26536902 26571434 34532 gain 1842 BTN2A3, BTN2A1, BTN3A3 Exon + ve, 2 cases 2.952941176 SEQ ID 550 7 133872990 133908027 35037 gain 1494 AKR1B10, AKR1B15 Exon + ve, 2 cases 2.952941176 SEQ ID 551 7 127640643 127675911 35268 gain 1733 LEP Exon + ve, 2 cases 2.952941176 SEQ ID 552 6 30021908 30057524 35616 loss 1488 HCG9 Exon + ve, 2 cases 2.952941176 SEQ ID 553 7 127640643 127678165 37522 gain 1266 LEP Exon + ve, 2 cases 2.952941176 SEQ ID 554 10 44921903 44960469 38566 gain 1295 LOC100133308 Exon + ve, 2 cases 2.952941176 SEQ ID 555 7 141408013 141446728 38715 gain 1225 MGAM Exon + ve, 2 cases 2.952941176 SEQ ID 555 7 141408013 141446728 38715 gain 1720 MGAM Exon + ve, 2 cases 2.952941176 SEQ ID 556 2 31279154 31321453 42299 loss 1544 CAPN14, EHD3 Exon + ve, 2 cases 2.952941176 SEQ ID 556 2 31279154 31321453 42299 loss 1929 CAPN14, EHD3 Exon + ve, 2 cases 2.952941176 SEQ ID 557 11 22175296 22218868 43572 gain 1609 ANO5 Exon + ve, 2 cases 2.952941176 SEQ ID 558 9 115858589 115903754 45165 gain 1406 ZNF618, AMBP, KIF12 Exon + ve, 2 cases 2.952941176 SEQ ID 558 9 115858589 115903754 45165 gain 2020 ZNF618, AMBP, KIF12 Exon + ve, 2 cases 2.952941176 SEQ ID 559 4 100955189 101000511 45322 gain 1462 DAPP1 Exon + ve, 2 cases 2.952941176 SEQ ID 559 4 100955189 101000511 45322 gain 1913 DAPP1 Exon + ve, 2 cases 2.952941176 SEQ ID 560 15 80318994 80364988 45994 gain 1740 EFTUD1, FAM154B Exon + ve, 2 cases 2.952941176 SEQ ID 561 2 44403707 44458771 55064 loss 1504 CAMKMT, PREPL Exon + ve, 2 cases 2.952941176 SEQ ID 562 2 99109502 99165006 55504 gain 1466 TSGA10, C2orf15, MRPL30, MITD1, LIPT1 Exon + ve, 2 cases 2.952941176 SEQ ID 563 14 47289928 47346649 56721 loss 1570 MIR548Y Exon + ve, 2 cases 2.952941176 SEQ ID 564 1 16520503 16578594 58091 gain 1995 C1orf144, FBXO42 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 565 12 50517950 50577179 59229 gain 1768 ANKRD33 Exon + ve, 2 cases 2.952941176 SEQ ID 566 14 77935509 77995126 59617 loss 1908 NRXN3 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 567 12 50517950 50578347 60397 gain 1836 ANKRD33 Exon + ve, 2 cases 2.952941176 SEQ ID 568 2 143887281 143956453 69172 loss 1677 ARHGAP15 Exon + ve, 2 cases 2.952941176 SEQ ID 569 16 31472312 31542172 69860 gain 1618 CSDAP1 Exon + ve, 2 cases 2.952941176 SEQ ID 570 2 201740139 201811330 71191 gain 1943 CASP10, CFLAR, CASP8 Exon + ve, 2 cases 2.952941176 SEQ ID 571 8 10658422 10732498 74076 loss 1663 PINX1, MIR1322 Exon + ve, 2 cases 2.952941176 SEQ ID 572 X 154297852 154375564 77712 gain 1831 F8A1, F8A3, F8A2, H2AFB3, H2AFB2, H2AFB1, Exon + ve, 2 cases 2.952941176 MIR1184-1, MIR1184-2, MIR1184-3, TMLHE SEQ ID 573 9 92658019 92739799 81780 gain 1626 SYK Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 574 8 10649592 10741416 91824 gain 2042 PINX1, MIR1322 Exon + ve, 2 cases 2.952941176 SEQ ID 575 1 65696044 65796708 100664 gain 1252 LEPR Exon + ve, 2 cases 2.952941176 SEQ ID 576 9 118469713 118571048 101335 loss 1559 ASTN2, TRIM32 Exon + ve, 2 cases 2.952941176 SEQ ID 577 4 99278436 99382350 103914 loss 1534 C4orf37 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 578 14 47273858 47378183 104325 gain 1709 MIR548Y Exon + ve, 2 cases 2.952941176 SEQ ID 579 20 26052035 26156944 104909 gain 1793 MIR663 Exon + ve, 2 cases 2.952941176 SEQ ID 580 1 65696044 65802848 106804 gain 1920 LEPR Exon + ve, 2 cases 2.952941176 SEQ ID 581 9 118405993 118524253 118260 loss 1622 ASTN2, TRIM32 Exon + ve, 2 cases 2.952941176 SEQ ID 582 16 81373761 81503479 129718 loss 1824 CDH13 Exon + ve, 2 cases 2.952941176 SEQ ID 583 12 110666479 110799506 133027 gain 2022 ACAD10, MAPKAPK5, C12orf47, ALDH2 Exon + ve, 2 cases 2.952941176 SEQ ID 584 12 110665203 110799506 134303 gain 1763 ACAD10, MAPKAPK5, C12orf47, ALDH2 Exon + ve, 2 cases 2.952941176 SEQ ID 585 10 118141035 118275679 134644 gain 2036 PNLIPRP3 Exon + ve, 2 cases 2.952941176 SEQ ID 586 11 51235737 51371826 136089 gain 1708 OR4C46, OR4A5 Exon + ve, 2 cases 2.952941176 SEQ ID 587 6 170616733 170753106 136373 gain 1729 TBP, PDCD2, PSMB1 Exon + ve, 2 cases 2.952941176 SEQ ID 588 16 68710277 68850394 140117 loss 1538 LOC729513, PDPR, AARS, EXOSC6, CLEC18C Exon + ve, 2 cases 2.952941176 SEQ ID 589 15 80222009 80364988 142979 gain 1354 EFTUD1, FAM154B Exon + ve, 2 cases 2.952941176 SEQ ID 590 1 199054239 199199515 145276 gain 1587 CAMSAP1L1, C1orf106, GPR25 Exon + ve, 2 cases 2.952941176 SEQ ID 590 1 199054239 199199515 145276 gain 1799 CAMSAP1L1, C1orf106, GPR25 Exon + ve, 2 cases 2.952941176 SEQ ID 591 1 246025834 246172497 146663 gain 2034 OR2L13, OR11L1, TRIM58, OR2T8, OR14A16, OR2W3 Exon + ve, 2 cases 2.952941176 SEQ ID 592 16 68710277 68859920 149643 loss 1793 LOC729513, PDPR, AARS, EXOSC6, CLEC18C Exon + ve, 2 cases 2.952941176 SEQ ID 593 19 20619921 20779347 159426 gain 1566 ZNF626 Exon + ve, 2 cases 2.952941176 SEQ ID 593 19 20619921 20779347 159426 gain 1761 ZNF626 Exon + ve, 2 cases 2.952941176 SEQ ID 594 3 59891946 60074208 182262 loss 1991 FHIT Exon + ve, 2 cases 2.952941176 SEQ ID 595 7 89622481 89820179 197698 gain 1274 STEAP1, GTPBP10, STEAP2, C7orf63 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 596 8 6718944 6926661 207717 gain 1572 DEFB1, DEFA10P, DEFT1P2, DEFA6, DEFA5, DEFA4, Exon + ve, 2 cases 2.952941176 DEFA3, DEFA1, DEFA1B, DEFT1P SEQ ID 597 9 134914697 135122604 207907 loss 1321 GBGT1, RALGDS, OBP2B, CEL, CELP, ABO, GTF3C5 Exon + ve, 2 cases 2.952941176 SEQ ID 598 19 63483128 63704294 221166 gain 1862 ZNF324B, ZNF446, LOC646862, ZNF324, ZNF8, ZNF497, Exon + ve, 2 cases 2.952941176 RPS5, ZNF584, ZNF837, SLC27A5, ZNF132, A1BG-AS1, ZSCAN22, A1BG SEQ ID 599 4 74035932 74268619 232687 gain 1347 COX18, ANKRD17 Exon + ve, 2 cases 2.952941176 SEQ ID 599 4 74035932 74268619 232687 gain 1945 COX18, ANKRD17 Exon + ve, 2 cases 2.952941176 SEQ ID 600 5 37174246 37411545 237299 gain 1765 NUP155, C5orf42 Exon + ve, 2 cases 2.952941176 SEQ ID 601 17 365082 612187 247105 gain 1494 VPS53, DBIL5P, FAM57A, GEMIN4, GLOD4 Exon + ve, 2 cases 2.952941176 SEQ ID 602 1 61661443 61911592 250149 gain 1828 NFIA Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 603 1 233499409 233769452 270043 gain 1466 B3GALNT2, ARID4B, TBCE, GGPS1 Exon + ve, 2 cases 2.952941176 SEQ ID 604 14 79195482 79484792 289310 loss 2036 NRXN3 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 605 6 165458835 165766046 307211 gain 1760 C6orf118, PDE10A Exon + ve, 2 cases 2.952941176 SEQ ID 606 8 6489869 6814347 324478 loss 1621 XKR5, DEFB1, DEFA10P, DEFA6, AGPAT5, DEFA4 Exon + ve, 2 cases 2.952941176 SEQ ID 607 4 186649665 186977002 327337 gain 1281 SORBS2, PDLIM3 Exon + ve, 2 cases 2.952941176 SEQ ID 608 3 76072 406838 330766 gain 1598 CHL1 Exon + ve, 2 cases 2.952941176 SEQ ID 609 19 47894889 48276273 381384 gain 1282 PSG11, LOC100289650, PSG10P, PSG8, PSG6, PSG7, Exon + ve, 2 cases 2.952941176 PSG2, PSG3, PSG1 SEQ ID 610 19 47894889 48279312 384423 gain 1281 PSG11, LOC100289650, PSG10P, PSG8, PSG6, PSG7, Exon + ve, 2 cases 2.952941176 PSG2, PSG3, PSG1 SEQ ID 611 X 32949940 33336759 386819 gain 1864 DMD Exon + ve, 2 cases 2.952941176 SEQ ID 612 5 13846827 14235806 388979 gain 1282 TRIO, DNAH5 Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 613 11 125616034 126095587 479553 gain 1713 DCPS, SRPR, FLJ39051, TIRAP, FAM118B, FOXRED1, Exon + ve, 2 cases 2.952941176 ST3GAL4, KIRREL3 SEQ ID 614 7 91113310 91618147 504837 loss 1734 MTERF, LOC401387, AKAP9, CYP51A1 Exon + ve, 2 cases 2.952941176 SEQ ID 615 10 44921903 45476905 555002 gain 1968 ANUBL1, ALOX5, LOC338579, LOC100133308, MIR3156-1, Exon + ve, 2 cases 2.952941176 OR13A1, MARCH8 SEQ ID 616 3 197412253 197977900 565647 gain 1565 PCYT1A, FBXO45, C3orf34, LRRC33, WDR53, TM4SF19- Exon + ve, 2 cases 2.952941176 TCTEX1D2, RNF168, ZDHHC19, OSTalpha, C3orf43, TM4SF19, PIGX, TCTEX1D2, UBXN7, PAK2 SEQ ID 617 4 188688388 189297555 609167 gain 1704 ZFP42, TRIML2, TRIML1 Exon + ve, 2 cases 2.952941176 SEQ ID 618 2 99091835 99871538 779703 gain 1461 MRPL30, LYG2, LIPT1, AFF3, MITD1, TXNDC9, TSGA10, Exon + ve, 2 cases 2.952941176 C2orf15, REV1, EIF5B, LYG1 SEQ ID 619 3 59354708 60181047 826339 gain 1936 FHIT Exon + ve, 2 cases 2.952941176 SEQ ID 620 7 47938912 48966480 1027568 loss 1886 UPP1, ABCA13, PKD1L1, HUS1, CDC14C, C7orf57, SUN3 Exon + ve, 2 cases 2.952941176 SEQ ID 621 1 60432403 61460047 1027644 gain 1396 NFIA Exon + ve, distinct 2.952941176 CNVs, same Gene SEQ ID 622 10 45478103 46558272 1080169 gain 1653 LOC643650, ANUBL1, GPRIN2, PTPN20B, PTPN20A, Exon + ve, 2 cases 2.952941176 FAM35B, LOC728643, FRMPD2P1, AGAP4, SYT15, BMS1P1, FAM21C, BMS1P5, PPYR1 SEQ ID 623 1 97323730 98426121 1102391 loss 1454 MIR137, DPYD Exon + ve, 2 cases 2.952941176 SEQ ID 624 3 227364 1488979 1261615 gain 1657 CHL1, CNTN6 Exon + ve, 2 cases 2.952941176 SEQ ID 625 15 26805834 28154955 1349121 loss 1994 LOC100289656, TJP1, APBA2, Exon + ve, 2 cases 2.952941176 NDNL2, LOC646278, FAM189A1 SEQ ID 626 16 80725035 82228276 1503241 gain 1875 CDH13, MIR3182, MPHOSPH6 Exon + ve, 2 cases 2.952941176 SEQ ID 627 10 45478103 47017598 1539495 gain 1408 GPRIN2, LOC643650, PTPN20B, PTPN20A, FAM35B, Exon + ve, 2 cases 2.952941176 FAM21C, SYT15, FAM25C, LOC728643, FAM25G, LOC642826, ANXA8, FAM35B2, ANXA8L1, FRMPD2P1, AGAP4, FAM25B, BMS1P1, AGAP9, BMS1P5, PPYR1, ANUBL1 SEQ ID 628 15 26805834 28439781 1633947 gain 1988 LOC100289656, TJP1, APBA2, FAM7A1, LOC653075, Exon + ve, 2 cases 2.952941176 DKFZP434L187, FAM7A2, FAM7A3, NDNL2, LOC646278, FAM189A1 SEQ ID 629 1 242999910 244841528 1841618 loss 1767 CNST, TFB2M, HNRNPU, KIF26B, NCRNA00201, FAM36A, Exon + ve, 2 cases 2.952941176 SMYD3, EFCAB2 SEQ ID 630 4 188089090 190030740 1941650 gain 1691 LOC401164, ZFP42, TRIML2, TRIML1 Exon + ve, 2 cases 2.952941176 SEQ ID 631 20 26080750 28252024 2171274 gain 1694 MIR663, FRG1B Exon + ve, 2 cases 2.952941176 SEQ ID 632 11 51235737 54785063 3549326 gain 1943 OR4C46, OR4A5 Exon + ve, 2 cases 2.952941176 SEQ ID 633 X 48171740 52710629 4538889 gain 1349 SSX7, SSX8, ERAS, PPP1R3F, GAGE1, WAS, XAGE2B, Exon + ve, 2 cases 2.952941176 GAGE5, GAGE4, CACNA1F, GAGE6, GATA1, NUDT10, SLC38A5, TFE3, PORCN, GAGE2D, GAGE2E, GAGE2A, GAGE2B, GAGE2C, GAGE12J, MAGIX, AKAP4, MAGED1, MAGED4, PQBP1, LOC347376, FOXP3, XAGE1D, PAGE4, PAGE1, WDR45, CCDC120, FTSJ1, SYP, TBC1D25, MIR532, GSPT2, GAGE8, GLOD5, XAGE2, HDAC6, OTUD5, PRAF2, SHROOM4, PLP2, GPKOW, MIR500A, MIR500B, LOC158572, CENPVL1, LOC441495, MIR188, GAGE12H, GAGE12I, MIR660, GRIPAP1, GAGE12B, GAGE12C, GAGE12D, GAGE12E, GAGE12F, GAGE12G, MIR502, MIR501, WDR13, RBM3, CCDC22, BMP15, TIMM17B, PRICKLE3, DGKK, KCND1, XAGE1A, XAGE1B, XAGE1C, PIM2, XAGE1E, SUV39H1, USP27X, SLC35A2, CLCN5, GAGE7, CCNB3, MIR362, PCSK1N, SNORA11E, SNORA11D, GAGE10, GAGE13, NUDT11, EBP, MAGED4B SEQ ID 634 19 62653275 62660645 7370 loss 1522 VN1R1 Exon + ve, 2 cases 1.474302496 SEQ ID 635 15 56031543 56044966 13423 loss 1680 ALDH1A2 Exon + ve, distinct 1.474302496 CNVs, same Gene SEQ ID 636 11 99646264 99660303 14039 loss 1936 CNTN5 Special 1.474302496 SEQ ID 637 11 70167828 70217957 50129 loss 1835 SHANK2 Special 1.474302496 SEQ ID 638 X 151730135 151853605 123470 gain 1887 ZNF185, CETN2, NSDHL Exon + ve, 2 cases 1.474302496 SEQ ID 639 2 50421622 50908053 486431 loss 1597 NRXN1 Exon + ve, distinct 1.474302496 CNVs, same Gene SEQ ID 640 3 2389001 2955718 566717 gain 1851 CNTN4 Special 1.474302496 SEQ ID 641 1 244191230 244851275 660045 gain 1819 TFB2M, CNST, SMYD3 Exon + ve, 2 cases 1.474302496 SEQ ID 642 X 96492941 97405356 912415 gain 1348 DIAPH2 Exon + ve, 2 cases 1.474302496 SEQ ID 643 17 26847029 26870510 23481 loss 1411 RAB11FIP4 Special 1.474302496 * Position references refer to the human genomic sequence Hg18 March 2006 (NCBI Build 36.1)
[0222] Table 1 lists all CNVs of interest, obtained as described in the text. For each entry, the originating CNV start and stop positions are noted, along with CNV size, CNV type (loss or gain), gene annotation (for original CNV), category of interest, and Odds Ratio (OR). The table also includes SEQ IDs for the CNVs in the range SEQ ID 1-SEQ ID 643. CNVs that are identical between different ASD subjects are grouped into a single SEQ ID. Each SEQ ID refers to a numbered sequence in file 33655-708.202_PDx_SK_ST25.txt. De novo refers to CNVs found to occur in the offspring of two parents, neither of whom has the relevant CNV; Intronic refers to CNV subregions affecting introns only; Ctrl pos High OR refers to CNVs which include regions present at high frequency in the ASD cohort cf. normal cohort; Exon+ve, distinct CNVs, same Gene refers to CNVs in 2 or more ASD individuals affecting different exons of the same gene; Exon+ve, 2 cases refers to CNVs in 2 or more ASD individuals affecting the same exon of a gene; Special refers to CNVs added to the list because of relationship to genes with strong biological evidence in ASD; OR refers to the odds ratio calculation for the candidate CNV. The OR is calculated by grouping together all cases with an identical CNV/CNV subregion, and comparing it to the frequency of the same CNV/CNV subregion in the normal cohort. The calculation is performed as follows: (ASD A/682-ASD A)/(NVE A/1,005-NVE A), where ASD A=number of ASD cases with the CNV and NVE A=number of normals with the CNV. In those cases for which no normals possess the CNV of interest, NVE A is set to 1 by convention. For example, the OR calculation for the MAOA Intronic CNV is as follows: OR=(26/682-26)/(1/1005-1)=(26/656)/(1/1004)=39.79268293.
[0223] Column 3 refers to the nucleotide position in the respective chromosome (column 2) where the corresponding CNV begins and column 4 refers to the nucleotide position in the respective chromosome where the corresponding CNV ends. Column 5 refers to the length/size of the CNV in bps. Nucleotide positions were determined using the database Hg18 Mar. 2006 (NCBI Build 36.1). The CNV classifications (column 6) of gain or loss indicate whether each CNV region found in the subjects was duplicated/amplified (gain) or deleted (loss) in the genome.
TABLE-US-00002 TABLE 2 CNV CNV CNV ASD Subregion Subregion Subregion CNV Case Exon Chr Start Stop Size type ID(s) RefSeq Gene Symbol(s) Category overlap 1 3752549 3754045 1496 loss 1426 KIAA0562 Exon + ve, 2 cases Yes 1 3752549 3754045 1496 loss 1439 KIAA0562 Exon + ve, 2 cases Yes 1 3752549 3754045 1496 loss 1441 KIAA0562 Exon + ve, 2 cases Yes 1 3752549 3754045 1496 loss 1912 KIAA0562 Exon + ve, 2 cases Yes 1 16563070 16569903 6833 gain 1995 Clorf144 Exon + ve, distinct Yes CNVs, same Gene 1 16578594 16591820 13226 loss 1315 Clorf144 Exon + ve, distinct Yes CNVs, same Gene 1 19054398 19061530 7132 gain 1502 TAS1R2 Exon + ve, 2 cases Yes 1 19054398 19061530 7132 loss 1940 TAS1R2 Exon + ve, 2 cases Yes 1 22787161 22788440 1279 loss 1278 EPHA8 Exon + ve, 2 cases Yes 1 22787161 22788440 1279 loss 1687 EPHA8 Exon + ve, 2 cases Yes 1 22787161 22788440 1279 loss 1895 EPHA8 Exon + ve, 2 cases Yes 1 47551915 47557441 5526 loss 1591 STIL Exon + ve, 2 cases Yes 1 47551915 47557441 5526 loss 1759 STIL Exon + ve, 2 cases Yes 1 61097736 61359814 262078 gain 1396 NFIA Exon + ve, distinct Yes CNVs, same Gene 1 61661443 61707075 45632 gain 1828 NFIA Exon + ve, distinct Yes CNVs, same Gene 1 65729501 65793446 63945 gain 1252 LEPR Exon + ve, 2 cases Yes 1 65729501 65793446 63945 gain 1920 LEPR Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1266 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1283 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1284 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1308 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1309 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1354 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1413 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1418 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1433 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1449 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1451 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1640 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1781 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1815 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1818 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1929 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 1994 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 2031 COL24A1 Exon + ve, 2 cases Yes 1 85964576 85967615 3039 loss 2040 COL24A1 Exon + ve, 2 cases Yes 1 91632025 91632374 349 loss 1582 HFM1 Exon + ve, 2 cases Yes 1 91632025 91632374 349 loss 1687 HFM1 Exon + ve, 2 cases Yes 1 91632025 91632374 349 loss 1929 HFM1 Exon + ve, 2 cases Yes 1 91632025 91632374 349 loss 2045 HFM1 Exon + ve, 2 cases Yes 1 91946409 91948225 1816 gain 1405 TGFBR3 Exon + ve, 2 cases Yes 1 91946409 91948225 1816 loss 1656 TGFBR3 Exon + ve, 2 cases Yes 1 91946409 91948225 1816 loss 2043 TGFBR3 Exon + ve, 2 cases Yes 1 93492660 93495455 2795 gain 1832 CCDC18 Exon + ve, 2 cases Yes 1 93492660 93495455 2795 gain 2032 CCDC18 Exon + ve, 2 cases Yes 1 94113132 94115121 1989 loss 1233 DNTTIP2 Exon + ve, 2 cases Yes 1 94113132 94115121 1989 loss 1802 DNTTIP2 Exon + ve, 2 cases Yes 1 94113132 94115121 1989 loss 1904 DNTTIP2 Exon + ve, 2 cases Yes 1 94115123 94116506 1383 loss 1233 DNTTIP2 Exon + ve, 2 cases Yes 1 94115123 94116506 1383 loss 1782 DNTTIP2 Exon + ve, 2 cases Yes 1 94115123 94116506 1383 loss 1802 DNTTIP2 Exon + ve, 2 cases Yes 1 97937667 97947671 10004 loss 1221 DPYD Exon + ve, 2 cases Yes 1 97937667 97947671 10004 loss 1454 DPYD Exon + ve, 2 cases Yes 1 110102580 110114121 11541 loss 1680 EPS8L3 Exon + ve, 2 cases Yes 1 110102580 110114121 11541 loss 1802 EPS8L3 Exon + ve, 2 cases Yes 1 144099302 144337286 237984 gain 1599 RNF115, RBM8A, GNRHR2, HFE2, Exon + ve, 2 cases Yes ANKRD34A, LIX1L, POLR3GL, ANKRD35, ITGA10, PEX11B, NUDT17, TXNIP, POLR3C, PIAS3 1 144099302 144337286 237984 loss 1874 RNF115, RBM8A, GNRHR2, HFE2, Exon + ve, 2 cases Yes ANKRD34A, LIX1L, POLR3GL, ANKRD35, ITGA10, PEX11B, NUDT17, TXNIP, POLR3C, PIAS3 1 144099302 144337286 237984 gain 1968 RNF115, RBM8A, GNRHR2, HFE2, Exon + ve, 2 cases Yes ANKRD34A, LIX1L, POLR3GL, ANKRD35, ITGA10, PEX11B, NUDT17, TXNIP, POLR3C, PIAS3 1 149957941 149964885 6944 loss 1867 RIIAD1 Exon + ve, 2 cases Yes 1 149957941 149964885 6944 loss 2033 RIIAD1 Exon + ve, 2 cases Yes 1 151040464 151045964 5500 gain 1223 LCE1C Exon + ve, 2 cases Yes 1 151040464 151045964 5500 gain 1587 LCE1C Exon + ve, 2 cases Yes 1 151040464 151045964 5500 gain 1664 LCE1C Exon + ve, 2 cases Yes 1 151040464 151045964 5500 gain 1695 LCE1C Exon + ve, 2 cases Yes 1 151040464 151045964 5500 gain 1740 LCE1C Exon + ve, 2 cases Yes 1 151040464 151045964 5500 gain 1936 LCE1C Exon + ve, 2 cases Yes 1 156784465 156785660 1195 loss 1858 OR6Y1 Exon + ve, 2 cases Yes 1 156784465 156785660 1195 loss 1877 OR6Y1 Exon + ve, 2 cases Yes 1 177589995 177591659 1664 loss 1372 SOAT1 Exon + ve, 2 cases Yes 1 177589995 177591659 1664 loss 1635 SOAT1 Exon + ve, 2 cases Yes 1 179250547 179263983 13436 loss 1638 STX6 Exon + ve, 2 cases Yes 1 179250547 179263983 13436 loss 1659 STX6 Exon + ve, 2 cases Yes 1 179250547 179263983 13436 loss 1662 STX6 Exon + ve, 2 cases Yes 1 179250547 179263983 13436 loss 1950 STX6 Exon + ve, 2 cases Yes 1 179263984 179269450 5466 loss 1638 MR1 Exon + ve, 2 cases Yes 1 179263984 179269450 5466 loss 1659 MR1 Exon + ve, 2 cases Yes 1 199054239 199082294 28055 gain 1587 CAMSAP1L1 Exon + ve, 2 cases Yes 1 199054239 199082294 28055 gain 1799 CAMSAP1L1 Exon + ve, 2 cases Yes 1 199149079 199185984 36905 gain 1587 Clorf106 Exon + ve, 2 cases Yes 1 199149079 199185984 36905 gain 1799 Clorf106 Exon + ve, 2 cases Yes 1 201194532 201202914 8382 loss 1572 CYB5R1 Exon + ve, 2 cases Yes 1 201194532 201202914 8382 loss 1687 CYB5R1 Exon + ve, 2 cases Yes 1 206023029 206024152 1123 loss 1724 CD46 Exon + ve, 2 cases Yes 1 206023029 206024152 1123 loss 1843 CD46 Exon + ve, 2 cases Yes 1 206054159 206076352 22193 loss 1638 LOC148696 Exon + ve, 2 cases Yes 1 206054159 206076352 22193 loss 1659 LOC148696 Exon + ve, 2 cases Yes 1 226069732 226072012 2280 loss 1234 PRSS38 Exon + ve, 2 cases Yes 1 226069732 226072012 2280 loss 1344 PRSS38 Exon + ve, 2 cases Yes 1 226069732 226072012 2280 loss 1371 PRSS38 Exon + ve, 2 cases Yes 1 226069732 226072012 2280 loss 1653 PRSS38 Exon + ve, 2 cases Yes 1 233582552 233602295 19743 gain 1466 TBCE Exon + ve, 2 cases Yes 1 233582552 233602295 19743 loss 1720 TBCE Exon + ve, 2 cases Yes 1 243768850 243772832 3982 loss 1767 KIF26B Exon + ve, 2 cases Yes 1 243768850 243772832 3982 loss 1840 KIF26B Exon + ve, 2 cases Yes 1 244768366 244771085 2719 loss 1767 TFB2M Exon + ve, 2 cases Yes 1 244768366 244771085 2719 gain 1819 TFB2M Exon + ve, 2 cases Yes 1 246138090 246162296 24206 gain 1798 OR2T8 Exon + ve, 2 cases Yes 1 246138090 246162296 24206 gain 2034 OR2T8 Exon + ve, 2 cases Yes 2 1469952 1472562 2610 loss 1510 TPO Exon + ve, 2 cases Yes 2 1469952 1472562 2610 loss 1564 TPO Exon + ve, 2 cases Yes 2 1469952 1472562 2610 loss 1639 TPO Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1256 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1285 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1307 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1370 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1396 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1415 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1616 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1654 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1830 C2orf48 Exon + ve, 2 cases Yes 2 10263146 10272210 9064 loss 1931 C2orf48 Exon + ve, 2 cases Yes 2 30306530 30308506 1976 loss 1429 LBH Exon + ve, 2 cases Yes 2 30306530 30308506 1976 loss 1884 LBH Exon + ve, 2 cases Yes 2 31279154 31321453 42299 loss 1544 CAPN14, EHD3 Exon + ve, 2 cases Yes 2 31279154 31321453 42299 loss 1929 CAPN14, EHD3 Exon + ve, 2 cases Yes 2 43857496 43862163 4667 loss 1688 DYNC2LI1 Exon + ve, 2 cases Yes 2 43857496 43862163 4667 loss 1786 DYNC2LI1 Exon + ve, 2 cases Yes 2 43857496 43862163 4667 loss 1790 DYNC2LI1 Exon + ve, 2 cases Yes 2 44403707 44406514 2807 loss 1504 PREPL Exon + ve, 2 cases Yes 2 44403707 44406514 2807 gain 1826 PREPL Exon + ve, 2 cases Yes 2 48603879 48627703 23824 gain 1276 STON1-GTF2A1L, STON1 Exon + ve, distinct Yes CNVs, same Gene 2 48666246 48676336 10090 gain 1386 STON1-GTF2A1L, STON1 Exon + ve, distinct Yes CNVs, same Gene 2 50421622 50452128 30506 loss 1597 NRXN1 Exon + ve, distinct Yes CNVs, same Gene 2 50458654 50639069 180415 loss 1597 NRXN1 Exon + ve, distinct Yes CNVs, same Gene 2 50642430 50722328 79898 loss 1597 NRXN1 Exon + ve, distinct Yes CNVs, same Gene 2 73706727 73732302 25575 gain 1369 NAT8, ALMS1P Exon + ve, 2 cases Yes 2 73706727 73732302 25575 loss 1551 NAT8, ALMS1P Exon + ve, 2 cases Yes 2 73706727 73732302 25575 gain 1626 NAT8, ALMS1P Exon + ve, 2 cases Yes 2 73706727 73732302 25575 loss 1728 NAT8, ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 gain 1369 ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 gain 1533 ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 loss 1551 ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 gain 1626 ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 loss 1728 ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 loss 1738 ALMS1P Exon + ve, 2 cases Yes 2 73732303 73764497 32194 gain 1887 ALMS1P Exon + ve, 2 cases Yes 2 73764498 73766459 1961 gain 1533 ALMS1P Exon + ve, 2 cases Yes 2 73764498 73766459 1961 loss 1551 ALMS1P Exon + ve, 2 cases Yes 2 73764498 73766459 1961 loss 1728 ALMS1P Exon + ve, 2 cases Yes 2 73764498 73766459 1961 loss 1738 ALMS1P Exon + ve, 2 cases Yes 2 73764498 73766459 1961 gain 1887 ALMS1P Exon + ve, 2 cases Yes 2 99109502 99129872 20370 gain 1461 TSGA10, C2orf15 Exon + ve, 2 cases Yes 2 99109502 99129872 20370 gain 1466 TSGA10, C2orf15 Exon + ve, 2 cases Yes 2 99134855 99165006 30151 gain 1461 TSGA10, MRPL30, MITD1, LIPT1 Exon + ve, 2 cases Yes 2 99134855 99165006 30151 gain 1466 TSGA10, MRPL30, MITD1, LIPT1 Exon + ve, 2 cases Yes 2 106174179 106177686 3507 loss 1505 UXS1 Exon + ve, 2 cases Yes 2 106174179 106177686 3507 loss 1611 UXS1 Exon + ve, 2 cases Yes 2 106174179 106177686 3507 loss 1697 UXS1 Exon + ve, 2 cases Yes 2 106784966 106787143 2177 loss 1592 ST6GAL2 Exon + ve, 2 cases Yes 2 106784966 106787143 2177 loss 1720 ST6GAL2 Exon + ve, 2 cases Yes 2 125082384 125084599 2215 gain 1532 CNTNAP5 Exon + ve, 2 cases Yes 2 125082384 125084599 2215 gain 1803 CNTNAP5 Exon + ve, 2 cases Yes 2 135704927 135712021 7094 gain 1451 ZRANB3 Exon + ve, 2 cases Yes 2 135704927 135712021 7094 loss 1512 ZRANB3 Exon + ve, 2 cases Yes 2 135704927 135712021 7094 loss 1574 ZRANB3 Exon + ve, 2 cases Yes 2 135704927 135712021 7094 loss 1757 ZRANB3 Exon + ve, 2 cases Yes 2 135704927 135712021 7094 gain 1970 ZRANB3 Exon + ve, 2 cases Yes 2 143888582 143915868 27286 loss 1677 ARHGAP15 Exon + ve, 2 cases Yes 2 143888582 143915868 27286 gain 1750 ARHGAP15 Exon + ve, 2 cases Yes 2 179837050 179838443 1393 loss 1425 SESTD1 Exon + ve, 2 cases Yes 2 179837050 179838443 1393 loss 1727 SESTD1 Exon + ve, 2 cases Yes 2 201713188 201714627 1439 gain 1344 CFLAR Exon + ve, 2 cases Yes 2 201713188 201714627 1439 gain 1824 CFLAR Exon + ve, 2 cases Yes 2 201713188 201714627 1439 gain 1841 CFLAR Exon + ve, 2 cases Yes 2 201713188 201714627 1439 gain 1927 CFLAR Exon + ve, 2 cases Yes 2 201773817 201783547 9730 loss 1534 CASP10 Exon + ve, 2 cases Yes 2 201773817 201783547 9730 gain 1943 CASP10 Exon + ve, 2 cases Yes 2 206586117 206590636 4519 gain 1220 INO80D Exon + ve, 2 cases Yes 2 206586117 206590636 4519 gain 1803 INO80D Exon + ve, 2 cases Yes 2 206586117 206590636 4519 gain 1921 INO80D Exon + ve, 2 cases Yes 2 206586117 206590636 4519 gain 1988 INO80D Exon + ve, 2 cases Yes 2 206586117 206590636 4519 gain 2028 INO80D Exon + ve, 2 cases Yes 2 206590637 206592116 1479 gain 1803 INO80D Exon + ve, 2 cases Yes 2 206590637 206592116 1479 gain 1921 INO80D Exon + ve, 2 cases Yes 2 206590637 206592116 1479 gain 1988 INO80D Exon + ve, 2 cases Yes 2 206590637 206592116 1479 gain 2028 INO80D Exon + ve, 2 cases Yes 2 213900382 213922938 22556 loss 1832 SPAG16 Exon + ve, distinct Yes CNVs, same Gene 2 213922938 213932901 9963 loss 1870 SPAG16 Exon + ve, distinct Yes CNVs, same Gene 2 213933570 213938010 4440 loss 1870 SPAG16 Exon + ve, distinct Yes CNVs, same Gene 2 214585717 214586936 1219 loss 1512 SPAG16 Exon + ve, 2 cases Yes 2 214585717 214586936 1219 loss 1636 SPAG16 Exon + ve, 2 cases Yes 2 214586937 214599105 12168 loss 1636 SPAG16 Exon + ve, distinct Yes CNVs, same Gene 2 218849164 218852974 3810 gain 1284 PNKD, TMBIM1 Exon + ve, 2 cases Yes 2 218849164 218852974 3810 gain 1660 PNKD, TMBIM1 Exon + ve, 2 cases Yes 2 218849164 218852974 3810 gain 1728 PNKD, TMBIM1 Exon + ve, 2 cases Yes 2 218849164 218852974 3810 gain 2024 PNKD, TMBIM1 Exon + ve, 2 cases Yes 2 218967950 218971707 3757 loss 1721 SLC11A1 Exon + ve, 2 cases Yes 2 218967950 218971707 3757 loss 1993 SLC11A1 Exon + ve, 2 cases Yes 2 218972429 218975318 2889 loss 1718 CTDSP1 Exon + ve, 2 cases Yes 2 218972429 218975318 2889 loss 1721 CTDSP1 Exon + ve, 2 cases Yes 2 218972429 218975318 2889 loss 1913 CTDSP1 Exon + ve, 2 cases Yes 2 218972429 218975318 2889 loss 1993 CTDSP1 Exon + ve, 2 cases Yes 2 218975319 218978243 2924 loss 1718 MIR26B, CTDSP1 Exon + ve, 2 cases Yes 2 218975319 218978243 2924 loss 1721 MIR26B, CTDSP1 Exon + ve, 2 cases Yes 2 218975319 218978243 2924 loss 1993 MIR26B, CTDSP1 Exon + ve, 2 cases Yes 2 218978244 218978839 595 loss 1721 CTDSP1 Exon + ve, 2 cases Yes 2 218978244 218978839 595 loss 1993 CTDSP1 Exon + ve, 2 cases Yes 3 404591 406838 2247 gain 1598 CHL1 Exon + ve, 2 cases Yes 3 404591 406838 2247 gain 1657 CHL1 Exon + ve, 2 cases Yes 3 2548711 2645342 96631 gain 1851 CNTN4 Special Yes 3 9720244 9722646 2402 gain 1264 CPNE9 Exon + ve, 2 cases Yes 3 9720244 9722646 2402 gain 1587 CPNE9 Exon + ve, 2 cases Yes 3 9720244 9722646 2402 gain 1618 CPNE9 Exon + ve, 2 cases Yes 3 10210951 10217019 6068 loss 1247 IRAK2 Exon + ve, distinct Yes CNVs, same Gene 3 10249256 10254819 5563 loss 1920 IRAK2 Exon + ve, distinct Yes CNVs, same Gene 3 33868917 33871822 2905 loss 1259 PDCD6IP Exon + ve, 2 cases Yes 3 33868917 33871822 2905 loss 1274 PDCD6IP Exon + ve, 2 cases Yes 3 33868917 33871822 2905 loss 1724 PDCD6IP Exon + ve, 2 cases Yes 3 38415026 38417567 2541 loss 1725 XYLB Exon + ve, 2 cases Yes 3 38415026 38417567 2541 loss 1802 XYLB Exon + ve, 2 cases Yes 3 46687043 46690457 3414 loss 1318 ALS2CL Exon + ve, 2 cases Yes 3 46687043 46690457 3414 loss 1834 ALS2CL Exon + ve, 2 cases Yes 3 48603483 48611409 7926 loss 1428 COL7A1, UQCRC1 Exon + ve, 2 cases Yes 3 48603483 48611409 7926 loss 1969 COL7A1, UQCRC1 Exon + ve, 2 cases Yes 3 48603483 48611409 7926 loss 2035 COL7A1, UQCRC1 Exon + ve, 2 cases Yes 3 48611410 48667744 56334 loss 1969 TMEM89, CELSR3, SLC26A6, UQCRC1 Exon + ve, 2 cases Yes 3 48611410 48667744 56334 loss 2035 TMEM89, CELSR3, SLC26A6, UQCRC1 Exon + ve, 2 cases Yes 3 54504338 54514944 10606 gain 1293 CACNA2D3 Exon + ve, 2 cases Yes 3 54504338 54514944 10606 gain 1921 CACNA2D3 Exon + ve, 2 cases Yes 3 58161589 58171419 9830 gain 1267 DNASE1L3 Exon + ve, 2 cases Yes 3 58161589 58171419 9830 gain 1268 DNASE1L3 Exon + ve, 2 cases Yes 3 58161589 58171419 9830 gain 1354 DNASE1L3 Exon + ve, 2 cases Yes 3 59891946 60045382 153436 gain 1936 FHIT Exon + ve, 2 cases Yes 3 59891946 60045382 153436 loss 1991 FHIT Exon + ve, 2 cases Yes 3 64479002 64486008 7006 loss 1428 ADAMTS9 Exon + ve, 2 cases Yes 3 64479002 64486008 7006 loss 1434 ADAMTS9 Exon + ve, 2 cases Yes 3 64479002 64486008 7006 loss 1572 ADAMTS9 Exon + ve, 2 cases Yes 3 64479002 64486008 7006 loss 1592 ADAMTS9 Exon + ve, 2 cases Yes 3 64479002 64486008 7006 loss 1763 ADAMTS9 Exon + ve, 2 cases Yes 3 96161892 96165551 3659 loss 1619 LOC255025 Exon + ve, 2 cases Yes 3 96161892 96165551 3659 loss 1624 LOC255025 Exon + ve, 2 cases Yes 3 155353325 155355022 1697 gain 1371 ARHGEF26 Exon + ve, distinct Yes CNVs, same Gene 3 155389583 155391992 2409 gain 1446 ARHGEF26 Exon + ve, distinct Yes CNVs, same Gene 3 197276556 197285789 9233 gain 1227 TFRC Exon + ve, 2 cases Yes 3 197276556 197285789 9233 gain 1565 TFRC Exon + ve, 2 cases Yes 3 197289125 197410852 121727 gain 1227 LOC401109, TFRC, ZDHHC19 Exon + ve, 2 cases Yes 3 197289125 197410852 121727 gain 1565 LOC401109, TFRC, ZDHHC19 Exon + ve, 2 cases Yes 3 197516474 197531031 14557 gain 1227 TCTEX1D2, TM4SF19-TCTEX1D2 Exon + ve, 2 cases Yes 3 197516474 197531031 14557 gain 1565 TCTEX1D2, TM4SF19-TCTEX1D2 Exon + ve, 2 cases Yes 3 197537870 197560934 23064 gain 1565 TM4SF19, TM4SF19-TCTEX1D2 Exon + ve, 2 cases Yes 3 197537870 197560934 23064 gain 1775 TM4SF19, TM4SF19-TCTEX1D2 Exon + ve, 2 cases Yes 3 197712985 197736785 23800 loss 1546 RNF168, C3orf43 Exon + ve, 2 cases Yes 3 197712985 197736785 23800 gain 1565 RNF168, C3orf43 Exon + ve, 2 cases Yes 3 197848634 197857567 8933 loss 1285 LRRC33 Exon + ve, 2 cases Yes 3 197848634 197857567 8933 gain 1565 LRRC33 Exon + ve, 2 cases Yes 3 197848634 197857567 8933 loss 1909 LRRC33 Exon + ve, 2 cases Yes 3 197848634 197857567 8933 loss 2030 LRRC33 Exon + ve, 2 cases Yes 4 20161068 20161847 779 loss 1426 SLIT2 Exon + ve, 2 cases Yes 4 20161068 20161847 779 loss 1528 SLIT2 Exon + ve, 2 cases Yes 4 20161068 20161847 779 loss 1665 SLIT2 Exon + ve, 2 cases Yes 4 20161068 20161847 779 loss 1667 SLIT2 Exon + ve, 2 cases Yes 4 20161068 20161847 779 loss 1671 SLIT2 Exon + ve, 2 cases Yes 4 39829776 39834522 4746 loss 1883 N4BP2 Exon + ve, 2 cases Yes 4 39829776 39834522 4746 loss 1947 N4BP2 Exon + ve, 2 cases Yes 4 44319603 44327596 7993 loss 1487 YIPF7 Exon + ve, 2 cases Yes 4 44319603 44327596 7993 loss 1659 YIPF7 Exon + ve, 2 cases Yes 4 47314693 47335844 21151 loss 1308 CORIN Exon + ve, distinct Yes CNVs, same Gene 4 47358255 47359575 1320 gain 1252 CORIN Exon + ve, 2 cases Yes 4 47358255 47359575 1320 gain 1658 CORIN Exon + ve, 2 cases Yes 4 47359576 47361851 2275 gain 1252 CORIN Exon + ve, distinct Yes CNVs, same Gene 4 56070868 56072258 1390 loss 1529 CLOCK Exon + ve, 2 cases Yes 4 56070868 56072258 1390 loss 1738 CLOCK Exon + ve, 2 cases Yes 4 68168394 68172597 4203 loss 1221 UBA6 Exon + ve, 2 cases Yes 4 68168394 68172597 4203 loss 1222 UBA6 Exon + ve, 2 cases Yes 4 70523201 70551081 27880 loss 1285 UGT2A2, UGT2A1 Exon + ve, 2 cases Yes 4 70523201 70551081 27880 loss 1433 UGT2A2, UGT2A1 Exon + ve, 2 cases Yes 4 74035932 74268619 232687 gain 1347 COX18, ANKRD17 Exon + ve, 2 cases Yes 4 74035932 74268619 232687 gain 1945 COX18, ANKRD17 Exon + ve, 2 cases Yes 4 74504402 74511880 7478 loss 1373 ALB Exon + ve, 2 cases Yes 4 74504402 74511880 7478 loss 1464 ALB Exon + ve, 2 cases Yes 4 74504402 74511880 7478 loss 1798 ALB Exon + ve, 2 cases Yes 4 74504402 74511880 7478 loss 1852 ALB Exon + ve, 2 cases Yes 4 74504402 74511880 7478 loss 1959 ALB Exon + ve, 2 cases Yes 4 99104657 99112516 7859 gain 1489 C4orf37 Exon + ve, distinct Yes CNVs, same Gene 4 99278436 99382350 103914 loss 1534 C4orf37 Exon + ve, distinct Yes CNVs, same Gene 4 100955189 100969192 14003 gain 1462 DAPP1 Exon + ve, 2 cases Yes 4 100955189 100969192 14003 gain 1913 DAPP1 Exon + ve, 2 cases Yes 4 100980535 101000511 19976 gain 1462 DAPP1 Exon + ve, 2 cases Yes 4 100980535 101000511 19976 gain 1913 DAPP1 Exon + ve, 2 cases Yes 4 101572938 101587882 14944 gain 1752 EMCN Exon + ve, 2 cases Yes 4 101572938 101587882 14944 gain 1867 EMCN Exon + ve, 2 cases Yes 4 107311633 107316223 4590 loss 1280 TBCK Exon + ve, 2 cases Yes 4 107311633 107316223 4590 loss 1933 TBCK Exon + ve, 2 cases Yes 4 149047165 149047423 258 loss 1498 ARHGAP10 Exon + ve, 2 cases Yes 4 149047165 149047423 258 loss 1916 ARHGAP10 Exon + ve, 2 cases Yes 4 186681554 186689469 7915 gain 1281 PDLIM3 Exon + ve, 2 cases Yes 4 186681554 186689469 7915 loss 1458 PDLIM3 Exon + ve, 2 cases Yes 4 189296361 189297555 1194 gain 1691 TRIML1 Exon + ve, 2 cases Yes 4 189296361 189297555 1194 gain 1704 TRIML1 Exon + ve, 2 cases Yes 4 191041482 191133608 92126 gain 1230 FRG1 Exon + ve, 2 cases Yes 4 191041482 191133608 92126 gain 1292 FRG1 Exon + ve, 2 cases Yes 4 191041482 191133608 92126 gain 1411 FRG1 Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1438 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1619 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1629 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1630 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1666 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1850 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 1998 ANKRD33B Exon + ve, 2 cases Yes 5 10688337 10691335 2998 loss 2026 ANKRD33B Exon + ve, 2 cases Yes 5 14184901 14235806 50905 gain 1282 TRIO Exon + ve, distinct Yes CNVs, same Gene 5 14333156 14334923 1767 gain 1417 TRIO Exon + ve, distinct Yes CNVs, same Gene 5 37398626 37405778 7152 loss 1426 NUP155 Exon + ve, 2 cases Yes 5 37398626 37405778 7152 gain 1765 NUP155 Exon + ve, 2 cases Yes 5 89477991 90081196 603205 gain 1786 LYSMD3, POLR3G, CETN3, MBLAC2, Exon + ve, 2 cases Yes GPR98 5 89477991 90081196 603205 gain 1886 LYSMD3, POLR3G, CETN3, MBLAC2, Exon + ve, 2 cases Yes GPR98 5 90081197 90084436 3239 gain 1489 GPR98 Exon + ve, 2 cases Yes 5 90081197 90084436 3239 gain 1786 GPR98 Exon + ve, 2 cases Yes 5 90081197 90084436 3239 gain 1886 GPR98 Exon + ve, 2 cases Yes 5 90084437 90142704 58267 gain 1786 GPR98 Exon + ve, 2 cases Yes 5 90084437 90142704 58267 gain 1886 GPR98 Exon + ve, 2 cases Yes 5 95183456 95189721 6265 gain 1281 GLRX Exon + ve, 2 cases Yes 5 95183456 95189721 6265 gain 1824 GLRX Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1224 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1548 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1552 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1681 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1740 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1763 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1786 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1807 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1880 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1881 PRDM6 Exon + ve, 2 cases Yes 5 122534134 122535395 1261 loss 1915 PRDM6 Exon + ve, 2 cases Yes 5 128326107 128331280 5173 loss 1248 SLC27A6 Exon + ve, 2 cases Yes 5 128326107 128331280 5173 loss 1699 SLC27A6 Exon + ve, 2 cases Yes 5 150506984 150518075 11091 loss 1433 ANXA6 Exon + ve, 2 cases Yes 5 150506984 150518075 11091 loss 1942 ANXA6 Exon + ve, 2 cases Yes 5 180189516 180365977 176461 Loss 1532 BTNL3 Ctrl pos High OR Yes 5 180189516 180365977 176461 Loss 1612 BTNL3 Ctrl pos High OR Yes 5 180189516 180365977 176461 Loss 1686 BTNL3 Ctrl pos High OR Yes 5 180189516 180192213 2697 loss 1229 LOC729678 Exon + ve, 2 cases Yes 5 180189516 180192213 2697 loss 1532 LOC729678 Exon + ve, 2 cases Yes 5 180189516 180192213 2697 loss 1548 LOC729678 Exon + ve, 2 cases Yes 5 180189516 180192213 2697 loss 1612 LOC729678 Exon + ve, 2 cases Yes 5 180189516 180192213 2697 loss 1686 LOC729678 Exon + ve, 2 cases Yes 5 180189516 180192213 2697 loss 1861 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180365977 173763 Loss 1606 BTNL3 Ctrl pos High OR Yes 5 180192214 180194322 2108 loss 1229 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 gain 1316 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1532 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1548 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1580 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1606 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1612 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1641 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1686 LOC729678 Exon + ve, 2 cases Yes 5 180192214 180194322 2108 loss 1861 LOC729678 Exon + ve, 2 cases Yes 5 180194323 180378586 184263 Loss 1429 BTNL3 Ctrl pos High OR Yes 5 180194323 180365977 171654 Loss 1546 BTNL3 Ctrl pos High OR Yes 5 180194323 180378586 184263 Loss 1634 BTNL3 Ctrl pos High OR Yes 5 180194323 180365977 171654 Loss 1696 BTNL3 Ctrl pos High OR Yes 5 180194323 180365977 171654 Loss 1792 BTNL3 Ctrl pos High OR Yes 5 180194323 180378586 184263 Loss 1851 BTNL3 Ctrl pos High OR Yes 5 180194323 180378586 184263 Loss 1902 BTNL3 Ctrl pos High OR Yes 5 180194323 180365977 171654 Loss 1927 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1261 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1265 BTNL3 Ctrl pos High OR Yes 5 180344964 180378586 33622 Loss 1268 BTNL3 Ctrl pos High OR Yes 5 180344964 180379663 34699 Loss 1277 BTNL3 Ctrl pos High OR Yes 5 180344964 180378586 33622 Loss 1354 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1438 BTNL3 Ctrl pos High OR Yes 5 180344964 180378586 33622 Loss 1463 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1467 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1568 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1570 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1662 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1671 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1726 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1769 BTNL3 Ctrl pos High OR Yes 5 180344964 180365977 21013 Loss 1799 BTNL3 Ctrl pos High OR Yes 5 180344964 180378586 33622 Loss 1849 BTNL3 Ctrl pos High OR Yes 5 180346557 180365977 19420 Loss 1540 BTNL3 Ctrl pos High OR Yes 5 180346557 180365977 19420 Loss 1754 BTNL3 Ctrl pos High OR Yes 5 180346557 180365977 19420 Loss 1755 BTNL3 Ctrl pos High OR Yes 5 180346557 180378586 32029 Loss 1942 BTNL3 Ctrl pos High OR Yes 6 26539830 26571434 31604 gain 1842 BTN2A1, BTN3A3 Exon + ve, 2 cases Yes 6 26539830 26571434 31604 loss 1968 BTN2A1, BTN3A3 Exon + ve, 2 cases Yes 6 29653815 29658113 4298 loss 1275 SNORD32B Exon + ve, 2 cases Yes 6 29653815 29658113 4298 loss 1440 SNORD32B Exon + ve, 2 cases Yes 6 29653815 29658113 4298 loss 1750 SNORD32B Exon + ve, 2 cases Yes 6 29653815 29658113 4298 loss 1862 SNORD32B Exon + ve, 2 cases Yes 6 30046182 30052053 5871 loss 1244 HCG9 Exon + ve, 2 cases Yes 6 30046182 30052053 5871 loss 1488 HCG9 Exon + ve, 2 cases Yes 6 33491109 33492393 1284 loss 1297 CUTA, PHF1 Exon + ve, 2 cases Yes 6 33491109 33492393 1284 loss 1718 CUTA, PHF1 Exon + ve, 2 cases Yes 6 33491109 33492393 1284 loss 1841 CUTA, PHF1 Exon + ve, 2 cases Yes 6 33491109 33492393 1284 loss 1905 CUTA, PHF1 Exon + ve, 2 cases Yes 6 33491109 33492393 1284 loss 2031 CUTA, PHF1 Exon + ve, 2 cases Yes 6 33491109 33492393 1284 loss 2032 CUTA, PHF1 Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 1297 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 1718 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 1841 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 1872 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 1905 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 1967 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 2031 CUTA Exon + ve, 2 cases Yes 6 33492394 33495073 2679 loss 2032 CUTA Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1297 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1718 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1824 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1840 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1841 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1872 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1905 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 1967 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 2031 SYNGAP1 Exon + ve, 2 cases Yes 6 33495074 33504619 9545 loss 2032 SYNGAP1 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 1680 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 1694 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 1718 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 1852 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 1950 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 1965 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 2006 C6orf126 Exon + ve, 2 cases Yes 6 35851495 35853208 1713 loss 2018 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1680 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1694 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1718 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1852 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1940 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1946 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1950 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1958 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1961 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1962 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 1965 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 2005 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 2006 C6orf126 Exon + ve, 2 cases Yes 6 35853209 35855651 2442 loss 2018 C6orf126 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1301 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1680 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1694 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1718 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1837 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1839 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1852 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1940 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1946 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1950 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1952 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1958 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1959 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1961 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1962 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 1965 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 2005 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 2006 C6orf127 Exon + ve, 2 cases Yes 6 35855652 35856921 1269 loss 2018 C6orf127 Exon + ve, 2 cases Yes 6 74521789 74527607 5818 gain 1638 CD109 Exon + ve, 2 cases Yes 6 74521789 74527607 5818 gain 1894 CD109 Exon + ve, 2 cases Yes 6 105298062 105303833 5771 loss 1426 HACE1 Exon + ve, 2 cases Yes 6 105298062 105303833 5771 loss 1458 HACE1 Exon + ve, 2 cases Yes 6 105298062 105303833 5771 loss 1490 HACE1 Exon + ve, 2 cases Yes 6 105298062 105303833 5771 loss 1492 HACE1 Exon + ve, 2 cases Yes 6 105298062 105303833 5771 loss 1500 HACE1 Exon + ve, 2 cases Yes 6 134624093 134627340 3247 loss 1224 SGK1 Exon + ve, 2 cases Yes 6 134624093 134627340 3247 loss 1576 SGK1 Exon + ve, 2 cases Yes 6 134624093 134627340 3247 loss 1667 SGK1 Exon + ve, 2 cases Yes 6 134624093 134627340 3247 loss 1708 SGK1 Exon + ve, 2 cases Yes 6 139638465 139641157 2692 loss 1387 TXLNB Exon + ve, 2 cases Yes 6 139638465 139641157 2692 loss 1396 TXLNB Exon + ve, 2 cases Yes 6 139638465 139641157 2692 loss 1401 TXLNB Exon + ve, 2 cases Yes 6 139638465 139641157 2692 loss 1403 TXLNB Exon + ve, 2 cases Yes 6 139638465 139641157 2692 loss 1696 TXLNB Exon + ve, 2 cases Yes 6 139638465 139641157 2692 loss 1895 TXLNB Exon + ve, 2 cases Yes 6 143693693 143696258 2565 gain 1281 AIG1 Exon + ve, 2 cases Yes 6 143693693 143696258 2565 gain 1372 AIG1 Exon + ve, 2 cases Yes 6 143693693 143696258 2565 gain 1409 AIG1 Exon + ve, 2 cases Yes 6 143693693 143696258 2565 gain 1619 AIG1 Exon + ve, 2 cases Yes 6 143693693 143696258 2565 gain 1639 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1281 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1372 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1409 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1429 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1619 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1639 AIG1 Exon + ve, 2 cases Yes 6 143696259 143697901 1642 gain 1926 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1281 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1372 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1409 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1429 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1619 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1639 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1905 AIG1 Exon + ve, 2 cases Yes 6 143697902 143705189 7287 gain 1926 AIG1 Exon + ve, 2 cases Yes 6 146912375 146914496 2121 loss 1291 RAB32 Exon + ve, 2 cases Yes 6 146912375 146914496 2121 loss 1309 RAB32 Exon + ve, 2 cases Yes 6 146912375 146914496 2121 loss 1535 RAB32 Exon + ve, 2 cases Yes 6 149109599 149110881 1282 loss 1369 UST Exon + ve, 2 cases Yes 6 149109599 149110881 1282 loss 1645 UST Exon + ve, 2 cases Yes 6 149109599 149110881 1282 loss 1660 UST Exon + ve, 2 cases Yes 6 155530613 155545570 14957 loss 1347 TIAM2 Exon + ve, 2 cases Yes 6 155530613 155545570 14957 loss 1598 TIAM2 Exon + ve, 2 cases Yes 6 159190838 159203355 12517 loss 1468 OSTCL Exon + ve, 2 cases Yes 6 159190838 159203355 12517 loss 1582 OSTCL Exon + ve, 2 cases Yes 6 159234892 159238587 3695 loss 1419 C6orf99 Exon + ve, 2 cases Yes 6 159234892 159238587 3695 loss 1468 C6orf99 Exon + ve, 2 cases Yes 6 159234892 159238587 3695 loss 1742 C6orf99 Exon + ve, 2 cases Yes 6 159234892 159238587 3695 loss 1900 C6orf99 Exon + ve, 2 cases Yes 6 160247865 160248266 401 gain 1242 MAS1 Exon + ve, 2 cases Yes 6 160247865 160248266 401 gain 1571 MAS1 Exon + ve, 2 cases Yes 6 160247865 160248266 401 gain 1574 MAS1 Exon + ve, 2 cases Yes 6 160247865 160248266 401 gain 1870 MAS1 Exon + ve, 2 cases Yes 6 165748837 165755595 6758 loss 1590 PDE10A Exon + ve, 2 cases Yes 6 165748837 165755595 6758 gain 1760 PDE10A Exon + ve, 2 cases Yes 6 166487200 166494679 7479 gain 1392 T Exon + ve, distinct Yes CNVs, same Gene 6 166499289 166503493 4204 loss 1859 T Exon + ve, distinct Yes CNVs, same Gene 6 170683495 170701779 18284 gain 1729 PSMB1 Exon + ve, 2 cases Yes 6 170683495 170701779 18284 gain 1954 PSMB1 Exon + ve, 2 cases Yes 7 6004111 6006782 2671 gain 1266 PMS2 Exon + ve, 2 cases Yes 7 6004111 6006782 2671 gain 1938 PMS2 Exon + ve, 2 cases Yes 7 45079997 45096030 16033 loss 1642 NACAD, CCM2 Exon + ve, 2 cases Yes 7 45079997 45096030 16033 loss 1819 NACAD, CCM2 Exon + ve, 2 cases Yes 7 45079997 45096030 16033 loss 1825 NACAD, CCM2 Exon + ve, 2 cases Yes 7 45079997 45096030 16033 loss 1907 NACAD, CCM2 Exon + ve, 2 cases Yes 7 48528408 48532031 3623 loss 1886 ABCA13 Exon + ve, 2 cases Yes 7 48528408 48532031 3623 loss 1891 ABCA13 Exon + ve, 2 cases Yes 7 86932062 86941683 9621 loss 1439 ABCB4 Exon + ve, 2 cases Yes 7 86932062 86941683 9621 loss 1579 ABCB4 Exon + ve, 2 cases Yes 7 89728688 89820179 91491 gain 1274 GTPBP10, C7orf63 Exon + ve, distinct Yes CNVs, same Gene 7 89824673 89852155 27482 gain 1864 GTPBP10 Exon + ve, distinct Yes CNVs, same Gene 7 91585706 91605955 20249 loss 1734 CYP51A1 Exon + ve, 2 cases Yes 7 91585706 91605955 20249 loss 1856 CYP51A1 Exon + ve, 2 cases Yes 7 99031711 99035131 3420 gain 1411 LOC100289187 Exon + ve, 2 cases Yes 7 99031711 99035131 3420 gain 1755 LOC100289187 Exon + ve, 2 cases Yes 7 99031711 99035131 3420 gain 1799 LOC100289187 Exon + ve, 2 cases Yes 7 100182351 100183859 1508 loss 1227 ZAN Exon + ve, 2 cases Yes 7 100182351 100183859 1508 loss 1236 ZAN Exon + ve, 2 cases Yes 7 100182351 100183859 1508 loss 1803 ZAN Exon + ve, 2 cases Yes 7 100182351 100183859 1508 loss 1824 ZAN Exon + ve, 2 cases Yes 7 100182351 100183859 1508 loss 1896 ZAN Exon + ve, 2 cases Yes 7 100182351 100183859 1508 loss 2034 ZAN Exon + ve, 2 cases Yes 7 100967884 100979053 11169 loss 1680 EMID2 Exon + ve, 2 cases Yes 7 100967884 100979053 11169 loss 1820 EMID2 Exon + ve, 2 cases Yes 7 107049716 107067706 17990 loss 1321 BCAP29 Exon + ve, 2 cases Yes 7 107049716 107067706 17990 loss 1475 BCAP29 Exon + ve, 2 cases Yes 7 122003026 122010979 7953 loss 1910 CADPS2 Exon + ve, distinct Yes CNVs, same Gene 7 122051537 122056508 4971 loss 1354 CADPS2 Exon + ve, distinct Yes CNVs, same Gene 7 127640643 127675911 35268 gain 1266 LEP Exon + ve, 2 cases Yes 7 127640643 127675911 35268 gain 1733 LEP Exon + ve, 2 cases Yes 7 133906667 133908027 1360 gain 1494 AKR1B15 Exon + ve, 2 cases Yes 7 133906667 133908027 1360 gain 1783 AKR1B15 Exon + ve, 2 cases Yes 7 141443578 141446728 3150 gain 1225 MGAM Exon + ve, 2 cases Yes 7 141443578 141446728 3150 gain 1720 MGAM Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1232 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1242 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1347 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1349 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1374 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1568 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1601 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1697 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1753 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1784 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1803 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1837 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 1930 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 2018 MTRNR2L6 Exon + ve, 2 cases Yes 7 142041787 142083554 41767 loss 2024 MTRNR2L6 Exon + ve, 2 cases Yes 7 147702365 147710037 7672 Loss 1728 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1227 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1346 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Loss 1371 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1517 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Loss 1617 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1621 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1636 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1639 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1645 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1670 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1727 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1753 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1754 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1761 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1792 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Loss 1803 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1806 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1820 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1826 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1836 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1854 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1867 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1872 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1916 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1918 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 1960 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 2003 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 2028 CNTNAP2 Ctrl pos High OR No 7 147704200 147710037 5837 Loss 2041 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1220 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1223 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1230 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1234 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1240 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1252 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1281 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1282 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1284 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1286 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1290 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1307 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1308 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1309 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1318 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1320 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1345 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1389 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1405 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1415 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1421 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1422 CNTNAP2 Ctrl pos High OR No 7 147704200 147711471 7271 Gain 1423 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1425 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1432 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1434 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1438 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1440 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1442 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1463 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1466 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1472 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1473 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1490 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1492 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1495 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1496 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1497 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1498 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1502 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1504 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1506 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1508 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1512 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1513 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1514 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1515 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1519 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1520 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1528 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1534 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1543 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1544 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1556 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1557 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1558 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1559 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1560 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1565 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1570 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1571 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1573 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1584 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1586 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1592 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1597 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1601 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1602 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1603 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1610 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1618 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1619 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1620 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1622 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1624 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1626 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1632 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1640 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1641 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1647 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1650 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1653 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1654 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1662 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1667 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1688 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1707 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1708 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1710 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1715 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1720 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1755 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1760 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1774 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1779 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1782 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1783 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1784 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1796 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1804 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1805 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 1808 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1811 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1813 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1814 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1815 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1818 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1831 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1832 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1835 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1838 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1839 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1845 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1851 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1861 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1874 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 1877 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1881 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1883 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1893 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 1895 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1905 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 1907 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1927 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1930 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1944 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1948 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 1951 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1970 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 1994 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 1997 CNTNAP2 Ctrl pos High OR No 7 147704200 147707161 2961 Gain 2006 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 2024 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 2026 CNTNAP2 Ctrl pos High OR No 7 147704200 147708382 4182 Gain 2034 CNTNAP2 Ctrl pos High OR No 7 147734925 147737360 2435 loss 1346 CNTNAP2 Exon + ve, 2 cases Yes 7 147734925 147737360 2435 loss 1403 CNTNAP2 Exon + ve, 2 cases Yes 7 147734925 147737360 2435 loss 1988 CNTNAP2 Exon + ve, 2 cases Yes 7 153158956 153290833 131877 gain 1486 DPP6 Exon + ve, 2 cases Yes 7 153158956 153290833 131877 gain 1730 DPP6 Exon + ve, 2 cases Yes 7 153158956 153290833 131877 gain 1755 DPP6 Exon + ve, 2 cases Yes 7 153290834 153384745 93911 gain 1730 DPP6 Exon + ve, 2 cases Yes 7 153290834 153384745 93911 gain 1755 DPP6 Exon + ve, 2 cases Yes 7 153742206 153775545 33339 gain 1730 DPP6 Exon + ve, 2 cases Yes 7 153742206 153775545 33339 loss 1885 DPP6 Exon + ve, 2 cases Yes 7 153798366 153819463 21097 gain 1730 DPP6 Exon + ve, 2 cases Yes 7 153798366 153819463 21097 loss 1949 DPP6 Exon + ve, 2 cases Yes 8 6718944 6779427 60483 gain 1572 DEFA6, DEFB1 Exon + ve, 2 cases Yes 8 6718944 6779427 60483 loss 1621 DEFA6, DEFB1 Exon + ve, 2 cases Yes 8 10658422 10666072 7650 loss 1663 PINX1 Exon + ve, 2 cases Yes 8 10658422 10666072 7650 gain 2042 PINX1 Exon + ve, 2 cases Yes 8 10670976 10732498 61522 loss 1663 PINX1, MIR1322 Exon + ve, 2 cases Yes 8 10670976 10732498 61522 gain 2042 PINX1, MIR1322 Exon + ve, 2 cases Yes 8 22631429 22641498 10069 loss 1293 PEBP4 Exon + ve, 2 cases Yes 8 22631429 22641498 10069 loss 1296 PEBP4 Exon + ve, 2 cases Yes 8 22631429 22641498 10069 loss 1842 PEBP4 Exon + ve, 2 cases Yes 8 22631429 22641498 10069 loss 1849 PEBP4 Exon + ve, 2 cases Yes 8 42134084 42135245 1161 loss 1251 AP3M2 Exon + ve, distinct Yes CNVs, same Gene 8 42145982 42149494 3512 gain 1634 AP3M2 Exon + ve, distinct Yes CNVs, same Gene 8 43057445 43170237 112792 gain 1406 HGSNAT, FNTA, SGK196 Exon + ve, 2 cases Yes 8 43057445 43170237 112792 gain 1695 HGSNAT, FNTA, SGK196 Exon + ve, 2 cases Yes 8 43288182 43294454 6272 gain 1316 POTEA Exon + ve, 2 cases Yes 8 43288182 43294454 6272 gain 1406 POTEA Exon + ve, 2 cases Yes 8 43288182 43294454 6272 loss 1549 POTEA Exon + ve, 2 cases Yes 8 43288182 43294454 6272 gain 1695 POTEA Exon + ve, 2 cases Yes 8 54952820 54956193 3373 loss 1604 RGS20 Exon + ve, 2 cases Yes 8 54952820 54956193 3373 loss 1993 RGS20 Exon + ve, 2 cases Yes 8 67685665 67689015 3350 loss 1275 MYBL1 Exon + ve, 2 cases Yes 8 67685665 67689015 3350 loss 1650 MYBL1 Exon + ve, 2 cases Yes 8 82910933 82920255 9322 loss 1638 SNX16 Exon + ve, 2 cases Yes 8 82910933 82920255 9322 loss 1950 SNX16 Exon + ve, 2 cases Yes 8 134331224 134336458 5234 gain 1854 NDRG1 Exon + ve, distinct Yes CNVs, same Gene 8 134337809 134342059 4250 loss 1552 NDRG1 Exon + ve, distinct Yes CNVs, same Gene 9 5646415 5660083 13668 gain 1463 KIAA1432 Exon + ve, 2 cases Yes 9 5646415 5660083 13668 gain 1667 KIAA1432 Exon + ve, 2 cases Yes 9 5646415 5660083 13668 gain 1818 KIAA1432 Exon + ve, 2 cases Yes 9 6555187 6578755 23568 loss 1609 GLDC Exon + ve, distinct Yes CNVs, same Gene 9 6606637 6610662 4025 loss 1391 GLDC Exon + ve, distinct Yes CNVs, same Gene 9 15655922 15658483 2561 loss 1386 C9orf93 Exon + ve, 2 cases Yes 9 15655922 15658483 2561 loss 1477 C9orf93 Exon + ve, 2 cases Yes 9 15655922 15658483 2561 loss 1594 C9orf93 Exon + ve, 2 cases Yes 9 15655922 15658483 2561 loss 1881 C9orf93 Exon + ve, 2 cases Yes 9 17260655 17271186 10531 loss 1743 CNTLN Exon + ve, distinct Yes CNVs, same Gene 9 17348551 17356839 8288 loss 1502 CNTLN Exon + ve, distinct Yes CNVs, same Gene 9 19775974 19783547 7573 loss 1418 SLC24A2 Exon + ve, 2 cases Yes 9 19775974 19783547 7573 loss 1511 SLC24A2 Exon + ve, 2 cases Yes 9 21267946 21274020 6074 loss 1418 IFNA22P Exon + ve, 2 cases Yes 9 21267946 21274020 6074 gain 2020 IFNA22P Exon + ve, 2 cases Yes 9 21321182 21330461 9279 loss 1418 KLHL9 Exon + ve, 2 cases Yes 9 21321182 21330461 9279 loss 1687 KLHL9 Exon + ve, 2 cases Yes 9 21422879 21434788 11909 loss 1418 IFNA1 Exon + ve, 2 cases Yes 9 21422879 21434788 11909 loss 1777 IFNA1 Exon + ve, 2 cases Yes 9 26919782 26925984 6202 loss 1539 PLAA Exon + ve, 2 cases Yes 9 26919782 26925984 6202 loss 1656 PLAA Exon + ve, 2 cases Yes 9 32459710 32463040 3330 loss 2003 DDX58 Exon + ve, distinct Yes CNVs, same Gene 9 32490919 32498096 7177 loss 1645 DDX58 Exon + ve, distinct Yes CNVs, same Gene 9 36263984 36268995 5011 gain 1716 GNE Exon + ve, 2 cases Yes 9 36263984 36268995 5011 gain 1829 GNE Exon + ve, 2 cases Yes 9 73777414 73780717 3303 gain 1793 C9orf85 Exon + ve, 2 cases Yes 9 73777414 73780717 3303 gain 1883 C9orf85 Exon + ve, 2 cases Yes 9 73777414 73780717 3303 gain 1893 C9orf85 Exon + ve, 2 cases Yes 9 79049925 79067111 17186 gain 1782 VPS13A Exon + ve, 2 cases Yes 9 79049925 79067111 17186 gain 1897 VPS13A Exon + ve, 2 cases Yes 9 79049925 79067111 17186 gain 1938 VPS13A Exon + ve, 2 cases Yes 9 92596909 92617806 20897 gain 1423 SYK Exon + ve, distinct Yes CNVs, same Gene 9 92658019 92700662 42643 gain 1626 SYK Exon + ve, distinct Yes CNVs, same Gene 9 98831789 98831814 25 gain 1629 CTSL2 Exon + ve, 2 cases Yes 9 98831789 98831814 25 loss 1715 CTSL2 Exon + ve, 2 cases Yes 9 98831789 98831814 25 loss 1718 CTSL2 Exon + ve, 2 cases Yes 9 115858589 115903754 45165 gain 1406 ZNF618, AMBP, KIF12 Exon + ve, 2 cases Yes 9 115858589 115903754 45165 gain 2020 ZNF618, AMBP, KIF12 Exon + ve, 2 cases Yes 9 116088109 116118906 30797 gain 1406 COL27A1 Exon + ve, 2 cases Yes 9 116088109 116118906 30797 gain 2020 COL27A1 Exon + ve, 2 cases Yes 9 116142500 116144225 1725 loss 1301 AKNA Exon + ve, 2 cases Yes 9 116142500 116144225 1725 gain 2020 AKNA Exon + ve, 2 cases Yes 9 118405993 118469712 63719 loss 1622 ASTN2 Exon + ve, distinct Yes CNVs, same Gene 9 118469713 118507633 37920 loss 1559 ASTN2, TRIM32 Exon + ve, 2 cases Yes 9 118469713 118507633 37920 loss 1622 ASTN2, TRIM32 Exon + ve, 2 cases Yes 9 118524254 118532360 8106 loss 1559 ASTN2 Exon + ve, distinct Yes CNVs, same Gene 9 127014097 127028444 14347 loss 1222 RABEPK Exon + ve, 2 cases Yes 9 127014097 127028444 14347 loss 1669 RABEPK Exon + ve, 2 cases Yes 9 132910836 132912214 1378 loss 1621 LAMC3 Exon + ve, 2 cases Yes 9 132910836 132912214 1378 loss 1639 LAMC3 Exon + ve, 2 cases Yes 9 132910836 132912214 1378 loss 1720 LAMC3 Exon + ve, 2 cases Yes 9 132912215 132916079 3864 loss 1345 LAMC3 Exon + ve, 2 cases Yes 9 132912215 132916079 3864 loss 1621 LAMC3 Exon + ve, 2 cases Yes 9 132912215 132916079 3864 loss 1639 LAMC3 Exon + ve, 2 cases Yes 9 132912215 132916079 3864 loss 1720 LAMC3 Exon + ve, 2 cases Yes 9 132916080 132921442 5362 loss 1345 LAMC3 Exon + ve, 2 cases Yes 9 132916080 132921442 5362 loss 1621 LAMC3 Exon + ve, 2 cases Yes 9 132916080 132921442 5362 loss 1639 LAMC3 Exon + ve, 2 cases Yes 9 132916080 132921442 5362 loss 1720 LAMC3 Exon + ve, 2 cases Yes 9 132916080 132921442 5362 loss 1897 LAMC3 Exon + ve, 2 cases Yes 9 134924325 134928569 4244 loss 1321 CEL Exon + ve, 2 cases Yes 9 134924325 134928569 4244 gain 1887 CEL Exon + ve, 2 cases Yes 10 5985730 5988631 2901 loss 1307 FBXO18 Exon + ve, 2 cases Yes 10 5985730 5988631 2901 loss 1409 FBXO18 Exon + ve, 2 cases Yes 10 5985730 5988631 2901 loss 1619 FBXO18 Exon + ve, 2 cases Yes 10 5985730 5988631 2901 loss 1654 FBXO18 Exon + ve, 2 cases Yes 10 5985730 5988631 2901 loss 2024 FBXO18 Exon + ve, 2 cases Yes 10 5988632 5993423 4791 loss 1307 FBXO18 Exon + ve, 2 cases Yes 10 5988632 5993423 4791 loss 1409 FBXO18 Exon + ve, 2 cases Yes 10 5988632 5993423 4791 loss 1619 FBXO18 Exon + ve, 2 cases Yes 10 5988632 5993423 4791 loss 1654 FBXO18 Exon + ve, 2 cases Yes 10 25049572 25051425 1853 gain 1401 ARHGAP21 Exon + ve, 2 cases Yes 10 25049572 25051425 1853 loss 1548 ARHGAP21 Exon + ve, 2 cases Yes 10 25049572 25051425 1853 loss 1699 ARHGAP21 Exon + ve, 2 cases Yes 10 25049572 25051425 1853 loss 1724 ARHGAP21 Exon + ve, 2 cases Yes 10 25049572 25051425 1853 gain 1820 ARHGAP21 Exon + ve, 2 cases Yes 10 25049572 25051425 1853 loss 1961 ARHGAP21 Exon + ve, 2 cases Yes 10 25051426 25057232 5806 gain 1401 ARHGAP21 Exon + ve, 2 cases Yes 10 25051426 25057232 5806 gain 1820 ARHGAP21 Exon + ve, 2 cases Yes 10 42318589 42340738 22149 gain 1299 ZNF37BP Exon + ve, 2 cases Yes 10 42318589 42340738 22149 gain 1746 ZNF37BP Exon + ve, 2 cases Yes 10 42955952 43009997 54045 gain 1746 RASGEF1A, CSGALNACT2 Exon + ve, 2 cases Yes 10 42955952 43009997 54045 gain 1968 RASGEF1A, CSGALNACT2 Exon + ve, 2 cases Yes 10 44921903 44960469 38566 gain 1295 LOC100133308 Exon + ve, 2 cases Yes 10 44921903 44960469 38566 gain 1968 LOC100133308 Exon + ve, 2 cases Yes 10 45478103 45487334 9231 gain 1408 ANUBL1 Exon + ve, 2 cases Yes 10 45478103 45487334 9231 gain 1653 ANUBL1 Exon + ve, 2 cases Yes 10 55328218 55334606 6388 gain 1309 PCDH15 Exon + ve, 2 cases Yes 10 55328218 55334606 6388 gain 1429 PCDH15 Exon + ve, 2 cases Yes 10 55580662 55589321 8659 gain 1429 PCDH15 Exon + ve, 2 cases Yes 10 55580662 55589321 8659 loss 1475 PCDH15 Exon + ve, 2 cases Yes 10 55580662 55589321 8659 loss 1537 PCDH15 Exon + ve, 2 cases Yes 10 67627258 67723299 96041 loss 1835 CTNNA3 Exon + ve, distinct Yes CNVs, same Gene 10 68606250 68611060 4810 loss 1970 CTNNA3 Exon + ve, distinct Yes CNVs, same Gene 10 69018417 69100982 82565 gain 1780 CTNNA3 Exon + ve, distinct Yes CNVs, same Gene 10 116963862 116971507 7645 gain 1292 ATRNL1 Exon + ve, 2 cases Yes 10 116963862 116971507 7645 gain 1394 ATRNL1 Exon + ve, 2 cases Yes 10 116963862 116971507 7645 gain 1834 ATRNL1 Exon + ve, 2 cases Yes 10 116963862 116971507 7645 gain 1880 ATRNL1 Exon + ve, 2 cases Yes 10 116963862 116971507 7645 gain 1924 ATRNL1 Exon + ve, 2 cases Yes 10 118190679 118193786 3107 loss 1287 PNLIPRP3 Exon + ve, 2 cases Yes 10 118190679 118193786 3107 gain 2036 PNLIPRP3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 loss 1572 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 gain 1597 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 gain 1644 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 loss 1691 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 loss 1703 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 loss 1704 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 gain 1709 EBF3 Exon + ve, 2 cases Yes 10 131651597 131652807 1210 loss 1724 EBF3 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1394 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1536 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1538 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1551 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1727 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1821 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1823 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1824 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1825 OR52N1 Exon + ve, 2 cases Yes 11 5766616 5774108 7492 gain 1902 OR52N1 Exon + ve, 2 cases Yes 11 5848930 5892024 43094 gain 1301 OR52E4 Exon + ve, 2 cases Yes 11 5848930 5892024 43094 gain 1333 OR52E4 Exon + ve, 2 cases Yes 11 5848930 5892024 43094 gain 1593 OR52E4 Exon + ve, 2 cases Yes 11 5848930 5892024 43094 gain 1920 OR52E4 Exon + ve, 2 cases Yes 11 22198120 22199909 1789 gain 1609 ANO5 Exon + ve, 2 cases Yes 11 22198120 22199909 1789 loss 2001 ANO5 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 gain 1324 C11orf96 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 loss 1396 C11orf96 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 gain 1530 C11orf96 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 loss 1829 C11orf96 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 gain 1860 C11orf96 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 loss 1874 C11orf96 Exon + ve, 2 cases Yes 11 43920001 43921971 1970 gain 1996 C11orf96 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 1798 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 1852 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 1854 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 1855 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 1857 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 1936 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 47142460 47155662 13202 loss 2031 C11orf49, ARFGAP2, PACSIN3 Exon + ve, 2 cases Yes 11 51241170 51286363 45193 gain 1708 OR4A5 Exon + ve, 2 cases Yes 11 51241170 51286363 45193 gain 1943 OR4A5 Exon + ve, 2 cases Yes 11 63065110 63070503 5393 loss 1776 RARRES3 Exon + ve, 2 cases Yes 11 63065110 63070503 5393 loss 1950 RARRES3 Exon + ve, 2 cases Yes 11 65851949 65860867 8918 loss 1958 RIN1 Exon + ve, 2 cases Yes 11 65851949 65860867 8918 loss 1993 RIN1 Exon + ve, 2 cases Yes 11 70167828 70206326 38498 loss 1835 SHANK2 Special Yes 11 95194789 95195561 772 loss 1349 CEP57 Exon + ve, 2 cases Yes 11 95194789 95195561 772 loss 1946 CEP57 Exon + ve, 2 cases Yes 11 99646264 99660303 14039 loss 1936 CNTN5 Special Yes 11 110872005 110875598 3593 loss 1276 BTG4 Exon + ve, 2 cases Yes 11 110872005 110875598 3593 loss 1465 BTG4 Exon + ve, 2 cases Yes 11 125808845 125810734 1889 gain 1713 KIRREL3 Exon + ve, 2 cases Yes 11 125808845 125810734 1889 gain 1861 KIRREL3 Exon + ve, 2 cases Yes 11 127895094 127897121 2027 gain 1429 ETS1 Exon + ve, 2 cases Yes 11 127895094 127897121 2027 gain 1779 ETS1 Exon + ve, 2 cases Yes 12 8173177 8179355 6178 gain 1246 POU5F1P3, CLEC4A Exon + ve, 2 cases Yes 12 8173177 8179355 6178 gain 1308 POU5F1P3, CLEC4A Exon + ve, 2 cases Yes 12 9777077 9778598 1521 loss 1264 CLECL1 Exon + ve, 2 cases Yes 12 9777077 9778598 1521 loss 1705 CLECL1 Exon + ve, 2 cases Yes 12 20859893 20860186 293 loss 1225 SLCO1B3 Exon + ve, 2 cases Yes 12 20859893 20860186 293 loss 1488 SLCO1B3 Exon + ve, 2 cases Yes 12 20859893 20860186 293 loss 1577 SLCO1B3 Exon + ve, 2 cases Yes 12 20859893 20860186 293 loss 1581 SLCO1B3 Exon + ve, 2 cases Yes 12 21514182 21516409 2227 gain 1465 RECQL, PYROXD1 Exon + ve, 2 cases Yes 12 21514182 21516409 2227 gain 1925 RECQL, PYROXD1 Exon + ve, 2 cases Yes 12 50517950 50577179 59229 gain 1768 ANKRD33 Exon + ve, 2 cases Yes 12 50517950 50577179 59229 gain 1836 ANKRD33 Exon + ve, 2 cases Yes 12 51132302 51150231 17929 loss 1844 KRT6C Exon + ve, 2 cases Yes 12 51132302 51150231 17929 loss 2037 KRT6C Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1447 ELK3 Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1728 ELK3 Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1742 ELK3 Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1957 ELK3 Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1961 ELK3 Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1965 ELK3 Exon + ve, 2 cases Yes 12 95110503 95112470 1967 loss 1967 ELK3 Exon + ve, 2 cases Yes 12 97699965 97704854 4889 loss 1872 ANKS1B Exon + ve, 2 cases Yes 12 97699965 97704854 4889 loss 1884 ANKS1B Exon + ve, 2 cases Yes 12 108878848 108882203 3355 loss 1279 GIT2 Exon + ve, 2 cases Yes 12 108878848 108882203 3355 loss 1665 GIT2 Exon + ve, 2 cases Yes 12 110666479 110799506 133027 gain 1763 ACAD10, MAPKAPK5, C12orf47, ALDH2 Exon + ve, 2 cases Yes 12 110666479 110799506 133027 gain 2022 ACAD10, MAPKAPK5, C12orf47, ALDH2 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1416 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 gain 1448 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1471 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1474 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1492 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1493 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1496 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1497 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1498 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1500 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1505 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1517 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1566 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1579 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1580 ULK1 Exon + ve, 2 cases Yes 12 130944468 130946248 1780 loss 1582 ULK1 Exon + ve, 2 cases Yes 13 22323381 22381531 58150 gain 1662 BASP1P1 Exon + ve, 2 cases Yes 13 22323381 22381531 58150 loss 1714 BASP1P1 Exon + ve, 2 cases Yes 13 22323381 22381531 58150 gain 1744 BASP1P1 Exon + ve, 2 cases Yes 13 22323381 22381531 58150 loss 1919 BASP1P1 Exon + ve, 2 cases Yes 13 35695761 35699663 3902 gain 1564 C13orf38-SOHLH2, C13orf38 Exon + ve, 2 cases Yes 13 35695761 35699663 3902 gain 1803 C13orf38-SOHLH2, C13orf38 Exon + ve, 2 cases Yes 13 42366568 42368413 1845 loss 1536 EPSTI1 Exon + ve, distinct Yes CNVs, same Gene 13 42369769 42372717 2948 gain 1502 EPSTI1 Exon + ve, distinct Yes CNVs, same Gene 13 42372718 42420937 48219 gain 1502 EPSTI1 Exon + ve, 2 cases Yes 13 42372718 42420937 48219 gain 1897 EPSTI1 Exon + ve, 2 cases Yes 13 42423318 42441665 18347 gain 1897 EPSTI1 Exon + ve, distinct Yes CNVs, same Gene 14 22811680 22814547 2867 gain 1642 HOMEZ Exon + ve, 2 cases Yes 14 22811680 22814547 2867 gain 1875 HOMEZ Exon + ve, 2 cases Yes 14 22929952 22958797 28845 Loss 1537 MYH6 Ctrl pos High OR Yes 14 22929952 22959469 29517 Loss 1669 MYH6 Ctrl pos High OR Yes 14 22943262 22951086 7824 Loss 1577 MYH6 Ctrl pos High OR Yes 14 22943262 22955470 12208 Loss 1856 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1718 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1802 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1816 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1817 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1819 MYH6 Ctrl pos High OR Yes 14 22946615 22947034 419 Loss 1820 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1850 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1895 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 1993 MYH6 Ctrl pos High OR Yes 14 22946615 22955470 8855 Loss 2032 MYH6 Ctrl pos High OR Yes 14 22946615 22947639 1024 Loss 2043 MYH6 Ctrl pos High OR Yes 14 30647372 30649432 2060 loss 1775 HECTD1 Exon + ve, distinct Yes CNVs, same Gene 14 30649432 30655206 5774 loss 1403 HECTD1 Exon + ve, distinct Yes CNVs, same Gene 14 47289928 47300593 10665 loss 1570 MIR548Y Exon + ve, 2 cases Yes 14 47289928 47300593 10665 gain 1709 MIR548Y Exon + ve, 2 cases Yes 14 51528998 51531503 2505 loss 1226 C14orf166 Exon + ve, 2 cases Yes 14 51528998 51531503 2505 loss 1253 C14orf166 Exon + ve, 2 cases Yes 14 51528998 51531503 2505 loss 1650 C14orf166 Exon + ve, 2 cases Yes 14 60551981 60553070 1089 loss 1269 SLC38A6 Exon + ve, 2 cases Yes 14 60551981 60553070 1089 gain 1281 SLC38A6 Exon + ve, 2 cases Yes 14 60551981 60553070 1089 loss 1470 SLC38A6 Exon + ve, 2 cases Yes 14 60551981 60553070 1089 gain 1773 SLC38A6 Exon + ve, 2 cases Yes 14 60551981 60553070 1089 loss 2000 SLC38A6 Exon + ve, 2 cases Yes 14 69012378 69022484 10106 loss 1852 UPF0639 Exon + ve, 2 cases Yes 14 69012378 69022484 10106 loss 1871 UPF0639 Exon + ve, 2 cases Yes 14 70274601 70276007 1406 loss 1314 MAP3K9 Exon + ve, 2 cases Yes 14 70274601 70276007 1406 loss 1910 MAP3K9 Exon + ve, 2 cases Yes 14 70274601 70276007 1406 loss 2001 MAP3K9 Exon + ve, 2 cases Yes 14 70274601 70276007 1406 loss 2002 MAP3K9 Exon + ve, 2 cases Yes 14 73010755 73015309 4554 gain 1291 HEATR4 Exon + ve, 2 cases Yes 14 73010755 73015309 4554 loss 1806 HEATR4 Exon + ve, 2 cases Yes 14 73051686 73058102 6416 loss 1237 HEATR4 Exon + ve, 2 cases Yes 14 73051686 73058102 6416 gain 1291 HEATR4 Exon + ve, 2 cases Yes 14 73058103 73060300 2197 loss 1237 HEATR4 Exon + ve, 2 cases Yes 14 73058103 73060300 2197 gain 1291 HEATR4 Exon + ve, 2 cases Yes 14 73058103 73060300 2197 loss 1676 HEATR4 Exon + ve, 2 cases Yes 14 73058103 73060300 2197 loss 1687 HEATR4 Exon + ve, 2 cases Yes 14 73058103 73060300 2197 loss 1718 HEATR4 Exon + ve, 2 cases Yes 14 73058103 73060300 2197 loss 1721 HEATR4 Exon + ve, 2 cases Yes 14 77935509 77995126 59617 loss 1908 NRXN3 Exon + ve, distinct Yes CNVs, same Gene 14 79195482 79220608 25126 loss 2036 NRXN3 Exon + ve, distinct Yes CNVs, same Gene 14 99827183 99828301 1118 gain 1790 SLC25A29 Exon + ve, distinct Yes CNVs, same Gene 14 99828301 99829704 1403 loss 1705 SLC25A29 Exon + ve, distinct Yes CNVs, same Gene 14 102401445 102409996 8551 gain 1447 TRAF3 Exon + ve, 2 cases Yes 14 102401445 102409996 8551 gain 1838 TRAF3 Exon + ve, 2 cases Yes 14 102447174 102447535 361 gain 1447 TRAF3 Exon + ve, 2 cases Yes 14 102447174 102447535 361 loss 1820 TRAF3 Exon + ve, 2 cases Yes 14 102447536 102450225 2689 gain 1447 TRAF3 Exon + ve, 2 cases Yes 14 102447536 102450225 2689 loss 1800 TRAF3 Exon + ve, 2 cases Yes 14 102447536 102450225 2689 loss 1820 TRAF3 Exon + ve, 2 cases Yes 15 26805834 27028093 222259 gain 1988 LOC646278, LOC100289656, APBA2 Exon + ve, 2 cases Yes 15 26805834 27028093 222259 loss 1994 LOC646278, LOC100289656, APBA2 Exon + ve, 2 cases Yes 15 27253448 27314654 61206 gain 1988 FAM189A1 Exon + ve, 2 cases Yes 15 27253448 27314654 61206 loss 1994 FAM189A1 Exon + ve, 2 cases Yes 15 27321201 27469286 148085 gain 1988 FAM189A1, NDNL2 Exon + ve, 2 cases Yes 15 27321201 27469286 148085 loss 1994 FAM189A1, NDNL2 Exon + ve, 2 cases Yes 15 27584561 27687173 102612 gain 1988 FAM189A1 Exon + ve, 2 cases Yes 15 27584561 27687173 102612 loss 1994 FAM189A1 Exon + ve, 2 cases Yes 15 41098343 41101310 2967 loss 1630 UBR1 Exon + ve, 2 cases Yes 15 41098343 41101310 2967 loss 2018 UBR1 Exon + ve, 2 cases Yes 15 42365660 42371493 5833 loss 1638 CASC4 Exon + ve, 2 cases Yes 15 42365660 42371493 5833 loss 1659 CASC4 Exon + ve, 2 cases Yes 15 42365660 42371493 5833 loss 1660 CASC4 Exon + ve, 2 cases Yes 15 42365660 42371493 5833 loss 1662 CASC4 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1237 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1347 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1441 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1456 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1494 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1496 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1497 TEX9, MNS1 Exon + ve, 2 cases Yes 15 54513726 54522863 9137 loss 1997 TEX9, MNS1 Exon + ve, 2 cases Yes 15 56031543 56036056 4513 loss 1680 ALDH1A2 Exon + ve, distinct Yes CNVs, same Gene 15 56039531 56044966 5435 loss 1680 ALDH1A2 Exon + ve, distinct Yes CNVs, same Gene 15 71247339 71258333 10994 gain 1293 NEO1 Exon + ve, 2 cases Yes 15 71247339 71258333 10994 loss 1415 NEO1 Exon + ve, 2 cases Yes 15 72804753 72806259 1506 gain 1309 CYP1A1 Exon + ve, 2 cases Yes 15 72804753 72806259 1506 loss 1415 CYP1A1 Exon + ve, 2 cases Yes 15 73443782 73460290 16508 gain 1301 MAN2C1, SIN3A Exon + ve, 2 cases Yes 15 73443782 73460290 16508 loss 1415 MAN2C1, SIN3A Exon + ve, 2 cases Yes 15 73661881 73680497 18616 loss 1415 SNUPN Exon + ve, 2 cases Yes 15 73661881 73680497 18616 gain 2018 SNUPN Exon + ve, 2 cases Yes 15 73680498 73684636 4138 loss 1415 SNUPN Exon + ve, 2 cases Yes 15 73680498 73684636 4138 loss 1773 SNUPN Exon + ve, 2 cases Yes 15 73680498 73684636 4138 gain 2018 SNUPN Exon + ve, 2 cases Yes 15 73690131 73729295 39164 loss 1415 IMP3, SNX33, SNUPN Exon + ve, 2 cases Yes 15 73690131 73729295 39164 gain 2018 IMP3, SNX33, SNUPN Exon + ve, 2 cases Yes 15 80318994 80323704 4710 gain 1354 EFTUD1 Exon + ve, 2 cases Yes 15 80318994 80323704 4710 gain 1740 EFTUD1 Exon + ve, 2 cases Yes 15 80329016 80364988 35972 gain 1354 EFTUD1, FAM154B Exon + ve, 2 cases Yes 15 80329016 80364988 35972 gain 1740 EFTUD1, FAM154B Exon + ve, 2 cases Yes 15 87996761 87999025 2264 loss 1317 KIF7 Exon + ve, 2 cases Yes 15 87996761 87999025 2264 gain 1548 KIF7 Exon + ve, 2 cases Yes 15 87999026 88001168 2142 loss 1317 KIF7 Exon + ve, 2 cases Yes 15 87999026 88001168 2142 gain 1548 KIF7 Exon + ve, 2 cases Yes 15 87999026 88001168 2142 loss 1738 KIF7 Exon + ve, 2 cases Yes 15 93669003 93671527 2524 gain 1309 LOC400456 Exon + ve, 2 cases Yes 15 93669003 93671527 2524 gain 1825 LOC400456 Exon + ve, 2 cases Yes 15 93669003 93671527 2524 gain 1837 LOC400456 Exon + ve, 2 cases Yes 15 93669003 93671527 2524 gain 1841 LOC400456 Exon + ve, 2 cases Yes 15 99236636 99239178 2542 loss 1544 ALDH1A3 Exon + ve, 2 cases Yes 15 99236636 99239178 2542 loss 1626 ALDH1A3 Exon + ve, 2 cases Yes 15 99236636 99239178 2542 gain 1644 ALDH1A3 Exon + ve, 2 cases Yes 15 99632987 99634433 1446 gain 1404 SELS Exon + ve, 2 cases Yes 15 99632987 99634433 1446 gain 1728 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1389 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1401 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1404 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1413 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1416 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1434 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1446 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1449 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1461 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1477 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1505 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1529 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1548 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1559 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1572 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1576 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1584 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1596 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1609 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1633 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1672 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1687 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1728 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1829 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 gain 1842 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1913 SELS Exon + ve, 2 cases Yes 15 99634434 99635701 1267 loss 1964 SELS Exon + ve, 2 cases Yes 16 3047597 3065144 17547 loss 1585 MMP25, IL32 Exon + ve, 2 cases Yes 16 3047597 3065144 17547 loss 1804 MMP25, IL32 Exon + ve, 2 cases Yes 16 3047597 3065144 17547 loss 1919 MMP25, IL32 Exon + ve, 2 cases Yes 16 3868512 3870704 2192 loss 1533 CREBBP Exon + ve, 2 cases Yes 16 3868512 3870704 2192 loss 1539 CREBBP Exon + ve, 2 cases Yes 16 3868512 3870704 2192 gain 1567 CREBBP Exon + ve, 2 cases Yes 16 3868512 3870704 2192 loss 1590 CREBBP Exon + ve, 2 cases Yes 16 4187745 4192872 5127 loss 1442 SRL Exon + ve, 2 cases Yes 16 4187745 4192872 5127 gain 1567 SRL Exon + ve, 2 cases Yes 16 4554395 4568979 14584 gain 1567 LOC342346 Exon + ve, 2 cases Yes 16 4554395 4568979 14584 loss 1689 LOC342346 Exon + ve, 2 cases Yes 16 4574012 4588011 13999 gain 1567 LOC342346 Exon + ve, 2 cases Yes 16 4574012 4588011 13999 loss 1689 LOC342346 Exon + ve, 2 cases Yes 16 5047987 5049746 1759 loss 1419 C16orf89 Exon + ve, 2 cases Yes 16 5047987 5049746 1759 gain 1567 C16orf89 Exon + ve, 2 cases Yes 16 20861337 20867356 6019 loss 1230 DNAH3 Exon + ve, 2 cases Yes 16 20861337 20867356 6019 loss 1760 DNAH3 Exon + ve, 2 cases Yes 16 22071418 22084314 12896 gain 1426 VWA3A Exon + ve, 2 cases Yes 16 22071418 22084314 12896 gain 1946 VWA3A Exon + ve, 2 cases Yes 16 22071418 22084314 12896 gain 1962 VWA3A Exon + ve, 2 cases Yes 16 28073908 28075568 1660 loss 1295 XPO6 Exon + ve, 2 cases Yes 16 28073908 28075568 1660 loss 1917 XPO6 Exon + ve, 2 cases Yes 16 31384536 31396729 12193 gain 1232 TGFB1I1, ARMC5 Exon + ve, 2 cases Yes 16 31384536 31396729 12193 gain 1508 TGFB1I1, ARMC5 Exon + ve, 2 cases Yes 16 31485690 31487952 2262 gain 1524 CSDAP1 Exon + ve, 2 cases Yes 16 31485690 31487952 2262 gain 1618 CSDAP1 Exon + ve, 2 cases Yes 16 48955985 48960972 4987 loss 1395 BRD7 Exon + ve, 2 cases Yes 16 48955985 48960972 4987 loss 1409 BRD7 Exon + ve, 2 cases Yes 16 48955985 48960972 4987 loss 1428 BRD7 Exon + ve, 2 cases Yes 16 66834856 66838398 3542 loss 1858 PLA2G15 Exon + ve, 2 cases Yes 16 66834856 66838398 3542 loss 2023 PLA2G15 Exon + ve, 2 cases Yes 16 68844017 68850394 6377 loss 1538 AARS Exon + ve, 2 cases Yes 16 68844017 68850394 6377 loss 1793 AARS Exon + ve, 2 cases Yes 16 73303266 73305630 2364 loss 1293 FA2H Exon + ve, 2 cases Yes 16 73303266 73305630 2364 loss 1297 FA2H Exon + ve, 2 cases Yes 16 73305631 73315221 9590 loss 1293 FA2H Exon + ve, 2 cases Yes 16 73305631 73315221 9590 loss 1297 FA2H Exon + ve, 2 cases Yes 16 73305631 73315221 9590 loss 1918 FA2H Exon + ve, 2 cases Yes 16 74135000 74137609 2609 gain 1879 TMEM231 Exon + ve, 2 cases Yes 16 74135000 74137609 2609 gain 1993 TMEM231 Exon + ve, 2 cases Yes 16 74135000 74137609 2609 gain 2032 TMEM231 Exon + ve, 2 cases Yes 16 79711900 79713478 1578 gain 1763 PKD1L2 Exon + ve, distinct Yes CNVs, same Gene 16 79730151 79735088 4937 loss 1404 PKD1L2 Exon + ve, distinct Yes CNVs, same Gene 16 79735089 79744613 9524 loss 1275 PKD1L2 Exon + ve, 2 cases Yes 16 79735089 79744613 9524 loss 1404 PKD1L2 Exon + ve, 2 cases Yes 16 79735089 79744613 9524 loss 1917 PKD1L2 Exon + ve, 2 cases Yes 16 79735089 79744613 9524 loss 1998 PKD1L2 Exon + ve, 2 cases Yes 16 79744614 79747297 2683 loss 1917 PKD1L2 Exon + ve, distinct Yes CNVs, same Gene 16 79747298 79758149 10851 gain 1252 PKD1L2 Exon + ve, 2 cases Yes 16 79747298 79758149 10851 loss 1917 PKD1L2 Exon + ve, 2 cases Yes 16 79758150 79761753 3603 gain 1252 PKD1L2 Exon + ve, 2 cases Yes 16 79758150 79761753 3603 gain 1459 PKD1L2 Exon + ve, 2 cases Yes 16 79758150 79761753 3603 loss 1917 PKD1L2 Exon + ve, 2 cases Yes 16 79761754 79785859 24105 gain 1459 PKD1L2 Exon + ve, 2 cases Yes 16 79761754 79785859 24105 loss 1917 PKD1L2 Exon + ve, 2 cases Yes 16 81442167 81503479 61312 loss 1824 CDH13 Exon + ve, 2 cases Yes 16 81442167 81503479 61312 gain 1875 CDH13 Exon + ve, 2 cases Yes 16 86321579 86326794 5215 loss 1258 KLHDC4 Exon + ve, distinct Yes CNVs, same Gene 16 86347096 86364664 17568 loss 2041 KLHDC4 Exon + ve, distinct Yes CNVs, same Gene 16 88355436 88370375 14939 loss 1274 FANCA Exon + ve, distinct Yes CNVs, same Gene 16 88409839 88412033 2194 gain 1877 FANCA Exon + ve, distinct Yes CNVs, same Gene 17 423069 446585 23516 loss 1268 VPS53 Exon + ve, 2 cases Yes 17 423069 446585 23516 gain 1494 VPS53 Exon + ve, 2 cases Yes 17 6673256 6695979 22723 gain 1600 TEKT1 Exon + ve, 2 cases Yes 17 6673256 6695979 22723 loss 1927 TEKT1 Exon + ve, 2 cases Yes 17 6699298 6745640 46342 loss 1600 ALOX12P2 Exon + ve, 2 cases Yes 17 6699298 6745640 46342 loss 1927 ALOX12P2 Exon + ve, 2 cases Yes 17 18814921 18833619 18698 gain 1596 SLC5A10, FAM83G Exon + ve, 2 cases Yes 17 18814921 18833619 18698 gain 1717 SLC5A10, FAM83G Exon + ve, 2 cases Yes 17 18845632 18864625 18993 gain 1596 SLC5A10, FAM83G Exon + ve, 2 cases Yes 17 18845632 18864625 18993 gain 1717 SLC5A10, FAM83G Exon + ve, 2 cases Yes 17 19924055 19935009 10954 loss 2038 SPECC1 Exon + ve, distinct Yes CNVs, same Gene 17 20154473 20159997 5524 loss 1988 SPECC1 Exon + ve, distinct Yes CNVs, same Gene 17 26220790 26225329 4539 loss 1238 ATAD5 Exon + ve, 2 cases Yes 17 26220790 26225329 4539 loss 1831 ATAD5 Exon + ve, 2 cases Yes 17 26865992 26870510 4518 loss 1411 RAB11FIP4 Special Yes 17 35069605 35072082 2477 loss 1316 STARD3 Exon + ve, 2 cases Yes 17 35069605 35072082 2477 loss 1318 STARD3 Exon + ve, 2 cases Yes 17 35069605 35072082 2477 loss 1676 STARD3 Exon + ve, 2 cases Yes 17 35069605 35072082 2477 loss 2045 STARD3 Exon + ve, 2 cases Yes 17 35072083 35073438 1355 loss 1316 STARD3 Exon + ve, 2 cases Yes 17 35072083 35073438 1355 loss 1318 STARD3 Exon + ve, 2 cases Yes 17 35072083 35073438 1355 loss 1665 STARD3 Exon + ve, 2 cases Yes 17 35072083 35073438 1355 loss 1676 STARD3 Exon + ve, 2 cases Yes 17 35072083 35073438 1355 loss 2045 STARD3 Exon + ve, 2 cases Yes 17 37790601 37795135 4534 loss 1659 STAT3 Exon + ve, 2 cases Yes 17 37790601 37795135 4534 loss 1887 STAT3 Exon + ve, 2 cases Yes 17 38282993 38287021 4028 loss 1295 LOC388387 Exon + ve, 2 cases Yes 17 38282993 38287021 4028 loss 1470 LOC388387 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1319 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1320 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1530 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1533 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1535 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1536 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1537 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1539 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1542 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1586 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1587 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1655 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1656 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1662 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1684 KIAA1267 Exon + ve, 2 cases Yes 17 41514481 41518221 3740 loss 1861 KIAA1267 Exon + ve, 2 cases Yes 17 42143049 42147225 4176 loss 1536 NSF Exon + ve, 2 cases Yes 17 42143049 42147225 4176 gain 1671 NSF Exon + ve, 2 cases Yes 17 42143049 42147225 4176 gain 1751 NSF Exon + ve, 2 cases Yes 17 42143049 42147225 4176 gain 1800 NSF Exon + ve, 2 cases Yes 17 42143049 42147225 4176 gain 1991 NSF Exon + ve, 2 cases Yes 17 42143049 42147225 4176 gain 2032 NSF Exon + ve, 2 cases Yes 17 57327446 57329782 2336 loss 1439 INTS2 Exon + ve, 2 cases Yes 17 57327446 57329782 2336 loss 1601 INTS2 Exon + ve, 2 cases Yes 17 57327446 57329782 2336 loss 1641 INTS2 Exon + ve, 2 cases Yes 17 57329783 57331105 1322 loss 1439 INTS2 Exon + ve, 2 cases Yes 17 57329783 57331105 1322 loss 1601 INTS2 Exon + ve, 2 cases Yes 17 57329783 57331105 1322 loss 1641 INTS2 Exon + ve, 2 cases Yes 17 57329783 57331105 1322 loss 1784 INTS2 Exon + ve, 2 cases Yes 17 72982885 73000459 17574 loss 1825 SEPT9 Exon + ve, 2 cases Yes 17 72982885 73000459 17574 loss 1909 SEPT9 Exon + ve, 2 cases Yes 17 76954271 77777066 822795 Gain 1891 C17orf70, ACTG1, TSPAN10, DCXR, De Novo Yes C17orf90, STRA13, ARL16, MIR3186, NPLOC4, PYCR1, SLC25A10, GPS1, DUS1L, ANAPC11, LOC92659, FASN, ARHGDIA, MAFG, BAHCC1, DYSFIP1, MRPL12, SIRT7, RAC3, CCDC57, P4HB, PCYT2, HGS, RFNG, MYADML2, FSCN2, THOC4, ASPSCR1, CCDC137, NOTUM, NPB, PDE6G, LRRC45 17 77787243 77847938 60695 Loss 1891 SLC16A3, CSNK1D De Novo Yes 18 17999811 18004912 5101 loss 1764 GATA6 Exon + ve, 2 cases Yes 18 17999811 18004912 5101 loss 1969 GATA6 Exon + ve, 2 cases Yes 18 22717441 22728600 11159 loss 1442 C18orf16 Exon + ve, 2 cases Yes 18 22717441 22728600 11159 loss 1502 C18orf16 Exon + ve, 2 cases Yes 19 11450908 11452390 1482 gain 1637 ELAVL3 Exon + ve, 2 cases Yes 19 11450908 11452390 1482 gain 1780 ELAVL3 Exon + ve, 2 cases Yes 19 11450908 11452390 1482 gain 1788 ELAVL3 Exon + ve, 2 cases Yes 19 11450908 11452390 1482 gain 1864 ELAVL3 Exon + ve, 2 cases Yes 19 12026895 12036294 9399 loss 1333 ZNF878 Exon + ve, 2 cases Yes 19 12026895 12036294 9399 loss 1391 ZNF878 Exon + ve, 2 cases Yes 19 12026895 12036294 9399 loss 1742 ZNF878 Exon + ve, 2 cases Yes 19 12651862 12659347 7485 loss 1538 DHPS Exon + ve, 2 cases Yes 19 12651862 12659347 7485 loss 1638 DHPS Exon + ve, 2 cases Yes 19 14665135 14666402 1267 loss 1416 ZNF333 Exon + ve, 2 cases Yes 19 14665135 14666402 1267 loss 1578 ZNF333 Exon + ve, 2 cases Yes 19 14665135 14666402 1267 loss 1881 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1416 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1578 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1677 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1738 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1775 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1826 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1837 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1881 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1957 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 1968 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 2004 ZNF333 Exon + ve, 2 cases Yes 19 14666403 14667646 1243 loss 2031 ZNF333 Exon + ve, 2 cases Yes 19 15420954 15422784 1830 loss 1471 MIR1470, WIZ Exon + ve, 2 cases Yes 19 15420954 15422784 1830 loss 1676 MIR1470, WIZ Exon + ve, 2 cases Yes 19 15420954 15422784 1830 loss 1687 MIR1470, WIZ Exon + ve, 2 cases Yes 19 15420954 15422784 1830 loss 1726 MIR1470, WIZ Exon + ve, 2 cases Yes 19 15420954 15422784 1830 loss 1887 MIR1470, WIZ Exon + ve, 2 cases Yes 19 20619921 20621911 1990 gain 1566 ZNF626 Exon + ve, 2 cases Yes 19 20619921 20621911 1990 gain 1761 ZNF626 Exon + ve, 2 cases Yes 19 23800105 23804481 4376 gain 1541 RPSAP58 Exon + ve, 2 cases Yes 19 23800105 23804481 4376 gain 1608 RPSAP58 Exon + ve, 2 cases Yes 19 23800105 23804481 4376 gain 1783 RPSAP58 Exon + ve, 2 cases Yes 19 47894889 47953617 58728 gain 1281 PSG3, PSG8 Exon + ve, 2 cases Yes 19 47894889 47953617 58728 gain 1282 PSG3, PSG8 Exon + ve, 2 cases Yes 19 53590042 53598814 8772 loss 1671 GRIN2D Exon + ve, 2 cases Yes 19 53590042 53598814 8772 loss 1901 GRIN2D Exon + ve, 2 cases Yes 19 53590042 53598814 8772 loss 1959 GRIN2D Exon + ve, 2 cases Yes 19 53896678 53899041 2363 loss 1227 FUT2 Exon + ve, 2 cases Yes 19 53896678 53899041 2363 loss 1448 FUT2 Exon + ve, 2 cases Yes 19 53896678 53899041 2363 loss 1694 FUT2 Exon + ve, 2 cases Yes 19 53896678 53899041 2363 loss 1697 FUT2 Exon + ve, 2 cases Yes 19 53900764 53901719 955 loss 1227 FUT2 Exon + ve, 2 cases Yes 19 53900764 53901719 955 loss 1448 FUT2 Exon + ve, 2 cases Yes 19 53900764 53901719 955 loss 1694 FUT2 Exon + ve, 2 cases Yes 19 53900764 53901719 955 loss 1697 FUT2 Exon + ve, 2 cases Yes 19 56882602 56889437 6835 loss 1232 MIR99B, MIRLET7E, MIR125A, Exon + ve, 2 cases Yes NCRNA00085 19 56882602 56889437 6835 loss 1859 MIR99B, MIRLET7E, MIR125A, Exon + ve, 2 cases Yes NCRNA00085 19 56882602 56889437 6835 loss 1965 MIR99B, MIRLET7E, MIR125A, Exon + ve, 2 cases Yes NCRNA00085 19 56882602 56889437 6835 loss 1993 MIR99B, MIRLET7E, MIR125A, Exon + ve, 2 cases Yes NCRNA00085 19 56882602 56889437 6835 loss 2032 MIR99B, MIRLET7E, MIR125A, Exon + ve, 2 cases Yes NCRNA00085 19 57718358 57733017 14659 loss 1678 ZNF808 Exon + ve, 2 cases Yes 19 57718358 57733017 14659 loss 1855 ZNF808 Exon + ve, 2 cases Yes 19 58919358 58920522 1164 gain 1585 MIR516B2 Exon + ve, 2 cases Yes 19 58919358 58920522 1164 gain 1606 MIR516B2 Exon + ve, 2 cases Yes 19 59177873 59179145 1272 loss 1720 CACNG8 Exon + ve, 2 cases Yes 19 59177873 59179145 1272 loss 1859 CACNG8 Exon + ve, 2 cases Yes 19 59179146 59180502 1356 loss 1720 CACNG8 Exon + ve, 2 cases Yes 19 59179146 59180502 1356 loss 1859 CACNG8 Exon + ve, 2 cases Yes 19 59179146 59180502 1356 loss 1953 CACNG8 Exon + ve, 2 cases Yes 19 59180503 59183718 3215 loss 1720 CACNG8 Exon + ve, 2 cases Yes 19 59180503 59183718 3215 loss 1859 CACNG8 Exon + ve, 2 cases Yes 19 59180503 59183718 3215 loss 1953 CACNG8 Exon + ve, 2 cases Yes 19 59180503 59183718 3215 loss 1966 CACNG8 Exon + ve, 2 cases Yes 19 62343981 62349061 5080 loss 1461 ZIM3 Exon + ve, 2 cases Yes 19 62343981 62349061 5080 loss 1995 ZIM3 Exon + ve, 2 cases Yes 19 62343981 62349061 5080 loss 1996 ZIM3 Exon + ve, 2 cases Yes 19 62653275 62660645 7370 loss 1461 VN1R1 Exon + ve, 2 cases Yes 19 62653275 62660645 7370 loss 1522 VN1R1 Exon + ve, 2 cases Yes 19 63655893 63669151 13258 loss 1454 ZNF324B Exon + ve, 2 cases Yes 19 63655893 63669151 13258 gain 1862 ZNF324B Exon + ve, 2 cases Yes 20 26127265 26144660 17395 gain 1694 MIR663 Exon + ve, 2 cases Yes 20 26127265 26144660 17395 gain 1793 MIR663 Exon + ve, 2 cases Yes 20 30793762 30795954 2192 loss 1241 COMMD7 Exon + ve, 2 cases Yes 20 30793762 30795954 2192 loss 1901 COMMD7 Exon + ve, 2 cases Yes 20 33633288 33634683 1395 loss 1419 FER1L4 Exon + ve, 2 cases Yes 20 33633288 33634683 1395 loss 1774 FER1L4 Exon + ve, 2 cases Yes 20 52074911 52078883 3972 loss 1354 BCAS1 Exon + ve, 2 cases Yes 20 52074911 52078883 3972 loss 1860 BCAS1 Exon + ve, 2 cases Yes 21 27260832 27262559 1727 loss 1442 ADAMTS5 Exon + ve, 2 cases Yes 21 27260832 27262559 1727 loss 1522 ADAMTS5 Exon + ve, 2 cases Yes 21 27260832 27262559 1727 loss 1714 ADAMTS5 Exon + ve, 2 cases Yes 21 27260832 27262559 1727 loss 1828 ADAMTS5 Exon + ve, 2 cases Yes 21 27260832 27262559 1727 loss 1915 ADAMTS5 Exon + ve, 2 cases Yes 22 16366605 16373481 6876 loss 1226 CECR2 Exon + ve, 2 cases Yes 22 16366605 16373481 6876 loss 1694 CECR2 Exon + ve, 2 cases Yes 22 16635762 16642926 7164 loss 1718 BID Exon + ve, 2 cases Yes 22 16635762 16642926 7164 loss 1859 BID Exon + ve, 2 cases Yes 22 16661122 16680825 19703 loss 1780 MICAL3 Exon + ve, 2 cases Yes 22 16661122 16680825 19703 loss 1805 MICAL3 Exon + ve, 2 cases Yes 22 16661122 16680825 19703 loss 2034 MICAL3 Exon + ve, 2 cases Yes 22 22324940 22354944 30004 loss 1549 LOC91316 Exon + ve, distinct Yes CNVs, same Gene 22 22362348 22369101 6753 gain 1895 LOC91316, RGL4 Exon + ve, distinct Yes CNVs, same Gene 22 24636477 24646275 9798 gain 1348 MIR1302-1, MYO18B Exon + ve, 2 cases Yes 22 24636477 24646275 9798 loss 1833 MIR1302-1, MYO18B Exon + ve, 2 cases Yes 22 34951404 34973305 21901 loss 1724 APOL2 Exon + ve, 2 cases Yes 22 34951404 34973305 21901 loss 2035 APOL2 Exon + ve, 2 cases Yes 22 37737241 37740258 3017 loss 1959 APOBEC3C Exon + ve, 2 cases Yes 22 37737241 37740258 3017 loss 1965 APOBEC3C Exon + ve, 2 cases Yes 22 45453176 45454102 926 gain 1660 GRAMD4 Exon + ve, 2 cases Yes 22 45453176 45454102 926 gain 1880 GRAMD4 Exon + ve, 2 cases Yes 22 48680818 48687314 6496 loss 1619 ALG12 Exon + ve, 2 cases Yes 22 48680818 48687314 6496 loss 1930 ALG12 Exon + ve, 2 cases Yes X 2742852 2743950 1098 gain 1434 XG Exon + ve, 2 cases Yes X 2742852 2743950 1098 gain 1509 XG Exon + ve, 2 cases Yes X 2742852 2743950 1098 gain 1732 XG Exon + ve, 2 cases Yes X 2742852 2743950 1098 gain 1825 XG Exon + ve, 2 cases Yes X 2742852 2743950 1098 gain 1917 XG Exon + ve, 2 cases Yes X 2749116 2768212 19096 gain 1434 GYG2 Exon + ve, 2 cases Yes X 2749116 2768212 19096 gain 1509 GYG2 Exon + ve, 2 cases Yes X 2749116 2768212 19096 gain 1732 GYG2 Exon + ve, 2 cases Yes X 2749116 2768212 19096 gain 1825 GYG2 Exon + ve, 2 cases Yes X 2749116 2768212 19096 gain 1917 GYG2 Exon + ve, 2 cases Yes X 2768213 2788489 20276 gain 1434 GYG2 Exon + ve, 2 cases Yes X 2768213 2788489 20276 gain 1509 GYG2 Exon + ve, 2 cases Yes X 2768213 2788489 20276 loss 1654 GYG2 Exon + ve, 2 cases Yes X 2768213 2788489 20276 gain 1732 GYG2 Exon + ve, 2 cases Yes X 2768213 2788489 20276 gain 1825 GYG2 Exon + ve, 2 cases Yes X 2768213 2788489 20276 gain 1917 GYG2 Exon + ve, 2 cases Yes X 2788490 2814330 25840 gain 1434 GYG2 Exon + ve, 2 cases Yes X 2788490 2814330 25840 gain 1509 GYG2 Exon + ve, 2 cases Yes X 2788490 2814330 25840 gain 1732 GYG2 Exon + ve, 2 cases Yes X 2788490 2814330 25840 gain 1825 GYG2 Exon + ve, 2 cases Yes X 2788490 2814330 25840 gain 1917 GYG2 Exon + ve, 2 cases Yes X 8397975 8463130 65155 gain 1566 KAL1 Exon + ve, 2 cases Yes X 8397975 8463130 65155 gain 1901 KAL1 Exon + ve, 2 cases Yes X 8463131 8473482 10351 loss 1298 KAL1 Exon + ve, 2 cases Yes X 8463131 8473482 10351 loss 1432 KAL1 Exon + ve, 2 cases Yes X 8463131 8473482 10351 gain 1566 KAL1 Exon + ve, 2 cases Yes X 8463131 8473482 10351 gain 1901 KAL1 Exon + ve, 2 cases Yes X 8473483 8531260 57777 gain 1566 KAL1 Exon + ve, 2 cases Yes X 8473483 8531260 57777 gain 1901 KAL1 Exon + ve, 2 cases Yes X 8532842 8553485 20643 gain 1566 KAL1 Exon + ve, 2 cases Yes X 8532842 8553485 20643 gain 1901 KAL1 Exon + ve, 2 cases Yes X 8931895 8958319 26424 loss 1496 FAM9B Exon + ve, 2 cases Yes X 8960105 8963721 3616 gain 1454 FAM9B Exon + ve, 2 cases Yes X 12833576 12834706 1130 loss 1633 TLR8, LOC349408 Exon + ve, 2 cases Yes X 12833576 12834706 1130 loss 1901 TLR8, LOC349408 Exon + ve, 2 cases Yes X 12833576 12834706 1130 loss 2024 TLR8, LOC349408 Exon + ve, 2 cases Yes X 13673158 13674550 1392 loss 1320 OFD1 Exon + ve, 2 cases Yes X 13695016 13696059 1043 gain 1590 OFD1 Exon + ve, 2 cases Yes X 15463254 15464663 1409 loss 1234 BMX Exon + ve, 2 cases Yes X 15463254 15464663 1409 loss 1320 BMX Exon + ve, 2 cases Yes X 15463254 15464663 1409 loss 1822 BMX Exon + ve, 2 cases Yes X 15463254 15464663 1409 loss 1827 BMX Exon + ve, 2 cases Yes X 15463254 15464663 1409 loss 1876 BMX Exon + ve, 2 cases Yes X 29595687 29597689 2002 loss 1506 IL1RAPL1 Exon + ve, 2 cases Yes X 29595687 29597689 2002 loss 1811 IL1RAPL1 Exon + ve, 2 cases Yes X 32210107 32228244 18137 gain 2018 DMD Exon + ve, 2 cases Yes X 32958581 33069843 111262 gain 1864 DMD Exon + ve, 2 cases Yes X 33074762 33228204 153442 gain 1864 DMD Exon + ve, 2 cases Yes X 33230517 33336759 106242 gain 1864 DMD Exon + ve, 2 cases Yes X 40938342 40940809 2467 loss 1415 USP9X Exon + ve, 2 cases Yes X 40940810 40942301 1491 loss 1415 USP9X Exon + ve, 2 cases Yes X 40940810 40942301 1491 loss 1583 USP9X Exon + ve, 2 cases Yes X 43457175 43465307 8132 Loss 1369 MAOA Intronic No X 43458232 43465307 7075 Loss 1300 MAOA Intronic No X 43458232 43465307 7075 Loss 1697 MAOA Intronic No X 43458232 43465307 7075 Loss 1751 MAOA Intronic No X 43458232 43465307 7075 Loss 1800 MAOA Intronic No X 43458232 43465307 7075 Loss 1842 MAOA Intronic No X 43458232 43465307 7075 Loss 1848 MAOA Intronic No X 43458232 43465307 7075 Loss 1855 MAOA Intronic No X 43458232 43465307 7075 Loss 1859 MAOA Intronic No X 43458232 43465307 7075 Loss 1898 MAOA Intronic No X 43458232 43465307 7075 Loss 1907 MAOA Intronic No X 43458232 43465307 7075 Loss 1916 MAOA Intronic No X 43458232 43465307 7075 Loss 1921 MAOA Intronic No X 43458232 43465307 7075 Loss 1935 MAOA Intronic No X 43458232 43465307 7075 Loss 1946 MAOA Intronic No X 43458232 43465307 7075 Loss 1958 MAOA Intronic No X 43458232 43465307 7075 Loss 1960 MAOA Intronic No X 43458232 43465307 7075 Loss 1961 MAOA Intronic No X 43458232 43465307 7075 Loss 1965 MAOA Intronic No X 43458232 43465307 7075 Loss 1966 MAOA Intronic No X 43458232 43465307 7075 Loss 1967 MAOA Intronic No X 43458232 43465307 7075 Loss 1969 MAOA Intronic No X 43458232 43465307 7075 Loss 1993 MAOA Intronic No X 43458232 43465307 7075 Loss 2033 MAOA Intronic No X 43458232 43465307 7075 Loss 2035 MAOA Intronic No X 46832380 46837814 5434 loss 1675 RGN Exon + ve, 2 cases Yes X 46832380 46837814 5434 gain 1896 RGN Exon + ve, 2 cases Yes X 46832380 46837814 5434 gain 2040 RGN Exon + ve, 2 cases Yes X 48688957 48716140 27183 gain 1349 KCND1, OTUD5, GRIPAP1 Exon + ve, 2 cases Yes X 48688957 48716140 27183 loss 1639 KCND1, OTUD5, GRIPAP1 Exon + ve, 2 cases Yes X 70060068 70062203 2135 gain 1284 SLC7A3 Exon + ve, 2 cases Yes X 70060068 70062203 2135 gain 1308 SLC7A3 Exon + ve, 2 cases Yes X 70060068 70062203 2135 gain 1346 SLC7A3 Exon + ve, 2 cases Yes X 96561809 96658023 96214 gain 1348 DIAPH2 Exon + ve, 2 cases Yes X 96718563 97203519 484956 gain 1348 DIAPH2 Exon + ve, 2 cases Yes X 100665462 100673058 7596 gain 1269 ARMCX4 Exon + ve, 2 cases Yes X 100665462 100673058 7596 loss 1413 ARMCX4 Exon + ve, 2 cases Yes X 100665462 100673058 7596 gain 1857 ARMCX4 Exon + ve, 2 cases Yes X 105750701 105752733 2032 loss 1239 CXorf57 Exon + ve, 2 cases Yes X 105750701 105752733 2032 loss 1372 CXorf57 Exon + ve, 2 cases Yes X 123691710 123698719 7009 loss 1421 ODZ1 Exon + ve, 2 cases Yes X 123691710 123698719 7009 loss 1428 ODZ1 Exon + ve, 2 cases Yes X 123691710 123698719 7009 loss 1805 ODZ1 Exon + ve, 2 cases Yes X 128772381 128775324 2943 gain 1806 ZDHHC9 Exon + ve, 2 cases Yes X 128772381 128775324 2943 gain 1824 ZDHHC9 Exon + ve, 2 cases Yes X 128775325 128777107 1782 gain 1459 ZDHHC9 Exon + ve, 2 cases Yes X 128775325 128777107 1782 gain 1806 ZDHHC9 Exon + ve, 2 cases Yes X 128775325 128777107 1782 gain 1824 ZDHHC9 Exon + ve, 2 cases Yes X 137525298 137527811 2513 gain 1223 LOC158696 Exon + ve, 2 cases Yes X 137525298 137527811 2513 gain 2041 LOC158696 Exon + ve, 2 cases Yes X 151736328 151770679 34351 gain 1887 CETN2, NSDHL Exon + ve, 2 cases Yes X 151788383 151853605 65222 gain 1887 ZNF185, NSDHL Exon + ve, 2 cases Yes X 154321522 154375563 54041 gain 1831 F8A1, F8A3, F8A2, H2AFB3, H2AFB2, Exon + ve, 2 cases Yes H2AFB1, MIR1184-1, MIR1184-2, MIR1184-3, TMLHE X 154404962 154427678 22716 gain 1724 TMLHE Exon + ve, 2 cases Yes * Position references refer to the human genomic sequence Hg18 March 2006 (NCBI Build 36.1).
[0224] Table 2 is identical to Table 1, with four exceptions. Firstly, the CNV coordinates listed refer to the actual CNV subregions found to be unique or significantly different in frequency between ASD and Normal cohorts, as opposed to Table 1, which lists the originating CNVs. For example, a CNV of a particular size/length (e.g., 100,000 bp) in an ASD patient may contain one or more smaller subregions within it (e.g., 10,000 bp in size/length) that do not occur at higher frequency in one or more ASD patients relative to the normal cohort. Another example is that a CNV unique to, or present at higher frequency in, ASD patients relative to normal subjects may partially overlap a second CNV that is present at comparable or higher frequency in normal subjects; in this case, only the unique subregion is reported in Table 2 as such subregions may further refine specific genomic loci causative of autism/ASD phenotypes. Secondly, an extra column details whether the CNV subregion of interest overlaps an exon or only an intron. Thirdly, no OR values are reported (see Table 1 for OR values). Fourthly, gene annotation is for CNV subregions only (i.e., other genes that may be impacted by the parent CNV reported in Table 1 are excluded if they are not likewise impacted by the CNV subregion(s)). De novo refers to CNV subregions found to occur in the offspring of two parents, neither of whom has the relevant CNV subregion(s); Intronic refers to CNV subregions affecting introns only; Ctrl pos High OR refers to CNV subregions present at high frequency in the ASD cohort compared to the normal cohort; Exon+ve, distinct CNVs, same Gene refers to CNV subregions in 2 or more ASD individuals affecting different exons of the same gene; Exon+ve, 2 cases refers to CNV subregions in 2 or more ASD individuals affecting the same exon of a gene; Special refers to CNV subregions added to list because of relationship to genes with strong biological evidence in ASD.
[0225] Column 2 refers to the nucleotide position in the respective chromosome (column 1) where the corresponding CNV subregion begins and column 3 refers to the nucleotide position in the respective chromosome where the corresponding CNV subregion ends. Column 4 refers to the length of the CNV subregion in bps. Nucleotide positions were determined using the database Hg18 Mar. 2006 (NCBI Build 36.1). The CNV classifications of gain or loss indicate whether each CNV subregion found in the subjects was duplicated/amplified (gain) or deleted (loss) in the genome.
TABLE-US-00003 TABLE 3 GENE NAME CNV Gene Region NCBI Gene ID Gene Description RefSeq Summmary AARS Exonic 16 alanyl-tRNA synthetase, cytoplasmic The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E. coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, July 2008]. ABCA13 Exonic 154664 ATP-binding cassette sub-family A member 13 In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated. [provided by RefSeq, March 2009]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ABCB4 Exonic 5244 multidrug resistance protein 3 isoform B The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, July 2008]. Transcript Variant: This variant (B) uses an alternate in-frame splice site in the 3 coding region, compared to variant A, resulting in a longer protein (isoform B). ACAD10 Exonic 80724 acyl-CoA dehydrogenase family member 10 isoform a This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N- terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, November 2008]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). ACTG1 Exonic 71 actin, cytoplasmic 2 Actins are highly conserved proteins that are involved in various types of cell motility, and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta and gamma have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Mutations in this gene are associated with DFNA20/26, a subtype of autosomal dominant non-syndromic sensorineural progressive hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, January 2011]. Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein. ADAMTS5 Exonic 11096 A disintegrin and metalloproteinase with thrombospondin This gene encodes a member of the ADAMTS (a disintegrin and motifs 5 preproprotein metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C- terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene contains two C-terminal TS motifs and functions as aggrecanase to cleave aggrecan, a major proteoglycan of cartilage. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ADAMTS9 Exonic 56999 A disintegrin and metalloproteinase with thrombospondin This gene encodes a member of the ADAMTS (a disintegrin and motifs 9 preproprotein metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C- terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. [provided by RefSeq, July 2008]. AIG1 Exonic 51390 androgen-induced gene 1 protein N/A AKNA Exonic 80709 AT-hook-containing transcription factor N/A AKR1B15 Exonic 441282 aldo-keto reductase family 1 member B15 N/A ALB Exonic 213 serum albumin preproprotein Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin. [provided by RefSeq, July 2008]. ALDH1A2 Exonic 8854 retinal dehydrogenase 2 isoform 3 This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]. Transcript Variant: This variant (3) differs in the 5 UTR and coding sequence compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. ALDH1A3 Exonic 220 aldehyde dehydrogenase family 1 member A3 Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The enzyme encoded by this gene uses retinal as a substrate, either in a free or cellular retinol-binding protein form. [provided by RefSeq, July 2008]. ALDH2 Exonic 217 aldehyde dehydrogenase, mitochondrial isoform 2 precursor This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of Orientals have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among Orientals than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, March 2011]. Transcript Variant: This variant (2) lacks an in-frame exon in the 5 coding region, compared to variant 1, and encodes a shorter isoform (2), compared to isoform 1. ALG12 Exonic 79087 dol-P-Man:Man(7)GlcN Ac(2)-PP-Dol alpha-1,6- This gene encodes a member of the glycosyltransferase 22 family. The encoded mannosyltransferase protein catalyzes the addition of the eighth mannose residue in an alpha-1,6 linkage onto the dolichol-PP-oligosaccharide precursor (dolichol-PP- Man(7)GlcNAc(2)) required for protein glycosylation. Mutations in this gene have been associated with congenital disorder of glycosylation type Ig (CDG- Ig)characterized by abnormal N-glycosylation. [provided by RefSeq, July 2008]. ALMS1P Exonic 200420 N/A N/A ALOX12P2 Exonic 245 N/A N/A ALS2CL Exonic 259173 ALS2 C-terminal-like protein isoform 3 N/A AMBP Exonic 259 protein AMBP preproprotein This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1- microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, July 2008]. ANAPC11 Exonic 51529 anaphase-promoting complex subunit 11 isoform 2 N/A ANKRD17 Exonic 26057 ankyrin repeat domain-containing protein 17 isoform b This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies in mice suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. ANKRD33 Exonic 341405 ankyrin repeat domain-containing protein 33 isoform 2 N/A ANKRD33B Exonic 651746 ankyrin repeat domain-containing protein 33B N/A ANKRD34A Exonic 284615 ankyrin repeat domain-containing protein 34A N/A ANKRD35 Exonic 148741 ankyrin repeat domain-containing protein 35 N/A ANKS1B Exonic 56899 ankyrin repeat and sterile alpha motif domain-containing This gene encodes a multi-domain protein that is predominantly expressed in protein 1B isoform 1 brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1; 19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID: 15004329) have been described for this gene. [provided by RefSeq, August 2011]. Transcript Variant: This variant (12) differs in the 5 UTR and coding region compared to variant 1. The resulting isoform (1) has a shorter and distinct N-terminus compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ANO5 Exonic 203859 anoctamin-5 isoform b This gene encodes a member of the anoctamin family of transmembrane proteins. The encoded protein is likely a calcium activated chloride channel. Mutations in this gene have been associated with gnathodiaphyseal dysplasia. Alternatively spliced transcript variants have been described. [provided by RefSeq, November 2009]. Transcript Variant: This variant (2) lacks an alternate in- frame segment, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. ANUBL1 Exonic N/A N/A N/A ANXA6 Exonic 309 annexin A6 isoform 2 Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, August 2010]. Transcript Variant: This variant (2) differs in the 5 UTR, lacks a portion of the 5 coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. AP3M2 Exonic 10947 AP-3 complex subunit mu-2 This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, August 2008]. Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein. APBA2 Exonic 321 amyloid beta A4 precursor protein-binding family A The protein encoded by this gene is a member of the X11 protein family. It is a member 2 isoform b neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks an alternate in- frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. APOBEC3C Exonic 27350 probable DNA dC->dU-editing enzyme APOBEC-3C This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. [provided by RefSeq, July 2008]. APOL2 Exonic 23780 apolipoprotein L2 This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (beta) differs in the 5 UTR compared to variant alpha. Both variants encode the same protein. ARFGAP2 Exonic 84364 ADP-ribosylation factor GTPase-activating protein 2 N/A isoform 1 ARHGAP10 Exonic 79658 rho GTPase-activating protein 10 N/A ARHGAP15 Exonic 55843 rho GTPase-activating protein 15 RHO GTPases (see ARHA; MIM 165390) regulate diverse biologic processes, and their activity is regulated by RHO GTPase-activating proteins (GAPs), such as ARHGAP15 (Seoh et al., 2003 [PubMed 12650940]). [supplied by OMIM, March 2008]. ARHGAP21 Exonic 57584 rho GTPase-activating protein 21 ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]). [supplied by OMIM, March 2008]. Sequence Note: The 5-most in-frame translation start codon is selected for this RefSeq and is well-conserved among mammalian species. An alternative start codon that would reduce the protein length by 1 aa is also present. The use of the downstream start codon is assumed in the literature, including PMIDs: 12056806, 15793564 and 17347647. ARHGDIA Exonic 396 rho GDP-dissociation inhibitor 1 isoform a Aplysia Ras-related homologs (ARHs), also called Rho genes, belong to the RAS gene superfamily encoding small guanine nucleotide exchange (GTP/GDP) factors. The ARH proteins may be kept in the inactive, GDP-bound state by interaction with GDP dissociation inhibitors, such as ARHGDIA (Leffers et al., 1993 [PubMed 8262133]).[supplied by OMIM, January 2009]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode isoform a. ARHGEF26 Exonic 26084 Src homology 3 domain-containing guanine nucleotide This gene encodes a member of the Rho-guanine nucleotide exchange factor exchange factor isoform 1 (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, October 2011]. Transcript Variant: This variant (2) differs in the 5 UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. ARL16 Exonic 339231 ADP-ribosylation factor-like protein 16 N/A ARMC5 Exonic 79798 armadillo repeat-containing protein 5 isoform a precursor N/A ARMCX4 Exonic 100131755 N/A N/A ASPSCR1 Exonic 79058 N/A The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X; 17)(p11; q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, October 2011]. Transcript Variant: This variant (3) lacks an internal exon in the 5 region, which results in a frame-shift and premature translation termination, compared to variant 1. The resulting transcript is a nonsense-mediated mRNA decay candidate. ASTN2 Exonic 23245 astrotactin-2 isoform f This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]. Transcript Variant: This variant (6) has multiple differences compared to variant 1. These differences result in a distinct 5 UTR and lead to translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (f) has distinct N- and C- termini and is shorter than isoform a. ATAD5 Exonic 79915 ATPase family AAA domain-containing protein 5 N/A ATRNL1 Exonic 26033 attractin-like protein 1 precursor N/A BAHCC1 Exonic 57597 BAH and coiled-coil domain-containing protein 1 N/A BASP1P1 Exonic 646201 N/A N/A BCAP29 Exonic 55973 B-cell receptor-associated protein 29 isoform a N/A BCAS1 Exonic 8537 breast carcinoma-amplified sequence 1 This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. BID Exonic 637 BH3-interacting domain death agonist isoform 3 This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH- terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, July 2008]. Transcript Variant: This variant (7) lacks two alternate coding exons compared to variant 1, that causes a frameshift. This variant uses a downstream in-frame start-codon, so the encoded isoform 3 has a shorter N- terminus, as compared to isoform 1. BMX Exonic 660 cytoplasmic tyrosine-protein kinase BMX This gene encodes a non-receptor tyrosine kinase belonging to the Tec kinase family. The protein contains a PH-like domain, which mediates membrane targeting by binding to phosphatidylinositol 3,4,5-triphosphate (PIP3), and a SH2 domain that binds to tyrosine-phosphorylated proteins and functions in signal transduction. The protein is implicated in several signal transduction pathways including the Stat pathway, and regulates differentiation and tumorigenicity of several types of cancer cells. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, September 2009]. Transcript Variant: This variant (2) has an alternate 5 UTR exon, as compared to variant 1. Both variants 1 and 2 encode the same protein. BRD7 Exonic 29117 bromodomain-containing protein 7 isoform 1 This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, July 2010]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. BTG4 Exonic 54766 protein BTG4 The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein can induce G1 arrest in the cell cycle. [provided by RefSeq, July 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. BTN2A1 Exonic 11120 butyrophilin subfamily 2 member A1 isoform 4 precursor This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is an integral plasma membrane B box protein involved in lipid, fatty-acid and sterol metabolism. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, October 2010]. Transcript Variant: This variant (4) has an alternate 3 exon compared to variant 1. The encoded isoform (4) is shorter and has a unique C- terminus compared to isoform 1. BTN3A3 Exonic 10384 butyrophilin subfamily 3 member A3 isoform c The butyrophilin (BTN) genes are a group of major histocompatibility complex (MHC)-associated genes that encode type I membrane proteins with 2 extracellular immunoglobulin (Ig) domains and an intracellular B30.2 (PRYSPRY) domain. Three subfamilies of human BTN genes are located in the MHC class I region: the single-copy BTN1A1 gene (MIM 601610) and the BTN2 (e.g., BTN2A1; MIM 613590) and BTN3 (e.g., BNT3A3) genes, which have undergone tandem duplication, resulting in 3 copies of each (summary by Smith et al., 2010 [PubMed 20208008]). [supplied by OMIM, November 2010]. Transcript Variant: This variant (3) lacks several exons in two regions, but the open reading frame is retained, compared to variant 1. The encoded isoform (c) has a shorter N-terminus and lacks an internal segment, compared to isoform a. BTNL3 Exonic 10917 butyrophilin-like protein 3 precursor N/A C11orf49 Exonic 79096 UPF0705 protein C11orf49 isoform 4 N/A C11orf96 Exonic 387763 uncharacterized protein C11orf96 N/A C12orf47 Exonic 51275 N/A N/A C13orf38 Exonic N/A N/A N/A C13orf38- Exonic N/A N/A N/A SOHLH2 C14orf166 Exonic 51637 UPF0568 protein C14orf166 N/A C16orf89 Exonic 146556 UPF0764 protein C16orf89 isoform 1 precursor This gene is expressed predominantly in the thyroid. Based on expression patterns similar to thyroid transcription factors and proteins, this gene may function in the development and function of the thyroid. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, October 2011]. Transcript Variant: This variant (1) encodes the longer isoform (1). C17orf70 Exonic 80233 Fanconi anemia-associated protein of 100 kDa isoform b FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]). [supplied by OMIM, March 2008]. Transcript Variant: This variant (2) represents the shorter transcript and encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. C17orf90 Exonic 339229 uncharacterized protein C17orf90 N/A C18orf16 Exonic N/A N/A N/A C1orf106 Exonic 55765 uncharacterized protein C1orf106 isoform 2 N/A C1orf144 Exonic 26099 UPF0485 protein C1orf144 isoform 1 N/A C2orf15 Exonic 150590 uncharacterized protein C2orf15 N/A C2orf48 Exonic 348738 uncharacterized protein C2orf48 N/A C3orf43 Exonic 255798 uncharacterized protein C3orf43 N/A C4orf37 Exonic 285555 uncharacterized protein C4orf37 N/A C6orf126 Exonic 389383 colipase-like protein C6orf126 precursor N/A C6orf127 Exonic 340204 colipase-like protein C6orf127 precursor N/A C6orf99 Exonic 100130967 putative uncharacterized protein C6orf99 N/A C7orf63 Exonic 79846 uncharacterized protein C7orf63 isoform 1 N/A C9orf85 Exonic 138241 uncharacterized protein C9orf85 N/A C9orf93 Exonic 203238 uncharacterized protein C9orf93 N/A CACNA2D3 Exonic 55799 voltage-dependent calcium channel subunit alpha- This gene encodes a member of the alpha-2/delta subunit family, a protein in 2/delta-3 precursor the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, July 2008]. CACNG8 Exonic 59283 voltage-dependent calcium channel gamma-8 subunit The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight- member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type II TARP and a calcium channel gamma subunit. The mRNA for this gene is believed to initiate translation from a non- AUG (CUG) start codon. [provided by RefSeq, December 2010]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CADPS2 Exonic 93664 calcium-dependent secretion activator 2 isoform c This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, November 2009]. Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CAMSAP1L1 Exonic N/A N/A N/A CAPN14 Exonic 440854 calpain-14 Calpains are a family of cytosolic calcium-activated cysteine proteases involved in a variety of cellular processes including apoptosis, cell division, modulation of integrin-cytoskeletal interactions, and synaptic plasticity (Dear et al., 2000 [PubMed 10964513]). CAPN14 belongs to the calpain large subunit family. [supplied by OMIM, March 2008]. CASC4 Exonic 113201 protein CASC4 isoform b The increased expression level of this gene is associated with HER-2/neu proto- oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. Alternatively spliced variants encoding different isoforms have been identified for this gene. [provided by RefSeq, December 2010]. Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (b), that is missing an internal segment compared to isoform a. CASP10 Exonic 843 caspase-10 isoform 6 preproprotein This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, April 2011]. Transcript Variant: This variant (6) lacks two in-frame coding exons compared to variant 1. This results in a shorter isoform (6) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDC137 Exonic 339230 coiled-coil domain-containing protein 137 N/A CCDC18 Exonic 343099 coiled-coil domain-containing protein 18 N/A CCDC57 Exonic 284001 coiled-coil domain-containing protein 57 N/A CCM2 Exonic 83605 malcavernin isoform 4 This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, November 2009]. Transcript Variant: This variant (4) represents use of an alternate promoter and 5 UTR, uses a distinct start codon, and lacks two alternate in- frame exons in the central coding region, compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus and lacks an internal segment, compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. CD109 Exonic 135228 CD109 antigen isoform 3 precursor This gene encodes a member of the alpha2-macroglobulin/complement superfamily. The encoded GPI-linked glycoprotein is found on the cell surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signaling of transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, April 2009]. Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5 coding region, compared to variant 1. The resulting isoform (3) lacks an internal 77-aa segment near the N-terminus, compared to isoform 1. CD46 Exonic 4179 membrane cofactor protein isoform 14 precursor The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, June 2010]. Transcript Variant: This variant (n) lacks three alternate in-frame exons as well as an alternate segment compared to variant a, which causes a frameshift. The resulting isoform (14) is shorter and has a distinct C-terminus compared to isoform 1. CDH13 Exonic 1012 cadherin-13 isoform 6 precursor This gene encodes a member of the cadherin superfamily. The encoded protein is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. The protein lacks the cytoplasmic domain characteristic of other cadherins, and so is not thought to be a cell-cell adhesion glycoprotein. This protein acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. The gene is hypermethylated in many types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]. Transcript Variant: This variant (6) lacks several coding exons and includes two alternate exons at the 3 end, compared to variant 1. It encodes isoform 6, which is shorter and has a distinct C-terminus, compared to isoform 1. CECR2 Exonic 27443 cat eye syndrome critical region protein 2 N/A CEL Exonic 1056 bile salt-activated lipase precursor The protein encoded by this gene is a glycoprotein secreted from the pancreas into the digestive tract and from the lactating mammary gland into human milk. The physiological role of this protein is in cholesterol and lipid-soluble vitamin ester hydrolysis and absorption. This encoded protein promotes large chylomicron production in the intestine. Also its presence in plasma suggests its interactions with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. In pancreatic tumoral cells, this encoded protein is thought to be sequestrated within the Golgi compartment and is probably not secreted. This gene contains a variable number of tandem repeat (VNTR) polymorphism in the coding region that may influence the function of the encoded protein. [provided by RefSeq, July 2008]. CELSR3 Exonic 1951 cadherin EGF LAG seven-pass G-type receptor 3 precursor The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, July 2008]. CEP57 Exonic 9702 centrosomal protein of 57 kDa isoform a This gene encodes a cytoplasmic protein called Translokin. This protein localizes to the centrosome and has a function in microtubular stabilization. The N-terminal half of this protein is required for its centrosome localization and for its multimerization, and the C-terminal half is required for nucleating, bundling and anchoring microtubules to the centrosomes. This protein specifically interacts with fibroblast growth factor 2 (FGF2), sorting nexin 6, Ran-binding protein M and the kinesins KIF3A and KIF3B, and thus mediates the nuclear translocation and mitogenic activity of the FGF2. It also interacts with cyclin D1 and controls nucleocytoplasmic distribution of the cyclin D1 in quiescent cells. This protein is crucial for maintaining correct chromosomal number during cell division. Mutations in this gene cause mosaic variegated aneuploidy syndrome, a rare autosomal recessive disorder. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, August 2011]. Transcript Variant: This variant (1) encodes the longest isoform (a). CETN2 Exonic 1069 centrin-2 Caltractin belongs to a family of calcium-binding proteins and is a structural component of the centrosome. The high level of conservation from algae to humans and its association with the centrosome suggested that caltractin plays a fundamental role in the structure and function of the microtubule-organizing center, possibly required for the proper duplication and segregation of the centrosome. [provided by RefSeq, July 2008]. CETN3 Exonic 1070 centrin-3 The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. [provided by RefSeq, July 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. CFLAR Exonic 8837 CASP8 and FADD-like apoptosis regulator isoform 6 The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, February 2011]. Transcript Variant: This variant (7) differs in the 5 UTR and coding sequence and the 3 UTR and coding sequence compared to variant 1. The resulting isoform (6) is shorter at the N-terminus and has a shorter and distinct C- terminus compared to isoform 1. Variants 7 and 8 both encode isoform 6. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CHL1 Exonic 10752 neural cell adhesion molecule L1-like protein precursor The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. Several alternatively spliced transcript variants of this gene have been described, but their full length nature is not known. [provided by RefSeq, July 2008]. CLEC4A Exonic 50856 C-type lectin domain family 4 member A isoform 2 This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2), also known as C-type lectin DDB27 short form, lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), that is missing the transmembrane domain compared to isoform 1. CLECL1 Exonic 160365 C-type lectin-like domain family 1 DCAL1 is a type II transmembrane, C-type lectin-like protein expressed on dendritic cells (DCs) and B cells. It interacts with subsets of T cells as a costimulatory molecule that enhances interleukin-4 (IL4; MIM 147780) production. [supplied by OMIM, April 2004]. CLOCK Exonic 9575 circadian locomoter output cycles protein kaput This gene encodes a protein that belongs to the basic helix-loop-helix (bHLH) family of transcription factors. Polymorphisms within the encoded protein have been associated with circadian rhythm sleep disorders. A similar protein in mice is a circadian regulator that acts as a transcription factor and forms a heterodimer with aryl hydrocarbon receptor nuclear translocator-like to activate transcription of mouse period 1. [provided by RefSeq, July 2008]. CNTLN Exonic 54875 centlein isoform 2 N/A CNTN4 Exonic 152330 contactin-4 isoform a precursor This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]. Transcript Variant: This variant (1) encodes the longest isoform (a). Both variants 1 and 4 encode the same isoform. CNTN5 Exonic 53942 contactin-5 isoform 1 precursor The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, August 2011]. Transcript Variant: This variant (2) lacks an exon in the 5 non-coding region, thus has a shorter 5 UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CNTNAP2 Both 26047 contactin-associated protein-like 2 precursor This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal- like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation. [provided by RefSeq, March 2010]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CNTNAP5 Exonic 129684 contactin-associated protein-like 5 precursor This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N- terminal-like domains. [provided by RefSeq, July 2008]. COL24A1 Exonic 255631 collagen alpha-1(XXIV) chain precursor N/A COL27A1 Exonic 85301 collagen alpha-1 (XXVII) chain preproprotein Fibrillar collagens, such as COL27A1, compose one of the most ancient families of extracellular matrix molecules. They form major structural elements in extracellular matrices of cartilage, skin, and tendon (Boot-Handford et al., 2003 [PubMed 12766169]) .[supplied by OMIM, March 2008]. COL7A1 Exonic 1294 collagen alpha-1(VII) chain precursor This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, July 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. COMMD7 Exonic 149951 COMM domain-containing protein 7 isoform 2 N/A CORIN Exonic 10699 atrial natriuretic peptide-converting enzyme This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro- brain-type natriuretic peptide convertase. [provided by RefSeq, July 2008]. COX18 Exonic 285521 mitochondrial inner membrane protein COX18 precursor COX18 encodes a cytochrome c oxidase (COX)-assembly protein. The S. cerevisiae Cox18 protein catalyzes the insertion of the Cox2 (MTCO2; MIM 516040) C-terminal tail into the mitochondrial inner membrane, an intermediate step in the assembly of complex IV of the mitochondrial respiratory chain (Sacconi et al., 2005 [PubMed 16212937]). [supplied by OMIM, March 2008]. CPNE9 Exonic 151835 copine-9 N/A CREBBP Exonic 1387 CREB-binding protein isoform b This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine- rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, February 2009]. Transcript Variant: This variant (2) lacks an alternate in- frame exon in the 5 coding region, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. CSDAP1 Exonic 440359 N/A N/A CSGALNACT2 Exonic 55454 chondroitin sulfate N-acetylgalactosaminyl-transferase 2 N/A CSNK1D Exonic 1453 casein kinase I isoform delta isoform 2 This gene is a member of the casein kinase I (CKI) gene family whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is highly similar to the mouse and rat CK1 delta homologs. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) has an additional exon at the 3 end compared to transcript variant 1. This results in a shorter isoform (2) with a different C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. CTDSP1 Exonic 58190 carboxy-terminal domain RNA polymerase II polypeptide A This gene encodes a member of the small C-terminal domain phosphatase small phosphatase 1 isoform 3 (SCP) family of nuclear phosphatases. These proteins play a role in transcriptional regulation through specific dephosphorylation of phosphoserine 5 within tandem heptapeptide repeats of the C-terminal domain of RNA polymerase II. The encoded protein plays a role in neuronal gene silencing in non-neuronal cells, and may also inhibit osteoblast differentiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, October 2011]. Transcript Variant: This variant (3) differs in the 5 UTR and has multiple differences in the coding region, including the use of an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CTNNA3 Exonic 29119 catenin alpha-3 N/A CTSL2 Exonic 1515 cathepsin L2 preproprotein The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may play an important role in corneal physiology. This gene is expressed in colorectal and breast carcinomas but not in normal colon, mammary gland, or peritumoral tissues, suggesting a possible role for this gene in tumor processes. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, January 2011]. Transcript Variant: This variant (2) differs in the 5 UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. CUTA Exonic 51596 protein CutA isoform 3 precursor N/A CXorf57 Exonic 55086 uncharacterized protein CXorf57 isoform 2 N/A CYB5R1 Exonic 51706 NADH-cytochrome b5 reductase 1 N/A CYP1A1 Exonic 1543 cytochrome P450 1A1 This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CYP51A1 Exonic 1595 lanosterol 14-alpha demethylase isoform 2 This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, March 2009]. Transcript Variant: This variant (2) differs in the 5 UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. DAPP1 Exonic 27071 dual adapter for phosphotyrosine and 3-phosphotyrosine N/A and 3-phosphoinositide DCXR Exonic 51181 L-xylulose reductase isoform 2 The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, August 2010]. Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5 end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is 2 aa shorter compared to isoform 1. DDX58 Exonic 23586 probable ATP-dependent RNA helicase DDX58 DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, July 2008]. DEFA6 Exonic 1671 defensin-6 preproprotein Defensins are a family of microbicidal and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 6, is highly expressed in the secretory granules of Paneth cells of the small intestine, and likely plays a role in host defense of human bowel. [provided by RefSeq, July 2008]. DEFB1 Exonic 1672 beta-defensin 1 preproprotein Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 1, an antimicrobial peptide implicated in the resistance of epithelial surfaces to microbial colonization. This gene maps in close proximity to defensin family member, defensin, alpha 1 and has been implicated in the pathogenesis of cystic fibrosis. [provided by RefSeq, July 2008]. DHPS Exonic 1725 N/A This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2011]. Transcript Variant: This variant (5) lacks an alternate internal exon, compared to variant 1. This variant is represented as non-coding because the use of the 5-most expected translational start codon, as used in variant 1, renders the transcript a candidate for nonsense-mediated mRNA decay (NMD). DIAPH2 Exonic 1730 protein diaphanous homolog 2 isoform 12C The product of this gene belongs to the diaphanous subfamily of the formin homology family of proteins. This gene may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, July 2008]. Transcript Variant: This variant (12C) differs in the 3 UTR and the 3 coding region, compared to variant 156. The resulting isoform (isoform 12C) contains a distinct C-terminus, compared to isoform 156. DMD Exonic 1756 dystrophin Dp140c isoform The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA- addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, July 2008]. Transcript Variant: Dp140 transcripts use exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp140 transcripts have a long (1 kb) 5 UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dp140 isoforms. Of these, this transcript (Dp140c) lacks exons 71-74. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. DNAH3 Exonic 55567 dynein heavy chain 3, axonemal N/A DNASE1L3 Exonic 1776 deoxyribonuclease gamma precursor This gene encodes a member of the DNase family. The protein hydrolyzes DNA, is not inhibited by actin, and mediates the breakdown of DNA during apoptosis. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, July 2008]. DNTTIP2 Exonic 30836 deoxynucleotidyl-transferase terminal-interacting This gene is thought to be involved in chromatin remodeling and gene protein 2 transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, December 2010]. DPP6 Exonic 1804 dipeptidyl aminopeptidase-like protein 6 isoform 2 This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) includes an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2, also referred to as S) that has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. DPYD Exonic 1806 dihydropyrimidine dehydrogenase [NADP+] isoform 1 The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine- uraciluria and an increased risk of toxicity in cancer patients receiving 5- fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). DUS1L Exonic 64118 tRNA-dihydrouridine synthase 1-like N/A DYNC2LI1 Exonic 51626 cytoplasmic dynein 2 light intermediate chain 1 isoform 4 N/A DYSFIP1 Exonic N/A N/A N/A EBF3 Exonic 253738 transcription factor COE3 This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, September 2011]. EFTUD1 Exonic 79631 elongation factor Tu GTP-binding domain-containing N/A protein 1 isoform 2 EHD3 Exonic 30845 EH domain-containing protein 3 N/A ELAVL3 Exonic 1995 ELAV-like protein 3 isoform 2 A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks an in-frame segment in the coding region, as compared to variant 1. It encodes isoform 2 which lacks an internal segment, as compared to isoform 1. ELK3 Exonic 2004 ETS domain-containing protein Elk-3 The protein encoded by this gene is a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. [provided by RefSeq, July 2008]. EMCN Exonic 51705 endomucin isoform 1 EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]). [supplied by OMIM, March 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. EMID2 Exonic 136227 collagen alpha-1(XXVI) chain precursor N/A EPHA8 Exonic 2046 ephrin type-A receptor 8 isoform 2 precursor This gene encodes a member of the ephrin receptor subfamily of the protein- tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses an alternate splice site in the 3 coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2, which has a shorter and distinct C-terminus compared to isoform 1. This transcript is supported by mRNA transcripts but the predicted ORF and its predicted precursor sequence have not yet been experimentally confirmed. EPS8L3 Exonic 79574 epidermal growth factor receptor kinase substrate 8- This gene encodes a protein that is related to epidermal growth factor receptor like protein 3 isoform c pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3) uses different splice acceptor sites for two coding region exons compared to variant 1. The encoded protein (isoform c) is shorter when it is compared to isoform a. EPSTI1 Exonic 94240 epithelial-stromal interaction protein 1 isoform 1 N/A ETS1 Exonic 2113 protein C-ets-1 isoform 1 This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, July 2011]. Transcript Variant: This variant (1) encodes the longest isoform (1). F8A1 Exonic 8263 factor VIII intron 22 protein This gene is contained entirely within intron 22 of the factor VIII gene; spans less than 2 kb, and is transcribed in the direction opposite of factor VIII. A portion of intron 22 (int22h), containing F8A, is repeated twice extragenically closer to the Xq telomere. Although its function is unknown, the observation that this gene is conserved in the mouse implies it has some function. Unlike factor VIII, this gene is transcribed abundantly in a wide variety of cell types. [provided by RefSeq, July 2008]. F8A2 Exonic 474383 factor VIII intron 22 protein This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the middle copy. Although its function is unknown, the observation that this gene is conserved in the mouse implies it has some function. Unlike factor VIII, this gene is transcribed abundantly in a wide variety of cell types. [provided by RefSeq, July 2008]. F8A3 Exonic 474384 factor VIII intron 22 protein This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most telomeric copy. Although its function is unknown, the observation that this gene is conserved in the mouse implies it has some function. Unlike factor VIII, this gene is transcribed abundantly in a wide variety of cell types. [provided by RefSeq, July 2008]. FA2H Exonic 79152 fatty acid 2-hydroxylase This gene encodes a protein that catalyzes the synthesis of 2- hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia. [provided by RefSeq, March 2010]. FAM154B Exonic 283726 protein FAM154B N/A FAM189A1 Exonic 23359 protein FAM189A1 N/A FAM83G Exonic 644815 protein FAM83G N/A FAM9B Exonic 171483 protein FAM9B This gene is a member of a gene family which arose through duplication on the X chromosome. The encoded protein may be localized to the nucleus as the protein contains several nuclear localization signals, and has similarity to a synaptonemal complex protein. [provided by RefSeq, August 2011]. FANCA Exonic 2175 Fanconi anemia group A protein isoform a The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). FASN Exonic 2194 fatty acid synthase The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C- terminus of ER-alpha. [provided by RefSeq, July 2008]. FBXO18 Exonic 84893 F-box only protein 18 isoform 1 This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F- box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation- dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) encodes the longer isoform (1). FER1L4 Exonic 80307 N/A N/A FHIT Exonic 2272 bis(5-adenosyl-triphosphatase This gene, a member of the histidine triad gene family, encodes a diadenosine 5,5-P1,P3-triphosphate hydrolase involved in purine metabolism. The gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts of this gene. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, October 2009]. Transcript Variant: This variant (2) has an alternate splice site in the 3 UTR, as compared to variant 1. Both variants 1 and 2 encode the same protein. FNTA Exonic 2339 protein farnesyltransferase/geranylgeranyltransferase Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group type-1 subunit alpha in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]. Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. FRG1 Exonic 2483 protein FRG1 This gene maps to a location 100 kb centromeric of the repeat units on chromosome 4q35 which are deleted in facioscapulohumeral muscular dystrophy (FSHD). It is evolutionarily conserved and has related sequences on multiple human chromosomes but DNA sequence analysis did not reveal any homology to known genes. In vivo studies demonstrate the encoded protein is localized to the nucleolus. [provided by RefSeq, July 2008]. FSCN2 Exonic 25794 fascin-2 isoform 2 This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) represents the longer transcript and encodes the longer isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. FUT2 Exonic 2524 galactoside 2-alpha-L-fucosyltransferase 2 The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) differs in the 5 UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Sequence Note: This RefSeq record represents the SE*01.01.01 allele. GATA6 Exonic 2627 transcription factor GATA-6 N/A GIT2 Exonic 9815 ARF GTPase-activating protein GIT2 isoform 6 This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, September 2008]. Transcript Variant: This variant (6) lacks two in-frame exons in the 3 coding region and includes an additional short in-frame exon in the central coding region, compared to isoform 1. The resulting isoform (6) is missing two internal fragments and includes a 2 residue insertion, compared to isoform 1. GLDC Exonic 2731 glycine dehydrogenase [decarboxylating], mitochondrial Degradation of glycine is brought about by the glycine cleavage system, which precursor is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH). [provided by RefSeq, January 2010]. GLRX Exonic 2745 glutaredoxin-1 This gene encodes a member of the glutaredoxin family. The encoded protein is a cytoplasmic enzyme catalyzing the reversible reduction of glutathione-protein mixed disulfides. This enzyme highly contributes to the antioxidant defense system. It is crucial for several signalling pathways by controlling the S- glutathionylation status of signalling mediators. It is involved in beta-amyloid toxicity and Alzheimer's disease. Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, August 2011]. Transcript Variant: This variant (3) differs in the 3 UTR, compared to variant 1. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. GNE Exonic 10020 bifunctional UDP-N-acetylglucosamine 2-epimerase/N- The protein encoded by this gene is a bifunctional enzyme that initiates and acetylmannosamine kinase isoform 4 regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, July 2008]. Transcript Variant: This variant (4) contains a different 5 terminal exon and lacks a 3 coding region segment, compared to transcript variant 1, which results in translation initiation from an in-frame downstream AUG. The predicted protein (isoform 4) is shorter when it is compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. GNRHR2 Exonic 114814 N/A In non-hominoid primates and non-mammalian vertebrates, the gonadotropin releasing hormone 2 receptor (GnRHR2) encodes a seven-transmembrane G- protein coupled receptor. However, in human, the N-terminus of the predicted protein contains a frameshift and premature stop codon. In human, GnRHR2 transcription occurs but the gene does not likely produce a functional C-terminal multi-transmembrane protein. A non-transcribed pseudogene of GnRHR2 is located on chromosome 14. [provided by RefSeq, February 2011]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. GPR98 Exonic 84059 G-protein coupled receptor 98 precursor This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1), also known as VLGR1b, encodes the predominant isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. GPS1 Exonic 2873 COP9 signalosome complex subunit 1 isoform 2 This gene is known to suppress G-protein and mitogen-activated signal transduction in mammalian cells. The encoded protein shares significant similarity with Arabidopsis FUS6, which is a regulator of light-mediated signal transduction in plant cells. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks an internal segment in the 5 region and uses an upstream translation start codon, as compared to variant 1. It encodes isoform 2 which has a shorter and distinct N-terminus, as compared to isoform 1. GRAMD4 Exonic 23151 GRAM domain-containing protein 4 GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]). [supplied by OMIM, January 2011]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. GRIN2D Exonic 2906 glutamate [NMDA] receptor subunit epsilon-4 precursor N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, March 2010]. GRIPAP1 Exonic 56850 GRIP1-associated protein 1 isoform 2 This gene encodes a guanine nucleotide exchange factor for the Ras family of small G proteins (RasGEF). In brain studies, the encoded protein was found with the GRIP/AMPA receptor complex. Multiple alternatively spliced transcript variants have been described that encode different protein isoforms; however, the full-length nature and biological validity of all of these variants have not been determined. [provided by RefSeq, November 2009]. Transcript Variant: This variant (2) lacks an alternate in-frame coding region segment and uses a different splice site in the 3 coding region, compared to variant 1. The reading frame is changed, such that the resulting protein (isoform 2) has a shorter and distinct C-terminus when compared to isoform 1. GTPBP10 Exonic 85865 GTP-binding protein 10 isoform 1 Small G proteins, such as GTPBP10, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]). [supplied by OMIM, March 2008]. Transcript Variant: This variant (1) lacks alternate in-frame exons in the 5 coding region, compared to variant 2. The resulting protein (isoform 1) is shorter when it is compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. GYG2 Exonic 8908 glycogenin-2 isoform a This gene encodes a member of the glycogenin family. Glycogenin is a self- glucosylating protein involved in the initiation reactions of glycogen biosynthesis. A gene on chromosome 3 encodes the muscle glycogenin and this X-linked gene encodes the glycogenin mainly present in liver; both are involved in blood glucose homeostasis. This gene has a short version on chromosome Y, which is 3 truncated and can not make a functional protein. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2010]. Transcript Variant: This variant (1) lacks an in-frame exon in the CDS, as compared to variant 2. The resulting isoform (a) lacks an internal segment, as compared to isoform b. H2AFB1 Exonic 474382 histone H2A-Bbd type 1 Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most centromeric copy which is in intron 22 of the F8 gene. [provided by RefSeq, July 2008]. H2AFB2 Exonic 474381 histone H2A-Bbd type 2/3 Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the middle copy. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. H2AFB3 Exonic 83740 histone H2A-Bbd type 2/3 Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most telomeric copy. [provided by RefSeq, July 2008]. HACE1 Exonic 57531 E3 ubiquitin-protein ligase HACE1 N/A HCG9 Exonic 10255 N/A This gene lies within the MHC class I region on chromosome 6p21.3. This gene is believed to be non-coding, but its function has not been determined. [provided by RefSeq, July 2009]. HEATR4 Exonic 399671 HEAT repeat-containing protein 4 N/A HECTD1 Exonic 25831 E3 ubiquitin-protein ligase HECTD1 N/A HFE2 Exonic 148738 hemojuvelin isoform c The product of this gene is involved in iron metabolism. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. It could also represent the cellular receptor for hepcidin. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Defects in this gene are the cause of hemochromatosis type 2A, also called juvenile hemochromatosis (JH). JH is an early-onset autosomal recessive disorder due to severe iron overload resulting in hypogonadotrophic hypogonadism, hepatic fibrosis or cirrhosis and cardiomyopathy, occurring typically before age of 30. [provided by RefSeq, July 2008]. Transcript Variant: This variant (c) lacks two segments in the 5 UTR and an in-frame portion of the 5 coding region, compared to variant a. The resulting isoform (c) has a shorter N-terminus when compared to isoform a. Variants c and d encode the same isoform (c). HFM1 Exonic 164045 probable ATP-dependent DNA helicase HFM1 N/A HGS Exonic 9146 hepatocyte growth factor-regulated tyrosine kinase The protein encoded by this gene regulates endosomal sorting and plays a substrate critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, December 2010]. HGSNAT Exonic 138050 heparan-alpha-glucosaminide N-acetyltransferase precursor This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C. one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, January 2009]. HOMEZ Exonic 57594 homeobox and leucine zipper protein Homez N/A IFNA1 Exonic 3439 interferon alpha-1/13 precursor The protein encoded by this gene is produced by macrophages and has antiviral activity. This gene is intronless and the encoded protein is secreted. [provided by RefSeq, September 2011]. IFNA22P Exonic 3453 N/A N/A IL1RAPL1 Exonic 11141 interleukin-1 receptor accessory protein-like 1 precursor The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2). This gene and IL1RAPL2 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. Deletions and mutations in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. [provided by RefSeq, July 2008]. IL32 Exonic 9235 interleukin-32 isoform D This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, July 2008]. Transcript Variant: This variant (7) lacks two alternate exons in the 5 UTR and an alternate in-frame exon within the coding region, compared to variant 1, resulting in a shorter protein (isoform D). IMP3 Exonic 55272 U3 small nucleolar ribonucleoprotein protein IMP3 This gene encodes the human homolog of the yeast Imp3 protein. The protein localizes to the nucleoli and interacts with the U3 snoRNP complex. The protein contains an S4 domain. [provided by RefSeq, July 2008]. INO80D Exonic 54891 INO80 complex subunit D N/A INTS2 Exonic 57508 integrator complex subunit 2 INTS2 is a subunit of the Integrator complex. which associates with the C- terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]). [supplied by OMIM, March 2008]. Transcript Variant: This variant (1) is the protein-coding variant. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. IRAK2 Exonic 3656 interleukin-1 receptor-associated kinase-like 2 IRAK2 encodes the interleukin-1 receptor-associated kinase 2, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. IRAK2 is reported to participate in the IL1- induced upregulation of NF-kappaB. [provided by RefSeq, July 2008]. ITGA10 Exonic 8515 integrin alpha-10 precursor Integrins are integral membrane proteins composed of an alpha chain and a beta chain, and are known to participate in cell adhesion as well as cell-surface mediated signalling. The I-domain containing alpha 10 combines with the integrin beta 1 chain (ITGB1) to form a novel collagen type II-binding integrin expressed in cartilage tissue. [provided by RefSeq, July 2008]. KAL1 Exonic 3730 anosmin-1 precursor Mutations in this gene cause the X-linked Kallmann syndrome. The encoded protein is similar in sequence to proteins known to function in neural cell adhesion and axonal migration. In addition, this cell surface protein is N- glycosylated and may have anti-protease activity. [provided by RefSeq, July 2008]. KCND1 Exonic 3750 potassium voltage-gated channel subfamily D member 1 Voltage-gated potassium (Kv) channels represent the most complex class of precursor voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This gene is expressed at moderate levels in all tissues analyzed, with lower levels in skeletal muscle. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. KIAA0562 Exonic N/A N/A N/A KIAA1267 Exonic 284058 MLL1/MLL complex subunit KIAA1267 isoform 1 N/A KIAA1432 Exonic 57589 protein RIC1 homolog isoform b N/A KIF12 Exonic 113220 kinesin-like protein KIF12 KIF12 is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that play important roles in intracellular transport and cell division (Nakagawa et al., 1997 [PubMed 9275178]). [supplied by OMIM, March 2008]. KIF26B Exonic 55083 kinesin-like protein KIF26B N/A KIF7 Exonic 374654 kinesin-like protein KIF7 This gene encodes a cilia-associated protein belonging to the kinesin family. This protein plays a role in the sonic hedgehog (SHH) signaling pathway through the regulation of GLI transcription factors. It functions as a negative regulator of the SHH pathway by preventing inappropriate activation of GLI2 in the absence of ligand, and as a positive regulator by preventing the processing of GLI3 into its repressor form. Mutations in this gene have been associated with various ciliopathies. [provided by RefSeq, October 2011]. KIRREL3 Exonic 84623 kin of IRRE-like protein 3 isoform 2 precursor The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, September 2009]. Transcript Variant: This variant (2) includes an alternate segment at the 3 end compared to variant 1. This results in a frame-shift, and a shorter isoform (2) with a distinct C-terminus compared to isoform 1. KLHDC4 Exonic 54758 kelch domain-containing protein 4 isoform 2 N/A KLHL9 Exonic 55958 kelch-like protein 9 N/A KRT6C Exonic 286887 keratin, type II cytoskeletal 6C Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, July 2009]. LAMC3 Exonic 10319 laminin subunit gamma-3 precursor Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, August 2011]. LBH Exonic 81606 protein LBH N/A LCE1C Exonic 353133 late cornified envelope protein 1C N/A LEP Exonic 3952 leptin precursor This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, July 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. LEPR Exonic 3953 leptin receptor isoform 3 precursor The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte- specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID: 54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID: 9207021). [provided by RefSeq, November 2010]. Transcript Variant: This variant (6) contains alternate 5 UTR and 3 terminal exon compared to variant 1, resulting in a shorter isoform (3) with a distinct C-terminus compared to isoform 1. Variants 3 and 6 encode the same isoform. LIPT1 Exonic 51601 lipoyltransferase 1, mitochondrial precursor The process of transferring lipoic acid to proteins is a two-step process. The first step is the activation of lipoic acid by lipoate-activating enzyme to form lipoyl-AMP. For the second step, the protein encoded by this gene transfers the lipoyl moiety to apoproteins. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 13. Read- through transcription also exists between this gene and the neighboring downstream mitochondrial ribosomal protein L30 (MRPL30) gene. [provided by RefSeq, March 2011]. Transcript Variant: This variant (1) encodes the same protein as variants 3-6. LIX1L Exonic 128077 LIX1-like protein N/A LOC100133308 Exonic 100133308 N/A N/A LOC100289187 Exonic 100289187 transmembrane protein 225-like N/A LOC100289656 Exonic 100289656 N/A N/A LOC148696 Exonic 148696 N/A N/A LOC158696 Exonic 158696 N/A N/A LOC255025 Exonic 255025 N/A N/A LOC342346 Exonic N/A N/A N/A LOC349408 Exonic N/A N/A N/A LOC388387 Exonic 388387 N/A N/A LOC400456 Exonic 400456 N/A N/A LOC401109 Exonic 401109 N/A N/A LOC646278 Exonic 646278 N/A N/A LOC729678 Exonic 729678 N/A N/A LOC91316 Exonic N/A N/A N/A LOC92659 Exonic 92659 N/A N/A LRRC33 Exonic 375387 leucine-rich repeat-containing protein 33 precursor N/A LRRC45 Exonic 201255 leucine-rich repeat-containing protein 45 N/A LYSMD3 Exonic 116068 lysM and putative peptidoglycan-binding domain- N/A containing protein 3 MAFG Exonic 4097 transcription factor MafG Globin gene expression is regulated through nuclear factor erythroid-2 (NFE2) elements located in enhancer-like locus control regions positioned many kb upstream of alpha- and beta-gene clusters (summarized by Blank et al., 1997 [PubMed 9166829]). NFE2 DNA-binding activity consists of a heterodimer containing a ubiquitous small Maf protein (MafF, MIM 604877; MafG; or MafK, MIM 600197) and the tissue-restricted protein p45 NFE2 (MIM 601490). Both subunits are members of the activator protein-1-like superfamily of basic leucine zipper (bZIP) proteins (see MIM 165160). [supplied by OMIM, March 2010]. Transcript Variant: This variant (2) differs in the 5 UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. MAN2C1 Exonic 4123 alpha-mannosidase 2C1 N/A MAOA Intronic 4128 amine oxidase [flavin-containing] A This gene encodes monoamine oxidase A, an enzyme that degrades amine neurotransmitters, such as dopamine, norepinephrine, and serotonin. The protein localizes to the mitochondrial outer membrane. The gene is adjacent to a related gene on the opposite strand of chromosome X. Mutation in this gene results in monoamine oxidase deficiency, or Brunner syndrome. [provided by RefSeq, July 2008]. MAP3K9 Exonic 4293 mitogen-activated protein kinase kinase kinase 9 N/A MAPKAPK5 Exonic 8550 MAP kinase-activated protein kinase 5 isoform 2 The protein encoded by this gene is a member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. In vitro, this kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) contains an extra 6 nt segment in the coding region when compared to variant 1. It encodes an isoform (2) longer by 2 aa, as compared to isoform 1. MAS1 Exonic 4142 proto-oncogene Mas The structure of the MAS1 product indicates that it belongs to the class of receptors that are coupled to GTP-binding proteins and share a conserved structural motif, which is described as a 7-transmembrane segment following the prediction that these hydrophobic segments form membrane-spanning alpha- helices. The MAS1 protein may be a receptor that, when activated, modulates a critical component in a growth-regulating pathway to bring about oncogenic effects. [provided by RefSeq, July 2008]. MBLAC2 Exonic 153364 metallo-beta-lactamase domain-containing protein 2 N/A MGAM Exonic 8972 maltase-glucoamylase, intestinal This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, July 2008]. MICAL3 Exonic 57553 protein MICAL-3 isoform 3 N/A MIR1184-1 Exonic 100302111 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR1184-2 Exonic 100422985 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR1184-3 Exonic 100422977 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR125A Exonic 406910 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. MIR1302-1 Exonic 100302227 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR1322 Exonic 100302166 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR1470 Exonic 100302127 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR26B Exonic 407017 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. MIR3186 Exonic 100422944 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR516B2 Exonic 574485 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR548Y Exonic 100500919 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR663 Exonic N/A N/A N/A MIR99B Exonic 407056 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIRLET7E Exonic 406887 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non- coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MITD1 Exonic 129531 MIT domain-containing protein 1 N/A MMP25 Exonic 64386 matrix metalloproteinase-25 preproprotein Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMPs are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily, attached to the plasma membrane via a glycosylphosphatidyl inositol anchor. In response to bacterial infection or inflammation, the encoded protein is thought to inactivate alpha-1 proteinase inhibitor, a major tissue protectant against proteolytic enzymes released by activated neutrophils, facilitating the transendothelial migration of neutrophils to inflammatory sites. The encoded protein may also play a role in tumor invasion and metastasis through activation of MMP2. The gene has previously been referred to as MMP20 but has been renamed MMP25. [provided by RefSeq, July 2008]. MNS1 Exonic 55329 meiosis-specific nuclear structural protein 1 This gene encodes a protein highly similar to the mouse meiosis-specific nuclear structural 1 protein. The mouse protein was shown to be expressed at the pachytene stage during spermatogenesis and may function as a nuclear skeletal protein to regulate nuclear morphology during meiosis. [provided by RefSeq, October 2008]. MR1 Exonic 3140 major histocompatibility complex class I-related gene N/A protein isoform 4 precursor MRPL12 Exonic 6182 39S ribosomal protein L12, mitochondrial precursor Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which forms homodimers. In prokaryotic ribosomes, two L7/L12 dimers and one L10 protein form the L8 protein complex. [provided by RefSeq, July 2008]. MRPL30 Exonic 51263 39S ribosomal protein L30, mitochondrial precursor Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Alternative splicing results in multiple transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 6p and 12p. Read-through transcription also exists between this gene and the neighboring upstream lipoyltransferase 1 (LIPT1) gene. [provided by RefSeq, March 2011]. Transcript Variant: This variant (1) represents the longer transcript and encodes the supported protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. MTRNR2L6 Exonic 100463482 humanin-like protein 6 N/A MYADML2 Exonic 255275 myeloid-associated differentiation marker-like protein 2 N/A MYBL1 Exonic 4603 myb-related protein A isoform 2 N/A MYH6 Exonic 4624 myosin-6 Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, March 2010]. MYO18B Exonic 84700 myosin-XVIIIb The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, July 2008]. N4BP2 Exonic 55728 NEDD4-binding protein 2 This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C- terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. [provided by RefSeq, July 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. NACAD Exonic 23148 NAC-alpha domain-containing protein 1 N/A NAT8 Exonic 9027 probable N-acetyltransferase 8 This gene, isolated using the differential display method to detect tissue- specific genes, is specifically expressed in kidney and liver. The encoded protein shows amino acid sequence similarity to N-acetyltransferases. A similar protein in Xenopus affects cell adhesion and gastrulation movements, and may be localized in the secretory pathway. A highly similar paralog is found in a cluster with this gene. [provided by RefSeq, September 2008]. NCRNA00085 Exonic N/A N/A N/A NDNL2 Exonic 56160 melanoma-associated antigen G1 The protein encoded by this gene is part of the SMC5-6 chromatin reorganizing complex and is a member of the MAGE superfamily. This is an intronless gene. [provided by RefSeq, May 2011]. NDRG1 Exonic 10397 protein NDRG1 This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. It is necessary for p53-mediated caspase activation and apoptosis. Mutation in this gene has been reported to be causative for hereditary motor and sensory neuropathy-Lom. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, September 2008]. Transcript Variant: This variant (2) uses an alternate splice site in the 5 UTR. Both variants 1 and 2 encode the same protein. NEOI Exonic 4756 neogenin isoform 1 precursor This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, February 2010]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). NFIA Exonic 4774 nuclear factor 1 A-type isoform 4 This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, September 2011]. Transcript Variant: This variant (4) differs in the 5 UTR and coding region compared to variant 1. The resulting protein (isoform 4) has a longer and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. NOTUM Exonic 147111 protein notum homolog precursor N/A NPB Exonic 256933 neuropeptide B preproprotein Neuropeptide B (NPB) is an endogenous peptide ligand for G protein-coupled receptor-7 (GPR7; MIM 600730). [supplied by OMIM, April 2004]. NPLOC4 Exonic 55666 nuclear protein localization protein 4 homolog N/A NRXN1 Exonic 9378 neurexin-1-beta isoform beta precursor Neurexins function in the vertebrate nervous system as cell adhesion molecules and receptors. Two neurexin genes are among the largest known in human (NRXN1 and NRXN3). By using alternate promoters, splice sites and exons, predictions of hundreds or even thousands of distinct mRNAs have been made. Most transcripts use the upstream promoter and encode alpha-neurexin isoforms; fewer transcripts are produced from the downstream promoter and encode beta-neurexin isoforms. Alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and they interact with neurexophilins. Beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. The RefSeq Project has decided to create only a few representative transcript variants of the multitude that are possible. [provided by RefSeq, October 2008]. Transcript Variant: This variant (beta) represents a beta neurexin transcript. It is transcribed from a downstream promoter, includes a different segment for its 5 UTR and 5 coding region, and lacks most of the 5 exons present in alpha transcripts, as compared to variant alpha2. The resulting protein (isoform beta) has a shorter and distinct N- terminus when it is compared to isoform alpha2. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. NRXN3 Exonic 9369 neurexin-3-beta isoform 3 precursor Neurexins are a family of proteins that function in the vertebrate nervous system as cell adhesion molecules and receptors. They are encoded by several unlinked genes of which two, NRXN1 and NRXN3, are among the largest known human genes. Three of the genes (NRXN1-3) utilize two alternate promoters and include numerous alternatively spliced exons to generate thousands of distinct mRNA transcripts and protein isoforms. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms; a much smaller number of transcripts are produced from the downstream promoter and encode beta-neurexin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF- like sequences and contain fewer laminin G domains than alpha-neurexins. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3) differs in the 5 UTR and has multiple coding region differences, compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus when compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. NSDHL Exonic 50814 sterol-4-alpha-carboxylate 3-dehydrogenase, The protein encoded by this gene is localized in the endoplasmic reticulum and decarboxylating is involved in cholesterol biosynthesis. Mutations in this gene are associated with CHILD syndrome, which is a X-linked dominant disorder of lipid metabolism with disturbed cholesterol biosynthesis, and typically lethal in males. Alternatively spliced transcript variants with differing 5 UTR have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the more predominant transcript. Transcript variants 1 and 2 encode the same protein. NSF Exonic 4905 N/A N/A NUDT17 Exonic 200035 nucleoside diphosphate-linked moiety X motif 17 N/A NUP155 Exonic 9631 nuclear pore complex protein Nup155 isoform 2 Nucleoporins are the main components of the nuclear pore complex (NPC) of eukaryotic cells. They are involved in the bidirectional trafficking of molecules, especially mRNAs and proteins, between the nucleus and the cytoplasm. The protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. Two protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses alternate splicing in the 5 region and a downstream start codon, compared to variant 1. Isoform 2 has a shorter N- terminus, compared to isoform 1. ODZ1 Exonic 10178 teneurin-1 isoform 3 The protein encoded by this gene belongs to the tenascin family and teneurin subfamily. It is expressed in the neurons and may function as a cellular signal transducer. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, September 2009]. Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3) missing an internal 7 aa protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. OFD1 Exonic 8481 oral-facial-digital syndrome 1 protein This gene is located on the X chromosome and encodes a centrosomal protein. A knockout mouse model has been used to study the effect of mutations in this gene. The mouse gene is also located on the X chromosome, however, unlike the human gene it is not subject to X inactivation. Mutations in this gene are associated with oral-facial-digital syndrome type I and Simpson-Golabi-Behmel syndrome type 2. Many pseudogenes have been identified; a single pseudogene is found on chromosome 5 while as many as fifteen have been found on the Y chromosome. Alternatively spliced transcripts have been described for this gene but the biological validity of these transcripts has not been determined. [provided by RefSeq, July 2008]. OR2T8 Exonic 343172 olfactory receptor 2T8 Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7- transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, July 2008]. OR4A5 Exonic 81318 olfactory receptor 4A5 Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7- transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. OR52E4 Exonic 390081 olfactory receptor 52E4 Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7- transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, July 2008]. OR52N1 Exonic 79473 olfactory receptor 52N1 Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7- transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, July 2008]. OR6Y1 Exonic 391112 olfactory receptor 6Y1 Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7- transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, July 2008]. OSTCL Exonic N/A N/A N/A OTUD5 Exonic 55593 OTU domain-containing protein 5 isoform b This gene encodes a member of the OTU (ovarian tumor) domain-containing cysteine protease superfamily. The OTU domain confers deubiquitinase activity and the encoded protein has been shown to suppress the type I interferon- dependent innate immune response by cleaving the polyubiquitin chain from an essential type I interferon adaptor protein. Cleavage results in disassociation of the adaptor protein from a downstream signaling complex and disruption of the type I interferon signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, October 2008]. Transcript Variant: This variant (3) differs in the 3 UTR and lacks an in- frame portion of an internal coding exon, compared to variant 1, resulting in a shorter protein compared to isoform a. Variants 2 and 3 encode the same isoform (b). P4HB Exonic 5034 protein disulfide-isomerase precursor This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S- nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, July 2008]. PACSIN3 Exonic 29763 protein kinase C and casein kinase substrate in neurons This gene is a member of the protein kinase C and casein kinase substrate in protein 3 neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]. Transcript Variant: This variant (3) differs in the 5 UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. PCDH15 Exonic 65217 protocadherin-15 isoform CD1-4 precursor This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, December 2008]. Transcript Variant: This variant (C) lacks two alternate in-frame exons in the 5 and 3 coding region, compared to variant A. The resulting isoform (CD1-4) lacks a 5-aa segment near the N-terminus and a 2-aa segment near the C-terminus, compared to isoform CD1-1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. PCYT2 Exonic 5833 ethanolamine-phosphate cytidylyltransferase isoform 1 This gene encodes an enzyme that catalyzes the formation of CDP- ethanolamine from CTP and phosphoethanolamine in the Kennedy pathway of phospholipid synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]. Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. PDCD6IP Exonic 10015 programmed cell death 6-interacting protein isoform 2 This gene encodes a protein thought to participate in programmed cell death. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, June 2009]. Transcript Variant: This variant (2) uses an alternative in-frame acceptor splice site at an internal coding exon compared to variant 1. This results in an isoform (2) 5 aa longer than isoform 1. PDE10A Exonic 10846 cAMP and cAMP-inhibited cGMP 3,5-cyclic Various cellular responses are regulated by the second messengers cAMP and phosphodiesterase 10A isoform 2 cGMP. Phosphodiesterases, such as PDE10A, eliminate cAMP- and cGMP- mediated intracellular signaling by hydrolyzing the cyclic nucleotide to the corresponding nucleoside 5-prime monophosphate (Fujishige et al., 2000 [PubMed 10998054]). [supplied by OMIM, March 2008]. Transcript Variant: This variant (2) has an additional exon in the 5 region, which includes an in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) has an alternate and shorter N-terminus, as compared to isoform 1. PDE6G Exonic 5148 retinal rod rhodopsin-sensitive cGMP 3,5-cyclic This gene encodes the gamma subunit of cyclic GMP-phosphodiesterase, which phosphodiesterase subunit gamma is composed of alpha- and beta- catalytic subunits and two identical, inhibitory gamma subunits. This gene is expressed in rod photoreceptors and functions in the phototransduction signaling cascade. It is also expressed in a variety of other tissues, and has been shown to regulate the c-Src protein kinase and G-protein- coupled receptor kinase 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, February 2009]. Transcript Variant: This variant (1) represents the longer transcript. PDLIM3 Exonic 27295 PDZ and LIM domain protein 3 isoform a The protein encoded by this gene contains a PDZ domain and a LIM domain, indicating that it may be involved in cytoskeletal assembly. In support of this, the encoded protein has been shown to bind the spectrin-like repeats of alpha- actinin-2 and to colocalize with alpha-actinin-2 at the Z lines of skeletal muscle. This gene is found near a region of chromosome 4 that has been implicated in facioscapulohumeral muscular dystrophy, but this gene does not appear to be involved in the disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. PEBP4 Exonic 157310 phosphatidylethanolamine-binding protein 4 precursor The phosphatidylethanolamine (PE)-binding proteins, including PEBP4, are an evolutionarily conserved family of proteins with pivotal biologic functions, such as lipid binding and inhibition of serine proteases (Wang et al., 2004 [PubMed 15302887]). [supplied by OMIM, December 2008]. PEX11B Exonic 8799 peroxisomal membrane protein 11B isoform 1 N/A PHF1 Exonic 5252 PHD finger protein 1 isoform a This gene encodes a Polycomb group protein. The protein is a component of a histone H3 lysine-27 (H3K27)-specific methyltransferase complex, and functions in transcriptional repression of homeotic genes. The protein is also recruited to double-strand breaks, and reduced protein levels results in X-ray sensitivity and increased homologous recombination. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. Transcript Variant: This variant (1), uses an alternate splice site and lacks an alternate exon in the 3 coding region resulting in a frameshift, compared to variant 2. The resulting isoform (a) has a shorter and distinct C- terminus, compared to isoform b. PIAS3 Exonic 10401 E3 SUMO-protein ligase PIAS3 This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)- E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, July 2008]. PINX1 Exonic 54984 PIN2/TERF1-interacting telomerase inhibitor 1 N/A PKD1L2 Exonic 114780 polycystic kidney disease protein 1-like 2 isoform a This gene encodes a member of the polycystin protein family. The encoded precursor protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript, and encodes the longer isoform (a). PLA2G15 Exonic 23659 group XV phospholipase A2 precursor Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, July 2008]. PLAA Exonic 9373 phospholipase A-2-activating protein N/A PMS2 Exonic 5395 N/A This gene is one of the PMS2 gene family members found in clusters on chromosome 7. The product of this gene is involved in DNA mismatch repair. It forms a heterodimer with MLH1 and this complex interacts with other complexes bound to mismatched bases. Mutations in this gene are associated with hereditary nonpolyposis colorectal cancer, Turcot syndrome, and are a cause of supratentorial primitive neuroectodermal tumors. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses an alternate acceptor splice site at exon 2, resulting in a frame-shift and premature translation termination, rendering the transcript susceptible to nonsense-mediated mRNA decay (NMD). PNKD Exonic 25953 probable hydrolase PNKD isoform 1 precursor This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, March 2010]. Transcript Variant: This variant (1), alternately referred to as the long form (MR-1L), represents the longest transcript and encodes the longest isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. PNLIPRP3 Exonic 119548 pancreatic lipase-related protein 3 precursor N/A POLR3C Exonic 10623 DNA-directed RNA polymerase III subunit RPC3 N/A POLR3G Exonic 10622 DNA-directed RNA polymerase III subunit RPC7 N/A POLR3GL Exonic 84265 DNA-directed RNA polymerase III subunit RPC7-like N/A POTEA Exonic 340441 POTE ankyrin domain family member A isoform 2 N/A POU5F1P3 Exonic 642559 N/A N/A PRDM6 Exonic 93166 putative histone-lysine N-methyltransferase PRDM6 N/A PREPL Exonic 9581 prolyl endopeptidase-like isoform 4 The protein encoded by this gene belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants encoding either the same or different isoforms have been described for this gene. [provided by RefSeq, January 2010]. Transcript Variant: This variant (7, also known as variant B) contains an alternate exon at the 5 end compared to variant 1, resulting in translation initiation from an in-frame downstream AUG and a shorter isoform (4) compared to isoform 1. Variants 6 and 7 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. PRSS38 Exonic 339501 serine protease 38 precursor N/A PSG3 Exonic 5671 pregnancy-specific beta-1-glycoprotein 3 precursor The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]). For additional general information about the PSG gene family, see PSG1 (HIM 176390). [supplied by OMIM, October 2009]. PSG8 Exonic 440533 pregnancy-specific beta-1-glycoprotein 8 isoform a The human pregnancy-specific glycoproteins (PSGs) are a group of molecules precursor that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390). [supplied by OMIM, October 2009]. Transcript Variant: This variant (1) encodes the longest isoform (a). PSMB1 Exonic 5689 proteasome subunit beta type-1 The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, July 2008]. PYCR1 Exonic 5831 pyrroline-5-carboxylate reductase 1, mitochondrial This gene encodes an enzyme that catalyzes the NAD(P)H-dependent isoform 1 conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) encodes the longer isoform (1) of this protein. PYROXD1 Exonic 79912 pyridine nucleotide-disulfide oxidoreductase domain- N/A containing protein 1 RAB11FIP4 Exonic 84440 rab11 family-interacting protein 4 Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP4 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]). [supplied by OMIM, April 2008]. RAB32 Exonic 10981 ras-related protein Rab-32 Small GTP-binding proteins of the RAB family, such as RAB32, play essential roles in vesicle and granule targeting (Bao et al., 2002 [PubMed 11784320]). [supplied by OMIM, August 2009]. Sequence Note: removed 2 bases from the 5 end that did not align to the reference genome assembly. RABEPK Exonic 10244 rab9 effector protein with kelch motifs isoform b N/A RAC3 Exonic 5881 ras-related C3 botulinum toxin substrate 3 The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. [provided by RefSeq, July 2008]. RARRES3 Exonic 5920 retinoic acid receptor responder protein 3 Retinoids exert biologic effects such as potent growth inhibitory and cell differentiation activities and are used in the treatment of hyperproliferative dermatological diseases. These effects are mediated by specific nuclear receptor proteins that are members of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. RARRES1, RARRES2, and RARRES3 are genes whose expression is upregulated by the synthetic retinoid tazarotene. RARRES3 is thought act as a tumor suppressor or growth regulator. [provided by RefSeq, July 2008]. RASGEF1A Exonic 221002 ras-GEF domain-containing family member 1A N/A RBM8A Exonic 9939 RNA-binding protein 8A This gene encodes a protein with a conserved RNA-binding motif. The protein is found predominantly in the nucleus, although it is also present in the cytoplasm. It is preferentially associated with mRNAs produced by splicing, including both nuclear mRNAs and newly exported cytoplasmic mRNAs. It is thought that the protein remains associated with spliced mRNAs as a tag to indicate where introns had been present, thus coupling pre- and post-mRNA splicing events. Previously, it was thought that two genes encode this protein, RBM8A and RBM8B; it is now thought that the RBM8B locus is a pseudogene. Two alternative start codons result in two forms of the protein, and this gene also uses multiple polyadenylation sites. [provided by RefSeq, July 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. RECQL Exonic 5965 ATP-dependent DNA helicase Q1 The protein encoded by this gene is a member of the RecQ DNA helicase family. DNA helicases are enzymes involved in various types of DNA repair, including mismatch repair, nucleotide excision repair and direct repair. Some members of this family are associated with genetic disorders with predisposition to malignancy and chromosomal instability. The biological function of this helicase has not yet been determined. Two alternatively spliced transcripts, which encode the same isoform but differ in their 5 and 3 UTRs, have been described. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks a segment of 5 UTR sequence, compared to variant 1. Variants 1 and 2 encode the same protein. RFNG Exonic 5986 beta-1,3-N-acetylglucosaminyl transferase radical fringe N/A precursor RGL4 Exonic 266747 ral-GDS-related protein precursor N/A RGN Exonic 9104 regucalcin The protein encoded by this gene is a highly conserved, calcium-binding protein, that is preferentially expressed in the liver and kidney. It may have an important role in calcium homeostasis. Studies in rat indicate that this protein may also play a role in aging, as it shows age-associated down-regulation. This gene is part of a gene cluster on chromosome Xp11.3-Xp11.23. Alternative splicing results in two transcript variants having different 5 UTRs, but encoding the same protein. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) has an additional exon in the 5 UTR, compared to transcript variant 1. Both variants encode the same protein. RGS20 Exonic 8601 regulator of G-protein signaling 20 isoform b The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, September 2011]. Transcript Variant: This variant (2) differs in the 5 UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. RIIAD1 Exonic 284485 RIIa domain-containing protein 1 N/A RIN1 Exonic 9610 ras and Rab interactor 1 N/A RNF115 Exonic 27246 E3 ubiquitin-protein ligase RNF115 N/A RNF168 Exonic 165918 E3 ubiquitin-protein ligase RNF168 This gene encodes an E3 ubiquitin ligase protein that contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The protein is involved in DNA double-strand break (DSB) repair. Mutations in this gene result in Riddle syndrome. [provided by RefSeq, September 2011]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. RPSAP58 Exonic 388524 N/A N/A SELS Exonic 55829 selenoprotein S This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3 UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Studies suggest that this protein may regulate cytokine production, and thus play a key role in the control of the inflammatory response. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript. Transcript variants 1 and 2 encode the same protein. SEPT9 Exonic 10801 septin-9 isoform f This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, March 2009]. Transcript Variant: This variant (7) lacks three 5 exon, but has an alternate 5 exon, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (f) has a much shorter N-terminus, as compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. SESTD1 Exonic 91404 SEC14 domain and spectrin repeat-containing protein 1 N/A SGK1 Exonic 6446 serine/threonine-protein kinase Sgk1 isoform 1 This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. High levels of expression of this gene may contribute to conditions such as hypertension and diabetic nephropathy. Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, January 2009]. Transcript Variant: This variant (1) represents the predominant transcript and encodes the shortest isoform (1). SGK196 Exonic 84197 protein kinase-like protein SgK196 N/A SHANK2 Exonic 22941 SH3 and multiple ankyrin repeat domains protein 2 This gene encodes a protein that is a member of the Shank family of synaptic isoform 2 proteins that may function as molecular scaffolds in the postsynaptic density (PSD). Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, an SH3 domain, a PSD-95/Dlg/ZO-1 domain, a sterile alpha motif domain, and a proline-rich region. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the PSDs of adult and developing brain. Two alternative splice variants, encoding distinct isoforms, are reported. Additional splice variants exist but their full-length nature has not been determined. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) represents use of a putative alternate promoter and 5 UTR, and uses an alternate start codon, compared to variant 1. The resulting isoform (2) has a substantially shorter and distinct N-terminus, compared to isoform 1. SIN3A Exonic 25942 paired amphipathic helix protein Sin3a The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) differs in the 5 UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. SIRT7 Exonic 51547 NAD-dependent deacetylase sirtuin-7 This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]. SLC11A1 Exonic 6556 natural resistance-associated macrophage protein 1 This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, July 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. SLC16A3 Exonic 9123 monocarboxylate transporter 4 Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]). [supplied by OMIM, March 2008]. Transcript Variant: This variant (6) differs in the 5 UTR compared to variant 1. Variants 1, 2, 3, 4, 5 and 6 encode the same protein. SLC24A2 Exonic 25769 sodium/potassium/calcium exchanger 2 isoform 2 This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, August 2011]. Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. SLC25A10 Exonic 1468 mitochondrial dicarboxylate carrier The dicarboxylate carrier catalyzes the transport of dicarboxylates such as malate and succinate across the mitochondrial membrane in exchange for phosphate, sulfate, and thiosulfate, thus supplying substrates for the Krebs cycle, gluconeogenesis, urea synthesis, and sulfur metabolism. [supplied by OMIM, July 2002]. SLC25A29 Exonic 123096 mitochondrial carnitine/acylcarnitine carrier protein N/A CACL SLC26A6 Exonic 65010 solute carrier family 26 member 6 isoform 4 This gene belongs to the solute carrier 26 family, whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting chloride, oxalate, sulfate and bicarbonate. Several alternatively spliced transcript variants of this gene, encoding distinct isoforms, have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, July 2008]. Transcript Variant: This variant (4), also known as S+Q, contains a distinct 5 UTR and lacks an in-frame portion of the 5 coding region, compared to variant 1. The resulting isoform (4) has a shorter N-terminus when compared to isoform 1. SLC27A6 Exonic 28965 long-chain fatty acid transport protein 6 This gene encodes a member of the fatty acid transport protein family (FATP). FATPs are involved in the uptake of long-chain fatty acids and have unique expression patterns. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) has an additional segment in the 5 UTR and encodes the same protein, as compared to variant 1. SLC38A6 Exonic 145389 probable sodium-coupled neutral amino acid transporter 6 N/A isoform 1 SLC5A10 Exonic 125206 sodium/glucose cotransporter 5 isoform 2 N/A SLC7A3 Exonic 84889 cationic amino acid transporter 3 This gene encodes a member of the solute carrier family 7. The encoded protein is a sodium-independent cationic amino acid transporter. Alternate splicing results in multiple transcripts that encoded the same protein. [provided by RefSeq, May 2010]. Transcript Variant: This variant (2) differs in the 5 UTR compared to variant 1. Both variants 1 and 2 encode the same protein. SLCO1B3 Exonic 28234 solute carrier organic anion transporter family member SLCO1B3 belongs to the organic anion transporter (OATP) family. OATPs are 1B3 involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]). [supplied by OMIM, April 2010]. SLIT2 Exonic 9353 slit homolog 2 protein precursor N/A SNORD32B Exonic 692092 N/A N/A SNUPN Exonic 10073 snurportin-1 The nuclear import of the spliceosomal snRNPs U1, U2, U4 and U5, is dependent on the presence of a complex nuclear localization signal. The latter is composed of the 5-2,2,7-terminal trimethylguanosine (m3G) cap structure of the U snRNA and the Sm core domain. The protein encoded by this gene interacts specifically with m3G-cap and functions as an snRNP-specific nuclear import receptor. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3) differs in the 5 UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. SNX16 Exonic 64089 sorting nexin-16 isoform a This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The function of this protein has not been determined. This gene results in three transcript variants encoding two distinct isoforms. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) encodes the longest isoform a. Both transcript variants 1 and 2 encode isoform a. SNX33 Exonic 257364 sorting nexin-33 N/A SOAT1 Exonic 6646 sterol O-acyltransferase 1 isoform 1 The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid- cholesterol esters. This gene has been implicated in the formation of beta- amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, November 2011]. Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. SPAG16 Exonic 79582 sperm-associated antigen 16 protein isoform 2 Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]). [supplied by OMIM, July 2008]. SPECC1 Exonic 92521 cytospin-B isoform 1 The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, August 2011]. Transcript Variant: This variant (6) contains an alternate 5 terminal non- coding exon compared to variant 1. Variants 1 and 6 encode the same isoform (1). SRL Exonic 6345 sarcalumenin precursor N/A ST6GAL2 Exonic 84620 beta-galactoside alpha-2,6-sialyltransferase 2 isoform b Sialyltransferases, such as ST6GAL2 (EC 2.4.99.1), are type II transmembrane proteins that catalyze the transfer of sialic acid from CMP-sialic acid to an acceptor carbohydrate, usually to the terminal ends of carbohydrate chains. [supplied by OMIM, March 2008]. Transcript Variant: This variant (2) differs in the 3 UTR and 3 coding region, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a. STARD3 Exonic 10948 stAR-related lipid transfer protein 3 isoform 3 This gene encodes a member of a subfamily of lipid trafficking proteins that are characterized by a C-terminal steroidogenic acute regulatory domain and an N- terminal metastatic lymph node 64 domain. The encoded protein localizes to the membranes of late endosomes and may be involved in exporting cholesterol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, October 2009]. Transcript Variant: This variant (3) lacks an exon in the coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. STAT3 Exonic 6774 signal transducer and activator of transcription 3 The protein encoded by this gene is a member of the STAT protein family. In isoform 3 response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3), also called STAT3B or STAT3beta, lacks a segment in the coding region resulting in an early termination codon, compared to variant 1. Variant 3 encodes isoform 3, which has a shorter and distinct C- terminus compared to isoform 1. STIL Exonic 6491 SCL-interrupting locus protein isoform 1 This gene encodes a cytoplasmic protein implicated in regulation of the mitotic spindle checkpoint, a regulatory pathway that monitors chromosome segregation during cell division to ensure the proper distribution of chromosomes to daughter cells. The protein is phosphorylated in mitosis and in response to activation of the spindle checkpoint, and disappears when cells transition to G1 phase. It interacts with a mitotic regulator, and its expression is required to efficiently activate the spindle checkpoint. It is proposed to regulate Cdc2 kinase activity during spindle checkpoint arrest. Chromosomal deletions that fuse this gene and the adjacent locus commonly occur in T cell leukemias, and are thought to arise through illegitimate V-(D)-J recombination events. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). STON1 Exonic 11037 stonin-1 Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline- rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, October 2010]. Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. STON1- Exonic 286749 STON1-GTF2A1L protein isoform 3 STON1-GTF2A1L mRNAs are infrequent but naturally occurring read-through GTF2A1L products of the neighboring STON1 and GTF2A1L genes. These transcripts encode fusion proteins composed of the vast majority of each of the individual elements, stonin 1 and general transcription factor IIA, 1-like. Alternative splicing results in multiple transcript variants. The significance of these read- through variants and the function of the resulting protein products have not yet been determined. [provided by RefSeq, October 2010]. Transcript Variant: This variant (3) lacks two alternate exons, resulting in a loss of an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. The 5 UTR is incomplete due to a lack of 5-complete transcript support for this variant and the presence of splicing ambiguity further upstream. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. STRA13 Exonic 201254 centromere protein X N/A STX6 Exonic 10228 syntaxin-6 N/A SYK Exonic 6850 tyrosine-protein kinase SYK isoform 2 This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, March 2010]. Transcript Variant: This variant (4) contains an alternate 5 terminal exon and lacks an in-frame coding exon compared to variant 1. The former introduces an upstream open reading frame (uORF) with a weak Kozak signal, making translation of the downstream primary ORF (with a strong Kozak signal) encoding isoform 2 likely by leaky scanning or re- initiation. Variants 2 and 4 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. SYNGAP1 Exonic 8831 ras GTPase-activating protein SynGAP The protein encoded by this gene is a major component of the postsynaptic density (PSD), a group of proteins found associated with NMDA receptors at synapses. The encoded protein is phosphorylated by calmodulin-dependent protein kinase II and dephosphorylated by NMDA receptor activation. Defects in this gene are a cause of mental retardation autosomal dominant type 5 (MRD5). [provided by RefSeq, December 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. T Exonic 6862 brachyury protein The protein encoded by this gene is an embryonic nuclear transcription factor that binds to a specific DNA element, the palindromic T-site. It binds through a region in its N-terminus, called the T-box, and effects transcription of genes required for mesoderm formation and differentiation. The protein is localized to notochord-derived cells. [provided by RefSeq, July 2008]. TAS1R2 Exonic 80834 taste receptor type 1 member 2 precursor N/A TBCE Exonic 6905 tubulin-specific chaperone E Cofactor E is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta- tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. TBCK Exonic 93627 TBC domain-containing protein kinase-like protein N/A isoform c TCTEX1D2 Exonic 255758 tctex1 domain-containing protein 2 N/A TEKT1 Exonic 83659 tektin-1 This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is predominantly expressed in the testis and in mouse, tektin 1 mRNA was localized to the spermatocytes and round spermatids in the seminiferous tubules, indicating that it may play a role in spermatogenesis. [provided by RefSeq, July 2008]. TEX9 Exonic 374618 testis-expressed sequence 9 protein N/A TFB2M Exonic 64216 dimethyladenosine transferase 2, mitochondrial N/A TFRC Exonic 7037 transferrin receptor protein 1 N/A TGFB1I1 Exonic 7041 transforming growth factor beta-1-induced transcript 1 This gene encodes a coactivator of the androgen receptor, a transcription factor protein isoform 2 which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, September 2009]. Transcript Variant: This variant (3) differs in the 5 UTR and coding region, and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Variants 2 and 3 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. TGFBR3 Exonic 7049 transforming growth factor beta receptor type 3 isoform b This locus encodes the transforming growth factor (TGF)-beta type III receptor. precursor The encoded receptor is a membrane proteoglycan that often functions as a co- receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, September 2010]. Transcript Variant: This variant (2) uses an alternate in-frame splice site in the middle portion of the coding region, compared to variant 1. This results in a shorter protein (isoform b), compared to isoform a. Both variants 2 and 3 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. THOC4 Exonic 10189 THO complex subunit 4 The protein encoded by this gene is a heat stable, nuclear protein and functions as a molecular chaperone. It is thought to regulate dimerization, DNA binding, and transcriptional activity of basic region-leucine zipper (bZIP) proteins. [provided by RefSeq, July 2008]. TIAM2 Exonic 26230 T-lymphoma invasion and metastasis-inducing protein 2 This gene encodes a guanine nucleotide exchange factor. A highly similar isoform b mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses an alternate 5 exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. TLR8 Exonic 51311 toll-like receptor 8 precursor The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X. [provided by RefSeq, July 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. TM4SF19 Exonic 116211 transmembrane 4 L6 family member 19 isoform 3 N/A TM4SF19- Exonic 100534611 N/A This locus represents naturally occurring read-through transcription between TCTEX1D2 the neighboring transmembrane 4 L six family member 19 (TM4SF19) and Tctex1 domain containing 2 (TCTEX1D2) genes on chromosome 3. The read- through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is thus not expected to produce a protein product. [provided by RefSeq, March 2011]. TMBIM1 Exonic 64114 transmembrane BAX inhibitor motif-containing protein 1 N/A TMEM231 Exonic 79583 transmembrane protein 231 isoform 3 N/A TMEM89 Exonic 440955 transmembrane protein 89 precursor N/A TMLHE Exonic 55217 trimethyllysine dioxygenase, mitochondrial isoform 2 This gene encodes the protein trimethyllysine dioxygenase which is the first precursor enzyme in the carnitine biosynthesis pathway. Carnitine play an essential role in the transport of activated fatty acids across the inner mitochondrial membrane. The encoded protein converts trimethyllysine into hydroxytrimethyllysine. A pseudogene of this gene is found on chromosome X. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]. Transcript Variant: This variant (2) differs in the 3 UTR and coding region differences, compared to variant 1. The resulting protein (isoform 2) has a distinct C- terminus and is shorter than isoform 1. TPO Exonic 7173 thyroid peroxidase isoform b precursor This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy- ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]. Transcript Variant: This variant (7) lacks a segment in the 5 UTR and an in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b, also known as TPO2) that is shorter than isoform a. TRAF3 Exonic 7187 TNF receptor-associated factor 3 isoform 3 The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, December 2010]. Transcript Variant: This variant (4) differs in the 5 UTR and lacks an in-frame coding segment compared to variant 1. The resulting isoform (2) lacks an internal region as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. TRIM32 Exonic 22954 E3 ubiquitin-protein ligase TRIM32 The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses a different splice site in the 5 UTR, compared to variant 1. Variants 1 and 2 encode the same protein. TRIML1 Exonic 339976 probable E3 ubiquitin-protein ligase TRIML1 N/A TRIO Exonic 7204 triple functional domain protein N/A TSGA10 Exonic 80705 testis-specific gene 10 protein N/A TSPAN10 Exonic 83882 tetraspanin-10 N/A TXLNB Exonic 167838 beta-taxilin N/A TXNIP Exonic 10628 thioredoxin-interacting protein N/A UBA6 Exonic 55236 ubiquitin-like modifier-activating enzyme 6 Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]). [supplied by OMIM, March 2008]. UBR1 Exonic 197131 E3 ubiquitin-protein ligase UBR1 The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, July 2008]. UGT2A1 Exonic 10941 UDP-glucuronosyltransferase 2A1 isoform 3 precursor The protein encoded by this gene belongs to the UDP-glycosyltransferase family, members of which catalyze biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This enzyme is expressed in the olfactory neuroepithelium, which lines the posterior nasal cavity and is exposed to a wide range of odorants and airborne toxic compounds. Hence, this protein has been suggested to be involved in clearing lipophilic odorant molecules from the sensory epithelium. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, November 2011]. Transcript Variant: This variant (3) contains an additional in-frame coding exon in the 5 region, and lacks an in-frame coding exon in the 3 region compared to variant 1. This results in an isoform (3) of the same length, but differing in two internal protein segments compared to isoform 1. UGT2A2 Exonic 574537 UDP-glucuronosyltransferase 2A2 N/A ULK1 Exonic 8408 serine/threonine-protein kinase ULK1 N/A UPF0639 Exonic N/A N/A N/A UQCRC1 Exonic 7384 cytochrome b-c1 complex subunit 1, mitochondrial N/A precursor USP9X Exonic 8239 probable ubiquitin carboxyl-terminal hydrolase FAF-X This gene is a member of the peptidase C19 family and encodes a protein that is isoform 4 similar to ubiquitin-specific proteases. Though this gene is located on the X chromosome, it escapes X-inactivation. Mutations in this gene have been associated with Turner syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, July 2008]. Transcript Variant: This variant (4) uses an alternate in-frame splice site at the 3 end of an exon compared to variant 3. The resulting isoform (4) has the same N- and C-termini but is shorter compared to isoform 3. UST Exonic 10090 uronyl 2-sulfotransferase Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]). [supplied by OMIM, March 2008]. UXS1 Exonic 80146 UDP-glucuronic acid decarboxylase 1 UDP-glucuronate decarboxylase (UGD; EC 4.1.1.35) catalyzes the formation of UDP-xylose from UDP-glucuronate. UDP-xylose is then used to initiate glycosaminoglycan biosynthesis on the core protein of proteoglycans. [supplied by OMIM, January 2006]. VN1R1 Exonic 57191 vomeronasal type-1 receptor 1 Pheromones are chemical signals that elicit specific behavioral responses and physiologic alterations in recipients of the same species. The protein encoded by this gene is similar to pheromone receptors and is primarily localized to the olfactory mucosa. An alternate splice variant of this gene is thought to exist, but its full length nature has not been determined. [provided by RefSeq, July 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. VPS13A Exonic 23230 vacuolar protein sorting-associated protein 13A isoform B The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, July 2008]. Transcript Variant: This variant (B) contains a distinct 3 coding region and 3 UTR, compared to variant A. The resulting isoform (B) has a shorter C-terminus compared to isoform A. VPS53 Exonic 55275 vacuolar protein sorting-associated protein 53 homolog This gene encodes a protein with sequence similarity to the yeast Vps53p isoform 1 protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript and it encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. VWA3A Exonic 146177 von Willebrand factor A domain-containing protein 3A N/A precursor WIZ Exonic 58525 protein Wiz N/A XG Exonic 7499 glycoprotein Xg isoform 3 precursor This gene encodes the XG blood group antigen, and is located at the pseudoautosomal boundary on the short (p) arm of chromosome X. The three 5 exons reside in the pseudoautosomal region and the remaining exons within the X-specific end. A truncated copy of this gene is found on the Y chromosome at the pseudoautosomal boundary. It is transcribed, but not expected to make a Y- chromosome specific gene product. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, November 2008]. Transcript Variant: This variant (3) uses an alternate donor splice site at one of the coding exons compared to transcript variant 1, resulting in an isoform (3) containing one additional aa compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Sequence Note: This RefSeq record represents the XG*001.1.1 allele. XPO6 Exonic 23214 exportin-6 Exportins, such as XPO6, recruit cargo in the nucleoplasm in the presence of RAN (MIM 601179)-GTP and form ternary export complexes. These complexes are transported through nuclear pore complexes to the cytoplasm, where GTP is hydrolyzed and the export complex is disassembled. [supplied by OMIM, April 2004]. XYLB Exonic 9942 xylulose kinase The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C. elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, August 2009]. YIPF7 Exonic 285525 protein YIPF7 N/A ZAN Exonic 7455 zonadhesin isoform 6 precursor This gene encodes a sperm membrane protein that binds the zona pellucida of the egg in a species-specific manner. The encoded protein may be involved in signaling or gamete recognition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, July 2008]. Transcript Variant: This variant (6) has multiple differences in the coding region but maintains the reading frame, compared to variant 3. This variant encodes isoform 6 which is 91 aa shorter than isoform 3. ZDHHC19 Exonic 131540 probable palmitoyltransferase ZDHHC19 N/A ZDHHC9 Exonic 51114 palmitoyltransferase ZDHHC9 This gene encodes an integral membrane protein that is a member of the zinc finger DHHC domain-containing protein family. The encoded protein forms a complex with golgin subfamily A member 7 and functions as a palmitoyltransferase. This protein specifically palmitoylates HRAS and NRAS. Mutations in this gene are associated with X-linked mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2010]. Transcript Variant: This variant (1) is the longer transcript and both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ZIM3 Exonic 114026 zinc finger imprinted 3 N/A ZNF185 Exonic 7739 zinc finger protein 185 isoform 9 Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a LIM-domain zinc finger protein. The LIM domain is composed of two contiguous zinc finger domains, separated by a two-amino acid residue hydrophobic linker. The LIM domain mediates protein:protein interactions. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2010]. Transcript Variant: This variant (9) lacks multiple 5 eons, but has an alternate 5 exon, as compared to variant 1. The resulting isoform (9) is much shorter and has a different N-terminus, as compared to isoform 1. ZNF324B Exonic 388569 zinc finger protein 324B N/A ZNF333 Exonic 84449 zinc finger protein 333 N/A ZNF37BP Exonic 100129482 N/A N/A ZNF618 Exonic 114991 zinc finger protein 618 N/A ZNF626 Exonic 199777 zinc finger protein 626 isoform 2 N/A ZNF808 Exonic 388558 zinc finger protein 808 N/A ZNF878 Exonic 729747 zinc finger protein 878 N/A ZRANB3 Exonic 84083 zinc finger Ran-binding domain-containing protein 3 N/A
[0226] Table 3 represents a non-redundant list for all genes listed in Table 2 (namely, those relevant to the CNV subregion). Column 1 refers to the genes name. Column 2 refers to whether the CNV Gene Region is intronic, exonic or both. Intronic refers to CNV subregions affecting introns only; Exonic refers to CNV subregions affecting part or all of one or more exons, which may include adjacent intronic regions if the CNV subregion extends beyond the exonic region. Column 3 refers to the DNA Accession number. Column 4 refers to a brief description for each respective gene. Column 5 refers to a summary of each respective gene's function
TABLE-US-00004 TABLE 4 CNV RefSeq RefSeq Gene Gene Accession Symbol Region SEQ_ID Number RefSeq Gene Description/Definition (transcript variant = tv; HS = HS) CSNK1D exonic SEQ ID 644 NM_001893 HS casein kinase 1, delta (CSNK1D), tv1, mRNA. SLC16A3 exonic SEQ ID 645 NM_001042423 HS solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), tv4, mRNA. CSNK1D exonic SEQ ID 646 NM_139062 HS casein kinase 1, delta (CSNK1D), tv2, mRNA. SLC16A3 exonic SEQ ID 647 NM_004207 HS solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), tv3, mRNA. SLC16A3 exonic SEQ ID 648 NM_001206952 HS solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), tv6, mRNA. SLC16A3 exonic SEQ ID 649 NM_001206951 HS solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), tv5, mRNA. SLC16A3 exonic SEQ ID 650 NM_001042422 HS solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), tv2, mRNA. SLC16A3 exonic SEQ ID 651 NM_001206950 HS solute carrier family 16, member 3 (monocarboxylic acid transporter 4) (SLC16A3), tv1, mRNA. SIRT7 exonic SEQ ID 652 NM_016538 HS sirtuin 7 (SIRT7), mRNA. NPLOC4 exonic SEQ ID 653 NM_017921 HS nuclear protein localization 4 homolog (S. cerevisiae) (NPLOC4), mRNA. CCDC57 exonic SEQ ID 654 NM_198082 HS coiled-coil domain containing 57 (CCDC57), mRNA. MIR3186 exonic SEQ ID 655 NR_036152 HS microRNA 3186 (MIR3186), microRNA. BAHCC1 exonic SEQ ID 656 NM_001080519 HS BAH domain and coiled-coil containing 1 (BAHCC1), mRNA. MIR4740 exonic SEQ ID 657 NR_039894 HS microRNA 4740 (MIR4740), microRNA. ACTG1 exonic SEQ ID 658 NM_001199954 HS actin, gamma 1 (ACTG1), tv1, mRNA. C17orf70 exonic SEQ ID 659 NR_033338 HS chromosome 17 open reading frame 70 (C17orf70), tv1, non-coding RNA. ACTG1 exonic SEQ ID 660 NM_001614 HS actin, gamma 1 (ACTG1), tv2, mRNA. FSCN2 exonic SEQ ID 661 NM_012418 HS fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) (FSCN2), tv1, mRNA. FSCN2 exonic SEQ ID 662 NM_001077182 HS fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) (FSCN2), tv2, mRNA. C17orf70 exonic SEQ ID 663 NM_025161 HS chromosome 17 open reading frame 70 (C17orf70), tv2, mRNA. ACTG1 exonic SEQ ID 664 NR_037688 HS actin, gamma 1 (ACTG1), tv3, non-coding RNA. HGS exonic SEQ ID 665 NM_004712 HS hepatocyte growth factor-regulated tyrosine kinase substrate (HGS), mRNA. SLC25A10 exonic SEQ ID 666 NM_001270888 HS solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 (SLC25A10), nuclear gene encoding mitochondrial protein, tv1, mRNA. OXLD1 exonic SEQ ID 667 NM_001039842 HS oxidoreductase-like domain containing 1 (OXLD1), mRNA. CCDC137 exonic SEQ ID 668 NM_199287 HS coiled-coil domain containing 137 (CCDC137), mRNA. PDE6G exonic SEQ ID 669 NR_026872 HS phosphodiesterase 6G, cGMP-specific, rod, gamma (PDE6G), tv2, non- coding RNA. PDE6G exonic SEQ ID 670 NM_002602 HS phosphodiesterase 6G, cGMP-specific, rod, gamma (PDE6G), tv1, mRNA. SLC25A10 exonic SEQ ID 671 NM_001270953 HS solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 (SLC25A10), nuclear gene encoding mitochondrial protein, tv3, mRNA. SLC25A10 exonic SEQ ID 672 NM_012140 HS solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 (SLC25A10), nuclear gene encoding mitochondrial protein, tv2, mRNA. TSPAN10 exonic SEQ ID 673 NM_031945 HS tetraspanin 10 (TSPAN10), mRNA. ARL16 exonic SEQ ID 674 NM_001040025 HS ADP-ribosylation factor-like 16 (ARL16), mRNA. MRPL12 exonic SEQ ID 675 NM_002949 HS mitochondrial ribosomal protein L12 (MRPL12), nuclear gene encoding mitochondrial protein, mRNA. PCYT2 exonic SEQ ID 676 NM_001256435 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv4, mRNA. P4HB exonic SEQ ID 677 NM_000918 HS prolyl 4-hydroxylase, beta polypeptide (P4HB), mRNA. PCYT2 exonic SEQ ID 678 NM_002861 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv2, mRNA. PCYT2 exonic SEQ ID 679 NM_001256434 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv3, mRNA. ARHGDIA exonic SEQ ID 680 NM_004309 HS Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), tv2, mRNA. ARHGDIA exonic SEQ ID 681 NM_001185078 HS Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), tv3, mRNA. ARHGDIA exonic SEQ ID 682 NM_001185077 HS Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), tv1, mRNA. PPP1R27 exonic SEQ ID 683 NM_001007533 HS protein phosphatase 1, regulatory subunit 27 (PPP1R27), mRNA. NPB exonic SEQ ID 684 NM_148896 HS neuropeptide B (NPB), mRNA. ALYREF exonic SEQ ID 685 NM_005782 HS Aly/REF export factor (ALYREF), mRNA. PCYT2 exonic SEQ ID 686 NM_001184917 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv1, mRNA. ANAPC11 exonic SEQ ID 687 NM_016476 HS anaphase promoting complex subunit 11 (ANAPC11), tv2, mRNA. PCYT2 exonic SEQ ID 688 NM_001256433 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv7, mRNA. PCYT2 exonic SEQ ID 689 NR_033683 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv5, non-coding RNA. PCYT2 exonic SEQ ID 690 NR_033685 HS phosphate cytidylyltransferase 2, ethanolamine (PCYT2), tv6, non-coding RNA. ANAPC11 exonic SEQ ID 691 NM_001002249 HS anaphase promoting complex subunit 11 (ANAPC11), tv7, mRNA. ANAPC11 exonic SEQ ID 692 NM_001002248 HS anaphase promoting complex subunit 11 (ANAPC11), tv6, mRNA. ANAPC11 exonic SEQ ID 693 NM_001002247 HS anaphase promoting complex subunit 11 (ANAPC11), tv5, mRNA. ANAPC11 exonic SEQ ID 694 NM_001002246 HS anaphase promoting complex subunit 11 (ANAPC11), tv4, mRNA. ANAPC11 exonic SEQ ID 695 NM_001002245 HS anaphase promoting complex subunit 11 (ANAPC11), tv3, mRNA. ANAPC11 exonic SEQ ID 696 NM_001002244 HS anaphase promoting complex subunit 11 (ANAPC11), tv1, mRNA. LRRC45 exonic SEQ ID 697 NM_144999 HS leucine rich repeat containing 45 (LRRC45), mRNA. MAFG-AS1 exonic SEQ ID 698 NR_015454 HS MAFG antisense RNA 1 (head to head) (MAFG-AS1), non-coding RNA. STRA13 exonic SEQ ID 699 NM_001271006 HS stimulated by retinoic acid 13 (STRA13), tv1, mRNA. PYCR1 exonic SEQ ID 700 NM_006907 HS pyrroline-5-carboxylate reductase 1 (PYCR1), tv1, mRNA. MAFG exonic SEQ ID 701 NM_002359 HS v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) (MAFG), tv1, mRNA. DCXR exonic SEQ ID 702 NM_001195218 HS dicarbonyl/L-xylulose reductase (DCXR), tv2, mRNA. PYCR1 exonic SEQ ID 703 NM_153824 HS pyrroline-5-carboxylate reductase 1 (PYCR1), tv2, mRNA. STRA13 exonic SEQ ID 704 NM_001271007 HS stimulated by retinoic acid 13 (STRA13), tv3, mRNA. NOTUM exonic SEQ ID 705 NM_178493 HS notum pectinacetylesterase homolog (Drosophila) (NOTUM), mRNA. ASPSCR1 exonic SEQ ID 706 NR_045351 HS alveolar soft part sarcoma chromosome region, candidate 1 (ASPSCR1), tv3, non-coding RNA. ASPSCR1 exonic SEQ ID 707 NM_024083 HS alveolar soft part sarcoma chromosome region, candidate 1 (ASPSCR1), tv1, mRNA. MYADML2 exonic SEQ ID 708 NM_001145113 HS myeloid-associated differentiation marker-like 2 (MYADML2), mRNA. DCXR exonic SEQ ID 709 NM_016286 HS dicarbonyl/L-xylulose reductase (DCXR), tv1, mRNA. ASPSCR1 exonic SEQ ID 710 NM_001251888 HS alveolar soft part sarcoma chromosome region, candidate 1 (ASPSCR1), tv2, mRNA. RAC3 exonic SEQ ID 711 NM_005052 HS ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) (RAC3), mRNA. MAFG exonic SEQ ID 712 NM_032711 HS v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) (MAFG), tv2, mRNA. STRA13 exonic SEQ ID 713 NM_144998 HS stimulated by retinoic acid 13 (STRA13), tv2, mRNA. RFNG exonic SEQ ID 714 NM_002917 HS RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (RFNG), mRNA. FASN exonic SEQ ID 715 NM_004104 HS fatty acid synthase (FASN), mRNA. GPS1 exonic SEQ ID 716 NM_004127 HS G protein pathway suppressor 1 (GPS1), tv2, mRNA. DUS1L exonic SEQ ID 717 NM_022156 HS dihydrouridine synthase 1-like (S. cerevisiae) (DUS1L), mRNA. GPS1 exonic SEQ ID 718 NM_212492 HS G protein pathway suppressor 1 (GPS1), tv1, mRNA. BTNL3 exonic SEQ ID 719 NM_197975 HS butyrophilin-like 3 (BTNL3), mRNA. ZFP62 exonic SEQ ID 720 NM_152283 HS ZFP62 zinc finger protein (ZFP62), tv1, mRNA. LINC00847 ncRNA SEQ ID 721 NR_027183 HS long intergenic non-protein coding RNA 847 (LINC00847), tv1, non-coding RNA. ZFP62 exonic SEQ ID 722 NM_001172638 HS ZFP62 zinc finger protein (ZFP62), tv2, mRNA. LINC00847 ncRNA SEQ ID 723 NR_045679 HS long intergenic non-protein coding RNA 847 (LINC00847), tv3, non-coding RNA. LINC00847 ncRNA SEQ ID 724 NR_045678 HS long intergenic non-protein coding RNA 847 (LINC00847), tv2, non-coding RNA. LINC-HEIH ncRNA SEQ ID 725 NR_045680 HS long intergenic non-protein coding RNA, highly expressed in hepatocellular carcinoma (LINC-HEIH), non-coding RNA. BTNL8 exonic SEQ ID 726 NM_024850 HS butyrophilin-like 8 (BTNL8), tv1, mRNA. BTNL8 exonic SEQ ID 727 NM_001159710 HS butyrophilin-like 8 (BTNL8), tv6, mRNA. BTNL8 exonic SEQ ID 728 NM_001159708 HS butyrophilin-like 8 (BTNL8), tv4, mRNA. BTNL8 exonic SEQ ID 729 NM_001159707 HS butyrophilin-like 8 (BTNL8), tv3, mRNA. BTNL8 exonic SEQ ID 730 NM_001159709 HS butyrophilin-like 8 (BTNL8), tv5, mRNA. BTNL8 exonic SEQ ID 731 NM_001040462 HS butyrophilin-like 8 (BTNL8), tv2, mRNA. CNTNAP2 both SEQ ID 732 NM_014141 HS contactin associated protein-like 2 (CNTNAP2), mRNA. VIMP exonic SEQ ID 733 NM_203472 HS VCP-interacting membrane protein (VIMP), tv1, mRNA. VIMP exonic SEQ ID 734 NM_018445 HS VCP-interacting membrane protein (VIMP), tv2, mRNA. MAOA intronic SEQ ID 735 NM_001270458 HS monoamine oxidase A (MAOA), tv2, mRNA. MAOA intronic SEQ ID 736 NM_000240 HS monoamine oxidase A (MAOA), nuclear gene encoding mitochondrial protein, tv1, mRNA. KANSL1 exonic SEQ ID 737 NM_015443 HS KAT8 regulatory NSL complex subunit 1 (KANSL1), tv2, mRNA. KANSL1 exonic SEQ ID 738 NM_001193466 HS KAT8 regulatory NSL complex subunit 1 (KANSL1), tv1, mRNA. KANSL1 exonic SEQ ID 739 NM_001193465 HS KAT8 regulatory NSL complex subunit 1 (KANSL1), tv3, mRNA. KANSL1-AS1 exonic SEQ ID 740 NR_034172 HS KANSL1 antisense RNA 1 (KANSL1-AS1), non-coding RNA. NSFP1 exonic SEQ ID 741 NR_033799 HS N-ethylmaleimide-sensitive factor pseudogene 1 (NSFP1), non-coding RNA. NSF exonic SEQ ID 742 NM_006178 HS N-ethylmaleimide-sensitive factor (NSF), tv1, mRNA. NSF exonic SEQ ID 743 NR_040116 HS N-ethylmaleimide-sensitive factor (NSF), tv2, non-coding RNA. ARL17B exonic SEQ ID 744 NM_001103154 HS ADP-ribosylation factor-like 17B (ARL17B), tv2, mRNA. LRRC37A exonic SEQ ID 745 NM_014834 HS leucine rich repeat containing 37A (LRRC37A), mRNA. ARL17B exonic SEQ ID 746 NM_001039083 HS ADP-ribosylation factor-like 17B (ARL17B), tv1, mRNA. ARL17A exonic SEQ ID 747 NM_001113738 HS ADP-ribosylation factor-like 17A (ARL17A), tv1, mRNA. ARL17A exonic SEQ ID 748 NM_016632 HS ADP-ribosylation factor-like 17A (ARL17A), tv2, mRNA. LRRC37A2 exonic SEQ ID 749 NM_001006607 HS leucine rich repeat containing 37, member A2 (LRRC37A2), mRNA. COL24A1 exonic SEQ ID 750 NM_152890 HS collagen, type XXIV, alpha 1 (COL24A1), mRNA. CLPSL2 exonic SEQ ID 751 NM_207409 HS colipase-like 2 (CLPSL2), mRNA. CLPSL1 exonic SEQ ID 752 NM_001010886 HS colipase-like 1 (CLPSL1), mRNA. CLPS exonic SEQ ID 753 NM_001252598 HS colipase, pancreatic (CLPS), tv3, mRNA. CLPS exonic SEQ ID 754 NM_001832 HS colipase, pancreatic (CLPS), tv1, mRNA. CLPS exonic SEQ ID 755 NM_001252597 HS colipase, pancreatic (CLPS), tv2, mRNA. ULK1 exonic SEQ ID 756 NM_003565 HS unc-51-like kinase 1 (C. elegans) (ULK1), mRNA. MYH6 exonic SEQ ID 757 NM_002471 HS myosin, heavy chain 6, cardiac muscle, alpha (MYH6), mRNA. MYH7 exonic SEQ ID 758 NM_000257 HS myosin, heavy chain 7, cardiac muscle, beta (MYH7), mRNA. MIR208B exonic SEQ ID 759 NR_030624 HS microRNA 208b (MIR208B), microRNA. MTRNR2L6 exonic SEQ ID 760 NM_001190487 HS MT-RNR2-like 6 (MTRNR2L6), mRNA. PRSS1 exonic SEQ ID 761 NM_002769 HS protease, serine, 1 (trypsin 1) (PRSS1), mRNA. PRSS3P2 exonic SEQ ID 762 NR_001296 HS protease, serine, 3 pseudogene 2 (PRSS3P2), non-coding RNA. PRSS2 exonic SEQ ID 763 NM_002770 HS protease, serine, 2 (trypsin 2) (PRSS2), mRNA. ZNF333 exonic SEQ ID 764 NM_032433 HS zinc finger protein 333 (ZNF333), mRNA. PRDM6 exonic SEQ ID 765 NM_001136239 HS PR domain containing 6 (PRDM6), mRNA. C2orf48 exonic SEQ ID 766 NM_182626 HS chromosome 2 open reading frame 48 (C2orf48), mRNA. SYNGAP1 exonic SEQ ID 767 NM_006772 HS synaptic Ras GTPase activating protein 1 (SYNGAP1), mRNA. CUTA exonic SEQ ID 768 NM_001014433 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv1, mRNA. PHF1 exonic SEQ ID 769 NR_027692 HS PHD finger protein 1 (PHF1), tv3, non-coding RNA. PHF1 exonic SEQ ID 770 NM_024165 HS PHD finger protein 1 (PHF1), tv2, mRNA. PHF1 exonic SEQ ID 771 NM_002636 HS PHD finger protein 1 (PHF1), tv1, mRNA. CUTA exonic SEQ ID 772 NM_001014840 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv5, mRNA. CUTA exonic SEQ ID 773 NM_001014838 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv4, mRNA. CUTA exonic SEQ ID 774 NM_001014837 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv3, mRNA. CUTA exonic SEQ ID 775 NM_015921 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv2, mRNA. OR52N1 exonic SEQ ID 776 NM_001001913 HS olfactory receptor, family 52, subfamily N, member 1 (OR52N1), mRNA. OR52N5 exonic SEQ ID 777 NM_001001922 HS olfactory receptor, family 52, subfamily N, member 5 (OR52N5), mRNA. KIFC1 exonic SEQ ID 778 NM_002263 HS kinesin family member C1 (KIFC1), mRNA. MIR935 exonic SEQ ID 779 NR_030632 HS microRNA 935 (MIR935), microRNA. CACNG8 exonic SEQ ID 780 NM_031895 HS calcium channel, voltage-dependent, gamma subunit 8 (CACNG8), mRNA. EBF3 exonic SEQ ID 781 NM_001005463 HS early B-cell factor 3 (EBF3), mRNA. MNS1 exonic SEQ ID 782 NM_018365 HS meiosis-specific nuclear structural 1 (MNS1), mRNA. TEX9 exonic SEQ ID 783 NM_198524 HS testis expressed 9 (TEX9), mRNA. ANKRD33B exonic SEQ ID 784 NM_001164440 HS ankyrin repeat domain 33B (ANKRD33B), mRNA. AIG1 exonic SEQ ID 785 NM_016108 HS androgen-induced 1 (AIG1), mRNA. MARCH6 exonic SEQ ID 786 NM_005885 HS membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase (MARCH6), tv1, mRNA. MARCH6 exonic SEQ ID 787 NM_001270661 HS membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase (MARCH6), tv3, mRNA. CTNND2 exonic SEQ ID 788 NM_001332 HS catenin (cadherin-associated protein), delta 2 (CTNND2), mRNA. SEMA5A exonic SEQ ID 789 NM_003966 HS sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A (SEMA5A), mRNA. MARCH6 exonic SEQ ID 790 NM_001270660 HS membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase (MARCH6), tv2, mRNA. CMBL exonic SEQ ID 791 NM_138809 HS carboxymethylenebutenolidase homolog (Pseudomonas) (CMBL), mRNA. LOC285692 exonic SEQ ID 792 NR_027112 HS uncharacterized LOC285692 (LOC285692), non-coding RNA. DAP exonic SEQ ID 793 NM_004394 HS death-associated protein (DAP), mRNA. CT49 ncRNA SEQ ID 794 NR_033383 HS cancer/testis antigen 49 (non-protein coding) (CT49), non-coding RNA. TAS2R1 exonic SEQ ID 795 NM_019599 HS taste receptor, type 2, member 1 (TAS2R1), mRNA. LOC100505806 exonic SEQ ID 796 NR_045196 HS uncharacterized LOC100505806 (LOC100505806), non-coding RNA. SNORD123 exonic SEQ ID 797 NR_003689 HS small nucleolar RNA, C/D box 123 (SNORD123), small nucleolar RNA. FAM173B exonic SEQ ID 798 NM_199133 HS family with sequence similarity 173, member B (FAM173B), tv1, mRNA. CCT5 exonic SEQ ID 799 NM_012073 HS chaperonin containing TCP1, subunit 5 (epsilon) (CCT5), mRNA. FAM173B exonic SEQ ID 800 NM_001258388 HS family with sequence similarity 173, member B (FAM173B), tv2, mRNA. FAM173B exonic SEQ ID 801 NM_001258389 HS family with sequence similarity 173, member B (FAM173B), tv3, mRNA. FAM173B exonic SEQ ID 802 NR_047670 HS family with sequence similarity 173, member B (FAM173B), tv6, non- coding RNA. FAM173B exonic SEQ ID 803 NR_047669 HS family with sequence similarity 173, member B (FAM173B), tv5, non- coding RNA. FAM173B exonic SEQ ID 804 NR_047668 HS family with sequence similarity 173, member B (FAM173B), tv4, non- coding RNA. ROPN1L exonic SEQ ID 805 NM_001201466 HS rhophilin associated tail protein 1-like (ROPN1L), tv2, mRNA. ROPN1L exonic SEQ ID 806 NM_031916 HS rhophilin associated tail protein 1-like (ROPN1L), tv1, mRNA. C16orf89 exonic SEQ ID 807 NM_001098514 HS chromosome 16 open reading frame 89 (C16orf89), tv2, mRNA. C16orf89 exonic SEQ ID 808 NM_152459 HS chromosome 16 open reading frame 89 (C16orf89), tv1, mRNA. ELK3 exonic SEQ ID 809 NM_005230 HS ELK3, ETS-domain protein (SRF accessory protein 2) (ELK3), mRNA. C11orf96 exonic SEQ ID 810 NM_001145033 HS chromosome 11 open reading frame 96 (C11orf96), mRNA. CREBBP exonic SEQ ID 811 NM_001079846 HS CREB binding protein (CREBBP), tv2, mRNA. CREBBP exonic SEQ ID 812 NM_004380 HS CREB binding protein (CREBBP), tv1, mRNA. HEATR4 exonic SEQ ID 813 NM_203309 HS HEAT repeat containing 4 (HEATR4), tv2, mRNA. HEATR4 exonic SEQ ID 814 NM_001220484 HS HEAT repeat containing 4 (HEATR4), tv1, mRNA. SRL exonic SEQ ID 815 NM_001098814 HS sarcalumenin (SRL), mRNA. PKD1L2 exonic SEQ ID 816 NM_052892 HS polycystic kidney disease 1-like 2 (PKD1L2), tv1, mRNA. C11orf49 exonic SEQ ID 817 NM_001003678 HS chromosome 11 open reading frame 49 (C11orf49), tv4, mRNA. ARFGAP2 exonic SEQ ID 818 NM_001242832 HS ADP-ribosylation factor GTPase activating protein 2 (ARFGAP2), tv2, mRNA. ARFGAP2 exonic SEQ ID 819 NM_032389 HS ADP-ribosylation factor GTPase activating protein 2 (ARFGAP2), tv1, mRNA. PACSIN3 exonic SEQ ID 820 NM_016223 HS protein kinase C and casein kinase substrate in neurons 3 (PACSIN3), tv2, mRNA. PACSIN3 exonic SEQ ID 821 NM_001184975 HS protein kinase C and casein kinase substrate in neurons 3 (PACSIN3), tv1, mRNA. PACSIN3 exonic SEQ ID 822 NM_001184974 HS protein kinase C and casein kinase substrate in neurons 3 (PACSIN3), tv3, mRNA. PKD1L2 exonic SEQ ID 823 NM_001076780 HS polycystic kidney disease 1-like 2 (PKD1L2), tv3, mRNA. GYG2 exonic SEQ ID 824 NM_001184703 HS glycogenin 2 (GYG2), tv4, mRNA. GYG2 exonic SEQ ID 825 NM_003918 HS glycogenin 2 (GYG2), tv2, mRNA. GYG2 exonic SEQ ID 826 NM_001079855 HS glycogenin 2 (GYG2), tv1, mRNA. GYG2 exonic SEQ ID 827 NM_001184704 HS glycogenin 2 (GYG2), tv5, mRNA. GYG2 exonic SEQ ID 828 NM_001184702 HS glycogenin 2 (GYG2), tv3, mRNA. GCSH exonic SEQ ID 829 NM_004483 HS glycine cleavage system protein H (aminomethyl carrier) (GCSH), nuclear gene encoding mitochondrial protein, tv1, mRNA. GCSH exonic SEQ ID 830 NR_033249 HS glycine cleavage system protein H (aminomethyl carrier) (GCSH), tv2, non- coding RNA. C16orf96 exonic SEQ ID 831 NM_001145011 HS chromosome 16 open reading frame 96 (C16orf96), mRNA. ACOT1 exonic SEQ ID 832 NM_001037161 HS acyl-CoA thioesterase 1 (ACOT1), mRNA. ALMS1P exonic SEQ ID 833 NR_003683 HS Alstrom syndrome 1 pseudogene (ALMS1P), non-coding RNA. NAT8B exonic SEQ ID 834 NM_016347 HS N-acetyltransferase 8B (GCN5-related, putative, gene/pseudogene) (NAT8B), mRNA. ACOT2 exonic SEQ ID 835 NM_006821 HS acyl-CoA thioesterase 2 (ACOT2), nuclear gene encoding mitochondrial protein, tv1, mRNA. ACOT2 exonic SEQ ID 836 NR_046028 HS acyl-CoA thioesterase 2 (ACOT2), tv2, non-coding RNA. NAT8 exonic SEQ ID 837 NM_003960 HS N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mRNA. C14orf169 exonic SEQ ID 838 NM_024644 HS chromosome 14 open reading frame 169 (C14orf169), mRNA. XG exonic SEQ ID 839 NM_001141919 HS Xg blood group (XG), tv2, mRNA. XG exonic SEQ ID 840 NM_175569 HS Xg blood group (XG), tv1, mRNA. XG exonic SEQ ID 841 NM_001141920 HS Xg blood group (XG), tv3, mRNA. BCMO1 exonic SEQ ID 842 NM_017429 HS beta-carotene 15,15-monooxygenase 1 (BCMO1), mRNA. CD99 exonic SEQ ID 843 NM_002414 HS CD99 molecule (CD99), tv1, mRNA. CD99 exonic SEQ ID 844 NM_001122898 HS CD99 molecule (CD99), tv2, mRNA. CD99P1 exonic SEQ ID 845 NR_033381 HS CD99 molecule pseudogene 1 (CD99P1), tv2, non-coding RNA. CD99P1 exonic SEQ ID 846 NR_033380 HS CD99 molecule pseudogene 1 (CD99P1), tv1, non-coding RNA. XGPY2 exonic SEQ ID 847 NR_003254 HS Xg pseudogene, Y-linked 2 (XGPY2), non-coding RNA. ARSE exonic SEQ ID 848 NM_000047 HS arylsulfatase E (chondrodysplasia punctata 1) (ARSE), mRNA. ARSF exonic SEQ ID 849 NM_004042 HS arylsulfatase F (ARSF), tv1, mRNA. ARSF exonic SEQ ID 850 NM_001201539 HS arylsulfatase F (ARSF), tv3, mRNA. ARSF exonic SEQ ID 851 NM_001201538 HS arylsulfatase F (ARSF), tv2, mRNA. ARSD exonic SEQ ID 852 NM_001669 HS arylsulfatase D (ARSD), mRNA. ARSH exonic SEQ ID 853 NM_001011719 HS arylsulfatase family, member H (ARSH), mRNA. ADCY9 exonic SEQ ID 854 NM_001116 HS adenylate cyclase 9 (ADCY9), mRNA. TRAP1 exonic SEQ ID 855 NM_016292 HS TNF receptor-associated protein 1 (TRAP1), nuclear gene encoding mitochondrial protein, tv1, mRNA. NLRC3 exonic SEQ ID 856 NM_178844 HS NLR family, CARD domain containing 3 (NLRC3), mRNA. ANKS3 exonic SEQ ID 857 NR_040252 HS ankyrin repeat and sterile alpha motif domain containing 3 (ANKS3), tv3, non-coding RNA. SEC14L5 exonic SEQ ID 858 NM_014692 HS SEC14-like 5 (S. cerevisiae) (SEC14L5), mRNA. ANKS3 exonic SEQ ID 859 NM_133450 HS ankyrin repeat and sterile alpha motif domain containing 3 (ANKS3), tv1, mRNA. NMRAL1 exonic SEQ ID 860 NM_020677 HS NmrA-like family domain containing 1 (NMRAL1), mRNA. UBN1 exonic SEQ ID 861 NM_016936 HS ubinuclein 1 (UBN1), tv1, mRNA. UBN1 exonic SEQ ID 862 NM_001079514 HS ubinuclein 1 (UBN1), tv2, mRNA. GLIS2 exonic SEQ ID 863 NM_032575 HS GLIS family zinc finger 2 (GLIS2), mRNA. ANKS3 exonic SEQ ID 864 NM_001242929 HS ankyrin repeat and sterile alpha motif domain containing 3 (ANKS3), tv2, mRNA. MTRNR2L4 exonic SEQ ID 865 NM_001190476 HS MT-RNR2-like 4 (MTRNR2L4), mRNA. ZSCAN32/ZNF434 exonic SEQ ID 866 NM_017810 HS zinc finger and SCAN domain containing 32 (ZSCAN32), mRNA. ZNF174 exonic SEQ ID 867 NM_003450 HS zinc finger protein 174 (ZNF174), tv1, mRNA. ZNF174 exonic SEQ ID 868 NM_001032292 HS zinc finger protein 174 (ZNF174), tv2, mRNA. CLUAP1 exonic SEQ ID 869 NM_015041 HS clusterin associated protein 1 (CLUAP1), tv1, mRNA. NAA60 exonic SEQ ID 870 NM_024845 HS N(alpha)-acetyltransferase 60, NatF catalytic subunit (NAA60), tv2, mRNA. NAA60 exonic SEQ ID 871 NM_001083600 HS N(alpha)-acetyltransferase 60, NatF catalytic subunit (NAA60), tv3, mRNA. CLUAP1 exonic SEQ ID 872 NM_024793 HS clusterin associated protein 1 (CLUAP1), tv2, mRNA. C16orf90 exonic SEQ ID 873 NM_001080524 HS chromosome 16 open reading frame 90 (C16orf90), mRNA. ZNF597 exonic SEQ ID 874 NM_152457 HS zinc finger protein 597 (ZNF597), mRNA. NAA60 exonic SEQ ID 875 NM_001083601 HS N(alpha)-acetyltransferase 60, NatF catalytic subunit (NAA60), tv1, mRNA. DNASE1 exonic SEQ ID 876 NM_005223 HS deoxyribonuclease I (DNASE1), mRNA. SLX4 exonic SEQ ID 877 NM_032444 HS SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae) (SLX4), mRNA. TFAP4 exonic SEQ ID 878 NM_003223 HS transcription factor AP-4 (activating enhancer binding protein 4) (TFAP4), mRNA. LOC100507501 exonic SEQ ID 879 NR_039999 HS uncharacterized LOC100507501 (LOC100507501), non-coding RNA. VASN exonic SEQ ID 880 NM_138440 HS vasorin (VASN), mRNA. PAM16 exonic SEQ ID 881 NM_016069 HS presequence translocase-associated motor 16 homolog (S. cerevisiae) (PAM16), nuclear gene encoding mitochondrial protein, mRNA. CORO7-PAM16 exonic SEQ ID 882 NM_001201479 HS CORO7-PAM16 readthrough (CORO7-PAM16), mRNA. CORO7 exonic SEQ ID 883 NM_001201473 HS coronin 7 (CORO7), tv3, mRNA. CORO7 exonic SEQ ID 884 NM_001201472 HS coronin 7 (CORO7), tv2, mRNA. DNAJA3 exonic SEQ ID 885 NM_001135110 HS DnaJ (Hsp40) homolog, subfamily A, member 3 (DNAJA3), nuclear gene encoding mitochondrial protein, tv2, mRNA. CORO7 exonic SEQ ID 886 NM_024535 HS coronin 7 (CORO7), tv1, mRNA. DNAJA3 exonic SEQ ID 887 NM_005147 HS DnaJ (Hsp40) homolog, subfamily A, member 3 (DNAJA3), nuclear gene encoding mitochondrial protein, tv1, mRNA. CDIP1/C16orf5 exonic SEQ ID 888 NM_013399 HS cell death-inducing p53 target 1 (CDIP1), tv2, mRNA. HMOX2 exonic SEQ ID 889 NM_001127206 HS heme oxygenase (decycling) 2 (HMOX2), tv4, mRNA. CDIP1/C16orf5 exonic SEQ ID 890 NM_001199056 HS cell death-inducing p53 target 1 (CDIP1), tv4, mRNA. CDIP1/C16orf5 exonic SEQ ID 891 NM_001199055 HS cell death-inducing p53 target 1 (CDIP1), tv3, mRNA. CDIP1/C16orf5 exonic SEQ ID 892 NM_001199054 HS cell death-inducing p53 target 1 (CDIP1), tv1, mRNA. HMOX2 exonic SEQ ID 893 NM_001127205 HS heme oxygenase (decycling) 2 (HMOX2), tv2, mRNA. HMOX2 exonic SEQ ID 894 NM_002134 HS heme oxygenase (decycling) 2 (HMOX2), tv3, mRNA. HMOX2 exonic SEQ ID 895 NM_001127204 HS heme oxygenase (decycling) 2 (HMOX2), tv1, mRNA. NUDT16L1 exonic SEQ ID 896 NM_001193452 HS nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (NUDT16L1), tv2, mRNA. NUDT16L1 exonic SEQ ID 897 NM_032349 HS nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (NUDT16L1), tv1, mRNA. MGRN1 exonic SEQ ID 898 NM_001142291 HS mahogunin ring finger 1, E3 ubiquitin protein ligase (MGRN1), tv4, mRNA. MGRN1 exonic SEQ ID 899 NM_015246 HS mahogunin ring finger 1, E3 ubiquitin protein ligase (MGRN1), tv1, mRNA. MGRN1 exonic SEQ ID 900 NM_001142289 HS mahogunin ring finger 1, E3 ubiquitin protein ligase (MGRN1), tv2, mRNA. MGRN1 exonic SEQ ID 901 NM_001142290 HS mahogunin ring finger 1, E3 ubiquitin protein ligase (MGRN1), tv3, mRNA. UBALD1/FAM100A exonic SEQ ID 902 NM_145253 HS UBA-like domain containing 1 (UBALD1), mRNA. C16orf71 exonic SEQ ID 903 NM_139170 HS chromosome 16 open reading frame 71 (C16orf71), mRNA. ROGDI exonic SEQ ID 904 NM_024589 HS rogdi homolog (Drosophila) (ROGDI), tv1, mRNA. LOC440335 exonic SEQ ID 905 NM_001253794 HS uncharacterized LOC440335 (LOC440335), tv4, mRNA. SEPT12 exonic SEQ ID 906 NM_144605 HS septin 12 (SEPT12), tv2, mRNA. ROGDI exonic SEQ ID 907 NR_046480 HS rogdi homolog (Drosophila) (ROGDI), tv2, non-coding RNA. SEPT12 exonic SEQ ID 908 NM_001154458 HS septin 12 (SEPT12), tv1, mRNA. GLYR1 exonic SEQ ID 909 NM_032569 HS glyoxylate reductase 1 homolog (Arabidopsis) (GLYR1), mRNA. ZNF500 exonic SEQ ID 910 NM_021646 HS zinc finger protein 500 (ZNF500), mRNA. LOC440335 exonic SEQ ID 911 NM_001253791 HS uncharacterized LOC440335 (LOC440335), tv2, mRNA. LOC440335 exonic SEQ ID 912 NM_001253790 HS uncharacterized LOC440335 (LOC440335), tv1, mRNA. LOC440335 exonic SEQ ID 913 NM_001253793 HS uncharacterized LOC440335 (LOC440335), tv3, mRNA. PPL exonic SEQ ID 914 NM_002705 HS periplakin (PPL), mRNA. ALG1 exonic SEQ ID 915 NM_019109 HS asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) (ALG1), mRNA. NAGPA exonic SEQ ID 916 NM_016256 HS N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase (NAGPA), mRNA. NAGPA-AS1 exonic SEQ ID 917 NR_038913 HS NAGPA antisense RNA 1 (NAGPA-AS1), non-coding RNA. SNUPN exonic SEQ ID 918 NM_001042588 HS snurportin 1 (SNUPN), tv3, mRNA. SNUPN exonic SEQ ID 919 NM_005701 HS snurportin 1 (SNUPN), tv1, mRNA. SNUPN exonic SEQ ID 920 NM_001042581 HS snurportin 1 (SNUPN), tv2, mRNA. SIN3A exonic SEQ ID 921 NM_001145357 HS SIN3 transcription regulator homolog A (yeast) (SIN3A), tv3, mRNA. SIN3A exonic SEQ ID 922 NM_001145358 HS SIN3 transcription regulator homolog A (yeast) (SIN3A), tv1, mRNA. MAN2C1 exonic SEQ ID 923 NM_006715 HS mannosidase, alpha, class 2C, member 1 (MAN2C1), tv1, mRNA. SIN3A exonic SEQ ID 924 NM_015477 HS SIN3 transcription regulator homolog A (yeast) (SIN3A), tv2, mRNA. MAN2C1 exonic SEQ ID 925 NM_001256494 HS mannosidase, alpha, class 2C, member 1 (MAN2C1), tv2, mRNA. MAN2C1 exonic SEQ ID 926 NM_001256496 HS mannosidase, alpha, class 2C, member 1 (MAN2C1), tv4, mRNA. MAN2C1 exonic SEQ ID 927 NM_001256495 HS mannosidase, alpha, class 2C, member 1 (MAN2C1), tv3, mRNA. IMP3 exonic SEQ ID 928 NM_018285 HS IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP3), mRNA. CSPG4 exonic SEQ ID 929 NM_001897 HS chondroitin sulfate proteoglycan 4 (CSPG4), mRNA. SNX33 exonic SEQ ID 930 NM_153271 HS sorting nexin 33 (SNX33), mRNA. CYP1A1 exonic SEQ ID 931 NM_000499 HS cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1), mRNA. ARHGAP21 exonic SEQ ID 932 NM_020824 HS Rho GTPase activating protein 21 (ARHGAP21), mRNA. NEO1 exonic SEQ ID 933 NM_002499 HS neogenin 1 (NEO1), tv1, mRNA. NEO1 exonic SEQ ID 934 NM_001172624 HS neogenin 1 (NEO1), tv3, mRNA. NEO1 exonic SEQ ID 935 NM_001172623 HS neogenin 1 (NEO1), tv2, mRNA. TXLNB exonic SEQ ID 936 NM_153235 HS taxilin beta (TXLNB), mRNA. ZAN exonic SEQ ID 937 NM_003386 HS zonadhesin (ZAN), tv3, mRNA. ZAN exonic SEQ ID 938 NM_173059 HS zonadhesin (ZAN), tv6, mRNA. LCE1D exonic SEQ ID 939 NM_178352 HS late cornified envelope 1D (LCE1D), mRNA. LCE1C exonic SEQ ID 940 NM_178351 HS late cornified envelope 1C (LCE1C), tv1, mRNA. LCE1E exonic SEQ ID 941 NM_178353 HS late cornified envelope 1E (LCE1E), mRNA. CCDC33 exonic SEQ ID 942 NM_025055 HS coiled-coil domain containing 33 (CCDC33), mRNA. GRAMD2 exonic SEQ ID 943 NM_001012642 HS GRAM domain containing 2 (GRAMD2), mRNA. MYO9A exonic SEQ ID 944 NM_006901 HS myosin IXA (MYO9A), mRNA. THSD4 exonic SEQ ID 945 NM_024817 HS thrombospondin, type I, domain containing 4 (THSD4), mRNA. BBS4 exonic SEQ ID 946 NM_033028 HS Bardet-Biedl syndrome 4 (BBS4), tv1, mRNA. CELF6 exonic SEQ ID 947 NM_001172684 HS CUGBP, Elav-like family member 6 (CELF6), tv2, mRNA. CELF6 exonic SEQ ID 948 NM_052840 HS CUGBP, Elav-like family member 6 (CELF6), tv1, mRNA. CELF6 exonic SEQ ID 949 NM_001172685 HS CUGBP, Elav-like family member 6 (CELF6), tv3, mRNA. BBS4 exonic SEQ ID 950 NM_001252678 HS Bardet-Biedl syndrome 4 (BBS4), tv2, mRNA. ARIH1 exonic SEQ ID 951 NM_005744 HS ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) (ARIH1), mRNA. BBS4 exonic SEQ ID 952 NR_045566 HS Bardet-Biedl syndrome 4 (BBS4), tv4, non-coding RNA. BBS4 exonic SEQ ID 953 NR_045565 HS Bardet-Biedl syndrome 4 (BBS4), tv3, non-coding RNA. NPTN exonic SEQ ID 954 NM_001161364 HS neuroplastin (NPTN), tvd, mRNA. PML exonic SEQ ID 955 NM_002675 HS promyelocytic leukemia (PML), tv6, mRNA. TBC1D21 exonic SEQ ID 956 NM_153356 HS TBC1 domain family, member 21 (TBC1D21), mRNA. PML exonic SEQ ID 957 NM_033240 HS promyelocytic leukemia (PML), tv2, mRNA. PML exonic SEQ ID 958 NM_033239 HS promyelocytic leukemia (PML), tv9, mRNA. C15orf60 exonic SEQ ID 959 NM_001042367 HS chromosome 15 open reading frame 60 (C15orf60), mRNA. PML exonic SEQ ID 960 NM_033250 HS promyelocytic leukemia (PML), tv11, mRNA. PML exonic SEQ ID 961 NM_033249 HS promyelocytic leukemia (PML), tv10, mRNA. PML exonic SEQ ID 962 NM_033247 HS promyelocytic leukemia (PML), tv8, mRNA. PML exonic SEQ ID 963 NM_033246 HS promyelocytic leukemia (PML), tv7, mRNA. PML exonic SEQ ID 964 NM_033244 HS promyelocytic leukemia (PML), tv5, mRNA. NPTN exonic SEQ ID 965 NM_012428 HS neuroplastin (NPTN), tvb, mRNA. PML exonic SEQ ID 966 NM_033238 HS promyelocytic leukemia (PML), tv1, mRNA. NPTN exonic SEQ ID 967 NM_017455 HS neuroplastin (NPTN), tva, mRNA. NPTN exonic SEQ ID 968 NM_001161363 HS neuroplastin (NPTN), tvc, mRNA. HCN4 exonic SEQ ID 969 NM_005477 HS hyperpolarization activated cyclic nucleotide-gated potassium channel 4 (HCN4), mRNA. C15orf59 exonic SEQ ID 970 NM_001039614 HS chromosome 15 open reading frame 59 (C15orf59), mRNA. CSK exonic SEQ ID 971 NM_001127190 HS c-src tyrosine kinase (CSK), tv2, mRNA. COX5A exonic SEQ ID 972 NM_004255 HS cytochrome c oxidase subunit Va (COX5A), nuclear gene encoding mitochondrial protein, mRNA. EDC3 exonic SEQ ID 973 NM_001142444 HS enhancer of mRNA decapping 3 homolog (S. cerevisiae) (EDC3), tv2, mRNA. EDC3 exonic SEQ ID 974 NM_001142443 HS enhancer of mRNA decapping 3 homolog (S. cerevisiae) (EDC3), tv1, mRNA. CSK exonic SEQ ID 975 NM_004383 HS c-src tyrosine kinase (CSK), tv1, mRNA. EDC3 exonic SEQ ID 976 NM_025083 HS enhancer of mRNA decapping 3 homolog (S. cerevisiae) (EDC3), tv3, mRNA. NR2E3 exonic SEQ ID 977 NM_016346 HS nuclear receptor subfamily 2, group E, member 3 (NR2E3), tv1, mRNA. NR2E3 exonic SEQ ID 978 NM_014249 HS nuclear receptor subfamily 2, group E, member 3 (NR2E3), tv2, mRNA. SENP8 exonic SEQ ID 979 NM_001172109 HS SUMO/sentrin specific peptidase family member 8 (SENP8), tv3, mRNA. SENP8 exonic SEQ ID 980 NM_001172111 HS SUMO/sentrin specific peptidase family member 8 (SENP8), tv5, mRNA. SENP8 exonic SEQ ID 981 NM_145204 HS SUMO/sentrin specific peptidase family member 8 (SENP8), tv2, mRNA. SENP8 exonic SEQ ID 982 NM_001172110 HS SUMO/sentrin specific peptidase family member 8 (SENP8), tv4, mRNA. SENP8 exonic SEQ ID 983 NM_001166340 HS SUMO/sentrin specific peptidase family member 8 (SENP8), tv1, mRNA. PKM exonic SEQ ID 984 NM_002654 HS pyruvate kinase, muscle (PKM), tv1, mRNA. PKM exonic SEQ ID 985 NM_001206796 HS pyruvate kinase, muscle (PKM), tv4, mRNA. PARP6 exonic SEQ ID 986 NM_020214 HS poly (ADP-ribose) polymerase family, member 6 (PARP6), mRNA. PKM exonic SEQ ID 987 NM_182471 HS pyruvate kinase, muscle (PKM), tv3, mRNA. PKM exonic SEQ ID 988 NM_182470 HS pyruvate kinase, muscle (PKM), tv2, mRNA. PKM exonic SEQ ID 989 NM_001206799 HS pyruvate kinase, muscle (PKM), tv7, mRNA. PKM exonic SEQ ID 990 NM_001206798 HS pyruvate kinase, muscle (PKM), tv6, mRNA. PKM exonic SEQ ID 991 NM_001206797 HS pyruvate kinase, muscle (PKM), tv5, mRNA. HEXA-AS1 exonic SEQ ID 992 NR_027262 HS HEXA antisense RNA 1 (HEXA-AS1), non-coding RNA. HEXA exonic SEQ ID 993 NM_000520 HS hexosaminidase A (alpha polypeptide) (HEXA), mRNA. TMEM202 exonic SEQ ID 994 NM_001080462 HS transmembrane protein 202 (TMEM202), mRNA. HIGD2B exonic SEQ ID 995 NR_002780 HS HIG1 hypoxia inducible domain family, member 2B (HIGD2B), non- coding RNA. GOLGA6B exonic SEQ ID 996 NM_018652 HS golgin A6 family, member B (GOLGA6B), mRNA. MIR630 exonic SEQ ID 997 NR_030359 HS microRNA 630 (MIR630), microRNA. ADPGK exonic SEQ ID 998 NR_023319 HS ADP-dependent glucokinase (ADPGK), tv3, non-coding RNA. ADPGK exonic SEQ ID 999 NR_023318 HS ADP-dependent glucokinase (ADPGK), tv2, non-coding RNA. ADPGK exonic SEQ ID 1000 NM_031284 HS ADP-dependent glucokinase (ADPGK), tv1, mRNA. ADPGK-AS1 exonic SEQ ID 1001 NR_040107 HS ADPGK antisense RNA 1 (ADPGK-AS1), non-coding RNA. CD276 exonic SEQ ID 1002 NM_001024736 HS CD276 molecule (CD276), tv1, mRNA. CD276 exonic SEQ ID 1003 NM_025240 HS CD276 molecule (CD276), tv2, mRNA. STOML1 exonic SEQ ID 1004 NM_001256677 HS stomatin (EPB72)-like 1 (STOML1), tv7, mRNA. STOML1 exonic SEQ ID 1005 NM_001256673 HS stomatin (EPB72)-like 1 (STOML1), tv3, mRNA. STOML1 exonic SEQ ID 1006 NM_001256672 HS stomatin (EPB72)-like 1 (STOML1), tv2, mRNA. LOXL1 exonic SEQ ID 1007 NM_005576 HS lysyl oxidase-like 1 (LOXL1), mRNA. LOXL1-AS1 exonic SEQ ID 1008 NR_040066 HS LOXL1 antisense RNA 1 (LOXL1-AS1), tv1, non-coding RNA. STOML1 exonic SEQ ID 1009 NM_001256676 HS stomatin (EPB72)-like 1 (STOML1), tv6, mRNA. STOML1 exonic SEQ ID 1010 NM_001256675 HS stomatin (EPB72)-like 1 (STOML1), tv5, mRNA. STOML1 exonic SEQ ID 1011 NM_001256674 HS stomatin (EPB72)-like 1 (STOML1), tv4, mRNA. LOXL1-AS1 exonic SEQ ID 1012 NR_040070 HS LOXL1 antisense RNA 1 (LOXL1-AS1), tv5, non-coding RNA. STOML1 exonic SEQ ID 1013 NM_004809 HS stomatin (EPB72)-like 1 (STOML1), tv1, mRNA. LOXL1-AS1 exonic SEQ ID 1014 NR_040069 HS LOXL1 antisense RNA 1 (LOXL1-AS1), tv4, non-coding RNA. LOXL1-AS1 exonic SEQ ID 1015 NR_040068 HS LOXL1 antisense RNA 1 (LOXL1-AS1), tv3, non-coding RNA. LOXL1-AS1 exonic SEQ ID 1016 NR_040067 HS LOXL1 antisense RNA 1 (LOXL1-AS1), tv2, non-coding RNA. ISLR2 exonic SEQ ID 1017 NM_020851 HS immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2), tv2, mRNA. LOC283731 exonic SEQ ID 1018 NR_027073 HS uncharacterized LOC283731 (LOC283731), non-coding RNA. ISLR2 exonic SEQ ID 1019 NM_001130138 HS immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2), tv4, mRNA. ISLR2 exonic SEQ ID 1020 NM_001130137 HS immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2), tv3, mRNA. ISLR2 exonic SEQ ID 1021 NM_001130136 HS immunoglobulin superfamily containing leucine-rich repeat 2 (ISLR2), tv1, mRNA. GOLGA6A exonic SEQ ID 1022 NM_001038640 HS golgin A6 family, member A (GOLGA6A), mRNA. STRA6 exonic SEQ ID 1023 NM_001199041 HS stimulated by retinoic acid 6 (STRA6), tv7, mRNA. STRA6 exonic SEQ ID 1024 NM_001142619 HS stimulated by retinoic acid 6 (STRA6), tv4, mRNA. STRA6 exonic SEQ ID 1025 NM_001199040 HS stimulated by retinoic acid 6 (STRA6), tv6, mRNA. STRA6 exonic SEQ ID 1026 NM_001142618 HS stimulated by retinoic acid 6 (STRA6), tv3, mRNA. STRA6 exonic SEQ ID 1027 NM_001142617 HS stimulated by retinoic acid 6 (STRA6), tv1, mRNA. STRA6 exonic SEQ ID 1028 NM_022369 HS stimulated by retinoic acid 6 (STRA6), tv2, mRNA. ISLR exonic SEQ ID 1029 NM_201526 HS immunoglobulin superfamily containing leucine-rich repeat (ISLR), tv2, mRNA. ISLR exonic SEQ ID 1030 NM_005545 HS immunoglobulin superfamily containing leucine-rich repeat (ISLR), tv1, mRNA. STRA6 exonic SEQ ID 1031 NM_001142620 HS stimulated by retinoic acid 6 (STRA6), tv5, mRNA. STRA6 exonic SEQ ID 1032 NM_001199042 HS stimulated by retinoic acid 6 (STRA6), tv8, mRNA. CYP11A1 exonic SEQ ID 1033 NM_000781 HS cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), nuclear gene encoding mitochondrial protein, tv1, mRNA. CYP11A1 exonic SEQ ID 1034 NM_001099773 HS cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), tv2, mRNA. CCDC33 exonic SEQ ID 1035 NM_182791 HS coiled-coil domain containing 33 (CCDC33), tv2, mRNA. LOC729739 exonic SEQ ID 1036 NR_045207 HS peptidylprolyl isomerase A (cyclophilin A) pseudogene (LOC729739), non- coding RNA. SEMA7A exonic SEQ ID 1037 NM_001146030 HS semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), tv3, mRNA. SEMA7A exonic SEQ ID 1038 NM_001146029 HS semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), tv2, mRNA. SEMA7A exonic SEQ ID 1039 NM_003612 HS semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), tv1, mRNA. LOC440288 exonic SEQ ID 1040 NR_038449 HS uncharacterized LOC440288 (LOC440288), tv2, non-coding RNA. LOC440288 exonic SEQ ID 1041 NR_038448 HS uncharacterized LOC440288 (LOC440288), tv1, non-coding RNA. UBL7 exonic SEQ ID 1042 NM_032907 HS ubiquitin-like 7 (bone marrow stromal cell-derived) (UBL7), tv1, mRNA. UBL7 exonic SEQ ID 1043 NM_201265 HS ubiquitin-like 7 (bone marrow stromal cell-derived) (UBL7), tv2, mRNA. CLK3 exonic SEQ ID 1044 NM_001130028 HS CDC-like kinase 3 (CLK3), tv1, mRNA. ARID3B exonic SEQ ID 1045 NM_006465 HS AT rich interactive domain 3B (BRIGHT-like) (ARID3B), mRNA. CLK3 exonic SEQ ID 1046 NM_003992 HS CDC-like kinase 3 (CLK3), tv2, mRNA. CYP1A2 exonic SEQ ID 1047 NM_000761 HS cytochrome P450, family 1, subfamily A, polypeptide 2 (CYP1A2), mRNA. MIR4513 exonic SEQ ID 1048 NR_039738 HS microRNA 4513 (MIR4513), microRNA. FAM219B exonic SEQ ID 1049 NM_020447 HS family with sequence similarity 219, member B (FAM219B), mRNA. CPLX3 exonic SEQ ID 1050 NM_001030005 HS complexin 3 (CPLX3), mRNA. MPI exonic SEQ ID 1051 NM_002435 HS mannose phosphate isomerase (MPI), mRNA. LMAN1L exonic SEQ ID 1052 NM_021819 HS lectin, mannose-binding, 1 like (LMAN1L), mRNA. ULK3 exonic SEQ ID 1053 NM_001099436 HS unc-51-like kinase 3 (C. elegans) (ULK3), mRNA. SCAMP2 exonic SEQ ID 1054 NM_005697 HS secretory carrier membrane protein 2 (SCAMP2), mRNA. RPP25 exonic SEQ ID 1055 NM_017793 HS ribonuclease P/MRP 25 kDa subunit (RPP25), mRNA. SCAMP5 exonic SEQ ID 1056 NM_001178112 HS secretory carrier membrane protein 5 (SCAMP5), tv2, mRNA. SCAMP5 exonic SEQ ID 1057 NM_138967 HS secretory carrier membrane protein 5 (SCAMP5), tv3, mRNA. SCAMP5 exonic SEQ ID 1058 NR_033660 HS secretory carrier membrane protein 5 (SCAMP5), tv4, non-coding RNA. PPCDC exonic SEQ ID 1059 NM_021823 HS phosphopantothenoylcysteine decarboxylase (PPCDC), mRNA. SCAMP5 exonic SEQ ID 1060 NM_001178111 HS secretory carrier membrane protein 5 (SCAMP5), tv1, mRNA. GOLGA6C exonic SEQ ID 1061 NM_001164404 HS golgin A6 family, member C (GOLGA6C), mRNA. GOLGA6D exonic SEQ ID 1062 NM_001145224 HS golgin A6 family, member D (GOLGA6D), mRNA. C15orf39 exonic SEQ ID 1063 NM_015492 HS chromosome 15 open reading frame 39 (C15orf39), mRNA. NEIL1 exonic SEQ ID 1064 NM_001256552 HS nei endonuclease VIII-like 1 (E. coli) (NEIL1), tv1, mRNA. NEIL1 exonic SEQ ID 1065 NM_024608 HS nei endonuclease VIII-like 1 (E. coli) (NEIL1), tv2, mRNA. MIR631 exonic SEQ ID 1066 NR_030360 HS microRNA 631 (MIR631), microRNA. COMMD4 exonic SEQ ID 1067 NM_017828 HS COMM domain containing 4 (COMMD4), mRNA. NEIL1 exonic SEQ ID 1068 NR_046311 HS nei endonuclease VIII-like 1 (E. coli) (NEIL1), tv3, non-coding RNA. PTPN9 exonic SEQ ID 1069 NM_002833 HS protein tyrosine phosphatase, non-receptor type 9 (PTPN9), mRNA. MIR4313 exonic SEQ ID 1070 NR_036198 HS microRNA 4313 (MIR4313), microRNA. ODF3L1 exonic SEQ ID 1071 NM_175881 HS outer dense fiber of sperm tails 3-like 1 (ODF3L1), mRNA. DNM1P35 exonic SEQ ID 1072 NR_024595 HS DNM1 pseudogene 35 (DNM1P35), non-coding RNA. STARD3 exonic SEQ ID 1073 NM_001165938 HS StAR-related lipid transfer (START) domain containing 3 (STARD3), tv3, mRNA. STARD3 exonic SEQ ID 1074 NM_001165937 HS StAR-related lipid transfer (START) domain containing 3 (STARD3), tv2, mRNA. STARD3 exonic SEQ ID 1075 NM_006804 HS StAR-related lipid transfer (START) domain containing 3 (STARD3), tv1, mRNA. KLHL9 exonic SEQ ID 1076 NM_018847 HS kelch-like family member 9 (KLHL9), mRNA. IFNA1 exonic SEQ ID 1077 NM_024013 HS interferon, alpha 1 (IFNA1), mRNA. ATRNL1 exonic SEQ ID 1078 NM_207303 HS attractin-like 1 (ATRNL1), tv1, mRNA. IFNA22P exonic SEQ ID 1079 NR_036676 HS interferon, alpha 22, pseudogene (IFNA22P), non-coding RNA. SLIT2 exonic SEQ ID 1080 NM_004787 HS slit homolog 2 (Drosophila) (SLIT2), mRNA. SLC38A6 exonic SEQ ID 1081 NR_033344 HS solute carrier family 38, member 6 (SLC38A6), tv3, non-coding RNA. SLC38A6 exonic SEQ ID 1082 NM_153811 HS solute carrier family 38, member 6 (SLC38A6), tv2, mRNA. SLC38A6 exonic SEQ ID 1083 NM_001172702 HS solute carrier family 38, member 6 (SLC38A6), tv1, mRNA. BMX exonic SEQ ID 1084 NM_203281 HS BMX non-receptor tyrosine kinase (BMX), tv1, mRNA. BMX exonic SEQ ID 1085 NM_001721 HS BMX non-receptor tyrosine kinase (BMX), tv2, mRNA. ADAMTS5 exonic SEQ ID 1086 NM_007038 HS ADAM metallopeptidase with thrombospondin type 1 motif, 5 (ADAMTS5), mRNA. WIZ exonic SEQ ID 1087 NM_021241 HS widely interspaced zinc finger motifs (WIZ), mRNA. MIR1470 exonic SEQ ID 1088 NR_031716 HS microRNA 1470 (MIR1470), microRNA. FBXO18 exonic SEQ ID 1089 NM_001258452 HS F-box protein, helicase, 18 (FBXO18), tv3, mRNA. FBXO18 exonic SEQ ID 1090 NM_001258453 HS F-box protein, helicase, 18 (FBXO18), tv4, mRNA. FBXO18 exonic SEQ ID 1091 NM_032807 HS F-box protein, helicase, 18 (FBXO18), tv1, mRNA. FBXO18 exonic SEQ ID 1092 NM_178150 HS F-box protein, helicase, 18 (FBXO18), tv2, mRNA. C6orf99 exonic SEQ ID 1093 NM_001195032 HS chromosome 6 open reading frame 99 (C6orf99), mRNA. INO80D exonic SEQ ID 1094 NM_017759 HS INO80 complex subunit D (INO80D), mRNA. LAMC3 exonic SEQ ID 1095 NM_006059 HS laminin, gamma 3 (LAMC3), mRNA. HACE1 exonic SEQ ID 1096 NM_020771 HS HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 (HACE1), mRNA. MIR99B exonic SEQ ID 1097 NR_029843 HS microRNA 99b (MIR99B), microRNA. LINC00085 exonic SEQ ID 1098 NR_024330 HS long intergenic non-protein coding RNA 85 (LINC00085), non-coding RNA. MIRLET7E exonic SEQ ID 1099 NR_029482 HS microRNA let-7e (MIRLET7E), microRNA. MIR125A exonic SEQ ID 1100 NR_029693 HS microRNA 125a (MIR125A), microRNA. ADAMTS9 exonic SEQ ID 1101 NM_182920 HS ADAM metallopeptidase with thrombospondin type 1 motif, 9 (ADAMTS9), mRNA. ZRANB3 exonic SEQ ID 1102 NM_032143 HS zinc finger, RAN-binding domain containing 3 (ZRANB3), mRNA. ALB exonic SEQ ID 1103 NM_000477 HS albumin (ALB), mRNA. SLC24A2 exonic SEQ ID 1104 NM_001193288 HS solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 (SLC24A2), tv2, mRNA. SLC24A2 exonic SEQ ID 1105 NM_020344 HS solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 (SLC24A2), tv1, mRNA. OSTCP1 exonic SEQ ID 1106 NR_028496 HS oligosaccharyltransferase complex subunit pseudogene 1 (OSTCP1), non- coding RNA. DPP6 exonic SEQ ID 1107 NM_001936 HS dipeptidyl-peptidase 6 (DPP6), tv2, mRNA. DPP6 exonic SEQ ID 1108 NM_001039350 HS dipeptidyl-peptidase 6 (DPP6), tv3, mRNA. DPP6 exonic SEQ ID 1109 NM_130797 HS dipeptidyl-peptidase 6 (DPP6), tv1, mRNA. PAXIP1 exonic SEQ ID 1110 NM_007349 HS PAX interacting (with transcription-activation domain) protein 1 (PAXIP1), mRNA. LOC100132707 exonic SEQ ID 1111 NR_024476 HS uncharacterized LOC100132707 (LOC100132707), tv1, non-coding RNA. LOC100132707 exonic SEQ ID 1112 NR_024477 HS uncharacterized LOC100132707 (LOC100132707), tv2, non-coding RNA. LOC202781 exonic SEQ ID 1113 NR_028090 HS uncharacterized LOC202781 (LOC202781), non-coding RNA. HTR5A exonic SEQ ID 1114 NM_024012 HS 5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled (HTR5A), mRNA. LOC100128264 exonic SEQ ID 1115 NR_038945 HS uncharacterized LOC100128264 (LOC100128264), non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1116 NR_003529 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv1, non-coding RNA. FOCAD exonic SEQ ID 1117 NM_017794 HS focadhesin (FOCAD), mRNA. CDKN2B-AS1 exonic SEQ ID 1118 NR_047543 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv3, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1119 NR_047542 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv12, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1120 NR_047541 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv11, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1121 NR_047540 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv10, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1122 NR_047539 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv9, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1123 NR_047538 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv8, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1124 NR_047537 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv7, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1125 NR_047536 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv6, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1126 NR_047535 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv5, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1127 NR_047534 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv4, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1128 NR_047533 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv13, non-coding RNA. CDKN2B-AS1 exonic SEQ ID 1129 NR_047532 HS CDKN2B antisense RNA 1 (CDKN2B-AS1), tv2, non-coding RNA. MLLT3 exonic SEQ ID 1130 NM_004529 HS myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (MLLT3), mRNA. MIR31HG exonic SEQ ID 1131 NR_027054 HS MIR31 host gene (non-protein coding) (MIR31HG), non-coding RNA. FLJ35282 exonic SEQ ID 1132 NR_038977 HS uncharacterized LOC441389 (FLJ35282), non-coding RNA. ELAVL2 exonic SEQ ID 1133 NM_004432 HS ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (ELAVL2), tv1, mRNA. ELAVL2 exonic SEQ ID 1134 NM_001171197 HS ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (ELAVL2), tv3, mRNA. ELAVL2 exonic SEQ ID 1135 NM_001171195 HS ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (ELAVL2), tv2, mRNA. MIR4473 exonic SEQ ID 1136 NR_039684 HS microRNA 4473 (MIR4473), microRNA. MIR4474 exonic SEQ ID 1137 NR_039685 HS microRNA 4474 (MIR4474), microRNA. MIR491 exonic SEQ ID 1138 NR_030166 HS microRNA 491 (MIR491), microRNA. IFNB1 exonic SEQ ID 1139 NM_002176 HS interferon, beta 1, fibroblast (IFNB1), mRNA. PTPLAD2 exonic SEQ ID 1140 NM_001010915 HS protein tyrosine phosphatase-like A domain containing 2 (PTPLAD2), mRNA. IFNA7 exonic SEQ ID 1141 NM_021057 HS interferon, alpha 7 (IFNA7), mRNA. IFNA16 exonic SEQ ID 1142 NM_002173 HS interferon, alpha 16 (IFNA16), mRNA. IFNA14 exonic SEQ ID 1143 NM_002172 HS interferon, alpha 14 (IFNA14), mRNA. IFNA21 exonic SEQ ID 1144 NM_002175 HS interferon, alpha 21 (IFNA21), mRNA. IFNA10 exonic SEQ ID 1145 NM_002171 HS interferon, alpha 10 (IFNA10), mRNA. IFNW1 exonic SEQ ID 1146 NM_002177 HS interferon, omega 1 (IFNW1), mRNA. IFNA4 exonic SEQ ID 1147 NM_021068 HS interferon, alpha 4 (IFNA4), mRNA. IFNA17 exonic SEQ ID 1148 NM_021268 HS interferon, alpha 17 (IFNA17), mRNA. IFNA6 exonic SEQ ID 1149 NM_021002 HS interferon, alpha 6 (IFNA6), mRNA. IFNA5 exonic SEQ ID 1150 NM_002169 HS interferon, alpha 5 (IFNA5), mRNA. IFNA13 exonic SEQ ID 1151 NM_006900 HS interferon, alpha 13 (IFNA13), mRNA. IFNE exonic SEQ ID 1152 NM_176891 HS interferon, epsilon (IFNE), mRNA. IFNA8 exonic SEQ ID 1153 NM_002170 HS interferon, alpha 8 (IFNA8), mRNA. IFNA2 exonic SEQ ID 1154 NM_000605 HS interferon, alpha 2 (IFNA2), mRNA. MIR31 exonic SEQ ID 1155 NR_029505 HS microRNA 31 (MIR31), microRNA. MTAP exonic SEQ ID 1156 NM_002451 HS methylthioadenosine phosphorylase (MTAP), mRNA. CDKN2A exonic SEQ ID 1157 NM_058195 HS cyclin-dependent kinase inhibitor 2A (CDKN2A), tv4, mRNA. CDKN2A exonic SEQ ID 1158 NM_058197 HS cyclin-dependent kinase inhibitor 2A (CDKN2A), tv3, mRNA. CDKN2B exonic SEQ ID 1159 NM_004936 HS cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) (CDKN2B), tv1, mRNA. CDKN2A exonic SEQ ID 1160 NM_000077 HS cyclin-dependent kinase inhibitor 2A (CDKN2A), tv1, mRNA. C9orf53 exonic SEQ ID 1161 NR_024274 HS chromosome 9 open reading frame 53 (C9orf53), non-coding RNA. CDKN2B exonic SEQ ID 1162 NM_078487 HS cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) (CDKN2B), tv2, mRNA. CDKN2A exonic SEQ ID 1163 NM_001195132 HS cyclin-dependent kinase inhibitor 2A (CDKN2A), tv5, mRNA. DMRTA1 exonic SEQ ID 1164 NM_022160 HS DMRT-like family A1 (DMRTA1), mRNA. MAS1 exonic SEQ ID 1165 NM_002377 HS MAS1 oncogene (MAS1), mRNA. MAP3K9 exonic SEQ ID 1166 NM_033141 HS mitogen-activated protein kinase kinase kinase 9 (MAP3K9), mRNA. ELAVL3 exonic SEQ ID 1167 NM_001420 HS ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (ELAVL3), tv1, mRNA. ELAVL3 exonic SEQ ID 1168 NM_032281 HS ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) (ELAVL3), tv2, mRNA. PNKD exonic SEQ ID 1169 NM_015488 HS paroxysmal nonkinesigenic dyskinesia (PNKD), nuclear gene encoding mitochondrial protein, tv1, mRNA. TMBIM1 exonic SEQ ID 1170 NM_022152 HS transmembrane BAX inhibitor motif containing 1 (TMBIM1), mRNA. CASC4 exonic SEQ ID 1171 NM_177974 HS cancer susceptibility candidate 4 (CASC4), tv2, mRNA. CASC4 exonic SEQ ID 1172 NM_138423 HS cancer susceptibility candidate 4 (CASC4), tv1, mRNA. TRAF3 exonic SEQ ID 1173 NM_001199427 HS TNF receptor-associated factor 3 (TRAF3), tv4, mRNA. TRAF3 exonic SEQ ID 1174 NM_003300 HS TNF receptor-associated factor 3 (TRAF3), tv3, mRNA. TRAF3 exonic SEQ ID 1175 NM_145726 HS TNF receptor-associated factor 3 (TRAF3), tv2, mRNA. TRAF3 exonic SEQ ID 1176 NM_145725 HS TNF receptor-associated factor 3 (TRAF3), tv1, mRNA. PCDH15 exonic SEQ ID 1177 NM_033056 HS protocadherin-related 15 (PCDH15), tvC, mRNA. PCDH15 exonic SEQ ID 1178 NM_001142770 HS protocadherin-related 15 (PCDH15), tvJ, mRNA. PCDH15 exonic SEQ ID 1179 NM_001142773 HS protocadherin-related 15 (PCDH15), tvH, mRNA. PCDH15 exonic SEQ ID 1180 NM_001142766 HS protocadherin-related 15 (PCDH15), tvE, mRNA. PCDH15 exonic SEQ ID 1181 NM_001142763 HS protocadherin-related 15 (PCDH15), tvA, mRNA. PCDH15 exonic SEQ ID 1182 NM_001142771 HS protocadherin-related 15 (PCDH15), tvK, mRNA. PCDH15 exonic SEQ ID 1183 NM_001142767 HS protocadherin-related 15 (PCDH15), tvF, mRNA. PCDH15 exonic SEQ ID 1184 NM_001142768 HS protocadherin-related 15 (PCDH15), tvG, mRNA. PCDH15 exonic SEQ ID 1185 NM_001142772 HS protocadherin-related 15 (PCDH15), tvL, mRNA. PCDH15 exonic SEQ ID 1186 NM_001142765 HS protocadherin-related 15 (PCDH15), tvD, mRNA. PCDH15 exonic SEQ ID 1187 NM_001142769 HS protocadherin-related 15 (PCDH15), tvI, mRNA. PCDH15 exonic SEQ ID 1188 NM_001142764 HS protocadherin-related 15 (PCDH15), tvB, mRNA. PEBP4 exonic SEQ ID 1189 NM_144962 HS phosphatidylethanolamine-binding protein 4 (PEBP4), mRNA. SGK1 exonic SEQ ID 1190 NM_001143676 HS serum/glucocorticoid regulated kinase 1 (SGK1), tv2, mRNA. NACAD exonic SEQ ID 1191 NM_001146334 HS NAC alpha domain containing (NACAD), mRNA. CCM2 exonic SEQ ID 1192 NR_030770 HS cerebral cavernous malformation 2 (CCM2), tv5, non-coding RNA. CCM2 exonic SEQ ID 1193 NM_031443 HS cerebral cavernous malformation 2 (CCM2), tv2, mRNA. CCM2 exonic SEQ ID 1194 NM_001167935 HS cerebral cavernous malformation 2 (CCM2), tv4, mRNA. CCM2 exonic SEQ ID 1195 NM_001167934 HS cerebral cavernous malformation 2 (CCM2), tv3, mRNA. CCM2 exonic SEQ ID 1196 NM_001029835 HS cerebral cavernous malformation 2 (CCM2), tv1, mRNA. GRAP exonic SEQ ID 1197 NM_006613 HS GRB2-related adaptor protein (GRAP), mRNA. SLC5A10 exonic SEQ ID 1198 NM_001270649 HS solute carrier family 5 (sodium/glucose cotransporter), member 10 (SLC5A10), tv4, mRNA. FAM83G exonic SEQ ID 1199 NM_001039999 HS family with sequence similarity 83, member G (FAM83G), mRNA. SLC5A10 exonic SEQ ID 1200 NM_152351 HS solute carrier family 5 (sodium/glucose cotransporter), member 10 (SLC5A10), tv1, mRNA. SLC5A10 exonic SEQ ID 1201 NM_001270648 HS solute carrier family 5 (sodium/glucose cotransporter), member 10 (SLC5A10), tv3, mRNA. SLC5A10 exonic SEQ ID 1202 NM_001042450 HS solute carrier family 5 (sodium/glucose cotransporter), member 10 (SLC5A10), tv2, mRNA. SLC5A10 exonic SEQ ID 1203 NR_073067 HS solute carrier family 5 (sodium/glucose cotransporter), member 10 (SLC5A10), tv5, non-coding RNA. BASP1P1 exonic SEQ ID 1204 NR_033774 HS brain abundant, membrane attached signal protein 1 pseudogene 1 (BASP1P1), non-coding RNA. HGSNAT exonic SEQ ID 1205 NM_152419 HS heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), mRNA. FNTA exonic SEQ ID 1206 NR_033698 HS farnesyltransferase, CAAX box, alpha (FNTA), tv4, non-coding RNA. FNTA exonic SEQ ID 1207 NM_002027 HS farnesyltransferase, CAAX box, alpha (FNTA), tv1, mRNA. SGK196 exonic SEQ ID 1208 NM_032237 HS protein kinase-like protein SgK196 (SGK196), mRNA. POTEA exonic SEQ ID 1209 NM_001005365 HS POTE ankyrin domain family, member A (POTEA), tv2, mRNA. POTEA exonic SEQ ID 1210 NM_001002920 HS POTE ankyrin domain family, member A (POTEA), tv1, mRNA. SLCO1B3 exonic SEQ ID 1211 NM_019844 HS solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. HFM1 exonic SEQ ID 1212 NM_001017975 HS HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) (HFM1), mRNA. DNTTIP2 exonic SEQ ID 1213 NM_014597 HS deoxynucleotidyltransferase, terminal, interacting protein 2 (DNTTIP2), mRNA. CFLAR exonic SEQ ID 1214 NM_001127183 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv2, mRNA. CFLAR exonic SEQ ID 1215 NM_001202515 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv4, mRNA. CFLAR exonic SEQ ID 1216 NM_001202519 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv8, mRNA. CFLAR exonic SEQ ID 1217 NM_001202518 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv7, mRNA. CFLAR exonic SEQ ID 1218 NM_001202516 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv5, mRNA. CFLAR exonic SEQ ID 1219 NM_003879 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv1, mRNA. CFLAR exonic SEQ ID 1220 NM_001202517 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv6, mRNA. CFLAR-AS1 exonic SEQ ID 1221 NR_040030 HS CFLAR antisense RNA 1 (CFLAR-AS1), non-coding RNA. CFLAR exonic SEQ ID 1222 NM_001127184 HS CASP8 and FADD-like apoptosis regulator (CFLAR), tv3, mRNA. CEP104 exonic SEQ ID 1223 NM_014704 HS centrosomal protein 104 kDa (CEP104), mRNA. LOC400456 exonic SEQ ID 1224 NR_034095 HS uncharacterized LOC400456 (LOC400456), non-coding RNA. CCDC171 exonic SEQ ID 1225 NM_173550 HS coiled-coil domain containing 171 (CCDC171), mRNA. CTDSP1 exonic SEQ ID 1226 NM_021198 HS CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), tv1, mRNA. CTDSP1 exonic SEQ ID 1227 NM_182642 HS CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), tv2, mRNA. CTDSP1 exonic SEQ ID 1228 NM_001206878 HS CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 (CTDSP1), tv3, mRNA. SPAG16 exonic SEQ ID 1229 NM_024532 HS sperm associated antigen 16 (SPAG16), tv1, mRNA. SPAG16 exonic SEQ ID 1230 NR_047659 HS sperm associated antigen 16 (SPAG16), tv3, non-coding RNA. SPAG16 exonic SEQ ID 1231 NR_047660 HS sperm associated antigen 16 (SPAG16), tv4, non-coding RNA. SNORD32B exonic SEQ ID 1232 NR_003049 HS small nucleolar RNA, C/D box 32B (SNORD32B), small nucleolar RNA. MIR26B exonic SEQ ID 1233 NR_029500 HS microRNA 26b (MIR26B), microRNA. INTS2 exonic SEQ ID 1234 NM_020748 HS integrator complex subunit 2 (INTS2), tv1, mRNA. INTS2 exonic SEQ ID 1235 NR_026641 HS integrator complex subunit 2 (INTS2), tv2, non-coding RNA. FUT2 exonic SEQ ID 1236 NM_001097638 HS fucosyltransferase 2 (secretor status included) (FUT2), tv2, mRNA. FUT2 exonic SEQ ID 1237 NM_000511 HS fucosyltransferase 2 (secretor status included) (FUT2), tv1, mRNA. PNKD exonic SEQ ID 1238 NM_001077399 HS paroxysmal nonkinesigenic dyskinesia (PNKD), nuclear gene encoding mitochondrial protein, tv3, mRNA. PRSS38 exonic SEQ ID 1239 NM_183062 HS protease, serine, 38 (PRSS38), mRNA. KAL1 exonic SEQ ID 1240 NM_000216 HS Kallmann syndrome 1 sequence (KAL1), mRNA. SLC11A1 exonic SEQ ID 1241 NM_000578 HS solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 (SLC11A1), mRNA. STX6 exonic SEQ ID 1242 NM_005819 HS syntaxin 6 (STX6), mRNA. MR1 exonic SEQ ID 1243 NM_001195000 HS major histocompatibility complex, class I-related (MR1), tv3, mRNA. MR1 exonic SEQ ID 1244 NM_001195035 HS major histocompatibility complex, class I-related (MR1), tv4, mRNA. MR1 exonic SEQ ID 1245 NM_001194999 HS major histocompatibility complex, class I-related (MR1), tv2, mRNA. MR1 exonic SEQ ID 1246 NM_001531 HS major histocompatibility complex, class I-related (MR1), tv1, mRNA. OR52E4 exonic SEQ ID 1247 NM_001005165 HS olfactory receptor, family 52, subfamily E, member 4 (OR52E4), mRNA. PRPSAP2 exonic SEQ ID 1248 NM_001243942 HS phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), tv5, mRNA. PRPSAP2 exonic SEQ ID 1249 NM_001243941 HS phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), tv4, mRNA. PRPSAP2 exonic SEQ ID 1250 NM_002767 HS phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), tv1, mRNA. PRPSAP2 exonic SEQ ID 1251 NM_001243940 HS phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), tv3, mRNA. PRPSAP2 exonic SEQ ID 1252 NM_001243936 HS phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), tv2, mRNA. IGF2R exonic SEQ ID 1253 NM_000876 HS insulin-like growth factor 2 receptor (IGF2R), mRNA. AIRN exonic SEQ ID 1254 NR_047514 HS antisense of IGF2R non-protein coding RNA (AIRN), tv2, non-coding RNA. AIRN exonic SEQ ID 1255 NR_047511 HS antisense of IGF2R non-protein coding RNA (AIRN), tv1, non-coding RNA. FAM9A exonic SEQ ID 1256 NM_001171186 HS family with sequence similarity 9, member A (FAM9A), tv1, mRNA. FAM9A exonic SEQ ID 1257 NM_174951 HS family with sequence similarity 9, member A (FAM9A), tv2, mRNA. RNU6-59 exonic SEQ ID 1258 NR_046933 HS RNA, U6 small nuclear 59 (RNU6-59), small nuclear RNA. MTRNR2L5 exonic SEQ ID 1259 NM_001190478 HS MT-RNR2-like 5 (MTRNR2L5), mRNA. PACS2 exonic SEQ ID 1260 NM_001243127 HS phosphofurin acidic cluster sorting protein 2 (PACS2), tv3, mRNA. PACS2 exonic SEQ ID 1261 NM_015197 HS phosphofurin acidic cluster sorting protein 2 (PACS2), tv2, mRNA. PACS2 exonic SEQ ID 1262 NM_001100913 HS phosphofurin acidic cluster sorting protein 2 (PACS2), tv1, mRNA. RCOR1 exonic SEQ ID 1263 NM_015156 HS REST corepressor 1 (RCOR1), mRNA. CDC42BPB exonic SEQ ID 1264 NM_006035 HS CDC42 binding protein kinase beta (DMPK-like) (CDC42BPB), mRNA. TECPR2 exonic SEQ ID 1265 NM_014844 HS tectonin beta-propeller repeat containing 2 (TECPR2), tv1, mRNA. PPP1R13B exonic SEQ ID 1266 NM_015316 HS protein phosphatase 1, regulatory subunit 13B (PPP1R13B), mRNA. TDRD9 exonic SEQ ID 1267 NM_153046 HS tudor domain containing 9 (TDRD9), mRNA. MARK3 exonic SEQ ID 1268 NM_002376 HS MAP/microtubule affinity-regulating kinase 3 (MARK3), tv3, mRNA. MARK3 exonic SEQ ID 1269 NM_001128918 HS MAP/microtubule affinity-regulating kinase 3 (MARK3), tv1, mRNA. MARK3 exonic SEQ ID 1270 NM_001128921 HS MAP/microtubule affinity-regulating kinase 3 (MARK3), tv5, mRNA. MARK3 exonic SEQ ID 1271 NM_001128919 HS MAP/microtubule affinity-regulating kinase 3 (MARK3), tv2, mRNA. MARK3 exonic SEQ ID 1272 NM_001128920 HS MAP/microtubule affinity-regulating kinase 3 (MARK3), tv4, mRNA. KIF26A exonic SEQ ID 1273 NM_015656 HS kinesin family member 26A (KIF26A), mRNA. GPR132 exonic SEQ ID 1274 NM_013345 HS G protein-coupled receptor 132 (GPR132), mRNA. PLD4 exonic SEQ ID 1275 NM_138790 HS phospholipase D family, member 4 (PLD4), mRNA. MTA1 exonic SEQ ID 1276 NM_001203258 HS metastasis associated 1 (MTA1), tv2, mRNA. MTA1 exonic SEQ ID 1277 NM_004689 HS metastasis associated 1 (MTA1), tv1, mRNA. MIR4309 exonic SEQ ID 1278 NR_036192 HS microRNA 4309 (MIR4309), microRNA. ANKRD9 exonic SEQ ID 1279 NM_152326 HS ankyrin repeat domain 9 (ANKRD9), mRNA. AMN exonic SEQ ID 1280 NM_030943 HS amnion associated transmembrane protein (AMN), mRNA. EXOC3L4 exonic SEQ ID 1281 NM_001077594 HS exocyst complex component 3-like 4 (EXOC3L4), mRNA. TNFAIP2 exonic SEQ ID 1282 NM_006291 HS tumor necrosis factor, alpha-induced protein 2 (TNFAIP2), mRNA. LINC00605 exonic SEQ ID 1283 NR_033938 HS long intergenic non-protein coding RNA 605 (LINC00605), non-coding RNA. EIF5 exonic SEQ ID 1284 NM_183004 HS eukaryotic translation initiation factor 5 (EIF5), tv2, mRNA. SNORA28 exonic SEQ ID 1285 NR_002964 HS small nucleolar RNA, H/ACA box 28 (SNORA28), small nucleolar RNA. EIF5 exonic SEQ ID 1286 NM_001969 HS eukaryotic translation initiation factor 5 (EIF5), tv1, mRNA. CKB exonic SEQ ID 1287 NM_001823 HS creatine kinase, brain (CKB), mRNA. APOPT1 exonic SEQ ID 1288 NM_032374 HS apoptogenic 1, mitochondrial (APOPT1), nuclear gene encoding mitochondrial protein, mRNA. BAG5 exonic SEQ ID 1289 NM_004873 HS BCL2-associated athanogene 5 (BAG5), tv2, mRNA. BAG5 exonic SEQ ID 1290 NM_001015048 HS BCL2-associated athanogene 5 (BAG5), tv3, mRNA. BAG5 exonic SEQ ID 1291 NM_001015049 HS BCL2-associated athanogene 5 (BAG5), tv1, mRNA. TRMT61A exonic SEQ ID 1292 NM_152307 HS tRNA methyltransferase 61 homolog A (S. cerevisiae) (TRMT61A), mRNA. ZFYVE21 exonic SEQ ID 1293 NM_024071 HS zinc finger, FYVE domain containing 21 (ZFYVE21), tv2, mRNA. XRCC3 exonic SEQ ID 1294 NM_005432 HS X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), tv2, mRNA. KLC1 exonic SEQ ID 1295 NM_005552 HS kinesin light chain 1 (KLC1), tv1, mRNA. XRCC3 exonic SEQ ID 1296 NM_001100119 HS X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), tv1, mRNA. XRCC3 exonic SEQ ID 1297 NM_001100118 HS X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), tv3, mRNA. ZFYVE21 exonic SEQ ID 1298 NM_001198953 HS zinc finger, FYVE domain containing 21 (ZFYVE21), tv1, mRNA. KLC1 exonic SEQ ID 1299 NM_001130107 HS kinesin light chain 1 (KLC1), tv3, mRNA. KLC1 exonic SEQ ID 1300 NM_182923 HS kinesin light chain 1 (KLC1), tv2, mRNA. LINC00637 exonic SEQ ID 1301 NR_038436 HS long intergenic non-protein coding RNA 637 (LINC00637), non-coding RNA. C14orf2 exonic SEQ ID 1302 NM_004894 HS chromosome 14 open reading frame 2 (C14orf2), tv1, mRNA. RD3L exonic SEQ ID 1303 NM_001257268 HS retinal degeneration 3-like (RD3L), mRNA. C14orf2 exonic SEQ ID 1304 NM_001127393 HS chromosome 14 open reading frame 2 (C14orf2), tv2, mRNA. MIR203 exonic SEQ ID 1305 NR_029620 HS microRNA 203 (MIR203), microRNA. ASPG exonic SEQ ID 1306 NM_001080464 HS asparaginase homolog (S. cerevisiae) (ASPG), mRNA. MIR3545 exonic SEQ ID 1307 NR_039859 HS microRNA 3545 (MIR3545), microRNA. TMEM179 exonic SEQ ID 1308 NM_207379 HS transmembrane protein 179 (TMEM179), mRNA. C14orf180 exonic SEQ ID 1309 NM_001008404 HS chromosome 14 open reading frame 180 (C14orf180), mRNA. INF2 exonic SEQ ID 1310 NM_022489 HS inverted formin, FH2 and WH2 domain containing (INF2), tv1, mRNA. SIVA1 exonic SEQ ID 1311 NM_006427 HS SIVA1, apoptosis-inducing factor (SIVA1), tv1, mRNA. ADSSL1 exonic SEQ ID 1312 NM_199165 HS adenylosuccinate synthase like 1 (ADSSL1), tv1, mRNA. AKT1 exonic SEQ ID 1313 NM_005163 HS v-akt murine thymoma viral oncogene homolog 1 (AKT1), tv1, mRNA. SIVA1 exonic SEQ ID 1314 NM_021709 HS SIVA1, apoptosis-inducing factor (SIVA1), tv2, mRNA. ADSSL1 exonic SEQ ID 1315 NM_152328 HS adenylosuccinate synthase like 1 (ADSSL1), tv2, mRNA. AKT1 exonic SEQ ID 1316 NM_001014432 HS v-akt murine thymoma viral oncogene homolog 1 (AKT1), tv2, mRNA. AKT1 exonic SEQ ID 1317 NM_001014431 HS v-akt murine thymoma viral oncogene homolog 1 (AKT1), tv3, mRNA. INF2 exonic SEQ ID 1318 NM_001031714 HS inverted formin, FH2 and WH2 domain containing (INF2), tv2, mRNA. MIR4710 exonic SEQ ID 1319 NR_039860 HS microRNA 4710 (MIR4710), microRNA. INF2 exonic SEQ ID 1320 NM_032714 HS inverted formin, FH2 and WH2 domain containing (INF2), tv3, mRNA. CEP170B/KIAA0284 exonic SEQ ID 1321 NM_001112726 HS centrosomal protein 170B (CEP170B), tv1, mRNA. LINC00638 exonic SEQ ID 1322 NR_024396 HS long intergenic non-protein coding RNA 638 (LINC00638), non-coding RNA. ZBTB42 exonic SEQ ID 1323 NM_001137601 HS zinc finger and BTB domain containing 42 (ZBTB42), mRNA. CEP170B/KIAA0284 exonic SEQ ID 1324 NM_015005 HS centrosomal protein 170B (CEP170B), tv2, mRNA. CDCA4 exonic SEQ ID 1325 NM_145701 HS cell division cycle associated 4 (CDCA4), tv2, mRNA. C14orf79 exonic SEQ ID 1326 NM_174891 HS chromosome 14 open reading frame 79 (C14orf79), mRNA. CDCA4 exonic SEQ ID 1327 NM_017955 HS cell division cycle associated 4 (CDCA4), tv1, mRNA. AHNAK2 exonic SEQ ID 1328 NM_138420 HS AHNAK nucleoprotein 2 (AHNAK2), mRNA. JAG2 exonic SEQ ID 1329 NM_002226 HS jagged 2 (JAG2), tv1, mRNA. NUDT14 exonic SEQ ID 1330 NM_177533 HS nudix (nucleoside diphosphate linked moiety X)-type motif 14 (NUDT14), mRNA. JAG2 exonic SEQ ID 1331 NM_145159 HS jagged 2 (JAG2), tv2, mRNA. BRF1 exonic SEQ ID 1332 NM_145685 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv3, mRNA. BRF1 exonic SEQ ID 1333 NM_001242787 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv5, mRNA. BRF1 exonic SEQ ID 1334 NM_001242786 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv4, mRNA. BRF1 exonic SEQ ID 1335 NM_001242790 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv8, mRNA. BRF1 exonic SEQ ID 1336 NM_001242789 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv7, mRNA. BRF1 exonic SEQ ID 1337 NM_001242788 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv6, mRNA. BRF1 exonic SEQ ID 1338 NM_001519 HS BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) (BRF1), tv1, mRNA. BTBD6 exonic SEQ ID 1339 NM_033271 HS BTB (POZ) domain containing 6 (BTBD6), mRNA. TEX22 exonic SEQ ID 1340 NM_001195082 HS testis expressed 22 (TEX22), mRNA. CRIP2 exonic SEQ ID 1341 NM_001312 HS cysteine-rich protein 2 (CRIP2), tv1, mRNA. C14orf80 exonic SEQ ID 1342 NM_001198983 HS chromosome 14 open reading frame 80 (C14orf80), tv5, mRNA. C14orf80 exonic SEQ ID 1343 NM_001134875 HS chromosome 14 open reading frame 80 (C14orf80), tv1, mRNA. CRIP1 exonic SEQ ID 1344 NM_001311 HS cysteine-rich protein 1 (intestinal) (CRIP1), mRNA. C14orf80 exonic SEQ ID 1345 NM_001134877 HS chromosome 14 open reading frame 80 (C14orf80), tv4, mRNA. C14orf80 exonic SEQ ID 1346 NM_001134876 HS chromosome 14 open reading frame 80 (C14orf80), tv2, mRNA. TMEM121 exonic SEQ ID 1347 NM_025268 HS transmembrane protein 121 (TMEM121), mRNA. CRIP2 exonic SEQ ID 1348 NM_001270841 HS cysteine-rich protein 2 (CRIP2), tv3, mRNA. CRIP2 exonic SEQ ID 1349 NM_001270837 HS cysteine-rich protein 2 (CRIP2), tv2, mRNA. CRIP2 exonic SEQ ID 1350 NR_073082 HS cysteine-rich protein 2 (CRIP2), tv5, non-coding RNA. CRIP2 exonic SEQ ID 1351 NR_073081 HS cysteine-rich protein 2 (CRIP2), tv4, non-coding RNA. CRIP2 exonic SEQ ID 1352 NR_073083 HS cysteine-rich protein 2 (CRIP2), tv6, non-coding RNA. CRIP2 exonic SEQ ID 1353 NR_073084 HS cysteine-rich protein 2 (CRIP2), tv7, non-coding RNA. CRIP2 exonic SEQ ID 1354 NR_073085 HS cysteine-rich protein 2 (CRIP2), tv8, non-coding RNA. ELK2AP exonic SEQ ID 1355 NR_046211 HS ELK2A, member of ETS oncogene family, pseudogene (ELK2AP), non- coding RNA. TPO exonic SEQ ID 1356 NM_175722 HS thyroid peroxidase (TPO), tv5, mRNA. TPO exonic SEQ ID 1357 NM_175721 HS thyroid peroxidase (TPO), tv4, mRNA. TPO exonic SEQ ID 1358 NM_000547 HS thyroid peroxidase (TPO), tv1, mRNA. TPO exonic SEQ ID 1359 NM_175719 HS thyroid peroxidase (TPO), tv2, mRNA. TPO exonic SEQ ID 1360 NM_001206744 HS thyroid peroxidase (TPO), tv6, mRNA. TPO exonic SEQ ID 1361 NM_001206745 HS thyroid peroxidase (TPO), tv7, mRNA. SLC7A3 exonic SEQ ID 1362 NM_001048164 HS solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 (SLC7A3), tv2, mRNA. SLC7A3 exonic SEQ ID 1363 NM_032803 HS solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 (SLC7A3), tv1, mRNA. BRD7 exonic SEQ ID 1364 NM_001173984 HS bromodomain containing 7 (BRD7), tv1, mRNA. BRD7 exonic SEQ ID 1365 NM_013263 HS bromodomain containing 7 (BRD7), tv2, mRNA. ZIM3 exonic SEQ ID 1366 NM_052882 HS zinc finger, imprinted 3 (ZIM3), mRNA. RGN exonic SEQ ID 1367 NM_152869 HS regucalcin (senescence marker protein-30) (RGN), tv2, mRNA. RGN exonic SEQ ID 1368 NM_004683 HS regucalcin (senescence marker protein-30) (RGN), tv1, mRNA. ZDHHC9 exonic SEQ ID 1369 NM_016032 HS zinc finger, DHHC-type containing 9 (ZDHHC9), tv1, mRNA. ZDHHC9 exonic SEQ ID 1370 NM_001008222 HS zinc finger, DHHC-type containing 9 (ZDHHC9), tv2, mRNA. TENM1 exonic SEQ ID 1371 NM_001163279 HS teneurin transmembrane protein 1 (TENM1), tv2, mRNA. TENM1 exonic SEQ ID 1372 NM_001163278 HS teneurin transmembrane protein 1 (TENM1), tv1, mRNA. TENM1 exonic SEQ ID 1373 NM_014253 HS teneurin transmembrane protein 1 (TENM1), tv3, mRNA. ARMCX4 exonic SEQ ID 1374 NR_045862 HS armadillo repeat containing, X-linked 4 (ARMCX4), tv5, non-coding RNA. ARMCX4 exonic SEQ ID 1375 NR_045864 HS armadillo repeat containing, X-linked 4 (ARMCX4), tv3, non-coding RNA. ARMCX4 exonic SEQ ID 1376 NR_045861 HS armadillo repeat containing, X-linked 4 (ARMCX4), tv4, non-coding RNA. ARMCX4 exonic SEQ ID 1377 NR_028407 HS armadillo repeat containing, X-linked 4 (ARMCX4), tv2, non-coding RNA. GRIN2D exonic SEQ ID 1378 NM_000836 HS glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D), mRNA. KDELR1 exonic SEQ ID 1379 NM_006801 HS KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 (KDELR1), mRNA. ARMCX4 exonic SEQ ID 1380 NR_045863 HS armadillo repeat containing, X-linked 4 (ARMCX4), tv6, non-coding RNA. RPSAP58 exonic SEQ ID 1381 NR_003662 HS ribosomal protein SA pseudogene 58 (RPSAP58), non-coding RNA. MICAL3 exonic SEQ ID 1382 NM_015241 HS microtubule associated monoxygenase, calponin and LIM domain containing 3 (MICAL3), tv1, mRNA. TMEM231 exonic SEQ ID 1383 NM_001077419 HS transmembrane protein 231 (TMEM231), tv3, mRNA. CHST5 exonic SEQ ID 1384 NM_024533 HS carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 (CHST5), mRNA. TMEM231 exonic SEQ ID 1385 NM_001077416 HS transmembrane protein 231 (TMEM231), tv1, mRNA. TMEM231 exonic SEQ ID 1386 NM_001077418 HS transmembrane protein 231 (TMEM231), tv2, mRNA. ZNF835 exonic SEQ ID 1387 NM_001005850 HS zinc finger protein 835 (ZNF835), mRNA. ZIM2 exonic SEQ ID 1388 NM_015363 HS zinc finger, imprinted 2 (ZIM2), tv1, mRNA. ZIM2 exonic SEQ ID 1389 NM_001146327 HS zinc finger, imprinted 2 (ZIM2), tv3, mRNA. ZIM2 exonic SEQ ID 1390 NM_001146326 HS zinc finger, imprinted 2 (ZIM2), tv2, mRNA. SMIM17/LOC147670 exonic SEQ ID 1391 NM_001193628 HS small integral membrane protein 17 (SMIM17), mRNA. ZNF71 exonic SEQ ID 1392 NM_021216 HS zinc finger protein 71 (ZNF71), mRNA. MIMT1 exonic SEQ ID 1393 NR_024059 HS MER1 repeat containing imprinted transcript 1 (non-protein coding) (MIMT1), non-coding RNA. PEG3-AS1 exonic SEQ ID 1394 NR_023847 HS PEG3 antisense RNA 1 (PEG3-AS1), antisense RNA. PEG3 exonic SEQ ID 1395 NM_001146186 HS paternally expressed 3 (PEG3), tv4, mRNA. PEG3 exonic SEQ ID 1396 NM_001146184 HS paternally expressed 3 (PEG3), tv2, mRNA. PEG3 exonic SEQ ID 1397 NM_001146185 HS paternally expressed 3 (PEG3), tv3, mRNA. PEG3 exonic SEQ ID 1398 NM_006210 HS paternally expressed 3 (PEG3), tv1, mRNA. PEG3 exonic SEQ ID 1399 NM_001146187 HS paternally expressed 3 (PEG3), tv5, mRNA. USP29 exonic SEQ ID 1400 NM_020903 HS ubiquitin specific peptidase 29 (USP29), mRNA. DUXA exonic SEQ ID 1401 NM_001012729 HS double homeobox A (DUXA), mRNA. ZNF805 exonic SEQ ID 1402 NM_001145078 HS zinc finger protein 805 (ZNF805), tv2, mRNA. ZNF805 exonic SEQ ID 1403 NM_001023563 HS zinc finger protein 805 (ZNF805), tv1, mRNA. AURKC exonic SEQ ID 1404 NM_003160 HS aurora kinase C (AURKC), tv3, mRNA. ZNF264 exonic SEQ ID 1405 NM_003417 HS zinc finger protein 264 (ZNF264), mRNA. ZNF460 exonic SEQ ID 1406 NM_006635 HS zinc finger protein 460 (ZNF460), mRNA. AURKC exonic SEQ ID 1407 NM_001015878 HS aurora kinase C (AURKC), tv1, mRNA. AURKC exonic SEQ ID 1408 NM_001015879 HS aurora kinase C (AURKC), tv2, mRNA. ZNF17 exonic SEQ ID 1409 NM_006959 HS zinc finger protein 17 (ZNF17), mRNA. ZNF749 exonic SEQ ID 1410 NM_001023561 HS zinc finger protein 749 (ZNF749), mRNA. ZNF543 exonic SEQ ID 1411 NM_213598 HS zinc finger protein 543 (ZNF543), mRNA. ZNF547 exonic SEQ ID 1412 NM_173631 HS zinc finger protein 547 (ZNF547), mRNA. ZNF548 exonic SEQ ID 1413 NM_152909 HS zinc finger protein 548 (ZNF548), tv2, mRNA. ZNF304 exonic SEQ ID 1414 NM_020657 HS zinc finger protein 304 (ZNF304), mRNA. ZNF548 exonic SEQ ID 1415 NM_001172773 HS zinc finger protein 548 (ZNF548), tv1, mRNA. TRAPPC2P1 exonic SEQ ID 1416 NR_002166 HS trafficking protein particle complex 2 pseudogene 1 (TRAPPC2P1), non- coding RNA. VN1R1 exonic SEQ ID 1417 NM_020633 HS vomeronasal 1 receptor 1 (VN1R1), mRNA. CTSL2 exonic SEQ ID 1418 NM_001201575 HS cathepsin L2 (CTSL2), tv2, mRNA. CTSL2 exonic SEQ ID 1419 NM_001333 HS cathepsin L2 (CTSL2), tv1, mRNA. TLR8 exonic SEQ ID 1420 NM_138636 HS toll-like receptor 8 (TLR8), mRNA. TLR8-AS1 exonic SEQ ID 1421 NR_030727 HS TLR8 antisense RNA 1 (TLR8-AS1), non-coding RNA. EPHA8 exonic SEQ ID 1422 NM_020526 HS EPH receptor A8 (EPHA8), tv1, mRNA. EPHA8 exonic SEQ ID 1423 NM_001006943 HS EPH receptor A8 (EPHA8), tv2, mRNA. UST exonic SEQ ID 1424 NM_005715 HS uronyl-2-sulfotransferase (UST), mRNA. CORIN exonic SEQ ID 1425 NM_006587 HS corin, serine peptidase (CORIN), mRNA. TGFBR3 exonic SEQ ID 1426 NM_001195684 HS transforming growth factor, beta receptor III (TGFBR3), tv3, mRNA. TGFBR3 exonic SEQ ID 1427 NM_001195683 HS transforming growth factor, beta receptor III (TGFBR3), tv2, mRNA. TGFBR3 exonic SEQ ID 1428 NM_003243 HS transforming growth factor, beta receptor III (TGFBR3), tv1, mRNA. TGFBR3 exonic SEQ ID 1429 NR_036634 HS transforming growth factor, beta receptor III (TGFBR3), tv4, non-coding RNA. EPSTI1 exonic SEQ ID 1430 NM_033255 HS epithelial stromal interaction 1 (breast) (EPSTI1), tv2, mRNA. EPSTI1 exonic SEQ ID 1431 NM_001002264 HS epithelial stromal interaction 1 (breast) (EPSTI1), tv1, mRNA. RAB32 exonic SEQ ID 1432 NM_006834 HS RAB32, member RAS oncogene family (RAB32), mRNA. CPNE9 exonic SEQ ID 1433 NM_153635 HS copine family member IX (CPNE9), mRNA. C14orf166 exonic SEQ ID 1434 NM_016039 HS chromosome 14 open reading frame 166 (C14orf166), mRNA. ALDH1A3 exonic SEQ ID 1435 NM_000693 HS aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), mRNA. KIF7 exonic SEQ ID 1436 NM_198525 HS kinesin family member 7 (KIF7), mRNA. GPR98 exonic SEQ ID 1437 NR_003149 HS G protein-coupled receptor 98 (GPR98), tv2, non-coding RNA. GPR98 exonic SEQ ID 1438 NM_032119 HS G protein-coupled receptor 98 (GPR98), tv1, mRNA. UXS1 exonic SEQ ID 1439 NM_025076 HS UDP-glucuronate decarboxylase 1 (UXS1), tv2, mRNA. UXS1 exonic SEQ ID 1440 NR_045607 HS UDP-glucuronate decarboxylase 1 (UXS1), tv4, non-coding RNA. UXS1 exonic SEQ ID 1441 NM_001253875 HS UDP-glucuronate decarboxylase 1 (UXS1), tv1, mRNA. PDCD6IP exonic SEQ ID 1442 NM_013374 HS programmed cell death 6 interacting protein (PDCD6IP), tv1, mRNA. PDCD6IP exonic SEQ ID 1443 NM_001162429 HS programmed cell death 6 interacting protein (PDCD6IP), tv2, mRNA. DYNC2LI1 exonic SEQ ID 1444 NM_015522 HS dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), tv2, mRNA. DYNC2LI1 exonic SEQ ID 1445 NM_016008 HS dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), tv1, mRNA. DYNC2LI1 exonic SEQ ID 1446 NM_001193464 HS dynein, cytoplasmic 2, light intermediate chain 1 (DYNC2LI1), tv4, mRNA. CTNNA3 exonic SEQ ID 1447 NM_013266 HS catenin (cadherin-associated protein), alpha 3 (CTNNA3), tv1, mRNA. CTNNA3 exonic SEQ ID 1448 NM_001127384 HS catenin (cadherin-associated protein), alpha 3 (CTNNA3), tv2, mRNA. LOC100289187 exonic SEQ ID 1449 NM_001195542 HS transmembrane protein 225-like (LOC100289187), tv2, mRNA. LOC100289187 exonic SEQ ID 1450 NM_001195541 HS transmembrane protein 225-like (LOC100289187), tv1, mRNA. LOC100289187 exonic SEQ ID 1451 NM_001195543 HS transmembrane protein 225-like (LOC100289187), tv3, mRNA. LRRC33 exonic SEQ ID 1452 NM_198565 HS leucine rich repeat containing 33 (LRRC33), mRNA. TFRC exonic SEQ ID 1453 NM_003234 HS transferrin receptor (p90, CD71) (TFRC), tv1, mRNA. TFRC exonic SEQ ID 1454 NM_001128148 HS transferrin receptor (p90, CD71) (TFRC), tv2, mRNA. C9orf85 exonic SEQ ID 1455 NM_182505 HS chromosome 9 open reading frame 85 (C9orf85), mRNA. FA2H exonic SEQ ID 1456 NM_024306 HS fatty acid 2-hydroxylase (FA2H), mRNA. DNASE1L3 exonic SEQ ID 1457 NM_004944 HS deoxyribonuclease I-like 3 (DNASE1L3), tv1, mRNA. DNASE1L3 exonic SEQ ID 1458 NM_001256560 HS deoxyribonuclease I-like 3 (DNASE1L3), tv2, mRNA. VWA3A exonic SEQ ID 1459 NM_173615 HS von Willebrand factor A domain containing 3A (VWA3A), mRNA. IL32 exonic SEQ ID 1460 NM_001012635 HS interleukin 32 (IL32), tv6, mRNA. IL32 exonic SEQ ID 1461 NM_004221 HS interleukin 32 (IL32), tv2, mRNA. IL32 exonic SEQ ID 1462 NM_001012636 HS interleukin 32 (IL32), tv7, mRNA. MMP25 exonic SEQ ID 1463 NM_022468 HS matrix metallopeptidase 25 (MMP25), mRNA. IL32 exonic SEQ ID 1464 NM_001012633 HS interleukin 32 (IL32), tv4, mRNA. IL32 exonic SEQ ID 1465 NM_001012632 HS interleukin 32 (IL32), tv3, mRNA. IL32 exonic SEQ ID 1466 NM_001012631 HS interleukin 32 (IL32), tv1, mRNA. IL32 exonic SEQ ID 1467 NM_001012634 HS interleukin 32 (IL32), tv5, mRNA. IL32 exonic SEQ ID 1468 NM_001012718 HS interleukin 32 (IL32), tv8, mRNA. ZNF37BP exonic SEQ ID 1469 NR_026777 HS zinc finger protein 37B, pseudogene (ZNF37BP), non-coding RNA. TEKT1 exonic SEQ ID 1470 NM_053285 HS tektin 1 (TEKT1), mRNA. ORM1 exonic SEQ ID 1471 NM_000607 HS orosomucoid 1 (ORM1), mRNA. AKNA exonic SEQ ID 1472 NM_030767 HS AT-hook transcription factor (AKNA), mRNA. ORM2 exonic SEQ ID 1473 NM_000608 HS orosomucoid 2 (ORM2), mRNA. KIAA1432 exonic SEQ ID 1474 NM_001206557 HS KIAA1432 (KIAA1432), tv3, mRNA. KIAA1432 exonic SEQ ID 1475 NM_001135920 HS KIAA1432 (KIAA1432), tv2, mRNA. KIAA1432 exonic SEQ ID 1476 NM_020829 HS KIAA1432 (KIAA1432), tv1, mRNA. COL7A1 exonic SEQ ID 1477 NM_000094 HS collagen, type VII, alpha 1 (COL7A1), mRNA. MIR711 exonic SEQ ID 1478 NR_031756 HS microRNA 711 (MIR711), microRNA. VPS13A exonic SEQ ID 1479 NM_015186 HS vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A), tvB, mRNA. VPS13A exonic SEQ ID 1480 NM_001018038 HS vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A), tvD, mRNA. VPS13A exonic SEQ ID 1481 NM_033305 HS vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A), tvA, mRNA. VPS13A exonic SEQ ID 1482 NM_001018037 HS vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A), tvC, mRNA. COL27A1 exonic SEQ ID 1483 NM_032888 HS collagen, type XXVII, alpha 1 (COL27A1), mRNA. UQCRC1 exonic SEQ ID 1484 NM_003365 HS ubiquinol-cytochrome c reductase core protein I (UQCRC1), nuclear gene encoding mitochondrial protein, mRNA. UCN2 exonic SEQ ID 1485 NM_033199 HS urocortin 2 (UCN2), mRNA. MIR4793 exonic SEQ ID 1486 NR_039956 HS microRNA 4793 (MIR4793), microRNA. SLC26A6 exonic SEQ ID 1487 NM_134426 HS solute carrier family 26, member 6 (SLC26A6), tv3, mRNA. CELSR3 exonic SEQ ID 1488 NM_001407 HS cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) (CELSR3), mRNA. SLC26A6 exonic SEQ ID 1489 NM_001040454 HS solute carrier family 26, member 6 (SLC26A6), tv4, mRNA. TMEM89 exonic SEQ ID 1490 NM_001008269 HS transmembrane protein 89 (TMEM89), mRNA. SLC26A6 exonic SEQ ID 1491 NM_134263 HS solute carrier family 26, member 6 (SLC26A6), tv2, mRNA. SLC26A6 exonic SEQ ID 1492 NM_022911 HS solute carrier family 26, member 6 (SLC26A6), tv1, mRNA. TICRR exonic SEQ ID 1493 NM_152259 HS TOPBP1-interacting checkpoint and replication regulator (TICRR), mRNA. ALOX12P2 exonic SEQ ID 1494 NR_002710 HS arachidonate 12-lipoxygenase pseudogene 2 (ALOX12P2), non-coding RNA. FRG1 exonic SEQ ID 1495 NM_004477 HS FSHD region gene 1 (FRG1), mRNA. LOC283788 exonic SEQ ID 1496 NR_027436 HS FSHD region gene 1 pseudogene (LOC283788), non-coding RNA. LOC401109 exonic SEQ ID 1497 NR_034088 HS uncharacterized LOC401109 (LOC401109), non-coding RNA. ZDHHC19 exonic SEQ ID 1498 NM_001039617 HS zinc finger, DHHC-type containing 19 (ZDHHC19), mRNA. XAF1 exonic SEQ ID 1499 NM_199139 HS XIAP associated factor 1 (XAF1), tv2, mRNA. FBXO39 exonic SEQ ID 1500 NM_153230 HS F-box protein 39 (FBXO39), mRNA. XAF1 exonic SEQ ID 1501 NM_017523 HS XIAP associated factor 1 (XAF1), tv1, mRNA. XAF1 exonic SEQ ID 1502 NR_046397 HS XIAP associated factor 1 (XAF1), tv4, non-coding RNA. XAF1 exonic SEQ ID 1503 NR_046396 HS XIAP associated factor 1 (XAF1), tv3, non-coding RNA. XAF1 exonic SEQ ID 1504 NR_046398 HS XIAP associated factor 1 (XAF1), tv5, non-coding RNA. ENOX1 exonic SEQ ID 1505 NM_001127615 HS ecto-NOX disulfide-thiol exchanger 1 (ENOX1), tv2, mRNA. ENOX1 exonic SEQ ID 1506 NM_017993 HS ecto-NOX disulfide-thiol exchanger 1 (ENOX1), tv1, mRNA. ENOX1 exonic SEQ ID 1507 NM_001242863 HS ecto-NOX disulfide-thiol exchanger 1 (ENOX1), tv3, mRNA. DNAJC15 exonic SEQ ID 1508 NM_013238 HS DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), mRNA. PDZK1 exonic SEQ ID 1509 NM_001201325 HS PDZ domain containing 1 (PDZK1), tv2, mRNA. PDZK1 exonic SEQ ID 1510 NM_002614 HS PDZ domain containing 1 (PDZK1), tv1, mRNA. PDZK1 exonic SEQ ID 1511 NM_001201326 HS PDZ domain containing 1 (PDZK1), tv3, mRNA. POLR3GL exonic SEQ ID 1512 NM_032305 HS polymerase (RNA) III (DNA directed) polypeptide G (32 kD)-like (POLR3GL), mRNA. POLR3C exonic SEQ ID 1513 NM_006468 HS polymerase (RNA) III (DNA directed) polypeptide C (62 kD) (POLR3C), mRNA. TNIP exonic SEQ ID 1514 NM_006472 HS thioredoxin interacting protein (TXNIP), mRNA. HFE2 exonic SEQ ID 1515 NM_213653 HS hemochromatosis type 2 (juvenile) (HFE2), tva, mRNA. HFE2 exonic SEQ ID 1516 NM_213652 HS hemochromatosis type 2 (juvenile) (HFE2), tvd, mRNA. HFE2 exonic SEQ ID 1517 NM_202004 HS hemochromatosis type 2 (juvenile) (HFE2), tvc, mRNA. HFE2 exonic SEQ ID 1518 NM_145277 HS hemochromatosis type 2 (juvenile) (HFE2), tvb, mRNA. RBM8A exonic SEQ ID 1519 NM_005105 HS RNA binding motif protein 8A (RBM8A), mRNA. PIAS3 exonic SEQ ID 1520 NM_006099 HS protein inhibitor of activated STAT, 3 (PIAS3), mRNA. ANKRD35 exonic SEQ ID 1521 NM_144698 HS ankyrin repeat domain 35 (ANKRD35), mRNA. PEX11B exonic SEQ ID 1522 NM_003846 HS peroxisomal biogenesis factor 11 beta (PEX11B), tv1, mRNA. GNRHR2 exonic SEQ ID 1523 NR_002328 HS gonadotropin-releasing hormone (type 2) receptor 2 (GNRHR2), non- coding RNA. PEX11B exonic SEQ ID 1524 NM_001184795 HS peroxisomal biogenesis factor 11 beta (PEX11B), tv2, mRNA. ANKRD34A exonic SEQ ID 1525 NM_001039888 HS ankyrin repeat domain 34A (ANKRD34A), mRNA. NUDT17 exonic SEQ ID 1526 NM_001012758 HS nudix (nucleoside diphosphate linked moiety X)-type motif 17 (NUDT17), mRNA. LIX1L exonic SEQ ID 1527 NM_153713 HS Lix1 homolog (mouse)-like (LIX1L), mRNA. ITGA10 exonic SEQ ID 1528 NM_003637 HS integrin, alpha 10 (ITGA10), mRNA. CD160 exonic SEQ ID 1529 NM_007053 HS CD160 molecule (CD160), mRNA. RNF115 exonic SEQ ID 1530 NM_014455 HS ring finger protein 115 (RNF115), mRNA. TCTEX1D2 exonic SEQ ID 1531 NM_152773 HS Tctex1 domain containing 2 (TCTEX1D2), mRNA. SDHAP1 exonic SEQ ID 1532 NR_003264 HS succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1 (SDHAP1), non-coding RNA. PCYT1A exonic SEQ ID 1533 NM_005017 HS phosphate cytidylyltransferase 1, choline, alpha (PCYT1A), mRNA. SLC51A exonic SEQ ID 1534 NM_152672 HS solute carrier family 51, alpha subunit (SLC51A), mRNA. TM4SF19- exonic SEQ ID 1535 NR_037950 HS TM4SF19-TCTEX1D2 readthrough (TM4SF19-TCTEX1D2), non-coding TCTEX1D2 RNA. GPR89A exonic SEQ ID 1536 NM_001097613 HS G protein-coupled receptor 89A (GPR89A), tv2, mRNA. GPR89A exonic SEQ ID 1537 NM_001097612 HS G protein-coupled receptor 89A (GPR89A), tv1, mRNA. GPR89A exonic SEQ ID 1538 NR_036541 HS G protein-coupled receptor 89A (GPR89A), tv3, non-coding RNA. UQCRC2 exonic SEQ ID 1539 NM_003366 HS ubiquinol-cytochrome c reductase core protein II (UQCRC2), nuclear gene encoding mitochondrial protein, mRNA. EEF2K exonic SEQ ID 1540 NM_013302 HS eukaryotic elongation factor-2 kinase (EEF2K), mRNA. CDR2 exonic SEQ ID 1541 NM_001802 HS cerebellar degeneration-related protein 2, 62 kDa (CDR2), mRNA. PDZD9 exonic SEQ ID 1542 NM_173806 HS PDZ domain containing 9 (PDZD9), tv1, mRNA. PDZD9 exonic SEQ ID 1543 NR_033694 HS PDZ domain containing 9 (PDZD9), tv2, non-coding RNA. C16orf52 exonic SEQ ID 1544 NM_001164579 HS chromosome 16 open reading frame 52 (C16orf52), mRNA. POLR3E exonic SEQ ID 1545 NM_018119 HS polymerase (RNA) III (DNA directed) polypeptide E (80 kD) (POLR3E), tv1, mRNA. POLR3E exonic SEQ ID 1546 NM_001258036 HS polymerase (RNA) III (DNA directed) polypeptide E (80 kD) (POLR3E), tv5, mRNA. POLR3E exonic SEQ ID 1547 NM_001258035 HS polymerase (RNA) III (DNA directed) polypeptide E (80 kD) (POLR3E), tv3, mRNA. POLR3E exonic SEQ ID 1548 NM_00125 8034 HS polymerase (RNA) III (DNA directed) polypeptide E (80 kD) (POLR3E), tv4, mRNA. POLR3E exonic SEQ ID 1549 NM_001258033 HS polymerase (RNA) III (DNA directed) polypeptide E (80 kD) (POLR3E), tv2, mRNA. POLR3E exonic SEQ ID 1550 NR_047581 HS polymerase (RNA) III (DNA directed) polypeptide E (80 kD) (POLR3E), tv6, non-coding RNA. CETN3 exonic SEQ ID 1551 NM_004365 HS centrin, EF-hand protein, 3 (CETN3), mRNA. MBLAC2 exonic SEQ ID 1552 NM_203406 HS metallo-beta-lactamase domain containing 2 (MBLAC2), mRNA. POLR3G exonic SEQ ID 1553 NM_006467 HS polymerase (RNA) III (DNA directed) polypeptide G (32 kD) (POLR3G), mRNA. LYSMD3 exonic SEQ ID 1554 NM_198273 HS LysM, putative peptidoglycan-binding, domain containing 3 (LYSMD3), mRNA. CSGALNACT2 exonic SEQ ID 1555 NM_018590 HS chondroitin sulfate N-acetylgalactosaminyltransferase 2 (CSGALNACT2), mRNA. BMS1 exonic SEQ ID 1556 NM_014753 HS BMS1 homolog, ribosome assembly protein (yeast) (BMS1), mRNA. ZNF487P exonic SEQ ID 1557 NR_026693 HS zinc finger protein 487, pseudogene (ZNF487P), non-coding RNA. MIR5100 exonic SEQ ID 1558 NR_049836 HS microRNA 5100 (MIR5100), microRNA. RET exonic SEQ ID 1559 NM_020630 HS ret proto-oncogene (RET), tv4, mRNA. RET exonic SEQ ID 1560 NM_020975 HS ret proto-oncogene (RET), tv2, mRNA. RASGEF1A exonic SEQ ID 1561 NM_145313 HS RasGEF domain family, member 1A (RASGEF1A), mRNA. HNRNPF exonic SEQ ID 1562 NM_001098208 HS heterogeneous nuclear ribonucleoprotein F (HNRNPF), tv1, mRNA. FXYD4 exonic SEQ ID 1563 NM_001184963 HS FXYD domain containing ion transport regulator 4 (FXYD4), tv2, mRNA. HNRNPF exonic SEQ ID 1564 NM_001098206 HS heterogeneous nuclear ribonucleoprotein F (HNRNPF), tv5, mRNA. HNRNPF exonic SEQ ID 1565 NM_001098205 HS heterogeneous nuclear ribonucleoprotein F (HNRNPF), tv4, mRNA. HNRNPF exonic SEQ ID 1566 NM_001098204 HS heterogeneous nuclear ribonucleoprotein F (HNRNPF), tv2, mRNA. HNRNPF exonic SEQ ID 1567 NM_001098207 HS heterogeneous nuclear ribonucleoprotein F (HNRNPF), tv6, mRNA. HNRNPF exonic SEQ ID 1568 NM_004966 HS heterogeneous nuclear ribonucleoprotein F (HNRNPF), tv3, mRNA. FXYD4 exonic SEQ ID 1569 NM_173160 HS FXYD domain containing ion transport regulator 4 (FXYD4), tv1, mRNA. LOC441666 exonic SEQ ID 1570 NR_024380 HS zinc finger protein 91 pseudogene (LOC441666), non-coding RNA. LINC00839 ncRNA SEQ ID 1571 NR_026827 HS long intergenic non-protein coding RNA 839 (LINC00839), non-coding RNA. ZNF33B exonic SEQ ID 1572 NM_006955 HS zinc finger protein 33B (ZNF33B), mRNA. ARHGAP10 exonic SEQ ID 1573 NM_024605 HS Rho GTPase activating protein 10 (ARHGAP10), mRNA. CEP57 exonic SEQ ID 1574 NM_001243777 HS centrosomal protein 57 kDa (CEP57), tv3, mRNA. CEP57 exonic SEQ ID 1575 NM_001243776 HS centrosomal protein 57 kDa (CEP57), tv2, mRNA. CEP57 exonic SEQ ID 1576 NM_014679 HS centrosomal protein 57 kDa (CEP57), tv1, mRNA. GRAMD4 exonic SEQ ID 1577 NM_015124 HS GRAM domain containing 4 (GRAMD4), mRNA. OFD1 exonic SEQ ID 1578 NM_003611 HS oral-facial-digital syndrome 1 (OFD1), mRNA. SLC25A29 exonic SEQ ID 1579 NM_001039355 HS solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29 (SLC25A29), nuclear gene encoding mitochondrial protein, mRNA. CD46 exonic SEQ ID 1580 NM_002389 HS CD46 molecule, complement regulatory protein (CD46), tva, mRNA. CD46 exonic SEQ ID 1581 NM_172350 HS CD46 molecule, complement regulatory protein (CD46), tvn, mRNA. CD46 exonic SEQ ID 1582 NM_172359 HS CD46 molecule, complement regulatory protein (CD46), tvb, mRNA. CD46 exonic SEQ ID 1583 NM_172351 HS CD46 molecule, complement regulatory protein (CD46), tvc, mRNA. CD46 exonic SEQ ID 1584 NM_172361 HS CD46 molecule, complement regulatory protein (CD46), tvl, mRNA. CD46 exonic SEQ ID 1585 NM_172353 HS CD46 molecule, complement regulatory protein (CD46), tvf, mRNA. CD46 exonic SEQ ID 1586 NM_153826 HS CD46 molecule, complement regulatory protein (CD46), tvd, mRNA. CD46 exonic SEQ ID 1587 NM_172352 HS CD46 molecule, complement regulatory protein (CD46), tve, mRNA. AP3M2 exonic SEQ ID 1588 NM_006803 HS adaptor-related protein complex 3, mu 2 subunit (AP3M2), tv2, mRNA. AP3M2 exonic SEQ ID 1589 NM_001134296 HS adaptor-related protein complex 3, mu 2 subunit (AP3M2), tv1, mRNA. MIR516B2 exonic SEQ ID 1590 NR_030207 HS microRNA 516b-2 (MIR516B2), microRNA. OR6Y1 exonic SEQ ID 1591 NM_001005189 HS olfactory receptor, family 6, subfamily Y, member 1 (OR6Y1), mRNA. CLOCK exonic SEQ ID 1592 NM_004898 HS clock circadian regulator (CLOCK), tv2, mRNA. CLOCK exonic SEQ ID 1593 NM_001267843 HS clock circadian regulator (CLOCK), tv1, mRNA. SESTD1 exonic SEQ ID 1594 NM_178123 HS SEC14 and spectrin domains 1 (SESTD1), mRNA. FER1L4 exonic SEQ ID 1595 NR_024377 HS fer-1-like 4 (C. elegans) pseudogene (FER1L4), non-coding RNA. USP9X exonic SEQ ID 1596 NM_001039591 HS ubiquitin specific peptidase 9, X-linked (USP9X), tv4, mRNA. USP9X exonic SEQ ID 1597 NM_001039590 HS ubiquitin specific peptidase 9, X-linked (USP9X), tv3, mRNA. CLECL1 exonic SEQ ID 1598 NM_001253750 HS C-type lectin-like 1 (CLECL1), tv3, mRNA. CLECL1 exonic SEQ ID 1599 NM_001267701 HS C-type lectin-like 1 (CLECL1), tv4, mRNA. CLECL1 exonic SEQ ID 1600 NM_172004 HS C-type lectin-like 1 (CLECL1), tv1, mRNA. XPO6 exonic SEQ ID 1601 NM_015171 HS exportin 6 (XPO6), tv2, mRNA. XPO6 exonic SEQ ID 1602 NM_001270940 HS exportin 6 (XPO6), tv1, mRNA. ARHGEF26 exonic SEQ ID 1603 NM_015595 HS Rho guanine nucleotide exchange factor (GEF) 26 (ARHGEF26), tv2, mRNA. ARHGEF26 exonic SEQ ID 1604 NM_001251962 HS Rho guanine nucleotide exchange factor (GEF) 26 (ARHGEF26), tv1, mRNA. ARHGEF26 exonic SEQ ID 1605 NM_001251963 HS Rho guanine nucleotide exchange factor (GEF) 26 (ARHGEF26), tv3, mRNA. TRIO exonic SEQ ID 1606 NM_007118 HS trio Rho guanine nucleotide exchange factor (TRIO), mRNA. ANO5 exonic SEQ ID 1607 NM_213599 HS anoctamin 5 (ANO5), tv1, mRNA. ANO5 exonic SEQ ID 1608 NM_001142649 HS anoctamin 5 (ANO5), tv2, mRNA. KIRREL3 exonic SEQ ID 1609 NM_001161707 HS kin of IRRE like 3 (Drosophila) (KIRREL3), tv2, mRNA. KIRREL3 exonic SEQ ID 1610 NM_032531 HS kin of IRRE like 3 (Drosophila) (KIRREL3), tv1, mRNA. LBH exonic SEQ ID 1611 NM_030915 HS limb bud and heart development (LBH), mRNA. IL1RAPL1 exonic SEQ ID 1612 NM_014271 HS interleukin 1 receptor accessory protein-like 1 (IL1RAPL1), mRNA. ETS1 exonic SEQ ID 1613 NM_001143820 HS v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), tv1, mRNA. ETS1 exonic SEQ ID 1614 NM_005238 HS v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), tv2, mRNA. ETS1 exonic SEQ ID 1615 NM_001162422 HS v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), tv3, mRNA. CXorf57 exonic SEQ ID 1616 NM_018015 HS chromosome X open reading frame 57 (CXorf57), tv1, mRNA. CXorf57 exonic SEQ ID 1617 NM_001184782 HS chromosome X open reading frame 57 (CXorf57), tv2, mRNA. HECTD1 exonic SEQ ID 1618 NM_015382 HS HECT domain containing E3 ubiquitin protein ligase 1 (HECTD1), mRNA. ST6GAL2 exonic SEQ ID 1619 NM_001142351 HS ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 (ST6GAL2), tv2, mRNA. ST6GAL2 exonic SEQ ID 1620 NM_032528 HS ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 (ST6GAL2), tv1, mRNA. COMMD7 exonic SEQ ID 1621 NM_053041 HS COMM domain containing 7 (COMMD7), tv1, mRNA. COMMD7 exonic SEQ ID 1622 NM_001099339 HS COMM domain containing 7 (COMMD7), tv2, mRNA. FANCA exonic SEQ ID 1623 NM_000135 HS Fanconi anemia, complementation group A (FANCA), tv1, mRNA. FANCA exonic SEQ ID 1624 NM_001018112 HS Fanconi anemia, complementation group A (FANCA), tv2, mRNA. PYROXD1 exonic SEQ ID 1625 NM_024854 HS pyridine nucleotide-disulphide oxidoreductase domain 1 (PYROXD1), mRNA. RECQL exonic SEQ ID 1626 NM_032941 HS RecQ protein-like (DNA helicase Q1-like) (RECQL), tv2, mRNA. RECQL exonic SEQ ID 1627 NM_002907 HS RecQ protein-like (DNA helicase Q1-like) (RECQL), tv1, mRNA. CSDAP1 exonic SEQ ID 1628 NR_027011 HS cold shock domain protein A pseudogene 1 (CSDAP1), non-coding RNA. LOC158696 exonic SEQ ID 1629 NR_026935 HS uncharacterized LOC158696 (LOC158696), non-coding RNA. PMS2 exonic SEQ ID 1630 NM_000535 HS PMS2 postmeiotic segregation increased 2 (S. cerevisiae) (PMS2), tv1, mRNA. PMS2 exonic SEQ ID 1631 NR_003085 HS PMS2 postmeiotic segregation increased 2 (S. cerevisiae) (PMS2), tv2, non- coding RNA. CCDC18 exonic SEQ ID 1632 NM_206886 HS coiled-coil domain containing 18 (CCDC18), mRNA. PREPL exonic SEQ ID 1633 NM_001042385 HS prolyl endopeptidase-like (PREPL), tv4, mRNA. PREPL exonic SEQ ID 1634 NM_001171617 HS prolyl endopeptidase-like (PREPL), tv7, mRNA. PREPL exonic SEQ ID 1635 NM_001042386 HS prolyl endopeptidase-like (PREPL), tv5, mRNA. PREPL exonic SEQ ID 1636 NM_001171603 HS prolyl endopeptidase-like (PREPL), tv2, mRNA. PREPL exonic SEQ ID 1637 NM_001171613 HS prolyl endopeptidase-like (PREPL), tv6, mRNA. PREPL exonic SEQ ID 1638 NM_001171606 HS prolyl endopeptidase-like (PREPL), tv3, mRNA. PREPL exonic SEQ ID 1639 NM_006036 HS prolyl endopeptidase-like (PREPL), tv1, mRNA. HOMEZ exonic SEQ ID 1640 NM_020834 HS homeobox and leucine zipper encoding (HOMEZ), mRNA. UBR1 exonic SEQ ID 1641 NM_174916 HS ubiquitin protein ligase E3 component n-recognin 1 (UBR1), mRNA. APOBEC3C exonic SEQ ID 1642 NM_014508 HS apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C (APOBEC3C), mRNA. PNLIPRP3 exonic SEQ ID 1643 NM_001011709 HS pancreatic lipase-related protein 3 (PNLIPRP3), mRNA. DDX58 exonic SEQ ID 1644 NM_014314 HS DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 (DDX58), mRNA. MYBL1 exonic SEQ ID 1645 NM_001080416 HS v-myb myeloblastosis viral oncogene homolog (avian)-like 1 (MYBL1), tv1, mRNA. MYBL1 exonic SEQ ID 1646 NM_001144755 HS v-myb myeloblastosis viral oncogene homolog (avian)-like 1 (MYBL1), tv2, mRNA. GIT2 exonic SEQ ID 1647 NM_014776 HS G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2), tv3, mRNA. GIT2 exonic SEQ ID 1648 NM_139201 HS G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2), tv4, mRNA. GIT2 exonic SEQ ID 1649 NM_057170 HS G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2), tv2, mRNA. GIT2 exonic SEQ ID 1650 NM_001135213 HS G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2), tv6, mRNA. GIT2 exonic SEQ ID 1651 NM_001135214 HS G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2), tv5, mRNA. GIT2 exonic SEQ ID 1652 NM_057169 HS G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2), tv1, mRNA. RGS20 exonic SEQ ID 1653 NM_003702 HS regulator of G-protein signaling 20 (RGS20), tv2, mRNA. RGS20 exonic SEQ ID 1654 NM_170587 HS regulator of G-protein signaling 20 (RGS20), tv1, mRNA. ALS2CL exonic SEQ ID 1655 NM_182775 HS ALS2 C-terminal like (ALS2CL), tv3, mRNA. ALS2CL exonic SEQ ID 1656 NM_147129 HS ALS2 C-terminal like (ALS2CL), tv1, mRNA. ALS2CL exonic SEQ ID 1657 NM_001190707 HS ALS2 C-terminal like (ALS2CL), tv2, mRNA. ALS2CL exonic SEQ ID 1658 NR_033815 HS ALS2 C-terminal like (ALS2CL), tv4, non-coding RNA. BTG4 exonic SEQ ID 1659 NM_017589 HS B-cell translocation gene 4 (BTG4), mRNA. FAM9B exonic SEQ ID 1660 NM_205849 HS family with sequence similarity 9, member B (FAM9B), mRNA. ABCA13 exonic SEQ ID 1661 NM_152701 HS ATP-binding cassette, sub-family A (ABC1), member 13 (ABCA13), mRNA. LOC255025 exonic SEQ ID 1662 NR_015400 HS uncharacterized LOC255025 (LOC255025), non-coding RNA. AKR1B15 exonic SEQ ID 1663 NM_001080538 HS aldo-keto reductase family 1, member B15 (AKR1B15), mRNA. GLDC exonic SEQ ID 1664 NM_000170 HS glycine dehydrogenase (decarboxylating) (GLDC), nuclear gene encoding mitochondrial protein, mRNA. LINC00671 exonic SEQ ID 1665 NR_027254 HS long intergenic non-protein coding RNA 671 (LINC00671), non-coding RNA. UBA6 exonic SEQ ID 1666 NM_018227 HS ubiquitin-like modifier activating enzyme 6 (UBA6), mRNA. T exonic SEQ ID 1667 NM_003181 HS T, brachyury homolog (mouse) (T), tv1, mRNA. T exonic SEQ ID 1668 NM_001270484 HS T, brachyury homolog (mouse) (T), tv2, mRNA. STAT3 exonic SEQ ID 1669 NM_213662 HS signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), tv3, mRNA. STAT3 exonic SEQ ID 1670 NM_139276 HS signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), tv1, mRNA. STAT3 exonic SEQ ID 1671 NM_003150 HS signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), tv2, mRNA. TBCK exonic SEQ ID 1672 NM_001163435 HS TBC1 domain containing kinase (TBCK), tv1, mRNA. TBCK exonic SEQ ID 1673 NM_001163437 HS TBC1 domain containing kinase (TBCK), tv3, mRNA. TBCK exonic SEQ ID 1674 NM_001163436 HS TBC1 domain containing kinase (TBCK), tv2, mRNA. TBCK exonic SEQ ID 1675 NM_033115 HS TBC1 domain containing kinase (TBCK), tv4, mRNA. N4BP2 exonic SEQ ID 1676 NM_018177 HS NEDD4 binding protein 2 (N4BP2), mRNA. CADPS2 exonic SEQ ID 1677 NM_001167940 HS Ca++-dependent secretion activator 2 (CADPS2), tv3, mRNA. CADPS2 exonic SEQ ID 1678 NM_001009571 HS Ca++-dependent secretion activator 2 (CADPS2), tv2, mRNA. CADPS2 exonic SEQ ID 1679 NM_017954 HS Ca++-dependent secretion activator 2 (CADPS2), tv1, mRNA. GNE exonic SEQ ID 1680 NM_001128227 HS glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase (GNE), tv1, mRNA. GNE exonic SEQ ID 1681 NM_001190388 HS glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase (GNE), tv3, mRNA. GATA6 exonic SEQ ID 1682 NM_005257 HS GATA binding protein 6 (GATA6), mRNA. SLC27A6 exonic SEQ ID 1683 NM_014031 HS solute carrier family 27 (fatty acid transporter), member 6 (SLC27A6), tv1, mRNA. SLC27A6 exonic SEQ ID 1684 NM_001017372 HS solute carrier family 27 (fatty acid transporter), member 6 (SLC27A6), tv2, mRNA. KIF26B exonic SEQ ID 1685 NM_018012 HS kinesin family member 26B (KIF26B), mRNA. MIR3680-2 exonic SEQ ID 1686 NR_049833 HS microRNA 3680-2 (MIR3680-2), microRNA. MIR3680-1 exonic SEQ ID 1687 NR_037451 HS microRNA 3680-1 (MIR3680-1), microRNA. RARRES3 exonic SEQ ID 1688 NM_004585 HS retinoic acid receptor responder (tazarotene induced) 3 (RARRES3), mRNA. SPECC1 exonic SEQ ID 1689 NM_001243439 HS sperm antigen with calponin homology and coiled-coil domains 1 (SPECC1), tv6, mRNA. SPECC1 exonic SEQ ID 1690 NM_001033555 HS sperm antigen with calponin homology and coiled-coil domains 1 (SPECC1), tv2, mRNA. SPECC1 exonic SEQ ID 1691 NM_001033553 HS sperm antigen with calponin homology and coiled-coil domains 1 (SPECC1), tv1, mRNA. IRAK2 exonic SEQ ID 1692 NM_001570 HS interleukin-1 receptor-associated kinase 2 (IRAK2), mRNA. NDRG1 exonic SEQ ID 1693 NM_006096 HS N-myc downstream regulated 1 (NDRG1), tv2, mRNA. NDRG1 exonic SEQ ID 1694 NM_001135242 HS N-myc downstream regulated 1 (NDRG1), tv1, mRNA. NDRG1 exonic SEQ ID 1695 NM_001258432 HS N-myc downstream regulated 1 (NDRG1), tv3, mRNA. NDRG1 exonic SEQ ID 1696 NM_001258433 HS N-myc downstream regulated 1 (NDRG1), tv4, mRNA. ATAD5 exonic SEQ ID 1697 NM_024857 HS ATPase family, AAA domain containing 5 (ATAD5), mRNA. CD109 exonic SEQ ID 1698 NM_001159588 HS CD109 molecule (CD109), tv3, mRNA. CD109 exonic SEQ ID 1699 NM_001159587 HS CD109 molecule (CD109), tv2, mRNA. CD109 exonic SEQ ID 1700 NM_133493 HS CD109 molecule (CD109), tv1, mRNA. DNAH3 exonic SEQ ID 1701 NM_017539 HS dynein, axonemal, heavy chain 3 (DNAH3), mRNA. POU5F1P3 exonic SEQ ID 1702 NR_036440 HS POU class 5 homeobox 1 pseudogene 3 (POU5F1P3), non-coding RNA. CLEC4A exonic SEQ ID 1703 NM_194450 HS C-type lectin domain family 4, member A (CLEC4A), tv2, mRNA. CLEC4A exonic SEQ ID 1704 NM_194448 HS C-type lectin domain family 4, member A (CLEC4A), tv4, mRNA. CLEC4A exonic SEQ ID 1705 NM_194447 HS C-type lectin domain family 4, member A (CLEC4A), tv3, mRNA. CLEC4A exonic SEQ ID 1706 NM_016184 HS C-type lectin domain family 4, member A (CLEC4A), tv1, mRNA. PLAA exonic SEQ ID 1707 NM_001031689 HS phospholipase A2-activating protein (PLAA), mRNA. GLRX exonic SEQ ID 1708 NM_001118890 HS glutaredoxin (thioltransferase) (GLRX), tv2, mRNA. GLRX exonic SEQ ID 1709 NM_001243659 HS glutaredoxin (thioltransferase) (GLRX), tv4, mRNA. GLRX exonic SEQ ID 1710 NM_002064 HS glutaredoxin (thioltransferase) (GLRX), tv1, mRNA. GLRX exonic SEQ ID 1711 NM_001243658 HS glutaredoxin (thioltransferase) (GLRX), tv3, mRNA. ALG12 exonic SEQ ID 1712 NM_024105 HS asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) (ALG12), mRNA. GUSBP11 exonic SEQ ID 1713 NR_024448 HS glucuronidase, beta pseudogene 11 (GUSBP11), non-coding RNA. RGL4 exonic SEQ ID 1714 NM_153615 HS ral guanine nucleotide dissociation stimulator-like 4 (RGL4), mRNA. PDE10A exonic SEQ ID 1715 NM_001130690 HS phosphodiesterase 10A (PDE10A), tv1, mRNA. PDE10A exonic SEQ ID 1716 NR_045597 HS phosphodiesterase 10A (PDE10A), tv2, non-coding RNA. ANKS1B exonic SEQ ID 1717 NM_152788 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv1, mRNA. ANKS1B exonic SEQ ID 1718 NM_001204068 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv7, mRNA. ANKS1B exonic SEQ ID 1719 NM_001204066 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv5, mRNA. ANKS1B exonic SEQ ID 1720 NM_001204065 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv4, mRNA. ANKS1B exonic SEQ ID 1721 NM_001204080 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv11, mRNA. ANKS1B exonic SEQ ID 1722 NM_001204070 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv9, mRNA. ANKS1B exonic SEQ ID 1723 NM_001204079 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv10, mRNA. ANKS1B exonic SEQ ID 1724 NM_001204067 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv6, mRNA. ANKS1B exonic SEQ ID 1725 NM_001204069 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv8, mRNA. ANKS1B exonic SEQ ID 1726 NM_020140 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv3, mRNA. ANKS1B exonic SEQ ID 1727 NM_181670 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv2, mRNA. ANKS1B exonic SEQ ID 1728 NM_001204081 HS ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), tv12, mRNA. CECR2 exonic SEQ ID 1729 NM_031413 HS cat eye syndrome chromosome region, candidate 2 (CECR2), mRNA. TAS1R2 exonic SEQ ID 1730 NM_152232 HS taste receptor, type 1, member 2 (TAS1R2), mRNA. NUP155 exonic SEQ ID 1731 NM_004298 HS nucleoporin 155 kDa (NUP155), tv2, mRNA. NUP155 exonic SEQ ID 1732 NM_153485 HS nucleoporin 155 kDa (NUP155), tv1, mRNA. STIL exonic SEQ ID 1733 NM_003035 HS SCL/TAL1 interrupting locus (STIL), tv2, mRNA. STIL exonic SEQ ID 1734 NM_001048166 HS SCL/TAL1 interrupting locus (STIL), tv1, mRNA. STPG2 exonic SEQ ID 1735 NM_174952 HS sperm-tail PG-rich repeat containing 2 (STPG2), mRNA. PDLIM3 exonic SEQ ID 1736 NM_001257962 HS PDZ and LIM domain 3 (PDLIM3), tv3, mRNA. PDLIM3 exonic SEQ ID 1737 NM_001114107 HS PDZ and LIM domain 3 (PDLIM3), tv2, mRNA. PDLIM3 exonic SEQ ID 1738 NR_047562 HS PDZ and LIM domain 3 (PDLIM3), tv5, non-coding RNA. PDLIM3 exonic SEQ ID 1739 NM_014476 HS PDZ and LIM domain 3 (PDLIM3), tv1, mRNA. PDLIM3 exonic SEQ ID 1740 NM_001257963 HS PDZ and LIM domain 3 (PDLIM3), tv4, mRNA. YIPF7 exonic SEQ ID 1741 NM_182592 HS Yip1 domain family, member 7 (YIPF7), mRNA. CCDC169- exonic SEQ ID 1742 NM_001198910 HS CCDC169-SOHLH2 readthrough (CCDC169-SOHLH2), mRNA. SOHLH2 CCDC169 exonic SEQ ID 1743 NM_001144983 HS coiled-coil domain containing 169 (CCDC169), tv3, mRNA. CCDC169 exonic SEQ ID 1744 NM_001198908 HS coiled-coil domain containing 169 (CCDC169), tv7, mRNA. CCDC169 exonic SEQ ID 1745 NM_001144984 HS coiled-coil domain containing 169 (CCDC169), tv4, mRNA. CCDC169 exonic SEQ ID 1746 NM_001144982 HS coiled-coil domain containing 169 (CCDC169), tv2, mRNA. PLA2G15 exonic SEQ ID 1747 NM_012320 HS phospholipase A2, group XV (PLA2G15), mRNA. CYB5R1 exonic SEQ ID 1748 NM_016243 HS cytochrome b5 reductase 1 (CYB5R1), mRNA. DHPS exonic SEQ ID 1749 NM_013406 HS deoxyhypusine synthase (DHPS), tv2, mRNA. DHPS exonic SEQ ID 1750 NM_001930 HS deoxyhypusine synthase (DHPS), tv1, mRNA. DHPS exonic SEQ ID 1751 NM_001206974 HS deoxyhypusine synthase (DHPS), tv4, mRNA. DHPS exonic SEQ ID 1752 NR_038192 HS deoxyhypusine synthase (DHPS), tv5, non-coding RNA. RIIAD1 exonic SEQ ID 1753 NM_001144956 HS regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1 (RIIAD1), mRNA. FBXW9 exonic SEQ ID 1754 NM_032301 HS F-box and WD repeat domain containing 9 (FBXW9), mRNA. CNTLN exonic SEQ ID 1755 NM_017738 HS centlein, centrosomal protein (CNTLN), tv1, mRNA. SNX16 exonic SEQ ID 1756 NM_152837 HS sorting nexin 16 (SNX16), tv3, mRNA. SNX16 exonic SEQ ID 1757 NM_152836 HS sorting nexin 16 (SNX16), tv2, mRNA. SNX16 exonic SEQ ID 1758 NM_022133 HS sorting nexin 16 (SNX16), tv1, mRNA. SOAT1 exonic SEQ ID 1759 NM_001252511 HS sterol O-acyltransferase 1 (SOAT1), nuclear gene encoding mitochondrial protein, tv2, mRNA. SOAT1 exonic SEQ ID 1760 NM_001252512 HS sterol O-acyltransferase 1 (SOAT1), nuclear gene encoding mitochondrial protein, tv3, mRNA. SOAT1 exonic SEQ ID 1761 NM_003101 HS sterol O-acyltransferase 1 (SOAT1), nuclear gene encoding mitochondrial protein, tv1, mRNA. SOAT1 exonic SEQ ID 1762 NR_045530 HS sterol O-acyltransferase 1 (SOAT1), tv4, non-coding RNA. ABCB4 exonic SEQ ID 1763 NM_000443 HS ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4), tvA, mRNA. ABCB4 exonic SEQ ID 1764 NM_018849 HS ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4), tvB, mRNA. ABCB4 exonic SEQ ID 1765 NM_018850 HS ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4), tvC, mRNA. CASP10 exonic SEQ ID 1766 NM_032974 HS caspase 10, apoptosis-related cysteine peptidase (CASP10), tv2, mRNA. CASP10 exonic SEQ ID 1767 NM_001206524 HS caspase 10, apoptosis-related cysteine peptidase (CASP10), tv6, mRNA. CASP10 exonic SEQ ID 1768 NM_032977 HS caspase 10, apoptosis-related cysteine peptidase (CASP10), tv1, mRNA. CASP10 exonic SEQ ID 1769 NM_001230 HS caspase 10, apoptosis-related cysteine peptidase (CASP10), tv3, mRNA. CASP10 exonic SEQ ID 1770 NM_032976 HS caspase 10, apoptosis-related cysteine peptidase (CASP10), tv4, mRNA. CASP10 exonic SEQ ID 1771 NM_001206542 HS caspase 10, apoptosis-related cysteine peptidase (CASP10), tv5, mRNA. MYO18B exonic SEQ ID 1772 NM_032608 HS myosin XVIIIB (MYO18B), mRNA. MIR1302-1 exonic SEQ ID 1773 NR_031631 HS microRNA 1302-1 (MIR1302-1), microRNA. DPYD exonic SEQ ID 1774 NM_000110 HS dihydropyrimidine dehydrogenase (DPYD), tv1, mRNA. STON1 exonic SEQ ID 1775 NM_001198595 HS stonin 1 (STON1), tv1, mRNA. STON1 exonic SEQ ID 1776 NM_006873 HS stonin 1 (STON1), tv2, mRNA. STON1- exonic SEQ ID 1777 NM_001198593 HS STON1-GTF2A1L readthrough (STON1-GTF2A1L), tv2, mRNA. GTF2A1L STON1- exonic SEQ ID 1778 NM_001198594 HS STON1-GTF2A1L readthrough (STON1-GTF2A1L), tv3, mRNA. GTF2A1L STON1- exonic SEQ ID 1779 NM_172311 HS STON1-GTF2A1L readthrough (STON1-GTF2A1L), tv1, mRNA. GTF2A1L CNTLN exonic SEQ ID 1780 NM_001114395 HS centlein, centrosomal protein (CNTLN), tv2, mRNA. CACNA2D3 exonic SEQ ID 1781 NM_018398 HS calcium channel, voltage-dependent, alpha 2/delta subunit 3 (CACNA2D3), mRNA. BID exonic SEQ ID 1782 NM_001196 HS BH3 interacting domain death agonist (BID), tv2, mRNA. BID exonic SEQ ID 1783 NM_197967 HS BH3 interacting domain death agonist (BID), tv3, mRNA. BID exonic SEQ ID 1784 NM_197966 HS BH3 interacting domain death agonist (BID), tv1, mRNA. BID exonic SEQ ID 1785 NM_001244572 HS BH3 interacting domain death agonist (BID), tv7, mRNA. BID exonic SEQ ID 1786 NM_001244570 HS BH3 interacting domain death agonist (BID), tv6, mRNA. BID exonic SEQ ID 1787 NM_001244569 HS BH3 interacting domain death agonist (BID), tv5, mRNA. BID exonic SEQ ID 1788 NM_001244567 HS BH3 interacting domain death agonist (BID), tv4, mRNA. SPECC1 exonic SEQ ID 1789 NM_152904 HS sperm antigen with calponin homology and coiled-coil domains 1 (SPECC1), tv3, mRNA. ANXA6 exonic SEQ ID 1790 NM_001155 HS annexin A6 (ANXA6), tv1, mRNA. AQP4-AS1 exonic SEQ ID 1791 NR_026908 HS AQP4 antisense RNA 1 (AQP4-AS1), non-coding RNA. COL26A1/EMID2 exonic SEQ ID 1792 NM_133457 HS collagen, type XXVI, alpha 1 (COL26A1), mRNA. EPS8L3 exonic SEQ ID 1793 NM_024526 HS EPS8-like 3 (EPS8L3), tv3, mRNA. EPS8L3 exonic SEQ ID 1794 NM_133181 HS EPS8-like 3 (EPS8L3), tv2, mRNA. EPS8L3 exonic SEQ ID 1795 NM_139053 HS EPS8-like 3 (EPS8L3), tv1, mRNA. PLEKHD1 exonic SEQ ID 1796 NM_001161498 HS pleckstrin homology domain containing, family D (with coiled-coil domains) member 1 (PLEKHD1), mRNA. ARMC5 exonic SEQ ID 1797 NM_001105247 HS armadillo repeat containing 5 (ARMC5), tv1, mRNA. TGFB1I1 exonic SEQ ID 1798 NM_001042454 HS transforming growth factor beta 1 induced transcript 1 (TGFB1I1), tv1, mRNA. TGFB1I1 exonic SEQ ID 1799 NM_015927 HS transforming growth factor beta 1 induced transcript 1 (TGFB1I1), tv2, mRNA. TGFB1I1 exonic SEQ ID 1800 NM_001164719 HS transforming growth factor beta 1 induced transcript 1 (TGFB1I1), tv3, mRNA. ARMC5 exonic SEQ ID 1801 NM_024742 HS armadillo repeat containing 5 (ARMC5), tv2, mRNA. XYLB exonic SEQ ID 1802 NM_005108 HS xylulokinase homolog (H. influenzae) (XYLB), mRNA. MIR521-2 exonic SEQ ID 1803 NR_030203 HS microRNA 521-2 (MIR521-2), microRNA. MIR520D exonic SEQ ID 1804 NR_030204 HS microRNA 520d (MIR520D), microRNA. MIR520G exonic SEQ ID 1805 NR_030206 HS microRNA 520g (MIR520G), microRNA. MIR517B exonic SEQ ID 1806 NR_030205 HS microRNA 517b (MIR517B), microRNA. MIR526A2 exonic SEQ ID 1807 NR_030208 HS microRNA 526a-2 (MIR526A2), microRNA. SZRD1 exonic SEQ ID 1808 NM_015609 HS SUZ RNA binding domain containing 1 (SZRD1), tv2, mRNA. SZRD1 exonic SEQ ID 1809 NM_001114600 HS SUZ RNA binding domain containing 1 (SZRD1), tv1, mRNA. ZNF324B exonic SEQ ID 1810 NM_207395 HS zinc finger protein 324B (ZNF324B), mRNA. CCDC169 exonic SEQ ID 1811 NM_001144986 HS coiled-coil domain containing 169 (CCDC169), tv6, mRNA. CCDC169 exonic SEQ ID 1812 NM_001144981 HS coiled-coil domain containing 169 (CCDC169), tv1, mRNA. CCDC169 exonic SEQ ID 1813 NM_001144985 HS coiled-coil domain containing 169 (CCDC169), tv5, mRNA. RIN1 exonic SEQ ID 1814 NM_004292 HS Ras and Rab interactor 1 (RIN1), mRNA. ZNF808 exonic SEQ ID 1815 NM_001039886 HS zinc finger protein 808 (ZNF808), mRNA. EMCN exonic SEQ ID 1816 NM_016242 HS endomucin (EMCN), tv1, mRNA. EMCN exonic SEQ ID 1817 NM_001159694 HS endomucin (EMCN), tv2, mRNA. TIAM2 exonic SEQ ID 1818 NM_012454 HS T-cell lymphoma invasion and metastasis 2 (TIAM2), tv1, mRNA. BCAS1 exonic SEQ ID 1819 NM_003657 HS breast carcinoma amplified sequence 1 (BCAS1), mRNA. RABEPK exonic SEQ ID 1820 NM_005833 HS Rab9 effector protein with kelch motifs (RABEPK), tv1, mRNA. RABEPK exonic SEQ ID 1821 NM_001174153 HS Rab9 effector protein with kelch motifs (RABEPK), tv3, mRNA. RABEPK exonic SEQ ID 1822 NM_001174152 HS Rab9 effector protein with kelch motifs (RABEPK), tv2, mRNA. KLHDC4 exonic SEQ ID 1823 NM_017566 HS kelch domain containing 4 (KLHDC4), tv1, mRNA. KLHDC4 exonic SEQ ID 1824 NM_001184856 HS kelch domain containing 4 (KLHDC4), tv2, mRNA. KLHDC4 exonic SEQ ID 1825 NM_001184854 HS kelch domain containing 4 (KLHDC4), tv3, mRNA. SEPT9 exonic SEQ ID 1826 NM_001113492 HS septin 9 (SEPT9), tv5, mRNA. SEPT9 exonic SEQ ID 1827 NM_001113491 HS septin 9 (SEPT9), tv1, mRNA. SEPT9 exonic SEQ ID 1828 NM_001113493 HS septin 9 (SEPT9), tv2, mRNA. SEPT9 exonic SEQ ID 1829 NM_006640 HS septin 9 (SEPT9), tv3, mRNA. SEPT9 exonic SEQ ID 1830 NM_001113496 HS septin 9 (SEPT9), tv7, mRNA. SEPT9 exonic SEQ ID 1831 NM_001113494 HS septin 9 (SEPT9), tv6, mRNA. SEPT9 exonic SEQ ID 1832 NM_001113495 HS septin 9 (SEPT9), tv4, mRNA. KRT6C exonic SEQ ID 1833 NM_173086 HS keratin 6C (KRT6C), mRNA. BCAP29 exonic SEQ ID 1834 NM_001008405 HS B-cell receptor-associated protein 29 (BCAP29), tv1, mRNA. BCAP29 exonic SEQ ID 1835 NR_027830 HS B-cell receptor-associated protein 29 (BCAP29), tv3, non-coding RNA. BCAP29 exonic SEQ ID 1836 NM_018844 HS B-cell receptor-associated protein 29 (BCAP29), tv2, mRNA. TBCE exonic SEQ ID 1837 NM_003193 HS tubulin folding cofactor E (TBCE), tv2, mRNA. TBCE exonic SEQ ID 1838 NM_001079515 HS tubulin folding cofactor E (TBCE), tv1, mRNA. CYP51A1 exonic SEQ ID 1839 NM_000786 HS cytochrome P450, family 51, subfamily A, polypeptide 1 (CYP51A1), tv1, mRNA. CYP51A1 exonic SEQ ID 1840 NM_001146152 HS cytochrome P450, family 51, subfamily A, polypeptide 1 (CYP51A1), tv2, mRNA. SYK exonic SEQ ID 1841 NM_001135052 HS spleen tyrosine kinase (SYK), tv2, mRNA. SYK exonic SEQ ID 1842 NM_001174168 HS spleen tyrosine kinase (SYK), tv4, mRNA. SYK exonic SEQ ID 1843 NM_003177 HS spleen tyrosine kinase (SYK), tv1, mRNA. PSMB1 exonic SEQ ID 1844 NM_002793 HS proteasome (prosome, macropain) subunit, beta type, 1 (PSMB1), mRNA. CEL exonic SEQ ID 1845 NM_001807 HS carboxyl ester lipase (bile salt-stimulated lipase) (CEL), mRNA. TM4SF19 exonic SEQ ID 1846 NM_138461 HS transmembrane 4 L six family member 19 (TM4SF19), tv1, mRNA. TM4SF19 exonic SEQ ID 1847 NM_001204898 HS transmembrane 4 L six family member 19 (TM4SF19), tv3, mRNA. TM4SF19 exonic SEQ ID 1848 NM_001204897 HS transmembrane 4 L six family member 19 (TM4SF19), tv2, mRNA. CELF3 exonic SEQ ID 1849 NM_001172649 HS CUGBP, Elav-like family member 3 (CELF3), tv3, mRNA. CELF3 exonic SEQ ID 1850 NM_007185 HS CUGBP, Elav-like family member 3 (CELF3), tv1, mRNA. CELF3 exonic SEQ ID 1851 NM_001172648 HS CUGBP, Elav-like family member 3 (CELF3), tv2, mRNA. LOC148696 exonic SEQ ID 1852 NR_026817 HS uncharacterized LOC148696 (LOC148696), non-coding RNA. VPS53 exonic SEQ ID 1853 NM_018289 HS vacuolar protein sorting 53 homolog (S. cerevisiae) (VPS53), tv2, mRNA. VPS53 exonic SEQ ID 1854 NM_001128159 HS vacuolar protein sorting 53 homolog (S. cerevisiae) (VPS53), tv1, mRNA. RNF168 exonic SEQ ID 1855 NM_152617 HS ring finger protein 168, E3 ubiquitin protein ligase (RNF168), mRNA. C3orf43 exonic SEQ ID 1856 NM_001077657 HS chromosome 3 open reading frame 43 (C3orf43), mRNA. OR2T8 exonic SEQ ID 1857 NM_001005522 HS olfactory receptor, family 2, subfamily T, member 8 (OR2T8), mRNA. DMD exonic SEQ ID 1858 NM_004012 HS dystrophin (DMD), tvDp260-2, mRNA. DMD exonic SEQ ID 1859 NM_004010 HS dystrophin (DMD), tvDp427p2, mRNA. DMD exonic SEQ ID 1860 NM_004011 HS dystrophin (DMD), tvDp260-1, mRNA. DMD exonic SEQ ID 1861 NM_000109 HS dystrophin (DMD), tvDp427c, mRNA. DMD exonic SEQ ID 1862 NM_004007 HS dystrophin (DMD), tvDp427l, mRNA. DMD exonic SEQ ID 1863 NM_004006 HS dystrophin (DMD), tvDp427m, mRNA. DMD exonic SEQ ID 1864 NM_004009 HS dystrophin (DMD), tvDp427p1, mRNA. CNTNAP5 exonic SEQ ID 1865 NM_130773 HS contactin associated protein-like 5 (CNTNAP5), mRNA. OTUD5 exonic SEQ ID 1866 NM_001136157 HS OTU domain containing 5 (OTUD5), tv2, mRNA. GRIPAP1 exonic SEQ ID 1867 NM_020137 HS GRIP1 associated protein 1 (GRIPAP1), tv1, mRNA. OTUD5 exonic SEQ ID 1868 NM_001136159 HS OTU domain containing 5 (OTUD5), tv4, mRNA. KCND1 exonic SEQ ID 1869 NM_004979 HS potassium voltage-gated channel, Shal-related subfamily, member 1 (KCND1), mRNA. OTUD5 exonic SEQ ID 1870 NM_017602 HS OTU domain containing 5 (OTUD5), tv1, mRNA. OTUD5 exonic SEQ ID 1871 NM_001136158 HS OTU domain containing 5 (OTUD5), tv3, mRNA. ARHGAP15 exonic SEQ ID 1872 NM_018460 HS Rho GTPase activating protein 15 (ARHGAP15), mRNA. IFT74 exonic SEQ ID 1873 NM_001099223 HS intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), tv3, mRNA. IFT74 exonic SEQ ID 1874 NM_001099224 HS intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), tv4, mRNA. IFT74 exonic SEQ ID 1875 NM_025103 HS intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), tv1, mRNA. IFT74 exonic SEQ ID 1876 NM_001099222 HS intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), tv2, mRNA. GTPBP10 exonic SEQ ID 1877 NM_001042717 HS GTP-binding protein 10 (putative) (GTPBP10), tv1, mRNA. GTPBP10 exonic SEQ ID 1878 NM_033107 HS GTP-binding protein 10 (putative) (GTPBP10), tv2, mRNA. UGT2A2 exonic SEQ ID 1879 NM_001105677 HS UDP glucuronosyltransferase 2 family, polypeptide A2 (UGT2A2), mRNA. UGT2A1 exonic SEQ ID 1880 NM_006798 HS UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus (UGT2A1), tv1, mRNA. UGT2A1 exonic SEQ ID 1881 NM_001252274 HS UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus (UGT2A1), tv2, mRNA. UGT2A1 exonic SEQ ID 1882 NM_001252275 HS UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus (UGT2A1), tv3, mRNA. HCG9 exonic SEQ ID 1883 NR_028032 HS HLA complex group 9 (non-protein coding) (HCG9), non-coding RNA. BTN2A1 exonic SEQ ID 1884 NM_001197233 HS butyrophilin, subfamily 2, member A1 (BTN2A1), tv3, mRNA. BTN2A1 exonic SEQ ID 1885 NM_001197234 HS butyrophilin, subfamily 2, member A1 (BTN2A1), tv4, mRNA. BTN3A3 exonic SEQ ID 1886 NM_197974 HS butyrophilin, subfamily 3, member A3 (BTN3A3), tv2, mRNA. BTN2A1 exonic SEQ ID 1887 NM_007049 HS butyrophilin, subfamily 2, member A1 (BTN2A1), tv1, mRNA. BTN3A3 exonic SEQ ID 1888 NM_006994 HS butyrophilin, subfamily 3, member A3 (BTN3A3), tv1, mRNA. BTN3A3 exonic SEQ ID 1889 NM_001242803 HS butyrophilin, subfamily 3, member A3 (BTN3A3), tv3, mRNA. BTN2A1 exonic SEQ ID 1890 NM_078476 HS butyrophilin, subfamily 2, member A1 (BTN2A1), tv2, mRNA. APOL2 exonic SEQ ID 1891 NM_030882 HS apolipoprotein L, 2 (APOL2), tvalpha, mRNA. APOL2 exonic SEQ ID 1892 NM_145637 HS apolipoprotein L, 2 (APOL2), tvbeta, mRNA. TMLHE exonic SEQ ID 1893 NM_018196 HS trimethyllysine hydroxylase, epsilon (TMLHE), nuclear gene encoding mitochondrial protein, tv1, mRNA. TMLHE exonic SEQ ID 1894 NM_001184797 HS trimethyllysine hydroxylase, epsilon (TMLHE), nuclear gene encoding mitochondrial protein, tv2, mRNA. BTN2A3P exonic SEQ ID 1895 NR_027795 HS butyrophilin, subfamily 2, member A3, pseudogene (BTN2A3P), non- coding RNA. AKR1B10 exonic SEQ ID 1896 NM_020299 HS aldo-keto reductase family 1, member B10 (aldose reductase) (AKR1B10), mRNA. LEP exonic SEQ ID 1897 NM_000230 HS leptin (LEP), mRNA. RSU1P2 exonic SEQ ID 1898 NR_024472 HS Ras suppressor protein 1 pseudogene 2 (RSU1P2), non-coding RNA. MGAM exonic SEQ ID 1899 NM_004668 HS maltase-glucoamylase (alpha-glucosidase) (MGAM), mRNA. EHD3 exonic SEQ ID 1900 NM_014600 HS EH-domain containing 3 (EHD3), mRNA. CAPN14 exonic SEQ ID 1901 NM_001145122 HS calpain 14 (CAPN14), mRNA. ZNF618 exonic SEQ ID 1902 NM_133374 HS zinc finger protein 618 (ZNF618), mRNA. AMBP exonic SEQ ID 1903 NM_001633 HS alpha-1-microglobulin/bikunin precursor (AMBP), mRNA. KIF12 exonic SEQ ID 1904 NM_138424 HS kinesin family member 12 (KIF12), mRNA. DAPP1 exonic SEQ ID 1905 NM_014395 HS dual adaptor of phosphotyrosine and 3-phosphoinositides (DAPP1), mRNA. EFTUD1 exonic SEQ ID 1906 NM_024580 HS elongation factor Tu GTP binding domain containing 1 (EFTUD1), tv1, mRNA. EFTUD1 exonic SEQ ID 1907 NM_001040610 HS elongation factor Tu GTP binding domain containing 1 (EFTUD1), tv2, mRNA. FAM154B exonic SEQ ID 1908 NM_001008226 HS family with sequence similarity 154, member B (FAM154B), mRNA. CAMKMT exonic SEQ ID 1909 NM_024766 HS calmodulin-lysine N-methyltransferase (CAMKMT), mRNA. TSGA10 exonic SEQ ID 1910 NM_182911 HS testis specific, 10 (TSGA10), tv2, mRNA. TSGA10 exonic SEQ ID 1911 NM_025244 HS testis specific, 10 (TSGA10), tv1, mRNA. MITD1 exonic SEQ ID 1912 NM_138798 HS MIT, microtubule interacting and transport, domain containing 1 (MITD1), mRNA. LIPT1 exonic SEQ ID 1913 NM_145198 HS lipoyltransferase 1 (LIPT1), nuclear gene encoding mitochondrial protein, tv4, mRNA. LIPT1 exonic SEQ ID 1914 NM_145197 HS lipoyltransferase 1 (LIPT1), nuclear gene encoding mitochondrial protein, tv3, mRNA. LIPT1 exonic SEQ ID 1915 NM_145199 HS lipoyltransferase 1 (LIPT1), nuclear gene encoding mitochondrial protein, tv5, mRNA. LIPT1 exonic SEQ ID 1916 NM_001204830 HS lipoyltransferase 1 (LIPT1), nuclear gene encoding mitochondrial protein, tv6, mRNA. MRPL30 exonic SEQ ID 1917 NM_145212 HS mitochondrial ribosomal protein L30 (MRPL30), nuclear gene encoding mitochondrial protein, tv1, mRNA. LIPT1 exonic SEQ ID 1918 NM_015929 HS lipoyltransferase 1 (LIPT1), nuclear gene encoding mitochondrial protein, tv1, mRNA. C2orf15 exonic SEQ ID 1919 NM_144706 HS chromosome 2 open reading frame 15 (C2orf15), mRNA. MRPL30 exonic SEQ ID 1920 NR_028356 HS mitochondrial ribosomal protein L30 (MRPL30), tv3, non-coding RNA. LIPT1 exonic SEQ ID 1921 NR_037935 HS lipoyltransferase 1 (LIPT1), tv7, non-coding RNA. LIPT1 exonic SEQ ID 1922 NR_037936 HS lipoyltransferase 1 (LIPT1), tv2, non-coding RNA. LINC00648 exonic SEQ ID 1923 NR_039996 HS long intergenic non-protein coding RNA 648 (LINC00648), non-coding RNA. MIR548Y exonic SEQ ID 1924 NR_037503 HS microRNA 548y (MIR548Y), microRNA. FBXO42 exonic SEQ ID 1925 NM_018994 HS F-box protein 42 (FBXO42), mRNA. ANKRD33 exonic SEQ ID 1926 NM_001130015 HS ankyrin repeat domain 33 (ANKRD33), tv1, mRNA. ANKRD33 exonic SEQ ID 1927 NM_182608 HS ankyrin repeat domain 33 (ANKRD33), tv2, mRNA. NRXN3 exonic SEQ ID 1928 NM_004796 HS neurexin 3 (NRXN3), tv1, mRNA. CASP8 exonic SEQ ID 1929 NM_033355 HS caspase 8, apoptosis-related cysteine peptidase (CASP8), tvB, mRNA. CASP8 exonic SEQ ID 1930 NM_001228 HS caspase 8, apoptosis-related cysteine peptidase (CASP8), tvA, mRNA. CASP8 exonic SEQ ID 1931 NM_001080124 HS caspase 8, apoptosis-related cysteine peptidase (CASP8), tvF, mRNA. CASP8 exonic SEQ ID 1932 NM_033358 HS caspase 8, apoptosis-related cysteine peptidase (CASP8), tvE, mRNA. MIR1322 exonic SEQ ID 1933 NR_031711 HS microRNA 1322 (MIR1322), microRNA. PINX1 exonic SEQ ID 1934 NM_017884 HS PIN2/TERF1 interacting, telomerase inhibitor 1 (PINX1), mRNA. F8A3 exonic SEQ ID 1935 NM_001007524 HS coagulation factor VIII-associated 3 (F8A3), mRNA. F8A1 exonic SEQ ID 1936 NM_012151 HS coagulation factor VIII-associated 1 (F8A1), mRNA. MIR1184-2 exonic SEQ ID 1937 NR_036259 HS microRNA 1184-2 (MIR1184-2), microRNA. F8A2 exonic SEQ ID 1938 NM_001007523 HS coagulation factor VIII-associated 2 (F8A2), mRNA. H2AFB1 exonic SEQ ID 1939 NM_001017990 HS H2A histone family, member B1 (H2AFB1), mRNA. H2AFB3 exonic SEQ ID 1940 NM_080720 HS H2A histone family, member B3 (H2AFB3), mRNA. MIR1184-1 exonic SEQ ID 1941 NR_036049 HS microRNA 1184-1 (MIR1184-1), microRNA. H2AFB2 exonic SEQ ID 1942 NM_001017991 HS H2A histone family, member B2 (H2AFB2), mRNA. TMLHE-AS1 exonic SEQ ID 1943 NR_039991 HS TMLHE antisense RNA 1 (TMLHE-AS1), non-coding RNA. MIR1184-3 exonic SEQ ID 1944 NR_036260 HS microRNA 1184-3 (MIR1184-3), microRNA. SYK exonic SEQ ID 1945 NM_001174167 HS spleen tyrosine kinase (SYK), tv3, mRNA. LEPR exonic SEQ ID 1946 NM_002303 HS leptin receptor (LEPR), tv1, mRNA. LEPR exonic SEQ ID 1947 NM_001198689 HS leptin receptor (LEPR), tv6, mRNA. LEPR exonic SEQ ID 1948 NM_001198687 HS leptin receptor (LEPR), tv4, mRNA. LEPR exonic SEQ ID 1949 NM_001198688 HS leptin receptor (LEPR), tv5, mRNA. LEPR exonic SEQ ID 1950 NM_001003679 HS leptin receptor (LEPR), tv3, mRNA. LEPR exonic SEQ ID 1951 NM_001003680 HS leptin receptor (LEPR), tv2, mRNA. ASTN2 exonic SEQ ID 1952 NM_198188 HS astrotactin 2 (ASTN2), tv4, mRNA. ASTN2 exonic SEQ ID 1953 NM_001184734 HS astrotactin 2 (ASTN2), tv5, mRNA. ASTN2 exonic SEQ ID 1954 NM_001184735 HS astrotactin 2 (ASTN2), tv6, mRNA. ASTN2 exonic SEQ ID 1955 NM_014010 HS astrotactin 2 (ASTN2), tv1, mRNA. ASTN2 exonic SEQ ID 1956 NM_198186 HS astrotactin 2 (ASTN2), tv2, mRNA. ASTN2 exonic SEQ ID 1957 NM_198187 HS astrotactin 2 (ASTN2), tv3, mRNA. TRIM32 exonic SEQ ID 1958 NM_012210 HS tripartite motif containing 32 (TRIM32), tv1, mRNA. TRIM32 exonic SEQ ID 1959 NM_001099679 HS tripartite motif containing 32 (TRIM32), tv2, mRNA. LOC284801 exonic SEQ ID 1960 NR_040095 HS uncharacterized LOC284801 (LOC284801), non-coding RNA. MIR663A exonic SEQ ID 1961 NR_030386 HS microRNA 663a (MIR663A), microRNA. CDH13 exonic SEQ ID 1962 NM_001257 HS cadherin 13, H-cadherin (heart) (CDH13), tv1, mRNA. CDH13 exonic SEQ ID 1963 NM_001220490 HS cadherin 13, H-cadherin (heart) (CDH13), tv4, mRNA. CDH13 exonic SEQ ID 1964 NM_001220489 HS cadherin 13, H-cadherin (heart) (CDH13), tv3, mRNA. CDH13 exonic SEQ ID 1965 NM_001220488 HS cadherin 13, H-cadherin (heart) (CDH13), tv2, mRNA. CDH13 exonic SEQ ID 1966 NM_001220492 HS cadherin 13, H-cadherin (heart) (CDH13), tv6, mRNA. CDH13 exonic SEQ ID 1967 NM_001220491 HS cadherin 13, H-cadherin (heart) (CDH13), tv5, mRNA. ACAD10 exonic SEQ ID 1968 NM_001136538 HS acyl-CoA dehydrogenase family, member 10 (ACAD10), tv1, mRNA. ACAD10 exonic SEQ ID 1969 NM_025247 HS acyl-CoA dehydrogenase family, member 10 (ACAD10), tv2, mRNA. ALDH2 exonic SEQ ID 1970 NM_001204889 HS aldehyde dehydrogenase 2 family (mitochondrial) (ALDH2), nuclear gene encoding mitochondrial protein, tv2, mRNA. ALDH2 exonic SEQ ID 1971 NM_000690 HS aldehyde dehydrogenase 2 family (mitochondrial) (ALDH2), nuclear gene encoding mitochondrial protein, tv1, mRNA. MAPKAPK5- exonic SEQ ID 1972 NR_015404 HS MAPKAPK5 antisense RNA 1 (MAPKAPK5-AS1), non-coding RNA. AS1 MAPKAPK5 exonic SEQ ID 1973 NM_139078 HS mitogen-activated protein kinase-activated protein kinase 5 (MAPKAPK5), tv2, mRNA. MAPKAPK5 exonic SEQ ID 1974 NM_003668 HS mitogen-activated protein kinase-activated protein kinase 5 (MAPKAPK5), tv1, mRNA. OR4A5 exonic SEQ ID 1975 NM_001005272 HS olfactory receptor, family 4, subfamily A, member 5 (OR4A5), mRNA. PDCD2 exonic SEQ ID 1976 NM_001199464 HS programmed cell death 2 (PDCD2), tv6, mRNA. PDCD2 exonic SEQ ID 1977 NM_001199463 HS programmed cell death 2 (PDCD2), tv5, mRNA. PDCD2 exonic SEQ ID 1978 NM_001199462 HS programmed cell death 2 (PDCD2), tv4, mRNA. TBP exonic SEQ ID 1979 NM_001172085 HS TATA box binding protein (TBP), tv2, mRNA. TBP exonic SEQ ID 1980 NM_003194 HS TATA box binding protein (TBP), tv1, mRNA. PDCD2 exonic SEQ ID 1981 NM_002598 HS programmed cell death 2 (PDCD2), tv1, mRNA. PDCD2 exonic SEQ ID 1982 NM_001199461 HS programmed cell death 2 (PDCD2), tv3, mRNA. PDCD2 exonic SEQ ID 1983 NM_144781 HS programmed cell death 2 (PDCD2), tv2, mRNA. LOC100506060 exonic SEQ ID 1984 NR_033959 HS SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) pseudogene (LOC100506060), non-coding RNA. PDPR exonic SEQ ID 1985 NM_017990 HS pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA. CLEC18C exonic SEQ ID 1986 NM_173619 HS C-type lectin domain family 18, member C (CLEC18C), mRNA. EXOSC6 exonic SEQ ID 1987 NM_058219 HS exosome component 6 (EXOSC6), mRNA. AARS exonic SEQ ID 1988 NM_001605 HS alanyl-tRNA synthetase (AARS), mRNA. CAMSAP2 exonic SEQ ID 1989 NM_203459 HS calmodulin regulated spectrin-associated protein family, member 2 (CAMSAP2), mRNA. C1orf106 exonic SEQ ID 1990 NM_018265 HS chromosome 1 open reading frame 106 (C1orf106), tv1, mRNA. C1orf106 exonic SEQ ID 1991 NM_001142569 HS chromosome 1 open reading frame 106 (C1orf106), tv2, mRNA. GPR25 exonic SEQ ID 1992 NM_005298 HS G protein-coupled receptor 25 (GPR25), mRNA. OR2L13 exonic SEQ ID 1993 NM_175911 HS olfactory receptor, family 2, subfamily L, member 13 (OR2L13), mRNA. TRIM58 exonic SEQ ID 1994 NM_015431 HS tripartite motif containing 58 (TRIM58), mRNA. OR14A16 exonic SEQ ID 1995 NM_001001966 HS olfactory receptor, family 14, subfamily A, member 16 (OR14A16), mRNA. OR11L1 exonic SEQ ID 1996 NM_001001959 HS olfactory receptor, family 11, subfamily L, member 1 (OR11L1), mRNA. OR2W3 exonic SEQ ID 1997 NM_001001957 HS olfactory receptor, family 2, subfamily W, member 3 (OR2W3), mRNA. ZNF626 exonic SEQ ID 1998 NM_145297 HS zinc finger protein 626 (ZNF626), tv2, mRNA. ZNF626 exonic SEQ ID 1999 NM_001076675 HS zinc finger protein 626 (ZNF626), tv1, mRNA. FHIT exonic SEQ ID 2000 NM_001166243 HS fragile histidine triad (FHIT), tv2, mRNA. FHIT exonic SEQ ID 2001 NM_002012 HS fragile histidine triad (FHIT), tv1, mRNA. STEAP1 exonic SEQ ID 2002 NM_012449 HS six transmembrane epithelial antigen of the prostate 1 (STEAP1), mRNA. STEAP2 exonic SEQ ID 2003 NM_001040665 HS STEAP family member 2, metalloreductase (STEAP2), tv2, mRNA. STEAP2 exonic SEQ ID 2004 NM_152999 HS STEAP family member 2, metalloreductase (STEAP2), tv1, mRNA. STEAP2 exonic SEQ ID 2005 NM_001244946 HS STEAP family member 2, metalloreductase (STEAP2), tv6, mRNA. STEAP2 exonic SEQ ID 2006 NM_001244944 HS STEAP family member 2, metalloreductase (STEAP2), tv4, mRNA. STEAP2 exonic SEQ ID 2007 NM_001040666 HS STEAP family member 2, metalloreductase (STEAP2), tv3, mRNA. C7orf63 exonic SEQ ID 2008 NM_001039706 HS chromosome 7 open reading frame 63 (C7orf63), tv1, mRNA. C7orf63 exonic SEQ ID 2009 NM_001160138 HS chromosome 7 open reading frame 63 (C7orf63), tv2, mRNA. STEAP2 exonic SEQ ID 2010 NM_001244945 HS STEAP family member 2, metalloreductase (STEAP2), tv5, mRNA. DEFA6 exonic SEQ ID 2011 NM_001926 HS defensin, alpha 6, Paneth cell-specific (DEFA6), mRNA. DEFA10P exonic SEQ ID 2012 NR_029386 HS defensin, alpha 10 pseudogene (DEFA10P), non-coding RNA. DEFB1 exonic SEQ ID 2013 NM_005218 HS defensin, beta 1 (DEFB1), mRNA. DEFA4 exonic SEQ ID 2014 NM_001925 HS defensin, alpha 4, corticostatin (DEFA4), mRNA. DEFA3 exonic SEQ ID 2015 NM_005217 HS defensin, alpha 3, neutrophil-specific (DEFA3), mRNA. DEFA1B exonic SEQ ID 2016 NM_001042500 HS defensin, alpha 1B (DEFA1B), mRNA. DEFA1 exonic SEQ ID 2017 NM_004084 HS defensin, alpha 1 (DEFA1), mRNA. DEFT1P2 exonic SEQ ID 2018 NR_036687 HS defensin, theta 1 pseudogene 2 (DEFT1P2), non-coding RNA. DEFT1P exonic SEQ ID 2019 NR_036686 HS defensin, theta 1 pseudogene (DEFT1P), non-coding RNA. DEFA5 exonic SEQ ID 2020 NM_021010 HS defensin, alpha 5, Paneth cell-specific (DEFA5), mRNA. RALGDS exonic SEQ ID 2021 NM_001042368 HS ral guanine nucleotide dissociation stimulator (RALGDS), tv2, mRNA. ABO exonic SEQ ID 2022 NM_020469 HS ABO blood group (transferase A, alpha 1-3-N- acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) (ABO), mRNA. GTF3C5 exonic SEQ ID 2023 NM_012087 HS general transcription factor IIIC, polypeptide 5, 63 kDa (GTF3C5), tv2, mRNA. GTF3C5 exonic SEQ ID 2024 NM_001122823 HS general transcription factor IIIC, polypeptide 5, 63 kDa (GTF3C5), tv1, mRNA. RALGDS exonic SEQ ID 2025 NM_006266 HS ral guanine nucleotide dissociation stimulator (RALGDS), tv1, mRNA. CELP exonic SEQ ID 2026 NR_001275 HS carboxyl ester lipase pseudogene (CELP), non-coding RNA. GBGT1 exonic SEQ ID 2027 NM_021996 HS globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), mRNA. OBP2B exonic SEQ ID 2028 NM_014581 HS odorant binding protein 2B (OBP2B), mRNA. ZNF497 exonic SEQ ID 2029 NM_198458 HS zinc finger protein 497 (ZNF497), mRNA. ZNF8 exonic SEQ ID 2030 NM_021089 HS zinc finger protein 8 (ZNF8), mRNA. A1BG-AS1 exonic SEQ ID 2031 NR_015380 HS A1BG antisense RNA 1 (A1BG-AS1), non-coding RNA. ZSCAN22 exonic SEQ ID 2032 NM_181846 HS zinc finger and SCAN domain containing 22 (ZSCAN22), mRNA. A1BG exonic SEQ ID 2033 NM_130786 HS alpha-1-B glycoprotein (A1BG), mRNA. ZNF497 exonic SEQ ID 2034 NM_001207009 HS zinc finger protein 497 (ZNF497), tv2, mRNA. ZNF837 exonic SEQ ID 2035 NM_138466 HS zinc finger protein 837 (ZNF837), tv2, mRNA. ZNF132 exonic SEQ ID 2036 NM_003433 HS zinc finger protein 132 (ZNF132), mRNA. ZNF324 exonic SEQ ID 2037 NM_014347 HS zinc finger protein 324 (ZNF324), mRNA. MIR4754 exonic SEQ ID 2038 NR_039910 HS microRNA 4754 (MIR4754), microRNA. ZNF446 exonic SEQ ID 2039 NM_017908 HS zinc finger protein 446 (ZNF446), mRNA. LOC646862 exonic SEQ ID 2040 NM_001195135 HS uncharacterized LOC646862 (LOC646862), mRNA. RPS5 exonic SEQ ID 2041 NM_001009 HS ribosomal protein S5 (RPS5), mRNA. ZNF584 exonic SEQ ID 2042 NM_173548 HS zinc finger protein 584 (ZNF584), mRNA. ZNF837 exonic SEQ ID 2043 NR_049780 HS zinc finger protein 837 (ZNF837), tv1, non-coding RNA. SLC27A5 exonic SEQ ID 2044 NM_012254 HS solute carrier family 27 (fatty acid transporter), member 5 (SLC27A5), mRNA. ANKRD17 exonic SEQ ID 2045 NM_198889 HS ankyrin repeat domain 17 (ANKRD17), tv2, mRNA. ANKRD17 exonic SEQ ID 2046 NM_032217 HS ankyrin repeat domain 17 (ANKRD17), tv1, mRNA. COX18 exonic SEQ ID 2047 NM_173827 HS cytochrome c oxidase assembly homolog 18 (yeast) (COX18), nuclear gene encoding mitochondrial protein, mRNA. C5orf42 exonic SEQ ID 2048 NM_023073 HS chromosome 5 open reading frame 42 (C5orf42), mRNA. GLOD4 exonic SEQ ID 2049 NM_016080 HS glyoxalase domain containing 4 (GLOD4), mRNA. FAM57A exonic SEQ ID 2050 NM_024792 HS family with sequence similarity 57, member A (FAM57A), mRNA. GEMIN4 exonic SEQ ID 2051 NM_015721 HS gem (nuclear organelle) associated protein 4 (GEMIN4), mRNA. DBIL5P exonic SEQ ID 2052 NR_024120 HS diazepam binding inhibitor-like 5, pseudogene (DBIL5P), non-coding RNA. NFIA exonic SEQ ID 2053 NM_001145512 HS nuclear factor I/A (NFIA), tv4, mRNA. NFIA exonic SEQ ID 2054 NM_001145511 HS nuclear factor I/A (NFIA), tv3, mRNA. NFIA exonic SEQ ID 2055 NM_001134673 HS nuclear factor I/A (NFIA), tv1, mRNA. NFIA exonic SEQ ID 2056 NM_005595 HS nuclear factor I/A (NFIA), tv2, mRNA. GGPS1 exonic SEQ ID 2057 NM_001037277 HS geranylgeranyl diphosphate synthase 1 (GGPS1), tv2, mRNA. ARID4B exonic SEQ ID 2058 NM_016374 HS AT rich interactive domain 4B (RBP1-like) (ARID4B), tv1, mRNA. ARID4B exonic SEQ ID 2059 NM_001206794 HS AT rich interactive domain 4B (RBP1-like) (ARID4B), tv3, mRNA. GGPS1 exonic SEQ ID 2060 NR_036605 HS geranylgeranyl diphosphate synthase 1 (GGPS1), tv3, non-coding RNA. B3GALNT2 exonic SEQ ID 2061 NM_152490 HS beta-1,3-N-acetylgalactosaminyltransferase 2 (B3GALNT2), mRNA. ARID4B exonic SEQ ID 2062 NM_031371 HS AT rich interactive domain 4B (RBP1-like) (ARID4B), tv2, mRNA. NRXN3 exonic SEQ ID 2063 NM_001105250 HS neurexin 3 (NRXN3), tv3, mRNA. NRXN3 exonic SEQ ID 2064 NM_138970 HS neurexin 3 (NRXN3), tv2, mRNA. C6orf118 exonic SEQ ID 2065 NM_144980 HS chromosome 6 open reading frame 118 (C6orf118), mRNA. AGPAT5 exonic SEQ ID 2066 NM_018361 HS 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) (AGPAT5), mRNA. LOC100652791 exonic SEQ ID 2067 NR_045217 HS uncharacterized LOC100652791 (LOC100652791), non-coding RNA. XKR5 exonic SEQ ID 2068 NM_207411 HS XK, Kell blood group complex subunit-related family, member 5 (XKR5), mRNA. MIR4659B exonic SEQ ID 2069 NR_039807 HS microRNA 4659b (MIR4659B), microRNA. MIR4659A exonic SEQ ID 2070 NR_039803 HS microRNA 4659a (MIR4659A), microRNA. SORBS2 exonic SEQ ID 2071 NM_021069 HS sorbin and SH3 domain containing 2 (SORBS2), tv2, mRNA. SORBS2 exonic SEQ ID 2072 NM_003603 HS sorbin and SH3 domain containing 2 (SORBS2), tv1, mRNA. SORBS2 exonic SEQ ID 2073 NM_001145672 HS sorbin and SH3 domain containing 2 (SORBS2), tv5, mRNA. SORBS2 exonic SEQ ID 2074 NM_001145671 HS sorbin and SH3 domain containing 2 (SORBS2), tv4, mRNA. SORBS2 exonic SEQ ID 2075 NM_001145670 HS sorbin and SH3 domain containing 2 (SORBS2), tv3, mRNA. SORBS2 exonic SEQ ID 2076 NM_001270771 HS sorbin and SH3 domain containing 2 (SORBS2), tv9, mRNA. SORBS2 exonic SEQ ID 2077 NM_001145675 HS sorbin and SH3 domain containing 2 (SORBS2), tv8, mRNA. SORBS2 exonic SEQ ID 2078 NM_001145674 HS sorbin and SH3 domain containing 2 (SORBS2), tv7, mRNA. SORBS2 exonic SEQ ID 2079 NM_001145673 HS sorbin and SH3 domain containing 2 (SORBS2), tv6, mRNA. CHL1 exonic SEQ ID 2080 NM_006614 HS cell adhesion molecule with homology to L1CAM (close homolog of L1) (CHL1), tv1, mRNA. CHL1 exonic SEQ ID 2081 NR_045572 HS cell adhesion molecule with homology to L1CAM (close homolog of L1) (CHL1), tv4, non-coding RNA. CHL1 exonic SEQ ID 2082 NM_001253388 HS cell adhesion molecule with homology to L1CAM (close homolog of L1) (CHL1), tv3, mRNA. CHL1 exonic SEQ ID 2083 NM_001253387 HS cell adhesion molecule with homology to L1CAM (close homolog of L1) (CHL1), tv2, mRNA. PSG6 exonic SEQ ID 2084 NM_002782 HS pregnancy specific beta-1-glycoprotein 6 (PSG6), tv1, mRNA. PSG6 exonic SEQ ID 2085 NM_001031850 HS pregnancy specific beta-1-glycoprotein 6 (PSG6), tv2, mRNA. PSG8 exonic SEQ ID 2086 NM_001130168 HS pregnancy specific beta-1-glycoprotein 8 (PSG8), tv3, mRNA. PSG8 exonic SEQ ID 2087 NM_001130167 HS pregnancy specific beta-1-glycoprotein 8 (PSG8), tv2, mRNA. PSG8 exonic SEQ ID 2088 NM_182707 HS pregnancy specific beta-1-glycoprotein 8 (PSG8), tv1, mRNA. PSG3 exonic SEQ ID 2089 NM_021016 HS pregnancy specific beta-1-glycoprotein 3 (PSG3), mRNA. PSG10P exonic SEQ ID 2090 NR_026824 HS pregnancy specific beta-1-glycoprotein 10, pseudogene (PSG10P), non- coding RNA. PSG1 exonic SEQ ID 2091 NM_006905 HS pregnancy specific beta-1-glycoprotein 1 (PSG1), tv1, mRNA. PSG1 exonic SEQ ID 2092 NM_001184826 HS pregnancy specific beta-1-glycoprotein 1 (PSG1), tv3, mRNA. LOC100289650 exonic SEQ ID 2093 NR_036584 HS uncharacterized LOC100289650 (LOC100289650), non-coding RNA. PSG1 exonic SEQ ID 2094 NM_001184825 HS pregnancy specific beta-1-glycoprotein 1 (PSG1), tv2, mRNA. PSG11 exonic SEQ ID 2095 NM_001113410 HS pregnancy specific beta-1-glycoprotein 11 (PSG11), tv3, mRNA. PSG7 exonic SEQ ID 2096 NM_002783 HS pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), tv1, mRNA. PSG11 exonic SEQ ID 2097 NM_002785 HS pregnancy specific beta-1-glycoprotein 11 (PSG11), tv1, mRNA. PSG11 exonic SEQ ID 2098 NM_203287 HS pregnancy specific beta-1-glycoprotein 11 (PSG11), tv2, mRNA. PSG7 exonic SEQ ID 2099 NM_001206650 HS pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), tv2, mRNA. PSG7 exonic SEQ ID 2100 NR_073194 HS pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene) (PSG7), tv1, non-coding, non-coding RNA. PSG2 exonic SEQ ID 2101 NM_031246 HS pregnancy specific beta-1-glycoprotein 2 (PSG2), mRNA. DNAH5 exonic SEQ ID 2102 NM_001369 HS dynein, axonemal, heavy chain 5 (DNAH5), mRNA. DCPS exonic SEQ ID 2103 NM_014026 HS decapping enzyme, scavenger (DCPS), mRNA. TIRAP exonic SEQ ID 2104 NM_148910 HS toll-interleukin 1 receptor (TIR) domain containing adaptor protein (TIRAP), tv2, mRNA. FOXRED1 exonic SEQ ID 2105 NM_017547 HS FAD-dependent oxidoreductase domain containing 1 (FOXRED1), nuclear gene encoding mitochondrial protein, tv1, mRNA. FOXRED1 exonic SEQ ID 2106 NR_037648 HS FAD-dependent oxidoreductase domain containing 1 (FOXRED1), tv2, non-coding RNA. FOXRED1 exonic SEQ ID 2107 NR_037647 HS FAD-dependent oxidoreductase domain containing 1 (FOXRED1), tv3, non-coding RNA. FAM118B exonic SEQ ID 2108 NM_024556 HS family with sequence similarity 118, member B (FAM118B), mRNA. TIRAP exonic SEQ ID 2109 NM_001039661 HS toll-interleukin 1 receptor (TIR) domain containing adaptor protein (TIRAP), tv3, mRNA. SRPR exonic SEQ ID 2110 NM_003139 HS signal recognition particle receptor (docking protein) (SRPR), tv1, mRNA. SRPR exonic SEQ ID 2111 NM_001177842 HS signal recognition particle receptor (docking protein) (SRPR), tv2, mRNA. ST3GAL4 exonic SEQ ID 2112 NM_001254758 HS ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), tv3, mRNA. ST3GAL4 exonic SEQ ID 2113 NM_001254757 HS ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), tv2, mRNA. FLJ39051 exonic SEQ ID 2114 NR_033839 HS uncharacterized LOC399972 (FLJ39051), non-coding RNA. ST3GAL4 exonic SEQ ID 2115 NM_006278 HS ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), tv1, mRNA. ST3GAL4 exonic SEQ ID 2116 NM_001254759 HS ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), tv4, mRNA. AKAP9 exonic SEQ ID 2117 NM_147185 HS A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), tv3, mRNA. LRRD1 exonic SEQ ID 2118 NM_001161528 HS leucine-rich repeats and death domain containing 1 (LRRD1), mRNA. AKAP9 exonic SEQ ID 2119 NM_005751 HS A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), tv2, mRNA. MTERF exonic SEQ ID 2120 NM_006980 HS mitochondrial transcription termination factor (MTERF), nuclear gene encoding mitochondrial protein, mRNA. ZFAND4 exonic SEQ ID 2121 NM_001128324 HS zinc finger, AN1-type domain 4 (ZFAND4), tv2, mRNA. ZFAND4 exonic SEQ ID 2122 NM_174890 HS zinc finger, AN1-type domain 4 (ZFAND4), tv1, mRNA. ALOX5 exonic SEQ ID 2123 NM_000698 HS arachidonate 5-lipoxygenase (ALOX5), tv1, mRNA. MARCH8 exonic SEQ ID 2124 NM_145021 HS membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), tv2, mRNA. ALOX5 exonic SEQ ID 2125 NM_001256154 HS arachidonate 5-lipoxygenase (ALOX5), tv3, mRNA. ALOX5 exonic SEQ ID 2126 NM_001256153 HS arachidonate 5-lipoxygenase (ALOX5), tv2, mRNA. MARCH8 exonic SEQ ID 2127 NM_001002265 HS membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), tv1, mRNA. ANKRD30BP3 ncRNA SEQ ID 2128 NR_033891 HS ankyrin repeat domain 30B pseudogene 3 (ANKRD30BP3), non-coding RNA. MIR3156-1 exonic SEQ ID 2129 NR_036112 HS microRNA 3156-1 (MIR3156-1), microRNA. OR13A1 exonic SEQ ID 2130 NM_001004297 HS olfactory receptor, family 13, subfamily A, member 1 (OR13A1), mRNA. MARCH8 exonic SEQ ID 2131 NM_001002266 HS membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase (MARCH8), tv3, mRNA. FBXO45 exonic SEQ ID 2132 NM_001105573 HS F-box protein 45 (FBXO45), mRNA. CEP19 exonic SEQ ID 2133 NM_032898 HS centrosomal protein 19 kDa (CEP19), mRNA. UBXN7 exonic SEQ ID 2134 NM_015562 HS UBX domain protein 7 (UBXN7), mRNA. WDR53 exonic SEQ ID 2135 NM_182627 HS WD repeat domain 53 (WDR53), mRNA. PAK2 exonic SEQ ID 2136 NM_002577 HS p21 protein (Cdc42/Rac)-activated kinase 2 (PAK2), mRNA. PIGX exonic SEQ ID 2137 NM_017861 HS phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), tv2, mRNA. PIGX exonic SEQ ID 2138 NM_001166304 HS phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), tv1, mRNA. ZFP42 exonic SEQ ID 2139 NM_174900 HS ZFP42 zinc finger protein (ZFP42), mRNA. TRIML2 exonic SEQ ID 2140 NM_173553 HS tripartite motif family-like 2 (TRIML2), mRNA. AFF3 exonic SEQ ID 2141 NM_002285 HS AF4/FMR2 family, member 3 (AFF3), tv1, mRNA. AFF3 exonic SEQ ID 2142 NM_001025108 HS AF4/FMR2 family, member 3 (AFF3), tv2, mRNA. EIF5B exonic SEQ ID 2143 NM_015904 HS eukaryotic translation initiation factor 5B (EIF5B), mRNA. LYG2 exonic SEQ ID 2144 NM_175735 HS lysozyme G-like 2 (LYG2), mRNA. TXNDC9 exonic SEQ ID 2145 NM_005783 HS thioredoxin domain containing 9 (TXNDC9), mRNA. LYG1 exonic SEQ ID 2146 NM_174898 HS lysozyme G-like 1 (LYG1), mRNA. REV1 exonic SEQ ID 2147 NM_016316 HS REV1, polymerase (DNA directed) (REV1), tv1, mRNA. REV1 exonic SEQ ID 2148 NM_001037872 HS REV1, polymerase (DNA directed) (REV1), tv2, mRNA. UPP1 exonic SEQ ID 2149 NM_003364 HS uridine phosphorylase 1 (UPP1), tv1, mRNA. PKD1L1 exonic SEQ ID 2150 NM_138295 HS polycystic kidney disease 1 like 1 (PKD1L1), mRNA. HUS1 exonic SEQ ID 2151 NR_037917 HS HUS1 checkpoint homolog (S. pombe) (HUS1), tv2, non-coding RNA. UPP1 exonic SEQ ID 2152 NM_181597 HS uridine phosphorylase 1 (UPP1), tv2, mRNA. HUS1 exonic SEQ ID 2153 NM_004507 HS HUS1 checkpoint homolog (S. pombe) (HUS1), tv1, mRNA. C7orf57 exonic SEQ ID 2154 NM_001100159 HS chromosome 7 open reading frame 57 (C7orf57), tv1, mRNA. C7orf57 exonic SEQ ID 2155 NM_001267866 HS chromosome 7 open reading frame 57 (C7orf57), tv3, mRNA. C7orf57 exonic SEQ ID 2156 NM_001267865 HS chromosome 7 open reading frame 57 (C7orf57), tv2, mRNA. SUN3 exonic SEQ ID 2157 NM_001030019 HS Sad1 and UNC84 domain containing 3 (SUN3), tv1, mRNA. SUN3 exonic SEQ ID 2158 NM_152782 HS Sad1 and UNC84 domain containing 3 (SUN3), tv2, mRNA. CDC14C exonic SEQ ID 2159 NR_003595 HS cell division cycle 14C (CDC14C), non-coding RNA. PTPN20B exonic SEQ ID 2160 NM_015605 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv2, mRNA. PTPN20B exonic SEQ ID 2161 NM_001042357 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv1, mRNA. PTPN20A exonic SEQ ID 2162 NM_001042395 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv8, mRNA. PTPN20B exonic SEQ ID 2163 NM_001042361 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv6, mRNA. PTPN20A exonic SEQ ID 2164 NM_0010423 89 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv1, mRNA. PTPN20A exonic SEQ ID 2165 NM_001042393 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv6, mRNA. PTPN20B exonic SEQ ID 2166 NM_001042362 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv7, mRNA. PTPN20A exonic SEQ ID 2167 NM_001042396 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv9, mRNA. PTPN20B exonic SEQ ID 2168 NM_001042365 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv10, mRNA. PTPN20B exonic SEQ ID 2169 NM_001042358 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv3, mRNA. PTPN20A exonic SEQ ID 2170 NM_0010423 87 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv2, mRNA. PTPN20B exonic SEQ ID 2171 NM_001042360 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv5, mRNA. PTPN20A exonic SEQ ID 2172 NM_001042391 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv4, mRNA. PTPN20A exonic SEQ ID 2173 NM_001042390 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv3, mRNA. PTPN20A exonic SEQ ID 2174 NM001042394 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv7, mRNA. PTPN20A exonic SEQ ID 2175 NM001042397 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv10, mRNA. PTPN20B exonic SEQ ID 2176 NM001042359 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv4, mRNA. PTPN20A exonic SEQ ID 2177 NM001042392 HS protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), tv5, mRNA. PTPN20B exonic SEQ ID 2178 NM001042363 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv8, mRNA. PTPN20B exonic SEQ ID 2179 NM001042364 HS protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), tv9, mRNA. LINC00842 ncRNA SEQ ID 2180 NR_033957 HS long intergenic non-protein coding RNA 842 (LINC00842), non-coding RNA. FAM21C exonic SEQ ID 2181 NM_001169106 HS family with sequence similarity 21, member C (FAM21C), tv2, mRNA. FAM21C exonic SEQ ID 2182 NM_001169107 HS family with sequence similarity 21, member C (FAM21C), tv3, mRNA. FAM21C exonic SEQ ID 2183 NM_015262 HS family with sequence similarity 21, member C (FAM21C), tv1, mRNA. AGAP4 exonic SEQ ID 2184 NM_133446 HS ArfGAP with GTPase domain, ankyrin repeat and PH domain 4 (AGAP4), mRNA. FRMPD2P1 exonic SEQ ID 2185 NR_033172 HS FERM and PDZ domain containing 2 pseudogene 1 (FRMPD2P1), non- coding RNA. BMS1P1 exonic SEQ ID 2186 NR_026566 HS BMS1 pseudogene 1 (BMS1P1), non-coding RNA. BMS1P5 exonic SEQ ID 2187 NR_003611 HS BMS1 pseudogene 5 (BMS1P5), non-coding RNA. GLUD1P7 exonic SEQ ID 2188 NR_048574 HS glutamate dehydrogenase 1 pseudogene 7 (GLUD1P7), non-coding RNA. SYT15 exonic SEQ ID 2189 NM_031912 HS synaptotagmin XV (SYT15), tva, mRNA. FAM35BP ncRNA SEQ ID 2190 NR_027632 HS family with sequence similarity 35, member B, pseudogene (FAM35BP), non-coding RNA. SYT15 exonic SEQ ID 2191 NM_181519 HS synaptotagmin XV (SYT15), tvb, mRNA. GPRIN2 exonic SEQ ID 2192 NM_014696 HS G protein regulated inducer of neurite outgrowth 2 (GPRIN2), mRNA. PPYR1 exonic SEQ ID 2193 NM_005972 HS pancreatic polypeptide receptor 1 (PPYR1), mRNA. HNRNPA1P33 ncRNA SEQ ID 2194 NR_003277 HS heterogeneous nuclear ribonucleoprotein A1 pseudogene 33 (HNRNPA1P33), non-coding RNA. DPYD-AS1 exonic SEQ ID 2195 NR_046590 HS DPYD antisense RNA 1 (DPYD-AS1), non-coding RNA. DPYD exonic SEQ ID 2196 NM_001160301 HS dihydropyrimidine dehydrogenase (DPYD), tv2, mRNA. MIR2682 exonic SEQ ID 2197 NR_039604 HS microRNA 2682 (MIR2682), microRNA. MIR137 exonic SEQ ID 2198 NR_029679 HS microRNA 137 (MIR137), microRNA. MIR137HG exonic SEQ ID 2199 NR_046105 HS MIR137 host gene (non-protein coding) (MIR137HG), non-coding RNA. CNTN6 exonic SEQ ID 2200 NM_014461 HS contactin 6 (CNTN6), mRNA. FAM189A1 exonic SEQ ID 2201 NM_015307 HS family with sequence similarity 189, member A1 (FAM189A1), mRNA. APBA2 exonic SEQ ID 2202 NM_001130414 HS amyloid beta (A4) precursor protein-binding, family A, member 2 (APBA2), tv2, mRNA. APBA2 exonic SEQ ID 2203 NM_005503 HS amyloid beta (A4) precursor protein-binding, family A, member 2 (APBA2), tv1, mRNA. LOC646278 exonic SEQ ID 2204 NR_037599 HS programmed cell death 6 interacting protein pseudogene (LOC646278), non-coding RNA. TJP1 exonic SEQ ID 2205 NM_175610 HS tight junction protein 1 (TJP1), tv2, mRNA. TJP1 exonic SEQ ID 2206 NM_003257 HS tight junction protein 1 (TJP1), tv1, mRNA. LOC100289656 exonic SEQ ID 2207 NR_036475 HS Dexi homolog (mouse) pseudogene (LOC100289656), non-coding RNA. GOLGA6L7P exonic SEQ ID 2208 NR_047567 HS golgin A6 family-like 7, pseudogene (GOLGA6L7P), non-coding RNA. NDNL2 exonic SEQ ID 2209 NM_138704 HS necdin-like 2 (NDNL2), mRNA. MPHOSPH6 exonic SEQ ID 2210 NM_005792 HS M-phase phosphoprotein 6 (MPHOSPH6), mRNA. MIR3182 exonic SEQ ID 2211 NR_036147 HS microRNA 3182 (MIR3182), microRNA. BMS1P6 exonic SEQ ID 2212 NR_024495 HS BMS1 pseudogene 6 (BMS1P6), non-coding RNA. BMS1P2 exonic SEQ ID 2213 NR_072978 HS BMS1 pseudogene 2 (BMS1P2), non-coding RNA. FAM25C exonic SEQ ID 2214 NM_001137548 HS family with sequence similarity 25, member C (FAM25C), mRNA. AGAP9 exonic SEQ ID 2215 NM_001190810 HS ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 (AGAP9), mRNA. FAM25G exonic SEQ ID 2216 NM_001137549 HS family with sequence similarity 25, member G (FAM25G), mRNA. FAM25B exonic SEQ ID 2217 NM_001137556 HS family with sequence similarity 25, member B (FAM25B), mRNA. ANXA8 exonic SEQ ID 2218 NM_001040084 HS annexin A8 (ANXA8), tv2, mRNA. ANXA8L1 exonic SEQ ID 2219 NM_001098845 HS annexin A8-like 1 (ANXA8L1), mRNA. FAM35DP ncRNA SEQ ID 2220 NR_027634 HS family with sequence similarity 35, member D, pseudogene (FAM35DP), non-coding RNA. DKFZP434L187 exonic SEQ ID 2221 NR_026771 HS uncharacterized LOC26082 (DKFZP434L187), non-coding RNA. ULK4P3 exonic SEQ ID 2222 NR_026859 HS unc-51-like kinase 4 (C. elegans) pseudogene 3 (ULK4P3), non-coding RNA. ULK4P1 exonic SEQ ID 2223 NR_026858 HS unc-51-like kinase 4 (C. elegans) pseudogene 1 (ULK4P1), non-coding RNA. ULK4P2 exonic SEQ ID 2224 NR_027470 HS unc-51-like kinase 4 (C. elegans) pseudogene 2 (ULK4P2), non-coding RNA. GOLGA8T exonic SEQ ID 2225 NR_033933 HS golgin A8 family, member T (GOLGA8T), non-coding RNA. EFCAB2 exonic SEQ ID 2226 NR_026588 HS EF-hand calcium binding domain 2 (EFCAB2), tv5, non-coding RNA. EFCAB2 exonic SEQ ID 2227 NM_032328 HS EF-hand calcium binding domain 2 (EFCAB2), tv1, mRNA. EFCAB2 exonic SEQ ID 2228 NM_001143943 HS EF-hand calcium binding domain 2 (EFCAB2), tv2, mRNA. EFCAB2 exonic SEQ ID 2229 NR_026587 HS EF-hand calcium binding domain 2 (EFCAB2), tv4, non-coding RNA. EFCAB2 exonic SEQ ID 2230 NR_026586 HS EF-hand calcium binding domain 2 (EFCAB2), tv3, non-coding RNA. SMYD3 exonic SEQ ID 2231 NM_022743 HS SET and MYND domain containing 3 (SMYD3), tv2, mRNA. SMYD3 exonic SEQ ID 2232 NM_001167740 HS SET and MYND domain containing 3 (SMYD3), tv1, mRNA. CNST exonic SEQ ID 2233 NM_001139459 HS consortin, connexin sorting protein (CNST), tv2, mRNA. CNST exonic SEQ ID 2234 NM_152609 HS consortin, connexin sorting protein (CNST), tv1, mRNA. HNRNPU-AS1 exonic SEQ ID 2235 NR_026778 HS HNRNPU antisense RNA 1 (HNRNPU-AS1), non-coding RNA. HNRNPU exonic SEQ ID 2236 NM_031844 HS heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) (HNRNPU), tv1, mRNA. HNRNPU exonic SEQ ID 2237 NM_004501 HS heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A) (HNRNPU), tv2, mRNA. COX20 exonic SEQ ID 2238 NM_198076 HS COX20 Cox2 chaperone homolog (S. cerevisiae) (COX20), mRNA. TFB2M exonic SEQ ID 2239 NM_022366 HS transcription factor B2, mitochondrial (TFB2M), nuclear gene encoding mitochondrial protein, mRNA. LOC255654 exonic SEQ ID 2240 NR_040002 HS uncharacterized LOC255654 (LOC255654), non-coding RNA. LOC339975 exonic SEQ ID 2241 NR_038931 HS uncharacterized LOC339975 (LOC339975), non-coding RNA. LOC401164 exonic SEQ ID 2242 NR_033869 HS uncharacterized LOC401164 (LOC401164), non-coding RNA. TRIML1 exonic SEQ ID 2243 NM_178556 HS tripartite motif family-like 1 (TRIML1), mRNA. FRG1B exonic SEQ ID 2244 NR_003579 HS FSHD region gene 1 family, member B (FRG1B), non-coding RNA. MLLT10P1 exonic SEQ ID 2245 NR_045115 HS myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 pseudogene 1 (MLLT10P1), non-coding RNA. OR4C46 exonic SEQ ID 2246 NM_001004703 HS olfactory receptor, family 4, subfamily C, member 46 (OR4C46), mRNA. GAGE2A exonic SEQ ID 2247 NM_001127212 HS G antigen 2A (GAGE2A), mRNA. PPP1R3F exonic SEQ ID 2248 NM_001184745 HS protein phosphatase 1, regulatory subunit 3F (PPP1R3F), tv2, mRNA. GAGE2E exonic SEQ ID 2249 NM_001127200 HS G antigen 2E (GAGE2E), mRNA. GAGE8 exonic SEQ ID 2250 NM_012196 HS G antigen 8 (GAGE8), mRNA. GAGE2C exonic SEQ ID 2251 NM_001472 HS G antigen 2C (GAGE2C), mRNA. PPP1R3F exonic SEQ ID 2252 NM_033215 HS protein phosphatase 1, regulatory subunit 3F (PPP1R3F), tv1, mRNA. CLCN5 exonic SEQ ID 2253 NM_001127899 HS chloride channel, voltage-sensitive 5 (CLCN5), tv1, mRNA. CLCN5 exonic SEQ ID 2254 NM_001127898 HS chloride channel, voltage-sensitive 5 (CLCN5), tv2, mRNA. CCNB3 exonic SEQ ID 2255 NM_033670 HS cyclin B3 (CCNB3), tv1, mRNA. CCNB3 exonic SEQ ID 2256 NM_033031 HS cyclin B3 (CCNB3), tv3, mRNA. DGKK exonic SEQ ID 2257 NM_001013742 HS diacylglycerol kinase, kappa (DGKK), mRNA. SHROOM4 exonic SEQ ID 2258 NM_020717 HS shroom family member 4 (SHROOM4), tv1, mRNA. SHROOM4 exonic SEQ ID 2259 NR_027121 HS shroom family member 4 (SHROOM4), tv2, non-coding RNA. MAGED1 exonic SEQ ID 2260 NM_001005332 HS melanoma antigen family D, 1 (MAGED1), tv3, mRNA. XAGE1E exonic SEQ ID 2261 NR_033257 HS X antigen family, member 1E (XAGE1E), tvc, non-coding RNA. XAGE1D exonic SEQ ID 2262 NR_033256 HS X antigen family, member 1D (XAGE1D), tvc, non-coding RNA. XAGE1B exonic SEQ ID 2263 NR_033254 HS X antigen family, member 1B (XAGE1B), tvc, non-coding RNA. XAGE1B exonic SEQ ID 2264 NM_001097594 HS X antigen family, member 1B (XAGE1B), tva, mRNA. XAGE1A exonic SEQ ID 2265 NM_001097593 HS X antigen family, member 1A (XAGE1A), tvd, mRNA. XAGE1B exonic SEQ ID 2266 NM_001097596 HS X antigen family, member 1B (XAGE1B), tvd, mRNA. XAGE1D exonic SEQ ID 2267 NM_133430 HS X antigen family, member 1D (XAGE1D), tvd, mRNA. XAGE1C exonic SEQ ID 2268 NM_001097597 HS X antigen family, member 1C (XAGE1C), tva, mRNA. XAGE1E exonic SEQ ID 2269 NM_001097604 HS X antigen family, member 1E (XAGE1E), tva, mRNA. XAGE1C exonic SEQ ID 2270 NR_033251 HS X antigen family, member 1C (XAGE1C), tvc, non-coding RNA. XAGE1E exonic SEQ ID 2271 NM_001097605 HS X antigen family, member 1E (XAGE1E), tvd, mRNA. XAGE1D exonic SEQ ID 2272 NM_020411 HS X antigen family, member 1D (XAGE1D), tva, mRNA. XAGE1A exonic SEQ ID 2273 NR_033253 HS X antigen family, member 1A (XAGE1A), tvc, non-coding RNA. XAGE1C exonic SEQ ID 2274 NM_001097598 HS X antigen family, member 1C (XAGE1C), tvd, mRNA. SSX7 exonic SEQ ID 2275 NM_173358 HS synovial sarcoma, X breakpoint 7 (SSX7), mRNA. XAGE1A exonic SEQ ID 2276 NM_001097592 HS X antigen family, member 1A (XAGE1A), tva, mRNA. FTSJ1 exonic SEQ ID 2277 NM_177439 HS FtsJ RNA methyltransferase homolog 1 (E. coli) (FTSJ1), tv3, mRNA. FTSJ1 exonic SEQ ID 2278 NM_177434 HS FtsJ RNA methyltransferase homolog 1 (E. coli) (FTSJ1), tv2, mRNA. FTSJ1 exonic SEQ ID 2279 NM_012280 HS FtsJ RNA methyltransferase homolog 1 (E. coli) (FTSJ1), tv1, mRNA. SLC38A5 exonic SEQ ID 2280 NM_033518 HS solute carrier family 38, member 5 (SLC38A5), mRNA. RBM3 exonic SEQ ID 2281 NM_006743 HS RNA binding motif (RNP1, RRM) protein 3 (RBM3), mRNA. WDR13 exonic SEQ ID 2282 NM_001166426 HS WD repeat domain 13 (WDR13), tv2, mRNA. WDR13 exonic SEQ ID 2283 NM_017883 HS WD repeat domain 13 (WDR13), tv1, mRNA. EBP exonic SEQ ID 2284 NM_006579 HS emopamil binding protein (sterol isomerase) (EBP), mRNA. TBC1D25 exonic SEQ ID 2285 NM_002536 HS TBC1 domain family, member 25 (TBC1D25), mRNA. PORCN exonic SEQ ID 2286 NM_022825 HS porcupine homolog (Drosophila) (PORCN), tvA, mRNA. WDR13 exonic SEQ ID 2287 NR_029427 HS WD repeat domain 13 (WDR13), tv3, non-coding RNA. PORCN exonic SEQ ID 2288 NM_203475 HS porcupine homolog (Drosophila) (PORCN), tvD, mRNA. PORCN exonic SEQ ID 2289 NM_203474 HS porcupine homolog (Drosophila) (PORCN), tvC, mRNA. PORCN exonic SEQ ID 2290 NM_203473 HS porcupine homolog (Drosophila) (PORCN), tvB, mRNA. SUV39H1 exonic SEQ ID 2291 NM_003173 HS suppressor of variegation 3-9 homolog 1 (Drosophila) (SUV39H1), mRNA. WAS exonic SEQ ID 2292 NM_000377 HS Wiskott-Aldrich syndrome (WAS), mRNA. GATA1 exonic SEQ ID 2293 NM_002049 HS GATA binding protein 1 (globin transcription factor 1) (GATA1), mRNA. GLOD5 exonic SEQ ID 2294 NM_001080489 HS glyoxalase domain containing 5 (GLOD5), mRNA. PCSK1N exonic SEQ ID 2295 NM_013271 HS proprotein convertase subtilisin/kexin type 1 inhibitor (PCSK1N), mRNA. HDAC6 exonic SEQ ID 2296 NM_006044 HS histone deacetylase 6 (HDAC6), mRNA. ERAS exonic SEQ ID 2297 NM_181532 HS ES cell expressed Ras (ERAS), mRNA. PQBP1 exonic SEQ ID 2298 NM_005710 HS polyglutamine binding protein 1 (PQBP1), tv1, mRNA. PQBP1 exonic SEQ ID 2299 NM_001032384 HS polyglutamine binding protein 1 (PQBP1), tv5, mRNA. PQBP1 exonic SEQ ID 2300 NM_001032383 HS polyglutamine binding protein 1 (PQBP1), tv4, mRNA. SLC35A2 exonic SEQ ID 2301 NM_001042498 HS solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), tv3, mRNA. PQBP1 exonic SEQ ID 2302 NM_144495 HS polyglutamine binding protein 1 (PQBP1), tv7, mRNA. PIM2 exonic SEQ ID 2303 NM_006875 HS pim-2 oncogene (PIM2), mRNA. PQBP1 exonic SEQ ID 2304 NM_001032382 HS polyglutamine binding protein 1 (PQBP1), tv3, mRNA. PQBP1 exonic SEQ ID 2305 NM_001032381 HS polyglutamine binding protein 1 (PQBP1), tv2, mRNA. PQBP1 exonic SEQ ID 2306 NM_001167992 HS polyglutamine binding protein 1 (PQBP1), tv10, mRNA. PQBP1 exonic SEQ ID 2307 NM_001167989 HS polyglutamine binding protein 1 (PQBP1), tv8, mRNA. PQBP1 exonic SEQ ID 2308 NM_001167990 HS polyglutamine binding protein 1 (PQBP1), tv9, mRNA. TIMM17B exonic SEQ ID 2309 NM_001167947 HS translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, tv1, mRNA. TIMM17B exonic SEQ ID 2310 NM_005834 HS translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B), nuclear gene encoding mitochondrial protein, tv2, mRNA. SLC35A2 exonic SEQ ID 2311 NM_005660 HS solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), tv1, mRNA. GRIPAP1 exonic SEQ ID 2312 NM_207672 HS GRIP1 associated protein 1 (GRIPAP1), tv2, mRNA. SLC35A2 exonic SEQ ID 2313 NM_001032289 HS solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), tv2, mRNA. PRAF2 exonic SEQ ID 2314 NM_007213 HS PRA1 domain family, member 2 (PRAF2), mRNA. GPKOW exonic SEQ ID 2315 NM_015698 HS G patch domain and KOW motifs (GPKOW), mRNA. CCDC120 exonic SEQ ID 2316 NM_001163323 HS coiled-coil domain containing 120 (CCDC120), tv4, mRNA. CCDC120 exonic SEQ ID 2317 NM_001163322 HS coiled-coil domain containing 120 (CCDC120), tv2, mRNA. CCDC120 exonic SEQ ID 2318 NM_033626 HS coiled-coil domain containing 120 (CCDC120), tv3, mRNA. WDR45 exonic SEQ ID 2319 NM_007075 HS WD repeat domain 45 (WDR45), tv1, mRNA. WDR45 exonic SEQ ID 2320 NM_001029896 HS WD repeat domain 45 (WDR45), tv2, mRNA. TFE3 exonic SEQ ID 2321 NM_006521 HS transcription factor binding to IGHM enhancer 3 (TFE3), mRNA. CCDC120 exonic SEQ ID 2322 NM_001163321 HS coiled-coil domain containing 120 (CCDC120), tv1, mRNA. PLP2 exonic SEQ ID 2323 NM_002668 HS proteolipid protein 2 (colonic epithelium-enriched) (PLP2), mRNA. PRICKLE3 exonic SEQ ID 2324 NM_006150 HS prickle homolog 3 (Drosophila) (PRICKLE3), mRNA. SYP exonic SEQ ID 2325 NM_003179 HS synaptophysin (SYP), mRNA. MAGIX exonic SEQ ID 2326 NM_001099682 HS MAGI family member, X-linked (MAGIX), tv4, mRNA. MAGIX exonic SEQ ID 2327 NM_001099681 HS MAGI family member, X-linked (MAGIX), tv3, mRNA. CCDC22 exonic SEQ ID 2328 NM_014008 HS coiled-coil domain containing 22 (CCDC22), mRNA. FOXP3 exonic SEQ ID 2329 NM_014009 HS forkhead box P3 (FOXP3), tv1, mRNA. FOXP3 exonic SEQ ID 2330 NM_001114377 HS forkhead box P3 (FOXP3), tv2, mRNA. CACNA1F exonic SEQ ID 2331 NM_005183 HS calcium channel, voltage-dependent, L type, alpha 1F subunit (CACNA1F), tv1, mRNA. MAGIX exonic SEQ ID 2332 NM_024859 HS MAGI family member, X-linked (MAGIX), tv1, mRNA. MAGIX exonic SEQ ID 2333 NM_001099680 HS MAGI family member, X-linked (MAGIX), tv2, mRNA. CACNA1F exonic SEQ ID 2334 NM_001256789 HS calcium channel, voltage-dependent, L type, alpha 1F subunit (CACNA1F), tv2, mRNA. CACNA1F exonic SEQ ID 2335 NM_001256790 HS calcium channel, voltage-dependent, L type, alpha 1F subunit (CACNA1F), tv3, mRNA. GAGE10 exonic SEQ ID 2336 NM_001098413 HS G antigen 10 (GAGE10), mRNA. GAGE12J exonic SEQ ID 2337 NM_001098406 HS G antigen 12J (GAGE12J), mRNA. GAGE12F exonic SEQ ID 2338 NM_001098405 HS G antigen 12F (GAGE12F), mRNA. GAGE2D exonic SEQ ID 2339 NM_001098407 HS G antigen 2D (GAGE2D), mRNA. GAGE5 exonic SEQ ID 2340 NM_001475 HS G antigen 5 (GAGE5), mRNA. GAGE13 exonic SEQ ID 2341 NM_001098412 HS G antigen 13 (GAGE13), mRNA. GAGE4 exonic SEQ ID 2342 NM_001474 HS G antigen 4 (GAGE4), mRNA. GAGE12I exonic SEQ ID 2343 NM_001477 HS G antigen 12I (GAGE12I), mRNA. GAGE7 exonic SEQ ID 2344 NM_021123 HS G antigen 7 (GAGE7), mRNA. GAGE2B exonic SEQ ID 2345 NM_001098411 HS G antigen 2B (GAGE2B), mRNA. GAGE1 exonic SEQ ID 2346 NM_001468 HS G antigen 1 (GAGE1), tv1, mRNA. GAGE12E exonic SEQ ID 2347 NM_001098418 HS G antigen 12E (GAGE12E), mRNA. GAGE12D exonic SEQ ID 2348 NM_001127199 HS G antigen 12D (GAGE12D), mRNA. GAGE12H exonic SEQ ID 2349 NM_001098410 HS G antigen 12H (GAGE12H), mRNA. GAGE12G exonic SEQ ID 2350 NM_001098409 HS G antigen 12G (GAGE12G), mRNA. GAGE12C exonic SEQ ID 2351 NM_001098408 HS G antigen 12C (GAGE12C), mRNA. GAGE6 exonic SEQ ID 2352 NM_001476 HS G antigen 6 (GAGE6), mRNA. GAGE1 exonic SEQ ID 2353 NM_001040663 HS G antigen 1 (GAGE1), tv2, mRNA. GAGE12B exonic SEQ ID 2354 NM_001127345 HS G antigen 12B (GAGE12B), mRNA. PAGE1 exonic SEQ ID 2355 NM_003785 HS P antigen family, member 1 (prostate associated) (PAGE1), mRNA. USP27X exonic SEQ ID 2356 NM_001145073 HS ubiquitin specific peptidase 27, X-linked (USP27X), mRNA. PAGE4 exonic SEQ ID 2357 NM_007003 HS P antigen family, member 4 (prostate associated) (PAGE4), mRNA. LOC158572 exonic SEQ ID 2358 NR_026742 HS uncharacterized LOC158572 (LOC158572), non-coding RNA. MIR362 exonic SEQ ID 2359 NR_029850 HS microRNA 362 (MIR362), microRNA. MIR502 exonic SEQ ID 2360 NR_030226 HS microRNA 502 (MIR502), microRNA. MIR501 exonic SEQ ID 2361 NR_030225 HS microRNA 501 (MIR501), microRNA. MIR500B exonic SEQ ID 2362 NR_036257 HS microRNA 500b (MIR500B), microRNA. MIR532 exonic SEQ ID 2363 NR_030241 HS microRNA 532 (MIR532), microRNA. MIR660 exonic SEQ ID 2364 NR_030397 HS microRNA 660 (MIR660), microRNA. MIR500A exonic SEQ ID 2365 NR_030224 HS microRNA 500a (MIR500A), microRNA. MIR188 exonic SEQ ID 2366 NR_029708 HS microRNA 188 (MIR188), microRNA. CLCN5 exonic SEQ ID 2367 NM_000084 HS chloride channel, voltage-sensitive 5 (CLCN5), tv3, mRNA. AKAP4 exonic SEQ ID 2368 NM_139289 HS A kinase (PRKA) anchor protein 4 (AKAP4), tv2, mRNA. AKAP4 exonic SEQ ID 2369 NM_003886 HS A kinase (PRKA) anchor protein 4 (AKAP4), tv1, mRNA. BMP15 exonic SEQ ID 2370 NM_005448 HS bone morphogenetic protein 15 (BMP15), mRNA. NUDT10 exonic SEQ ID 2371 NM_153183 HS nudix (nucleoside diphosphate linked moiety X)-type motif 10 (NUDT10), mRNA. NUDT11 exonic SEQ ID 2372 NM_018159 HS nudix (nucleoside diphosphate linked moiety X)-type motif 11 (NUDT11), mRNA. GSPT2 exonic SEQ ID 2373 NM_018094 HS G1 to S phase transition 2 (GSPT2), mRNA. CENPVP1 exonic SEQ ID 2374 NR_033772 HS centromere protein V pseudogene 1 (CENPVP1), non-coding RNA. CENPVP2 exonic SEQ ID 2375 NR_033773 HS centromere protein V pseudogene 2 (CENPVP2), non-coding RNA. MAGED1 exonic SEQ ID 2376 NM_006986 HS melanoma antigen family D, 1 (MAGED1), tv2, mRNA. MAGED1 exonic SEQ ID 2377 NM_001005333 HS melanoma antigen family D, 1 (MAGED1), tv1, mRNA. SNORA11D exonic SEQ ID 2378 NR_003711 HS small nucleolar RNA, H/ACA box 11D (SNORA11D), small nucleolar RNA. SNORA11E exonic SEQ ID 2379 NR_003712 HS small nucleolar RNA, H/ACA box 11E (SNORA11E), small nucleolar RNA. MAGED4B exonic SEQ ID 2380 NM_001242362 HS melanoma antigen family D, 4B (MAGED4B), tv4, mRNA. MAGED4B exonic SEQ ID 2381 NM_030801 HS melanoma antigen family D, 4B (MAGED4B), tv1, mRNA. MAGED4B exonic SEQ ID 2382 NM_177537 HS melanoma antigen family D, 4B (MAGED4B), tv3, mRNA. MAGED4B exonic SEQ ID 2383 NM_177535 HS melanoma antigen family D, 4B (MAGED4B), tv2, mRNA. MAGED4 exonic SEQ ID 2384 NM_001098800 HS melanoma antigen family D, 4 (MAGED4), tv3, mRNA. XAGE2 exonic SEQ ID 2385 NM_130777 HS X antigen family, member 2 (XAGE2), mRNA. XAGE2B exonic SEQ ID 2386 NM_001079538 HS X antigen family, member 2B (XAGE2B), mRNA. SSX8 exonic SEQ ID 2387 NR_027250 HS synovial sarcoma, X breakpoint 8 (SSX8), non-coding RNA. ALDH1A2 exonic SEQ ID 2388 NM_001206897 HS aldehyde dehydrogenase 1 family, member A2 (ALDH1A2), tv4, mRNA. ALDH1A2 exonic SEQ ID 2389 NM_003888 HS aldehyde dehydrogenase 1 family, member A2 (ALDH1A2), tv1, mRNA. ALDH1A2 exonic SEQ ID 2390 NM_170696 HS aldehyde dehydrogenase 1 family, member A2 (ALDH1A2), tv2, mRNA. ALDH1A2 exonic SEQ ID 2391 NM_170697 HS aldehyde dehydrogenase 1 family, member A2 (ALDH1A2), tv3, mRNA. CNTN5 exonic SEQ ID 2392 NM_001243271 HS contactin 5 (CNTN5), tv4, mRNA. CNTN5 exonic SEQ ID 2393 NM_001243270 HS contactin 5 (CNTN5), tv2, mRNA. CNTN5 exonic SEQ ID 2394 NM_014361 HS contactin 5 (CNTN5), tv1, mRNA. CNTN5 exonic SEQ ID 2395 NM_175566 HS contactin 5 (CNTN5), tv3, mRNA. SHANK2 exonic SEQ ID 2396 NM_012309 HS SH3 and multiple ankyrin repeat domains 2 (SHANK2), tv1, mRNA. SHANK2 exonic SEQ ID 2397 NM_133266 HS SH3 and multiple ankyrin repeat domains 2 (SHANK2), tv2, mRNA. NSDHL exonic SEQ ID 2398 NM_015922 HS NAD(P) dependent steroid dehydrogenase-like (NSDHL), tv1, mRNA. NSDHL exonic SEQ ID 2399 NM_001129765 HS NAD(P) dependent steroid dehydrogenase-like (NSDHL), tv2, mRNA. CETN2 exonic SEQ ID 2400 NM_004344 HS centrin, EF-hand protein, 2 (CETN2), mRNA. ZNF185 exonic SEQ ID 2401 NM_001178110 HS zinc finger protein 185 (LIM domain) (ZNF185), tv6, mRNA. ZNF185 exonic SEQ ID 2402 NM_001178109 HS zinc finger protein 185 (LIM domain) (ZNF185), tv5, mRNA. ZNF185 exonic SEQ ID 2403 NM_001178113 HS zinc finger protein 185 (LIM domain) (ZNF185), tv7, mRNA. ZNF185 exonic SEQ ID 2404 NM_007150 HS zinc finger protein 185 (LIM domain) (ZNF185), tv4, mRNA. ZNF185 exonic SEQ ID 2405 NM_001178108 HS zinc finger protein 185 (LIM domain) (ZNF185), tv3, mRNA. ZNF185 exonic SEQ ID 2406 NM_001178107 HS zinc finger protein 185 (LIM domain) (ZNF185), tv2, mRNA. ZNF185 exonic SEQ ID 2407 NM_001178106 HS zinc finger protein 185 (LIM domain) (ZNF185), tv1, mRNA. NRXN1 exonic SEQ ID 2408 NM_004801 HS neurexin 1 (NRXN1), tvalpha1, mRNA. NRXN1 exonic SEQ ID 2409 NM_001135659 HS neurexin 1 (NRXN1), tvalpha2, mRNA. NRXN1 exonic SEQ ID 2410 NM_138735 HS neurexin 1 (NRXN1), tvbeta, mRNA. CNTN4 exonic SEQ ID 2411 NM_001206955 HS contactin 4 (CNTN4), tv4, mRNA. CNTN4 exonic SEQ ID 2412 NM_001206956 HS contactin 4 (CNTN4), tv5, mRNA. CNTN4 exonic SEQ ID 2413 NM_175613 HS contactin 4 (CNTN4), tv3, mRNA. CNTN4 exonic SEQ ID 2414 NM_175607 HS contactin 4 (CNTN4), tv1, mRNA. DIAPH2 exonic SEQ ID 2415 NM_006729 HS diaphanous homolog 2 (Drosophila) (DIAPH2), tv156, mRNA. DIAPH2 exonic SEQ ID 2416 NM_007309 HS diaphanous homolog 2 (Drosophila) (DIAPH2), tv12C, mRNA. RAB11FIP4 exonic SEQ ID 2417 NM_032932 HS RAB11 family interacting protein 4 (class II) (RAB11FIP4), mRNA.
[0227] Table 4 represents a list of all genes listed in Table 2 (namely, those relevant to the CNV subregion). Column 1 refers to the gene's name, or also known as the RefSeq gene symbol, as specified by HUGO Gene Nomenclature Committee (www.genenames.org), but it is understood by those skilled in the art that a gene name or RefSeq Gene Symbol (such as are listed in Tables 1-7) may be known by other names as well. Such alternate gene names are commonly listed in the RefSeq entry for the gene under gene synonym in the Features section. Column 2 refers to whether the CNV Gene Region is intronic, exonic, both, or non-coding RNA (ncRNA). Intronic refers to CNV subregions affecting introns only; Exonic refers to CNV subregions affecting part or all of one or more exons, which may include adjacent intronic regions if the CNV subregion extends beyond the exonic region. Column 3 refers to the assigned sequence ID of the full genomic extent of each of the transcripts. Column 4 refers to the RefSeq RNA Accession number. Column 5 refers to a brief description of an mRNA, or in some cases non-coding RNA, for each respective gene, including multiple mRNA or other RNA entries associated with a gene. In one embodiment, the transcripts listed in Table 4 can be expression products of the gene biomarker as listed in Table 2. In some embodiments, a gene biomarker can comprise genomic DNA encoding the gene, including exons, introns, and/or regulatory binding regions (such as enhancers, promoters, silencers, and/or response elements). In one embodiment, point mutations, polymorphisms, translocations, insertions, deletions, amplifications, inversions, microsatellites, interstitial deletions, copy number variations (CNVs), loss of heterozygosity, or any other aberrations which affect the structure or function of one or more gene biomarkers and/or expression products thereof, are associated with a developmental disorder as described herein. It should be appreciated by those skilled in the art that reference to a CNV gene region can mean a CNV is present in a subject and it impacts part or all of a gene, and similarly it can also mean a CNV subregion present in a subject than impacts part or all of a gene (e.g., a very large CNV may encompass several genes, but only one of the CNV's subregions impacts a specific gene).
TABLE-US-00005 TABLE 5 Original Original Original CNV CNV RefSeq Gene Exon SEQ ID No Chr CNV Start CNV Stop Size type ASD Case ID(s) Symbol(s) overlap SEQ ID 2418 1 8415471 8424072 8601 Gain H1M_013111T_SS0795_61878- RERE N L_252152923546 SEQ ID 2419 1 8578840 8591521 12681 Loss H1M_060310R_SS0571_59800L_25215 RERE N 2921381 SEQ ID 2420 1 10018692 10025053 6361 Loss H1M_031110R_SS0386_50002_252152 UBE4B N 919301 SEQ ID 2420 1 10018692 10025053 6361 Loss H1M_032911T_SS0854_155486L_2521 UBE4B N 52924302 SEQ ID 2420 1 10018692 10025053 6361 Loss H1M_040511T_SS0870_146440L_2521 UBE4B N 52924320 SEQ ID 2420 1 10018692 10025053 6361 Loss H1M_042710R_SS0482_86474_252152 UBE4B N 921374 SEQ ID 2421 1 97762074 97773772 11698 Loss H1M_092810T_SS0678_82302_252152 DPYD N 922076 SEQ ID 2422 1 97937467 97947871 10404 Loss H1M_010510R_SS0235_82062L_25215 DPYD Y 2916181 SEQ ID 2423 1 143820620 144003268 182648 Gain H1M_050511T_SS0930_168169_25215 SEC22B, Y 2924404 NOTCH2NL SEQ ID 2424 1 143822673 144003268 180595 Gain H1M_061411R_SS0966_62798L_25215 SEC22B, Y 2924509 NOTCH2NL SEQ ID 2425 1 179248555 179264183 15628 Loss H1M_052010R_SS0531_L051_2521529 STX6 Y 21658 SEQ ID 2426 1 179250347 179274360 24013 Loss H1M_051810R_SS0525_L384_2521529 MR1, STX6 Y 21651 SEQ ID 2427 1 239422311 239435974 13663 Loss H1M_062510R_SS0602_117370L_2521 RGS7 N 52921901 SEQ ID 2427 1 239422311 239435974 13663 Loss H1M_062510R_SS0608_52401_252152 RGS7 N 921907 SEQ ID 2428 2 31122986 31130364 7378 Loss H1M_031610R_SS0397_67941_252152 GALNT14 N 919353 SEQ ID 2428 2 31122986 31130364 7378 Loss H1M_100510T_SS0694_100678L_2521 GALNT14 N 52922410 SEQ ID 2428 2 31122986 31130364 7378 Loss H1M_102009R_SS0057_47387_252152 GALNT14 N 914518 SEQ ID 2428 2 31122986 31130364 7378 Loss H1M_120809R_SS0195_125391_25215 GALNT14 N 2914778 SEQ ID 2429 2 50451929 50458853 6924 Loss H1M_011410bR_SS0286_87396_25215 NRXN1 N 2918810 SEQ ID 2430 2 50707592 50720618 13026 Loss H1M_042710R_SS0484_78391_252152 NRXN1 Y 921376 SEQ ID 2431 2 50722129 50730867 8738 Loss H1M_103009R_SS0083_122686L_2521 NRXN1 N 52914488 SEQ ID 2432 2 51045326 51127104 81778 Loss H1M_051810R_SS0525_L384_2521529 NRXN1 Y 21651 SEQ ID 2433 2 124806817 124830494 23677 Loss H1M_040511T_SS0868_140059L_2521 CNTNAP5 N 52924318 SEQ ID 2434 2 124812715 124830494 17779 Loss H1M_032310R_SS0424_111520L_2521 CNTNAP5 N 52920373 SEQ ID 2435 2 124820246 124830494 10248 Loss H1M_011410aR_SS0270_129914_2521 CNTNAP5 N 52918777 SEQ ID 2436 2 133432106 133451626 19520 Gain H1M_011410aR_SS0274_62257L_2521 NCKAP5 Y 52918781 SEQ ID 2437 2 133905311 133915419 10108 Loss H1M_061010R_SS0541_88032_252152 NCKAP5 N 921473 SEQ ID 2438 2 143887081 143956653 69572 Loss H1M_060110R_SS0560_50172L_25215 ARHGAP15 Y 2921323 SEQ ID 2439 2 143888382 143916068 27686 Gain H1M_090910T_SS0635_142468_25215 ARHGAP15 Y 2922005 SEQ ID 2440 2 187939949 187948064 8115 Loss H1M_041211T_SS0888 _3586- CALCRL N L_252152924343 SEQ ID 2440 2 187939949 187948064 8115 Loss H1M_050510R_SS0508_103021L_2521 CALCRL N 52921282 SEQ ID 2440 2 187939949 187948064 8115 Loss H1M_051011T_SS0939_62224- CALCRL N L_252152924413 SEQ ID 2441 2 188013560 188019828 6268 Loss H1M_090910T_SS0640_99006_252152 CALCRL N 922010 SEQ ID 2442 2 212395514 212407126 11612 Loss H1M_042811T_SS0913_138145L_2521 ERBB4 N 52924382 SEQ ID 2443 2 212595621 212601943 6322 Loss H1M_110309R_SS0098_90188_252152 ERBB4 N 914565 SEQ ID 2444 2 230027762 230036470 8708 Loss H1M_062110R_SS0599_143189_25215 DNER N 2921898 SEQ ID 2444 2 230027762 230036470 8708 Loss H1M_100609R_SS0029_93919L_25215 DNER N 2914858 SEQ ID 2445 2 238945136 238954610 9474 Gain H1M_010510R_SS0245_57842L_25215 TRAF3IP1 N 2918506 SEQ ID 2445 2 238945136 238954610 9474 Gain H1M_091410T_SS0641_115738L_2521 TRAF3IP1 N 52922011 SEQ ID 2446 3 59831948 59843515 11567 Loss H1M_012511T_SS0791_57928_252152 FHIT N 923637 SEQ ID 2447 3 59891746 60074408 182662 Loss H1M_112609R_SS0162_68637L_25215 FHIT Y 2914709 SEQ ID 2448 3 60310452 60323411 12959 Loss H1M_042611T_SS0906_83152L_25215 FHIT N 2924375 SEQ ID 2449 3 60635843 60968263 332420 Loss H1M_051810R_SS0527_L656_2521529 FHIT Y 21653 SEQ ID 2450 3 60814214 60829360 15146 Loss H1M_102709R_SS0073_60701L_25215 FHIT N 2914480 SEQ ID 2451 3 77559671 77571280 11609 Loss H1M_050311T_SS0927_156900_25215 ROBO2 N 2924401 SEQ ID 2451 3 77559671 77571280 11609 Loss H1M_061510R_SS0589_52335_252152 ROBO2 N 921712 SEQ ID 2452 4 57676862 57683744 6882 Loss H1M_062510R_SS0610_128122_25215 LOC255130 N 2921909 SEQ ID 2453 4 57708111 57723394 15283 Loss H1M_060110R_SS0558_83555L_25215 LOC255130 N 2921303 SEQ ID 2454 4 81084565 81107218 22653 Gain H1M_092810T_SS0672_55262- ANTXR2 N L_252152921992 SEQ ID 2454 4 81084565 81107218 22653 Gain H1M_122309R_SS0232_61384_252152 ANTXR2 N 916118 SEQ ID 2455 4 93780494 93794806 14312 Loss H1M_062510R_SS0609_51165L_25215 GRID2 N 2921908 SEQ ID 2455 4 93780494 93794806 14312 Loss H1M_120309R_SS0177_96086L_25215 GRID2 N 2914841 SEQ ID 2456 4 93783990 93794806 10816 Loss H1M_033111T_SS0862_139459L_2521 GRID2 N 52924312 SEQ ID 2456 4 93783990 93794806 10816 Loss H1M_122109R_SS0211_101464_25215 GRID2 N 2914903 SEQ ID 2457 4 94167265 94186125 18860 Loss H1M_041510R_SS0457_60685L_25215 GRID2 N 2921062 SEQ ID 2458 4 100954989 101000711 45722 Gain H1M_032510R_SS0432_115813L_2521 DAPP1 Y 52920381 SEQ ID 2458 4 100954989 101000711 45722 Gain H1M_103009R_SS0093_117463L_2521 DAPP1 Y 52914570 SEQ ID 2459 4 119333328 119349029 15701 Loss H1M_093010T_SS0684_117371L_2521 NDST3 N 52922370 SEQ ID 2459 4 119333328 119349029 15701 Loss H1M_111709R_SS0124_82366_252152 NDST3 N 914823 SEQ ID 2459 4 119333328 119349029 15701 Loss H1M_111909R_SS0133_64249L_25215 NDST3 N 2914832 SEQ ID 2460 4 119333615 119349029 15414 Loss H1M_101910T_SS0718_100573L_2521 NDST3 N 52921190 SEQ ID 2461 5 78410721 78424190 13469 Gain H1M_051110R_SS0513_49202_252152 BHMT2 Y 921758 SEQ ID 2462 5 78412278 78427595 15317 Gain H1M_042110R_SS0472_62261L_25215 BHMT2 Y 2921260 SEQ ID 2463 5 112548119 112556605 8486 Loss H1M_050510R_SS0500_72296_252152 MCC N 921461 SEQ ID 2464 5 112699032 112724865 25833 Loss H1M_060310R_SS0568_59269L_25215 MCC Y 2921343 SEQ ID 2465 5 146286927 146295686 8759 Loss H1M_100609R_SS0023_117486L_2521 PPP2R2B N 52914648 SEQ ID 2465 5 146286927 146295686 8759 Loss H1M_102709R_SS0081_45562_252152 PPP2R2B N 914584 SEQ ID 2466 5 180507805 180542040 34235 Gain H1M_042111T_SS0902_83680L_25215 OR2V2 Y 2924371 SEQ ID 2466 5 180507805 180542040 34235 Gain H1M_111909R_SS0133_64249L_25215 OR2V2 Y 2914832 SEQ ID 2467 6 33490909 33506174 15265 Loss H1M_122109R_SS0211_101464_25215 SYNGAP1, Y 2914903 CUTA, PHF1 SEQ ID 2468 6 33490909 33507787 16878 Loss H1M_020210R_SS0297_96241_252152 SYNGAP1, Y 918826 CUTA, PHF1 SEQ ID 2469 6 33492194 33506174 13980 Loss H1M_111909R_SS0133_64249L_25215 SYNGAP1, Y 2914832 CUTA, PHF1 SEQ ID 2470 6 38069512 38093797 24285 Gain H1M_021710R_SS0327_60416_252152 ZFAND3 N 919127 SEQ ID 2470 6 38069512 38093797 24285 Gain H1M_031610R_SS0399_68672_252152 ZFAND3 N 919360 SEQ ID 2471 6 65407331 65423639 16308 Loss H1M_051810R_SS0527_L656_2521529 EYS N 21653 SEQ ID 2472 6 65844562 65871185 26623 Loss H1M_032310R_SS0425_65891_252152 EYS N 920374 SEQ ID 2472 6 65844562 65871185 26623 Loss H1M_041411T_SS0892_157660L_2521 EYS N 52924347 SEQ ID 2473 6 66130866 66137447 6581 Loss H1M_010510R_SS0238_92121_252152 EYS N 916184 SEQ ID 2473 6 66130866 66137447 6581 Loss H1M_031110R_SS0390_85983_252152 EYS N 919320 SEQ ID 2473 6 66130866 66137447 6581 Loss H1M_042110R_SS0474_47836_252152 EYS N 921321 SEQ ID 2474 7 26020603 26172358 151755 Gain H1M_061411R_SS0964_83548L_25215 NFE2L3 Y 2910796 SEQ ID 2475 7 26180912 26202927 22015 Gain H1M_020211T_SS0806_125855_25215 NFE2L3, Y 2924196 HNRNPA2B 1 SEQ ID 2476 7 43210229 43217598 7369 Loss H1M_032310R_SS0418_68160L_25215 HECW1 N 2920367 SEQ ID 2476 7 43210229 43217598 7369 Loss H1M_100510T_SS0689_67955- HECW1 N L_252152922405 SEQ ID 2476 7 43210229 43217598 7369 Loss H1M_103009R_SS0085_60576_252152 HECW1 N 914490 SEQ ID 2477 7 45079797 45096230 16433 Loss H1M_100609R_SS0026_47909_252152 NACAD, Y 914651 CCM2 SEQ ID 2477 7 45079797 45096230 16433 Loss H1M_103009R_SS0087_62391L_25215 NACAD, Y 2914539 CCM2 SEQ ID 2478 7 124324707 124335800 11093 Gain H1M_031110R_SS0388_119776_25215 POT1 Y 2919318 SEQ ID 2478 7 124324707 124335800 11093 Gain H1M_110309R_SS0095_44644_252152 POT1 Y 914411 SEQ ID 2479 7 126121250 126155919 34669 Gain H1M_102610T_SS0734_128860_25215 GRM8 Y 2922183 SEQ ID 2480 7 126272537 126289499 16962 Gain H1M_040711T_SS0873_146436L_2521 GRM8 N 52924324 SEQ ID 2481 7 126580660 126602515 21855 Loss H1M_091010T_SS0634_130293_25215 GRM8 N 2922004 SEQ ID 2482 7 127640443 127676111 35668 Gain H1M_062110R_SS0601_91617_252152 LEP Y 921900 SEQ ID 2483 7 127640443 127678365 37922 Gain H1M_011410aR_SS0277_45751_25215 LEP Y 2918784 SEQ ID 2484 7 131704792 131719045 14253 Loss H1M_070810R_SS0622_69180_252152 PLXNA4 Y 921936 SEQ ID 2485 7 131972774 131988294 15520 Gain H1M_092410T_SS0664_59144_252152 PLXNA4 Y 921962 SEQ ID 2486 7 142175874 142198576 22702 Loss H1M_050311T_SS0925_154624L_2521 PRSS2 Y 52924399 SEQ ID 2486 7 142175874 142198576 22702 Loss H1M_022211T_SS0811_162340L_2521 PRSS2 Y 52924211 SEQ ID 2487 7 142175874 142206030 30156 Loss H1M_031011T_SS0820_54259_252152 PRSS2 Y 924504 SEQ ID 2487 7 142175874 142206030 30156 Loss H1M_050511T_SS0936_128963_25215 PRSS2 Y 2924410 SEQ ID 2487 7 142175874 142206030 30156 Loss H1M_090910T_SS0637_77114_252152 PRSS2 Y 922007 SEQ ID 2488 7 157158010 157165854 7844 Loss H1M_102009R_SS0054_107433_25215 PTPRN2 N 2914512 SEQ ID 2489 7 157224935 157298194 73259 Gain H1M_050510R_SS0501_72057_252152 PTPRN2 N 921496 SEQ ID 2490 8 42687678 42703550 15872 Gain H1M_110309R_SS0095_44644_252152 CHRNB3 N 914411 SEQ ID 2491 8 42691586 42703550 11964 Loss H1M_030311T_SS0817_65690_252152 CHRNB3 N 924275 SEQ ID 2492 8 145990558 146003494 12936 Loss H1M_011410aR_SS0275_47389_25215 ZNF517 Y 2918782 SEQ ID 2492 8 145990558 146003494 12936 Loss H1M_122109R_SS0219_110612L_2521 ZNF517 Y 52916081 SEQ ID 2493 9 21250172 21268145 17973 Gain H1M_031810R_SS0410_69354_252152 IFNA22P Y 919401 SEQ ID 2493 9 21250172 21268145 17973 Gain H1M_050510R_SS0510_55360_252152 IFNA22P Y 921284 SEQ ID 2494 9 93432583 93440062 7479 Loss H1M_061510R_SS0585_60666L_25215 MIR3910-1, Y 2921685 MIR3910-2 SEQ ID 2494 9 93432583 93440062 7479 Loss H1M_062510R_SS0606_117525L_2521 MIR3910-1, Y 52921905 MIR3910-2 SEQ ID 2494 9 93432583 93440062 7479 Loss H1M_110210T_SS0754_60973L_25215 MIR3910-1, Y 2922357 MIR3910-2 SEQ ID 2495 10 67439723 67447839 8116 Loss H1M_060310R_SS0576_118909L_2521 CTNNA3 N 52921401 SEQ ID 2496 10 68761434 68779805 18371 Loss H1M_100209R_SS0014_95578_252152 CTNNA3 N 914604 SEQ ID 2497 10 77916018 77928938 12920 Gain H1M_030910R_SS0379_MM0234- C10orf11 N 5_252152919292 SEQ ID 2497 10 77916018 77928938 12920 Gain H1M_042910R_SS0495_68388_252152 C10orf11 N 921455 SEQ ID 2498 10 77917670 77928938 11268 Gain H1M_050510R_SS0501_72057_252152 C10orf11 N 921496 SEQ ID 2499 10 103148325 103156849 8524 Gain H1M_042710R_SS0477_45758_252152 BTRC N 921364 SEQ ID 2499 10 103148325 103156849 8524 Gain H1M_060810R_SS0543_95746_252152 BTRC N 921403 SEQ ID 2500 11 10067279 10107273 39994 Loss H1M_050510R_SS0500_72296_252152 SBF2 N 921461 SEQ ID 2501 11 10116873 10123876 7003 Loss H1M_032310R_SS0419_55449_252152 SBF2 N 920368 SEQ ID 2501 11 10116873 10123876 7003 Loss H1M_092410T_SS0670_85276L_25215 SBF2 N 2921990 SEQ ID 2501 11 10116873 10123876 7003 Loss H1M_121009R_SS0207_95011_252152 SBF2 N 914854 SEQ ID 2502 11 43728776 43739172 10396 Loss H1M_050311T_SS0922_155493L_2521 HSD17B12 Y 52924396 SEQ ID 2502 11 43728776 43739172 10396 Loss H1M_050511T_SS0933_170300_25215 HSD17B12 Y 2924407 SEQ ID 2503 11 89473890 89516888 42998 Loss H1M_103009R_SS0084_82921L_25215 NAALAD2 Y 2914489 SEQ ID 2504 11 89546524 89558793 12269 Loss H1M_103009R_SS0084_82921L_25215 NAALAD2 Y 2914489 SEQ ID 2505 12 1321756 1332345 10589 Loss H1M_020210R_SS0295_90412_252152 ERC1 N 918824 SEQ ID 2506 12 1432461 1447783 15322 Gain H1M_061411R_SS0961_168866_25215 ERC1 N 2910793 SEQ ID 2507 12 110497497 110510158 12661 Loss H1M_050311T_SS0928_167532_25215 ATXN2 N 2924402 SEQ ID 2507 12 110497497 110510158 12661 Loss H1M_100510T_SS0692_136064_25215 ATXN2 N 2922408 SEQ ID 2507 12 110497497 110510158 12661 Loss H1M_101910T_SS0712_67766_252152 ATXN2 N 922504 SEQ ID 2508 12 110497497 110512690 15193 Loss H1M_032211T_SS0842_146904L_2521 ATXN2 N 52924290 SEQ ID 2509 12 119355152 119372694 17542 Gain H1M_042110R_SS0465_60811_252152 GATC, Y 921077 COX6A1, TRIAP1 SEQ ID 2509 12 119355152 119372694 17542 Gain H1M_050311T_SS0923_155571L_2521 GATC, Y 52924397 COX6A1, TRIAP1 SEQ ID 2509 12 119355152 119372694 17542 Gain H1M_101510T_SS0708_137484_25215 GATC, Y 2922500 COX6A1, TRIAPI1 SEQ ID 2510 14 66255943 66292122 36179 Loss H1M_120109R_SS0175_103018L_2521 GPHN N 52914810 SEQ ID 2511 14 78094937 78108997 14060 Loss H1M_051810R_SS0524_102350_25215 NRXN3 N 2921650 SEQ ID 2512 14 79195282 79484992 289710 Loss H1M_122309R_SS0222_95458L_25215 NRXN3 Y 2916084 SEQ ID 2513 14 100004394 100013283 8889 Loss H1M_062510R_SS0603_59794L_25215 WDR25 N 2921902 SEQ ID 2513 14 100004394 100013283 8889 Loss H1M_120109R_SS0167_77405L_25215 WDR25 N 2914704 SEQ ID 2514 15 40000247 40008898 8651 Loss H1M_050311T_SS0927_156900_25215 EHD4 N 2924401 SEQ ID 2514 15 40000247 40008898 8651 Loss H1M_110410T_SS0768_59962- EHD4 N L_252152922532 SEQ ID 2515 15 76203086 76226626 23540 Gain H1M_020210R_SS0300_117395L_2521 CIB2 Y 52918834 SEQ ID 2516 15 76205943 76223581 17638 Gain H1M_110210T_SS0753_94478_252152 CIB2 Y 922346 SEQ ID 2517 15 76205943 76224670 18727 Gain H1M_041411T_SS0890_132199L_2521 CIB2 Y 52924345 SEQ ID 2518 16 3047397 3065441 18044 Loss H1M_042910R_SS0488_110408_25215 MMP25, Y 2921409 IL32 SEQ ID 2518 16 3047397 3065441 18044 Loss H1M_110210T_SS0754_60973L_25215 MMP25, Y 2922357 IL32 SEQ ID 2519 16 86251131 86263122 11991 Gain H1M_011410aR_SS0277_45751_25215 JPH3 N 2918784 SEQ ID 2520 16 86267253 86273542 6289 Loss H1M_092410T_SS0665_92812_252152 JPH3 N 921963 SEQ ID 2521 16 86306880 86326994 20114 Loss H1M_011410aR_SS0269_MM0196- KLHDC4 Y 4_252152918776 SEQ ID 2522 16 86346896 86364864 17968 Loss H1M_122309R_SS0227_68711_252152 KLHDC4 Y 916113 SEQ ID 2523 17 1182304 1207115 24811 Gain H1M_031610R_SS0399_68672_252152 YWHAE Y 919360 SEQ ID 2524 17 4617476 4629828 12352 Loss H1M_060310R_SS0574_64374L_25215 TM4SF5 Y 2921399 SEQ ID 2524 17 4617476 4629828 12352 Loss H1M_110309R_SS0095_44644_252152 TM4SF5 Y 914411 SEQ ID 2525 17 10288578 10297580 9002 Loss H1M_060310R_SS0554_59902L_25215 MYH4 Y 2921341 SEQ ID 2525 17 10288578 10297580 9002 Loss H1M_090910T_SS0636_114094L_2521 MYH4 Y 52922006 SEQ ID 2526 17 56212732 56222563 9831 Loss H1M_011311T_SS0787_63582- BCAS3 N L_252152923633 SEQ ID 2526 17 56212732 56222563 9831 Loss H1M_062110R_SS0601_91617_252152 BCAS3 N 921900 SEQ ID 2526 17 56212732 56222563 9831 Loss H1M_110509R_SS0108_83553L_25215 BCAS3 N 2914788 SEQ ID 2527 19 18154567 18171834 17267 Gain H1M_032911T_SS0850_154267L_2521 RAB3A, Y 52924298 MPV17L2 SEQ ID 2528 19 18154567 18174395 19828 Gain H1M_092410T_SS0660_66673_252152 RAB3A, Y 921918 MPV17L2 SEQ ID 2529 19 45711646 45808780 97134 Loss H1M_102810T_SS0739_61360_252152 SPTBN4, Y 922199 SHKBP1, LTBP4 SEQ ID 2530 19 45752434 45808780 56346 Loss H1M_110210T_SS0758_126047_25215 SPTBN4, Y 2922361 SHKBP1, LTBP4 SEQ ID 2531 19 52315324 52340052 24728 Gain H1M_031011T_SS0821_45554_252152 SAE1 Y 924321 SEQ ID 2531 19 52315324 52340052 24728 Gain H1M_100510T_SS0691_124475_25215 SAE1 Y 2922407 SEQ ID 2531 19 52315324 52340052 24728 Gain H1M_110309R_SS0095_44644_252152 SAE1 Y 914411 SEQ ID 2532 19 55872843 55934778 61935 Loss H1M_030311T_SS0813_168753_25215 SHANK1, Y 2924272 CLEC11A SEQ ID 2533 19 56882402 56889637 7235 Loss H1M_093010T_SS0684_117371L_2521 MIR99B, Y 52922370 MIRLET7E, MIR125A, NCRNA0008 5 SEQ ID 2533 19 56882402 56889637 7235 Loss H1M_102110T_SS0724_59724- MIR99B, Y L_252152922157 MIRLET7E, MIR125A, NCRNA0008 5 SEQ ID 2533 19 56882402 56889637 7235 Loss H1M_111909R_SS0137_100677L_2521 MIR99B, Y 52914836 MIRLET7E, MIR125A, NCRNA0008 5 SEQ ID 2534 20 314677 331942 17265 Loss H1M_111909R_SS0137_100677L_2521 TRIB3 Y 52914836 SEQ ID 2535 20 314677 326132 11455 Loss H1M_041510R_SS0475_62251L_25215 TRIB3 Y 2921074 SEQ ID 2536 20 3827236 3831572 4336 Loss H1M_033110R_SS0449_55497_252152 PANK2 N 920408 SEQ ID 2536 20 3827236 3831572 4336 Loss H1M_051110R_SS0513_49202_252152 PANK2 N 921758 SEQ ID 2536 20 3827236 3831572 4336 Loss H1M_110210T_SS0754_60973L_25215 PANK2 N 2922357 SEQ ID 2536 20 3827236 3831572 4336 Loss H1M_110210T_SS0758_126047_25215 PANK2 N 2922361 SEQ ID 2537 21 16479907 16550832 70925 Loss H1M_102810T_SS0744_58016_252152 C21orf34 Y 922216 SEQ ID 2538 21 16698731 16710463 11732 Loss H1M_031610R_SS0399_68672_252152 C21orf34 N 919360 SEQ ID 2539 X 2014899 2290904 276005 Gain H1M_011410aR_SS0273_62227L_2521 DHRSX Y 52918780 SEQ ID 2540 X 2019039 2184946 165907 Gain H1M_102810T_SS0748_32794_252152 DHRSX Y 922219 SEQ ID 2540 X 2019039 2184946 165907 Gain H1M_120109R_SS0173_101121L_2521 DHRSX Y 52914808 SEQ ID 2541 X 2128189 2390326 262137 Gain H1M_032911T_SS0850_154267L_2521 DHRSX Y 52924298 SEQ ID 2542 X 2239268 2262996 23728 Gain H1M_031110R_SS0389_143178_25215 DHRSX N 2919319 SEQ ID 2543 X 2282899 2289078 6179 Loss H1M_031110R_SS0389_143178_25215 DHRSX N 2919319 SEQ ID 2544 X 2288678 2313952 25274 Loss H1M_062510R_SS0608_52401_252152 DHRSX N 921907 SEQ ID 2545 X 2290478 2313952 23474 Loss H1M_020210R_SS0301_114961L_2521 DHRSX N 52918835 SEQ ID 2546 X 2302992 2307482 4490 Loss H1M_100209R_SS0013_47029_252152 DHRSX N 914603 SEQ ID 2546 X 2302992 2307482 4490 Loss H1M_101510T_SS0705_131698_25215 DHRSX N 2922492 SEQ ID 2547 X 2319097 2325935 6838 Loss H1M_112609R_SS0164_72085_252152 DHRSX N 914711 SEQ ID 2548 X 2382384 2385428 3044 Loss H1M_010710R_SS0246_57224L_25215 DHRSX N 2918507 SEQ ID 2548 X 2382384 2385428 3044 Loss H1M_102610T_SS0735_54089_252152 DHRSX N 922184 SEQ ID 2549 X 16688233 16707403 19170 Gain H1M_051810R_SS0521_58294L_25215 SYAP1 Y 2921647 SEQ ID 2549 X 16688233 16707403 19170 Gain H1M_060810R_SS0579_55310_252152 SYAP1 Y 921451 SEQ ID 2550 X 23760070 23778530 18460 Gain H1M_041411T_SS0894_139353L_2521 APOO Y 52924331 SEQ ID 2551 X 23761433 23778530 17097 Gain H1M_050511T_SS0933_170300_25215 APOO Y 2924407 SEQ ID 2552 X 32004122 32019493 15371 Gain H1M_030910R_SS0376_59641L_25215 DMD N 2919284 SEQ ID 2553 X 32574048 32580308 6260 Loss H1M_031610R_SS0394_100570L_2521 DMD N 52919350 SEQ ID 2554 X 32905207 32928210 23003 Loss H1M_011210R_SS0260_62231L_25215 DMD N 2918755 SEQ ID 2555 X 33069644 33076560 6916 Loss H1M_100209R_SS0020_91548L_25215 DMD N 2914820 SEQ ID 2556 X 95853392 95864822 11430 Loss H1M_041411T_SS0889_117482L_2521 DIAPH2 N 52924344 SEQ ID 2557 X 96415067 96426115 11048 Loss H1M_110410T_SS0771_47556_252152 DIAPH2 N 922556 * Position references refer to the human genomic sequence Hg18 March 2006 (NCBI Build 36.1)
Table 5 lists all CNVs of interest, obtained using the method described in example 2. For each entry, the originating CNV start and stop positions are noted, along with CNV size, CNV type (gain, loss or both), ASD cases IDs, RefSeq gene symbols and whether or not the CNV overlaps an exon. Unlike Table 2, the gene annotation refers to the (original) CNV as detailed in the table.
TABLE-US-00006 TABLE 6 CNV GENE CNV Gene NCBI Gene NAME type Region Gene ID Description RefSeq Summmary ANTXR2 Gain Intronic 118429 anthrax toxin This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and receptor 2 laminin, suggesting that it may be involved in extracellular matrix adhesion. isoform 2 Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic precursor hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, March 2009]. Transcript Variant: This variant (2) uses an alternate 3 splice pattern, compared to variant 1. The resulting isoform (2) has a longer and distinct C-terminus, compared to isoform 1. APOO Gain Exonic 79135 apolipoprotein This gene is a member of the apolipoprotein family. Members of this protein family O precursor are involved in the transport and metabolism of lipids. The encoded protein associates with HDL, LDL and VLDL lipoproteins and is characterized by chondroitin-sulfate glycosylation. This protein may be involved in preventing lipid accumulation in the myocardium in obese and diabetic patients. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 4, 5, 12 and 16. [provided by RefSeq, September 2009]. Transcript Variant: This variant (1) represents the longer transcript and is predicted to encode the functional protein. ARHGAP15 Both Exonic 55843 rho GTPase- RHO GTPases (see ARHA; MIM 165390) regulate diverse biologic processes, and activating their activity is regulated by RHO GTPase-activating proteins (GAPs), such as protein 15 ARHGAP15 (Seoh et al., 2003 [PubMed 12650940]). [supplied by OMIM, March 2008]. ATXN2 Loss Intronic 6311 ataxin-2 The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. Defects in this gene are the cause of spinocerebellar ataxia type 2 (SCA2). SCA2 belongs to the autosomal dominant cerebellar ataxias type I (ADCA I) which are characterized by cerebellar ataxia in combination with additional clinical features like optic atrophy, ophthalmoplegia, bulbar and extrapyramidal signs, peripheral neuropathy and dementia. SCA2 is caused by expansion of a CAG repeat in the coding region of this gene. This locus has been mapped to chromosome 12, and it has been determined that the diseased allele contains 37-50 CAG repeats, compared to 17-29 in the normal allele. Longer expansions result in earlier onset of the disease. Alternatively spliced transcript variants encoding different isoforms have been identified but their full length sequence has not been determined. [provided by RefSeq, January 2010]. BCAS3 Loss Intronic 54828 breast N/A carcinoma- amplified sequence 3 isoform 1 BHMT2 Gain Exonic 23743 betaine-- Homocysteine is a sulfur-containing amino acid that plays a crucial role in homocysteine methylation reactions. Transfer of the methyl group from betaine to homocysteine S- creates methionine, which donates the methyl group to methylate DNA, proteins, methyltransferase lipids, and other intracellular metabolites. The protein encoded by this gene is one of 2 two methyl transferases that can catalyze the transfer of the methyl group from betaine isoform 2 to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]. Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the consistent with the reference genome assembly. The genomic coordinates used for the sequence transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. BTRC Gain Intronic 8945 F-box/WD This gene encodes a member of the F-box protein family which is characterized by an repeat- approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of containing the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F- protein 1A box), which function in phosphorylation-dependent ubiquitination. The F-box proteins isoform 2 are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine- rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. This protein is homologous to Xenopus bTrCP1, yeast Met30, Neurospora Scon2 and Drosophila Slimb proteins. It interacts with HIV-1 Vpu and connects CD4 to the proteolytic machinery. It also associates specifically with phosphorylated IkappaBalpha and beta-catenin destruction motifs, probably functioning in multiple transcriptional programs by activating the NF-kappaB pathway and inhibiting the beta-catenin pathway. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks a 108 nt fragment within the coding region, as compared to variant 1, and thus encodes a 36 aa shorter isoform than variant 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. C10orf11 Gain Intronic 83938 leucine-rich N/A repeat- containing protein C10orf11 C21orf34 Loss Both N/A N/A N/A CALCRL Loss Intronic 10203 calcitonin N/A gene-related peptide type 1 receptor precursor CCM2 Loss Exonic 83605 malcavernin This gene encodes a scaffold protein that functions in the stress-activated p38 isoform 4 Mitogen-activated protein kinase (MAPK) signaling caseade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, November 2009]. Transcript Variant: This variant (4) represents use of an alternate promoter and 5 UTR, uses a distinct start codon, and lacks two alternate in-frame exons in the central coding region, compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus and lacks an internal segment, compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. CHRNB3 Both Intronic 1142 neuronal The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of acetylcholine ligand-gated ion channels that mediate fast signal transmission at synapses. The receptor nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that subunit beta- make up the muscle and neuronal forms of nAChRs are encoded by separate genes 3 precursor and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. [supplied by OMIM, April 2010]. CIB2 Gain Exonic 10518 calcium and The amino acid sequence the protein encoded by this gene is similar to that of integrin- KIP/CIB, calcineurin B, and calmodulin. This suggests that the encoded protein may binding be a Ca2+-binding regulatory protein that interacts with DNA-dependent protein family kinase catalytic subunit (DNA-PKcs). [provided by RefSeq, July 2008]. member 2 CLEC11A Loss Exonic 6320 C-type lectin This gene encodes a member of the C-type lectin superfamily. The encoded protein is domain a secreted sulfated glycoprotein and functions as a growth factor for primitive family 11 hematopoietic progenitor cells. An alternative splice variant has been described but its member A biological nature has not been determined. [provided by RefSeq, July 2008]. precursor Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. CNTNAP5 Loss Intronic 129684 contactin- This gene product belongs to the neurexin family, members of which function in the associated vertebrate nervous system as cell adhesion molecules and receptors. This protein, like protein-like 5 other neurexin proteins, contains epidermal growth factor repeats and laminin G precursor domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, July 2008]. COX6A1 Gain Exonic 1337 cytochrome c Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory oxidase chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a subunit 6A1, heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial mitochondrial genes and multiple structural subunits encoded by nuclear genes. The precursor mitochondrially-encoded subunits function in the electron transfer and the nuclear- encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (liver isoform) of subunit VIa, and polypeptide 1 is found in all non-muscle tissues. Polypeptide 2 (heart/muscle isoform) of subunit VIa is encoded by a different gene, and is present only in striated muscles. These two polypeptides share 66% amino acid sequence identity. It has been reported that there may be several pseudogenes on chromosomes 1, 6, 7q21, 7q31-32 and 12. However, only one pseudogene (COX6A1P) on chromosome 1p31.1 has been documented. [provided by RefSeq, July 2008]. CTNNA3 Loss Intronic 29119 catenin N/A alpha-3 CUTA Loss Exonic 51596 protein CutA N/A isoform 3 precursor DAPP1 Gain Exonic 27071 dual adapter N/A for phosphotyrosine and 3- phosphotyrosine and 3- phosphoinositide DHRSX Both Intronic 207063 dehydrogenase/ N/A reductase SDR family member on chromosome X precursor DHRSX Gain Exonic 207063 dehydrogenase/ N/A reductase SDR family member on chromosome X precursor DIAPH2 Loss Intronic 1730 protein The product of this gene belongs to the diaphanous subfamily of the formin homology diaphanous family of proteins. This gene may play a role in the development and normal function homolog 2 of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. isoform 12C Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, July 2008]. Transcript Variant: This variant (12C) differs in the 3 UTR and the 3 coding region, compared to variant 156. The resulting isoform (isoform 12C) contains a distinct C-terminus, compared to isoform 156. DMD Both Intronic 1756 dystrophin The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene Dp140c was identified through a positional cloning approach, targeted at the isolation of the isoform gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin- glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, July 2008]. Transcript Variant: Dp140 transcripts use exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp140 transcripts have a long (1 kb) 5 UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dp140 isoforms. Of these, this transcript (Dp140c) lacks exons 71-74. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. DNER Loss Intronic 92737 delta and N/A Notch-like epidermal growth factor-related receptor precursor DPYD Loss Both 1806 dihydropyrimidine The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and dehydrogenase rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in [NADP+] this gene result in dihydropyrimidine dehydrogenase deficiency, an error in isoform 1 pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). EHD4 Loss Intronic 30844 EH domain- N/A containing protein 4 ERBB4 Loss Intronic 2066 receptor This gene is a member of the Tyr protein kinase family and the epidermal growth tyrosine- factor receptor subfamily. It encodes a single-pass type I membrane protein with protein multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a kinase erbB- phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The 4 isoform protein binds to and is activated by neuregulins and other factors and induces a variety JM-a/CVT-2 of cellular responses including mitogenesis and differentiation. Multiple proteolytic precursor events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, July 2008]. Transcript Variant: This variant (JM-a/CYT-2) lacks an alternate in-frame exon, compared to variant JM-a/CYT-1, resulting in a shorter protein (isoform JM-a/CYT-2) that lacks the phosphotidylinositol-3 kinase binding site, compared to isoform JM-a/CYT-1. ERC1 Both Intronic 23085 ELKS/Rab6- The protein encoded by this gene is a member of a family of RIM-binding proteins. interacting/ RIMs are active zone proteins that regulate neurotransmitter release. This gene has CAST family been found fused to the receptor-type tyrosine kinase gene RET by gene member 1 rearrangement due to the translocation t(10; 12)(q11; p13). Multiple transcript variants isoform encoding different isoforms have been found for this gene. [provided by RefSeq, July epsilon 2008]. Transcript Variant: This variant (epsilon) encodes the longest isoform (epsilon). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. EYS Loss Intronic 346007 protein eyes The product of this gene contains multiple epidermal growth factor (EGF)-like and shut homolog LamG domains. The protein is expressed in the photoreceptor layer of the retina, and isoform 2 the gene is mutated in autosomal recessive retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, December 2008]. Transcript Variant: This variant (2) uses an alternate exon and 3 UTR, compared to variant 1. The resulting isoform (2) has a substantially shorter and unique C-terminus, compared to isoform 1. FHIT Loss Both 2272 bis(5- This gene, a member of the histidine triad gene family, encodes a diadenosine 5,5- adenosyl)- P1,P3-triphosphate hydrolase involved in purine metabolism. The gene encompasses triphosphatase the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts of this gene. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, October 2009]. Transcript Variant: This variant (2) has an alternate splice site in the 3 UTR, as compared to variant 1. Both variants 1 and 2 encode the same protein. GALNT14 Loss Intronic 79623 polypeptide GALNT14 (EC 2.4.1.41) belongs to a large subfamily of glycosyltransferases residing N- in the Golgi apparatus. GALNT enzymes catalyze the first step in the O-glycosylation acetylgalactos- of mammalian proteins by transferring N-acetyl-D-galactosamine (GalNAc) to aminyltransferase peptide substrates. [supplied by OMIM, April 2004]. 14 GATC Gain Exonic 283459 N/A N/A GPHN Loss Intronic 10243 gephyrin This gene encodes a neuronal assembly protein that anchors inhibitory isoform 2 neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2), also known as Geph2, lacks an alternate, in-frame exon, compared to variant 1. It encodes isoform 2, which is shorter than isoform 1. GRID2 Loss Intronic 2895 glutamate Human glutamate receptor delta-2 (GRID2) is a relatively new member of the family receptor of ionotropic glutamate receptors which are the predominant excitatory delta-2 neurotransmitter receptors in the mammalian brain. GRID2 is a predicted 1,007 amino subunit acid protein that shares 97% identity with the mouse homolog which is expressed precursor selectively in cerebellar Purkinje cells. A point mutation in mouse GRID2, associated with the phenotype named lurcher, in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid-and hindbrain neurons during late embryogenesis. This strongly suggests a role for GRID2 in neuronal apoptotic death. [provided by RefSeq, July 2008]. GRM8 Both Intronic 2918 metabotropic L-glutamate is the major excitatory neurotransmitter in the central nervous system and glutamate activates both ionotropic and metabotropic glutamate receptors. Glutamatergic receptor 8 neurotransmission is involved in most aspects of normal brain function and can be isoform b perturbed in many neuropathologic conditions. The metabotropic glutamate receptors precursor are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP caseade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses an alternate donor splice site at the penultimate exon compared to transcript variant 1, resulting in an isoform (b) of the same length, but with 16 different amino acids at the C-terminus compared to isoform a. This variant was designated as HmGluR8b by Malherbe et al, 1999 (PMID: 10216218). GRM8 Gain Exonic 2918 metabotropic L-glutamate is the major excitatory neurotransmitter in the central nervous system and glutamate activates both ionotropic and metabotropic glutamate receptors. Glutamatergic receptor 8 neurotransmission is involved in most aspects of normal brain function and can be isoform b perturbed in many neuropathologic conditions. The metabotropic glutamate receptors precursor are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP caseade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) uses an alternate donor splice site at the penultimate exon compared to transcript variant 1, resulting in an isoform (b) of the same length, but with 16 different amino acids at the C-terminus compared to isoform a. This variant was designated as HmGluR8b by Malherbe et al, 1999 (PMID: 10216218). HECW1 Loss Intronic 23072 E3 ubiquitin- N/A protein ligase HECW1 HNRNPA2B1 Gain Exonic 3181 heterogeneous This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and ribonucleoproteins they complex with heterogeneous nuclear RNA (hnRNA). These proteins are A2/B1 associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA isoform B1 processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, July 2008]. Transcript Variant: This variant (B1) contains an additional 36 bases compared to variant A2. This additional region affects only the beginning of the coding region. The N-terminus of isoform B1 is thus different from isoform A2. HSD17B12 Loss Exonic 51144 estradiol 17- This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta- beta- HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also dehydrogenase involved in fatty acid elongation. [provided by RefSeq, October 2011]. 12 IFNA22P Gain Exonic 3453 N/A N/A IL32 Loss Exonic 9235 interleukin- This gene encodes a member of the cytokine family. The protein contains a tyrosine 32 isoform D sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, July 2008]. Transcript Variant: This variant (7) lacks two alternate exons in the 5 UTR and an alternate in-frame exon within the coding region, compared to variant 1, resulting in a shorter protein (isoform D). JPH3 Both Intronic 57338 junctophilin- Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic 3 reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansions at the Huntingtons disease (HD)-like 2 locus have been identified in this gene, which is a member of the junctophilin gene family. [provided by RefSeq, July 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. KLHDC4 Loss Exonic 54758 kelch N/A domain- containing protein 4 isoform 2 LEP Gain Exonic 3952 leptin This gene encodes a protein that is secreted by white adipocytes, and which plays a precursor major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, July 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. LOC255130 Loss Intronic 255130 N/A N/A LTBP4 Loss Exonic 8425 latent- The protein encoded by this gene binds transforming growth factor beta (TGFB) as it transforming is secreted and targeted to the extracellular matrix. TGFB is biologically latent after growth factor secretion and insertion into the extracellular matrix, and sheds TGFB and other beta-binding proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe protein 4 pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants isoform b encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]. Transcript Variant: This variant (2) differs in the 5 UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. MCC Loss Both 4163 colorectal This gene is a candidate colorectal tumor suppressor gene that is thought to negatively mutant regulate cell cycle progression. The orthologous gene in the mouse expresses a cancer phosphoprotein associated with the plasma membrane and membrane organelles, and protein overexpression of the mouse protein inhibits entry into S phase. Multiple transcript isoform 1 variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. MIR125A Loss Exonic 406910 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri- miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. MIR3910-1 Loss Exonic 100500821 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri- miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR3910-2 Loss Exonic 100500902 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri- miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIR99B Loss Exonic 407056 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri- miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MIRLET7E Loss Exonic 406887 N/A microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri- miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, September 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5 and 3 ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. MMP25 Loss Exonic 64386 matrix Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown metallo- of extracellular matrix in normal physiological processes, such as embryonic proteinase-25 development, reproduction, and tissue remodeling, as well as in disease processes, preproprotein such as arthritis and metastasis. Most MMPs are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily, attached to the plasma membrane via a glycosylphosphatidyl inositol anchor. In response to bacterial infection or inflammation, the encoded protein is thought to inactivate alpha-1 proteinase inhibitor, a major tissue protectant against proteolytic enzymes released by activated neutrophils, facilitating the transendothelial migration of neutrophils to inflammatory sites. The encoded protein may also play a role in tumor invasion and metastasis through activation of MMP2. The gene has previously been referred to as MMP20 but has been renamed MMP25. [provided by RefSeq, July 2008]. MPV17L2 Gain Exonic 84769 mpv17-like N/A protein 2 precursor MR1 Loss Exonic 3140 major N/A histocompatibility complex class I- related gene protein isoform 4 precursor MYH4 Loss Exonic 4622 myosin-4 N/A NAALAD2 Loss Exonic 10003 N-acetylated- This gene is a member of the N-acetylated alpha-linked acidic dipeptidase alpha-linked (NAALADase) gene family. The representative member of this family is the gene acidic encoding human prostate-specific membrane antigen (PSM), which is a marker of dipeptidase 2 prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. [provided by RefSeq, July 2008]. NACAD Loss Exonic 23148 NAC-alpha N/A domain- containing protein 1 NCKAP5 Both Exonic 344148 nck- N/A associated protein 5 isoform 2 NCRNA00085 Loss Exonic N/A N/A N/A NDST3 Loss Intronic 9348 bifunctional This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ heparan N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein sulfate N- that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the deacetylase/ N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate N- and heparin, which are the initial chemical modifications required for the biosynthesis sulfotransferase of the functional oligosaccharide sequences that define the specific ligand binding 3 activities of heparan sulfate and heparin. [provided by RefSeq, November 2008]. NFE2L3 Gain Exonic 9603 nuclear factor This gene encodes a member of the cap n collar basic-region leucine zipper family of erythroid 2- transcription factors. The encoded protein heterodimerizes with small related factor musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in 3 target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, March 2009]. NOTCH2NL Gain Exonic 388677 notch N/A homolog 2 N-terminal- like protein NRXN1 Loss Both 9378 neurexin-1- Neurexins function in the vertebrate nervous system as cell adhesion molecules and beta isoform receptors. Two neurexin genes are among the largest known in human (NRXN1 and beta NRXN3). By using alternate promoters, splice sites and exons, predictions of precursor hundreds or even thousands of distinct mRNAs have been made. Most transcripts use the upstream promoter and encode alpha-neurexin isoforms; fewer transcripts are produced from the downstream promoter and encode beta-neurexin isoforms. Alpha- neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and they interact with neurexophilins. Beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. The RefSeq Project has decided to create only a few representative transcript variants of the multitude that are possible. [provided by RefSeq, October 2008]. Transcript Variant: This variant (beta) represents a beta neurexin transcript. It is transcribed from a downstream promoter, includes a different segment for its 5 UTR and 5 coding region, and lacks most of the 5 exons present in alpha transcripts, as compared to variant alpha2. The resulting protein (isoform beta) has a shorter and distinct N- terminus when it is compared to isoform alpha2. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. NRXN3 Loss Both 9369 neurexin-3- Neurexins are a family of proteins that function in the vertebrate nervous system as beta isoform cell adhesion molecules and receptors. They are encoded by several unlinked genes of 3 precursor which two, NRXN1 and NRXN3, are among the largest known human genes. Three of the genes (NRXN1-3) utilize two alternate promoters and include numerous alternatively spliced exons to generate thousands of distinct mRNA transcripts and protein isoforms. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms; a much smaller number of transcripts are produced from the downstream promoter and encode beta-neurexin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta- neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha- neurexins. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3) differs in the 5 UTR and has multiple coding region differences, compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus when compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. OR2V2 Gain Exonic 285659 olfactory Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal receptor 2V2 response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, July 2008]. PANK2 Loss Intronic 80025 pantothenate This gene encodes a protein belonging to the pantothenate kinase family and is the kinase 2, only member of that family to be expressed in mitochondria. Pantothenate kinase is a mitochondrial key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and isoform 2 mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden- Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) has an alternate first exon, and uses a downstream translation initiation site, compared to variant 1. The resulting protein (isoform 2) lacks an N-terminal segment compared to isoform 1, resulting in a shorter protein that shares identity through the C-terminus. Isoform 2 is not expressed in mitochondria. Variants 2 and 3 encode isoform 2. PHF1 Loss Exonic 5252 PHD finger This gene encodes a Polycomb group protein. The protein is a component of a histone protein 1 H3 lysine-27 (H3K27)-specific methyltransferase complex, and functions in isoform a transcriptional repression of homeotic genes. The protein is also recruited to double- strand breaks, and reduced protein levels results in X-ray sensitivity and increased homologous recombination. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. Transcript Variant: This variant (1), uses an alternate splice site and lacks an alternate exon in the 3 coding region resulting in a frameshift, compared to variant 2. The resulting isoform (a) has a shorter and distinct C-terminus, compared to isoform b. PLXNA4 Both Exonic 91584 plexin-A4 N/A isoform 1 precursor POT1 Gain Exonic 25913 protection of This gene is a member of the telombin family and encodes a nuclear protein involved telomeres in telomere maintenance. Specifically, this protein functions as a member of a multi- protein 1 protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere isoform 1 length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) encodes the longer isoform (1). PPP2R2B Loss Intronic 5521 serine/threonine- The product of this gene belongs to the phosphatase 2 regulatory subunit B family. protein Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is phosphatase implicated in the negative control of cell growth and division. It consists of a common 2A 55 kDa heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory regulatory subunit, that associates with a variety of regulatory subunits. The B subunit B regulatory subunit might modulate substrate selectivity and catalytic activity. This beta isoform gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this isoform a gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5 UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 66-78 copies in cases of SCA12. [provided by RefSeq, July 2008]. Transcript Variant: This variant (7) differs in the 5 UTR, which includes a trinucleotide repeat region, compared to variant 1. Transcript variants 1, 2, 3 and 7 encode the same isoform (a). PRSS2 Loss Exonic 5645 trypsin-2 This gene encodes a trypsinogen, which is a member of the trypsin family of serine preproprotein proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, July 2008]. PTPRN2 Both Intronic 5799 receptor-type The protein encoded by this gene is a member of the protein tyrosine phosphatase tyrosine- (PTP) family. PTPs are known to be signaling molecules that regulate a variety of protein cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic phosphatase transformation. This PTP possesses an extracellular region, a single transmembrane N2 isoform 3 region, and a single intracellular catalytic domain, and thus represents a receptor-type precursor PTP. The catalytic domain of this PTP is most closely related to PTPRN/IA-2beta. This PTP and PTPRN are both found to be major autoantigens associated with insulin-dependent diabetes mellitus. Three alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3) lacks an internal fragment within the coding region when compared to variant 1. The translation remains in-frame, and thus results in a protein that lacks a 29 aa internal segment, as compared to isoform (1). RAB3A Gain Exonic 5864 ras-related N/A protein Rab- 3A RERE Both Intronic 473 arginine- This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) glutamic acid dipeptide repeat-containing proteins. The encoded protein co-localizes with a dipeptide transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar repeats protein in mouse associates with histone deacetylase and is thought to function as a protein transcriptional co-repressor during embryonic development. Multiple transcript isoform b variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (3) contains a distinct 5 UTR and lacks an in-frame portion of the 5 coding region, compared to variant 1. The resulting isoform (b) has a shorter N-terminus when compared to isoform a. RGS7 Loss Intronic 6000 regulator of N/A G-protein signaling 7 ROBO2 Loss Intronic 6092 roundabout This gene belongs to the ROBO family, part of the immunoglobulin superfamily homolog 2 proteins that are highly conserved from fly to human. The encoded protein is a isoform receptor for SLIT2, molecules known to function in axon guidance and cell migration. ROBO2a Defects in this gene are the cause of vesicoureteral reflux type 2. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (1) encodes the longer protein (isoform ROBO2a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. SAE1 Gain Exonic 10055 SUMO- Posttranslational modification of proteins by the addition of the small protein SUMO activating (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and enzyme intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that subunit 1 functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et isoform b al., 1999 [PubMed 9920803]). [supplied by OMIM, March 2010]. Transcript Variant: This variant (2) lacks two alternate exons, compared to variant 1, which causes a frameshift. The resulting protein (isoform b) has a distinct C-terminus and is shorter than isoform a. SBF2 Loss Intronic 81846 myotubularin- This gene encodes a pseudophosphatase and member of the myotubularin-related related protein family. This gene maps within the CMT4B2 candidate region of chromosome protein 13 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, July 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. SEC22B Gain Exonic 9554 vesicle- The protein encoded by this gene is a member of the SEC22 family of vesicle trafficking trafficking proteins. It seems to complex with SNARE and it is thought to play a role protein in the ER-Golgi protein trafficking. This protein has strong similarity to Mus SEC22b musculus and Cricetulus griseus proteins. [provided by RefSeq, September 2009]. precursor SHKBP1 Loss Exonic 92799 SH3KBP1- N/A binding protein 1 SPTBN4 Loss Exonic 57731 spectrin beta Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma chain, brain 3 membrane to the actin cytoskeleton, and functions in the determination of cell shape, isoform arrangement of transmembrane proteins, and organization of organelles. It is sigma1 composed of two antiparallel dimers of alpha- and beta-subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (sigmal) represents the longer transcript and encodes the longer isoform (sigmal), also known as the 289 kDa isoform. STX6 Loss Exonic 10228 syntaxin-6 N/A SYAP1 Gain Exonic 94056 N/A N/A SYNGAP1 Loss Exonic 8831 ras GTPase- The protein encoded by this gene is a major component of the postsynaptic density activating (PSD), a group of proteins found associated with NMDA receptors at synapses. The protein encoded protein is phosphorylated by calmodulin-dependent protein kinase II and SynGAP dephosphorylated by NMDA receptor activation. Defects in this gene are a cause of mental retardation autosomal dominant type 5 (MRD5). [provided by RefSeq, December 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. TM4SF5 Loss Exonic 9032 transmembrane The protein encoded by this gene is a member of the transmembrane 4 superfamily, 4 L6 also known as the tetraspanin family. Most of these members are cell-surface proteins family that are characterized by the presence of four hydrophobic domains. The proteins member 5 mediate signal transduction events that play a role in the regulation of cell precursor development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is highly similar in sequence and structure to transmembrane 4 superfamily member 1. It may play a role in cell proliferation, and overexpression of this protein may be associated with the uncontrolled growth of tumour cells. [provided by RefSeq, July 2008]. TRAF3IP1 Gain Intronic 26146 TRAF3- N/A interacting protein 1 isoform 2 TRIAP1 Gain Exonic 51499 TP53- N/A regulated inhibitor of apoptosis 1 TRIB3 Loss Exonic 57761 tribbles The protein encoded by this gene is a putative protein kinase that is induced by the homolog 3 transcription factor NF-kappaB. The encoded protein is a negative regulator of NF- kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. [provided by RefSeq, July 2008]. UBE4B Loss Intronic 10277 ubiquitin The modification of proteins with ubiquitin is an important cellular mechanism for conjugation targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at factor E4 B least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin- isoform 2 conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, July 2008]. Transcript Variant: This variant (2) lacks an in-frame coding exon in the middle region of the CDS, and thus encodes a shorter isoform (2), as compared to variant 1. WDR25 Loss Intronic 79446 WD repeat- N/A containing protein 25 YWHAE Gain Exonic 7531 14-3-3 This gene product belongs to the 14-3-3 family of proteins which mediate signal protein transduction by binding to phosphoserine-containing proteins. This highly conserved epsilon protein family is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. It interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. Two transcript variants, one protein-coding and the other non-protein-coding, have been found for this gene. [provided by RefSeq, August 2008]. Transcript Variant: This variant (1) represents the protein-coding transcript. ZFAND3 Gain Intronic 60685 AN1-type N/A zinc finger protein 3 ZNF517 Loss Exonic 340385 zinc finger N/A protein 517
[0228] Table 6 represents a non-redundant list of genes for all genes listed in Table 5. Column 1 refers to the gene name using the RefSeq Gene Symbol nomenclature. CNV classifications of gain or loss in column 2 indicate whether each CNV region found in the subjects was duplicated/amplified (gain) or deleted (loss) in the genome. Column 3 refers to whether the CNV Gene Region is intronic, exonic or both. Intronic refers to CNVs affecting introns only; Exonic refers to CNVs affecting part or all of one or more exons, which may include adjacent intronic regions if the CNV extends beyond the exonic region. Column 4 refers to the DNA Accession number associated with each respective gene. Column 5 lists the full gene name and column 6 refers to a summary of each respective gene's function.
TABLE-US-00007 TABLE 7 CNV RefSeq RefSeq Gene Gene CNV Accession RefSeq Gene Description/Definition SEQ ID Symbol Region Type Number (transcript variant = tv; HS = HS) SEQ ID 2558 RERE intronic Both NM_012102 HS arginine-glutamic acid dipeptide (RE) repeats (RERE), tv1, mRNA. SEQ ID 2559 RERE intronic Both NM_001042681 HS arginine-glutamic acid dipeptide (RE) repeats (RERE), tv2, mRNA. SEQ ID 2560 UBE4B intronic Loss NM_006048 HS ubiquitination factor E4B (UBE4B), tv2, mRNA. SEQ ID 2561 UBE4B intronic Loss NM_001105562 HS ubiquitination factor E4B (UBE4B), tv1, mRNA. SEQ ID 2562 DPYD both Loss NM_000110 HS dihydropyrimidine dehydrogenase (DPYD), tv1, mRNA. SEQ ID 2563 SEC22B exonic Gain NM_004892 HS SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene) (SEC22B), mRNA. SEQ ID 2564 NOTCH2NL exonic Gain NM_203458 HS notch 2 N-terminal like (NOTCH2NL), mRNA. SEQ ID 2565 STX6 exonic Loss NM_005819 HS syntaxin 6 (STX6), mRNA. SEQ ID 2566 MR1 exonic Loss NM_001195000 HS major histocompatibility complex, class I-related (MR1), tv3, mRNA. SEQ ID 2567 MR1 exonic Loss NM_001195035 HS major histocompatibility complex, class I-related (MR1), tv4, mRNA. SEQ ID 2568 MR1 exonic Loss NM_001194999 HS major histocompatibility complex, class I-related (MR1), tv2, mRNA. SEQ ID 2569 MR1 exonic Loss NM_001531 HS major histocompatibility complex, class I-related (MR1), tv1, mRNA. SEQ ID 2570 RGS7 intronic Loss NM_002924 HS regulator of G-protein signaling 7 (RGS7), mRNA. SEQ ID 2571 GALNT14 intronic Loss NM_024572 HS UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- acetylgalactosaminyltransferase 14 (GalNAc-T14) (GALNT14), tv1, mRNA. SEQ ID 2572 GALNT14 intronic Loss NR_045602 HS UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- acetylgalactosaminyltransferase 14 (GalNAc-T14) (GALNT14), tv4, non-coding RNA. SEQ ID 2573 GALNT14 intronic Loss NM_001253827 HS UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- acetylgalactosaminyltransferase 14 (GalNAc-T14) (GALNT14), tv3, mRNA. SEQ ID 2574 GALNT14 intronic Loss NM_001253826 HS UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- acetylgalactosaminyltransferase 14 (GalNAc-T14) (GALNT14), tv2, mRNA. SEQ ID 2575 NRXN1 both Loss NM_004801 HS neurexin 1 (NRXN1), tvalpha1, mRNA. SEQ ID 2576 NRXN1 both Loss NM_001135659 HS neurexin 1 (NRXN1), tvalpha2, mRNA. SEQ ID 2577 CNTNAP5 intronic Loss NM_130773 HS contactin associated protein-like 5 (CNTNAP5), mRNA. SEQ ID 2578 NCKAP5 both Both NM_207363 HS NCK-associated protein 5 (NCKAP5), tv1, mRNA. SEQ ID 2579 NCKAP5 both Both NM_207481 HS NCK-associated protein 5 (NCKAP5), tv2, mRNA. SEQ ID 2580 ARHGAP15 exonic Both NM_018460 HS Rho GTPase activating protein 15 (ARHGAP15), mRNA. SEQ ID 2581 CALCRL intronic Loss NM_005795 HS calcitonin receptor-like (CALCRL), tv1, mRNA. SEQ ID 2582 ERBB4 intronic Loss NM_005235 HS v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) (ERBB4), tvJM-a/CVT-1, mRNA. SEQ ID 2583 ERBB4 intronic Loss NM_001042599 HS v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) (ERBB4), tvJM-a/CVT-2, mRNA. SEQ ID 2584 DNER intronic Loss NM_139072 HS delta/notch-like EGF repeat containing (DNER), mRNA. SEQ ID 2585 TRAF3IP1 intronic Gain NM_001139490 HS TNF receptor-associated factor 3 interacting protein 1 (TRAF3IP1), tv2, mRNA. SEQ ID 2586 TRAF3IP1 intronic Gain NM_015650 HS TNF receptor-associated factor 3 interacting protein 1 (TRAF3IP1), tv1, mRNA. SEQ ID 2587 FHIT both Loss NM_001166243 HS fragile histidine triad (FHIT), tv2, mRNA. SEQ ID 2588 FHIT both Loss NM_002012 HS fragile histidine triad (FHIT), tv1, mRNA. SEQ ID 2589 ROBO2 intronic Loss NM_001128929 HS roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), tv1, mRNA. SEQ ID 2590 ROBO2 intronic Loss NM_002942 HS roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), tv2, mRNA. SEQ ID 2591 LOC255130 intronic Loss NR_034081 HS uncharacterized LOC255130 (LOC255130), non-coding RNA. SEQ ID 2592 ANTXR2 intronic Gain NM_058172 HS anthrax toxin receptor 2 (ANTXR2), tv1, mRNA. SEQ ID 2593 GRID2 intronic Loss NM_001510 HS glutamate receptor, ionotropic, delta 2 (GRID2), mRNA. SEQ ID 2594 DAPP1 exonic Gain NM_014395 HS dual adaptor of phosphotyrosine and 3-phosphoinositides (DAPP1), mRNA. SEQ ID 2595 NDST3 intronic Loss NM_004784 HS N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 (NDST3), mRNA. SEQ ID 2596 BHMT2 exonic Gain NM_001178005 HS betaine--homocysteine S-methyltransferase 2 (BHMT2), tv2, mRNA. SEQ ID 2597 BHMT2 exonic Gain NM_017614 HS betaine--homocysteine S-methyltransferase 2 (BHMT2), tv1, mRNA. SEQ ID 2598 MCC both Loss NM_002387 HS mutated in colorectal cancers (MCC), tv2, mRNA. SEQ ID 2599 MCC both Loss NM_001085377 HS mutated in colorectal cancers (MCC), tv1, mRNA. SEQ ID 2600 PPP2R2B intronic Loss NM_181677 HS protein phosphatase 2, regulatory subunit B, beta (PPP2R2B), tv5, mRNA. SEQ ID 2601 PPP2R2B intronic Loss NM_181676 HS protein phosphatase 2, regulatory subunit B, beta (PPP2R2B), tv4, mRNA. SEQ ID 2602 PPP2R2B intronic Loss NM_181678 HS protein phosphatase 2, regulatory subunit B, beta (PPP2R2B), tv6, mRNA. SEQ ID 2603 PPP2R2B intronic Loss NM_181674 HS protein phosphatase 2, regulatory subunit B, beta (PPP2R2B), tv2, mRNA. SEQ ID 2604 OR2V2 exonic Gain NM_206880 HS olfactory receptor, family 2, subfamily V, member 2 (OR2V2), mRNA. SEQ ID 2605 SYNGAP1 exonic Loss NM_006772 HS synaptic Ras GTPase activating protein 1 (SYNGAP1), mRNA. SEQ ID 2606 CUTA exonic Loss NM_001014433 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv1, mRNA. SEQ ID 2607 PHF1 exonic Loss NR_027692 HS PHD finger protein 1 (PHF1), tv3, non-coding RNA. SEQ ID 2608 PHF1 exonic Loss NM_024165 HS PHD finger protein 1 (PHF1), tv2, mRNA. SEQ ID 2609 PHF1 exonic Loss NM_002636 HS PHD finger protein 1 (PHF1), tv1, mRNA. SEQ ID 2610 CUTA exonic Loss NM_001014840 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv5, mRNA. SEQ ID 2611 CUTA exonic Loss NM_001014838 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv4, mRNA. SEQ ID 2612 CUTA exonic Loss NM_001014837 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv3, mRNA. SEQ ID 2613 CUTA exonic Loss NM_015921 HS cutA divalent cation tolerance homolog (E. coli) (CUTA), tv2, mRNA. SEQ ID 2614 ZFAND3 intronic Gain NM_021943 HS zinc linger, AN1-type domain 3 (ZFAND3), mRNA. SEQ ID 2615 EYS intronic Loss NM_001142800 HS eyes shut homolog (Drosophila) (EYS), tv1, mRNA. SEQ ID 2616 EYS intronic Loss NM_198283 HS eyes shut homolog (Drosophila) (EYS), tv3, mRNA. SEQ ID 2617 EYS intronic Loss NM_001142801 HS eyes shut homolog (Drosophila) (EYS), tv2, mRNA. SEQ ID 2618 NFE2L3 exonic Gain NM_004289 HS nuclear factor (erythroid-derived 2)-like 3 (NFE2L3), mRNA. SEQ ID 2619 HNRNPA2B1 exonic Gain NM_031243 HS heterogeneous nuclear ribonuclcoprotein A2/B1 (HNRNPA2B1), tvB1, mRNA. SEQ ID 2620 HNRNPA2B1 exonic Gain NM_002137 HS heterogeneous nuclear ribonuclcoprotein A2/B1 (HNRNPA2B1), tvA2, mRNA. SEQ ID 2621 HECW1 intronic Loss NM_015052 HS HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 (HECW1), mRNA. SEQ ID 2622 NACAD exonic Loss NM_001146334 HS NAC alpha domain containing (NACAD), mRNA. SEQ ID 2623 CCM2 exonic Loss NR_030770 HS cerebral cavernous malformation 2 (CCM2), tv5, non-coding RNA. SEQ ID 2624 CCM2 exonic Loss NM_031443 HS cerebral cavernous malformation 2 (CCM2), tv2, mRNA. SEQ ID 2625 CCM2 exonic Loss NM_001167935 HS cerebral cavernous malformation 2 (CCM2), tv4, mRNA. SEQ ID 2626 CCM2 exonic Loss NM_001167934 HS cerebral cavernous malformation 2 (CCM2), tv3, mRNA. SEQ ID 2627 CCM2 exonic Loss NM_001029835 HS cerebral cavernous malformation 2 (CCM2), tv1, mRNA. SEQ ID 2628 POT1 exonic Gain NR_003103 HS protection of telomeres 1 (POT1), tv3, non-coding RNA. SEQ ID 2629 POT1 exonic Gain NM_015450 HS protection of telomeres 1 (POT1), tv1, mRNA. SEQ ID 2630 POT1 exonic Gain NM_001042594 HS protection of telomeres 1 (POT1), tv4, mRNA. SEQ ID 2631 POT1 exonic Gain NR_003104 HS protection of telomeres 1 (POT1), tv5, non-coding RNA. SEQ ID 2632 POTI exonic Gain NR_003102 HS protection of telomeres 1 (POT1), tv2, non-coding RNA. SEQ ID 2633 GRM8 both Both NM_000845 HS glutamate receptor, metabotropic 8 (GRM8), tv1, mRNA. SEQ ID 2634 GRM8 both Both NR_028041 HS glutamate receptor, metabotropic 8 (GRM8), tv3, non-coding RNA. SEQ ID 2635 GRM8 both Both NM_001127323 HS glutamate receptor, metabotropic 8 (GRM8), tv2, mRNA. SEQ ID 2636 LEP exonic Gain NM_000230 HS leptin (LEP), mRNA. SEQ ID 2637 PLXNA4 exonic Both NM_020911 HS plexin A4 (PLXNA4), tv1, mRNA. SEQ ID 2638 PLXNA4 exonic Both NM_001105543 HS plexin A4 (PLXNA4), tv3, mRNA. SEQ ID 2639 FLJ40288 exonic #N/A NR_046323 HS uncharacterized FLJ40288 (FLJ40288), non-coding RNA. SEQ ID 2640 PLXNA4 exonic Both NM_181775 HS plexin A4 (PLXNA4), tv2, mRNA. SEQ ID 2641 PRSS2 exonic Loss NM_002770 HS protease, serine, 2 (trypsin 2) (PRSS2), mRNA. SEQ ID 2642 PTPRN2 intronic Both NM_002847 HS protein tyrosine phosphatase, receptor type, N polypeptide 2 (PTPRN2), tv1, mRNA. SEQ ID 2643 PTPRN2 intronic Both NM_130843 HS protein tyrosine phosphatase, receptor type, N polypeptide 2 (PTPRN2), tv3, mRNA. SEQ ID 2644 PTPRN2 intronic Both NM_130842 HS protein tyrosine phosphatase, receptor type, N polypeptide 2 (PTPRN2), tv2, mRNA. SEQ ID 2645 CHRNB3 intronic Both NM_000749 HS cholinergic receptor, nicotinic, beta 3 (neuronal) (CHRNB3), mRNA. SEQ ID 2646 ZNF517 exonic Loss NM_213605 HS zinc finger protein 517 (ZNF517), mRNA. SEQ ID 2647 IFNA22P exonic Gain NR_036676 HS interferon, alpha 22, pseudogene (IFNA22P), non-coding RNA. SEQ ID 2648 MIR3910-1 exonic Loss NR_037472 HS microRNA 3910-1 (MIR3910-1), microRNA. SEQ ID 2649 MIR3910-2 exonic Loss NR_037489 HS microRNA 3910-2 (MIR3910-2), microRNA. SEQ ID 2650 CTNNA3 intronic Loss NM_013266 HS catenin (cadherin-associated protein), alpha 3 (CTNNA3), tv1, mRNA. SEQ ID 2651 CTNNA3 intronic Loss NM_001127384 HS catenin (cadherin-associated protein), alpha 3 (CTNNA3), tv2, mRNA. SEQ ID 2652 C10orf11 intronic Gain NM_032024 HS chromosome 10 open reading frame 11 (C10orf11), mRNA. SEQ ID 2653 BTRC intronic Gain NM_003939 HS beta-transducin repeat containing E3 ubiquitin protein ligase (BTRC), tv2, mRNA. SEQ ID 2654 BTRC intronic Gain NM_033637 HS beta-transducin repeat containing E3 ubiquitin protein ligase (BTRC), tv1, mRNA. SEQ ID 2655 BTRC intronic Gain NM_001256856 HS beta-transducin repeat containing E3 ubiquitin protein ligase (BTRC), tv3, mRNA. SEQ ID 2656 SBF2 intronic Loss NM_030962 HS SET binding factor 2 (SBF2), mRNA. SEQ ID 2657 HSD17B12 exonic Loss NM_016142 HS hydroxysteroid (17-beta) dehydrogenase 12 (HSD17B12), mRNA. SEQ ID 2658 NAALAD2 exonic Loss NM_005467 HS N-acetylated alpha-linked acidic dipeptidase 2 (NAALAD2), mRNA. SEQ ID 2659 ERC1 intronic Both NR_027948 HS ELKS/RAB6-interacting/CAST family member 1 (ERC1), tvbeta, non-coding RNA. SEQ ID 2660 ERC1 intronic Both NR_027949 HS ELKS/RAB6-interacting/CAST family member 1 (ERC1), tvgamma, non-coding RNA. SEQ ID 2661 ERC1 intronic Both NM_178040 HS ELKS/RAB6-interacting/CAST family member 1 (ERC1), tvepsilon, mRNA. SEQ ID 2662 ERC1 intronic Both NR_027946 HS ELKS/RAB6-interacting/CAST family member 1 (ERC1), tvalpha, non-coding RNA. SEQ ID 2663 ERC1 intronic Both NM_178039 HS ELKS/RAB6-interacting/CAST family member 1 (ERC1), tvdelta, mRNA. SEQ ID 2664 ATXN2 intronic Loss NM_002973 HS ataxin 2 (ATXN2), mRNA. SEQ ID 2665 TRIAP1 exonic Gain NM_016399 HS TP53 regulated inhibitor of apoptosis 1 (TRIAP1), mRNA. SEQ ID 2666 GATC exonic Gain NM_176818 HS glutamyl-tRNA(Gln) amidotransferase, subunit C (GATC), tv1, mRNA. SEQ ID 2667 COX6A1 exonic Gain NM_004373 HS cytochrome c oxidase subunit VIa polypeptide 1 (COX6A1), nuclear gene encoding mitochondrial protein, mRNA. SEQ ID 2668 GATC exonic Gain NR_033684 HS glutamyl-tRNA(Gln) amidotransferase, subunit C (GATC), tv2, non-coding RNA. SEQ ID 2669 GPHN intronic Loss NM_001024218 HS gephyrin (GPHN), tv2, mRNA. SEQ ID 2670 GPHN intronic Loss NM_020806 HS gephyrin (GPHN), tv1, mRNA. SEQ ID 2671 NRXN3 both Loss NM_004796 HS neurexin 3 (NRXN3), tv1, mRNA. SEQ ID 2672 NRXN3 both Loss NM_001105250 HS neurexin 3 (NRXN3), tv3, mRNA. SEQ ID 2673 NRXN3 both Loss NM_138970 HS neurexin 3 (NRXN3), tv2, mRNA. SEQ ID 2674 WDR25 intronic Loss NM_001161476 HS WD repeat domain 25 (WDR25), tv2, mRNA. SEQ ID 2675 WDR25 intronic Loss NM_024515 HS WD repeat domain 25 (WDR25), tv1, mRNA. SEQ ID 2676 EHD4 intronic Loss NM_139265 HS EH-domain containing 4 (EHD4), mRNA. SEQ ID 2677 CIB2 exonic Gain NM_006383 HS calcium and integrin binding family member 2 (CIB2), tv1, mRNA. SEQ ID 2678 IL32 exonic Loss NM_001012635 HS interleukin 32 (IL32), tv6, mRNA. SEQ ID 2679 IL32 exonic Loss NM_004221 HS interleukin 32 (IL32), tv2, mRNA. SEQ ID 2680 IL32 exonic Loss NM_001012636 HS interleukin 32 (IL32), tv7, mRNA. SEQ ID 2681 MMP25 exonic Loss NM_022468 HS matrix metallopeptidase 25 (MMP25), mRNA. SEQ ID 2682 IL32 exonic Loss NM_001012633 HS interleukin 32 (IL32), tv4, mRNA. SEQ ID 2683 IL32 exonic Loss NM_001012632 HS interleukin 32 (IL32), tv3, mRNA. SEQ ID 2684 IL32 exonic Loss NM_001012631 HS interleukin 32 (IL32), tv1, mRNA. SEQ ID 2685 IL32 exonic Loss NM_001012634 HS interleukin 32 (IL32), tv5, mRNA. SEQ ID 2686 IL32 exonic Loss NM_001012718 HS interleukin 32 (IL32), tv8, mRNA. SEQ ID 2687 JPH3 intronic Both NM_020655 HS junctophilin 3 (JPH3), tv1, mRNA. SEQ ID 2688 KLHDC4 exonic Loss NM_017566 HS kelch domain containing 4 (KLHDC4), tv1, mRNA. SEQ ID 2689 KLHDC4 exonic Loss NM_001184856 HS kelch domain containing 4 (KLHDC4), tv2, mRNA. SEQ ID 2690 KLHDC4 exonic Loss NM_001184854 HS kelch domain containing 4 (KLHDC4), tv3, mRNA. SEQ ID 2691 YWHAE exonic Gain NM_006761 HS tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (YWHAE), tv1, mRNA. SEQ ID 2692 YWHAE exonic Gain NR_024058 HS tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (YWHAE), tv2, non-coding RNA. SEQ ID 2693 TM4SF5 exonic Loss NM_003963 HS transmembrane 4 L six family member 5 (TM4SF5), mRNA. SEQ ID 2694 MYH4 exonic Loss NM_017533 HS myosin, heavy chain 4, skeletal muscle (MYH4), mRNA. SEQ ID 2695 BCAS3 intronic Loss NM_001099432 HS breast carcinoma amplified sequence 3 (BCAS3), tv1, mRNA. SEQ ID 2696 BCAS3 intronic Loss NM_017679 HS breast carcinoma amplified sequence 3 (BCAS3), tv2, mRNA. SEQ ID 2697 RAB3A exonic Gain NM_002866 HS RAB3A, member RAS oncogene family (RAB3A), mRNA. SEQ ID 2698 MPV17L2 exonic Gain NM_032683 HS MPV17 mitochondrial membrane protein-like 2 (MPV17L2), nuclear gene encoding mitochondrial protein, mRNA. SEQ ID 2699 SPTBN4 exonic Loss NM_025213 HS spectrin, beta, non-erythrocytic 4 (SPTBN4), tvsigma5, mRNA. SEQ ID 2700 SPTBN4 exonic Loss NM_020971 HS spectrin, beta, non-erythrocytic 4 (SPTBN4), tvsigma1, mRNA. SEQ ID 2701 LTBP4 exonic Loss NM_001042544 HS latent transforming growth factor beta binding protein 4 (LTBP4), tv1, mRNA. SEQ ID 2702 LTBP4 exonic Loss NM_003573 HS latent transforming growth factor beta binding protein 4 (LTBP4), tv2, mRNA. SEQ ID 2703 SHKBP1 exonic Loss NM_138392 HS SH3KBP1 binding protein 1 (SHKBP1), mRNA. SEQ ID 2704 LTBP4 exonic Loss NM_001042545 HS latent transforming growth factor beta binding protein 4 (LTBP4), tv3, mRNA. SEQ ID 2705 SAE1 exonic Gain NR_027280 HS SUMO1 activating enzyme subunit 1 (SAE1), tv4, non-coding RNA. SEQ ID 2706 SAE1 exonic Gain NM_001145713 HS SUMO1 activating enzyme subunit 1 (SAE1), tv2, mRNA. SEQ ID 2707 SAE1 exonic Gain NM_001145714 HS SUMO1 activating enzyme subunit 1 (SAE1), tv3, mRNA. SEQ ID 2708 SAE1 exonic Gain NM_005500 HS SUMO1 activating enzyme subunit 1 (SAE1), tv1, mRNA. SEQ ID 2709 SHANK1 exonic Loss NM_016148 HS SH3 and multiple ankyrin repeat domains 1 (SHANK1), mRNA. SEQ ID 2710 CLEC11A exonic Loss NM_002975 HS C-type lectin domain family 11, member A (CLEC11A), mRNA. SEQ ID 2711 MIR99B exonic Loss NR_029843 HS microRNA 99b (MIR99B), microRNA. SEQ ID 2712 LINC00085 exonic Loss NR_024330 HS long intergenic non-protein coding RNA 85 (LINC00085), non- coding RNA. SEQ ID 2713 MIRLET7E exonic Loss NR_029482 HS microRNA let-7e (MIRLET7E), microRNA. SEQ ID 2714 MIR125A exonic Loss NR_029693 HS microRNA 125a (MIR125A), microRNA. SEQ ID 2715 TRIB3 exonic Loss NM_021158 HS tribbles homolog 3 (Drosophila) (TRIB3), mRNA. SEQ ID 2716 PANK2 intronic Loss NM_024960 HS pantothenate kinase 2 (PANK2), tv3, mRNA. SEQ ID 2717 PANK2 intronic Loss NM_153640 HS pantothenate kinase 2 (PANK2), tv2, mRNA. SEQ ID 2718 PANK2 intronic Loss NM_153638 HS pantothenate kinase 2 (PANK2), nuclear gene encoding mitochondrial protein, tv1, mRNA. SEQ ID 2719 LINC00478 both Loss NR_027790 HS long intergenic non-protein coding RNA 478 (LINC00478), tv1, non-coding RNA. SEQ ID 2720 LINC00478 both Loss NR_027791 HS long intergenic non-protein coding RNA 478 (LINC00478), tv2, non-coding RNA. SEQ ID 2721 DHRSX both Both NM_145177 HS dehydrogenase/reductase (SDR family) X-linked (DHRSX), mRNA. SEQ ID 2722 SYAP1 exonic Gain NR_033181 HS synapse associated protein 1 (SYAP1), tv2, non-coding RNA. SEQ ID 2723 SYAP1 exonic Gain NM_032796 HS synapse associated protein 1 (SYAP1), tv1, mRNA. SEQ ID 2724 APOO exonic Gain NR_026545 HS apolipoprotein O (APOO), tv2, non-coding RNA. SEQ ID 2725 APOO exonic Gain NM_024122 HS apolipoprotein O (APOO), tv1, mRNA. SEQ ID 2726 DMD intronic Both NM_004012 HS dystrophin (DMD), tvDp260-2, mRNA. SEQ ID 2727 DMD intronic Both NM_004010 HS dystrophin (DMD), tvDp427p2, mRNA. SEQ ID 2728 DMD intronic Both NM_004011 HS dystrophin (DMD), tvDp260-1, mRNA. SEQ ID 2729 DMD intronic Both NM_000109 HS dystrophin (DMD), tvDp427c, mRNA. SEQ ID 2730 DMD intronic Both NM_004007 HS dystrophin (DMD), tvDp427l, mRNA. SEQ ID 2731 DMD intronic Both NM_004021 HS dystrophin (DMD), tvDp140b, mRNA. SEQ ID 2732 DMD intronic Both NM_004013 HS dystrophin (DMD), tvDp140, mRNA. SEQ ID 2733 DMD intronic Both NM_004020 HS dystrophin (DMD), tvDp140c, mRNA. SEQ ID 2734 DMD intronic Both NM_004006 HS dystrophin (DMD), tvDp427m, mRNA. SEQ ID 2735 DMD intronic Both NM_004009 HS dystrophin (DMD), tvDp427p1, mRNA. SEQ ID 2736 DMD intronic Both NM_004023 HS dystrophin (DMD), tvDp140bc, mRNA. SEQ ID 2737 DMD intronic Both NM_004022 HS dystrophin (DMD), tvD140ab, mRNA. SEQ ID 2738 DIAPH2 intronic Loss NM_006729 HS diaphanous homolog 2 (Drosophila) (DIAPH2), tv156, mRNA. SEQ ID 2739 DIAPH2 intronic Loss NM_007309 HS diaphanous homolog 2 (Drosophila) (DIAPH2), tv12C, mRNA.
[0229] Table 7 represents a list of all genes listed in Table 5 (non-redundant) and Table 6. Column 2 lists the RefSeq Gene Symbol for each gene. Column 4 refers to the CNV classification based on whether each CNV found in the subjects was duplicated/amplified (gain) or deleted (loss) in the genome. Column 3 refers to whether the CNV Gene Region (i.e., portion of the gene impacted by the CNV) is intronic, exonic or both. Intronic refers to CNVs affecting introns only; Exonic refers to CNVs affecting part or all of one or more exons, which may include adjacent intronic regions if the CNV extends beyond the exonic region. Column 1 refers to the assigned sequence ID of full genomic extent of each of the transcripts. Column 5 refers to the RefSeq RNA Accession number. Column 6 refers to a brief description of an RNA (usually an mRNA, but can be a non-coding RNA) for each respective gene, including multiple mRNA or other RNA entries associated with a gene.
[0230] In one embodiment, the transcripts listed in Table 7 can be expression products of the same gene biomarker as listed in Table 5 or 6. In some embodiments, a gene biomarker can comprise genomic DNA encoding the gene, including exons, introns, and/or regulatory binding regions (such as enhancers, promoters, silencers, and/or response elements). In one embodiment, point mutations, polymorphisms, translocations, insertions, deletions, amplifications, inversions, microsatellites, interstitial deletions, copy number variations (CNVs), loss of heterozygosity, or any other aberrations which affect the structure or function of one or more gene biomarkers and/or expression products thereof, are associated with a developmental disorder as described herein.
Computer-Implemented Aspects
[0231] As understood by those of ordinary skill in the art, the methods and information described herein (genetic variation association with developmental disorders) can be implemented, in all or in part, as computer executable instructions on known computer readable media. For example, the methods described herein can be implemented in hardware. Alternatively, the method can be implemented in software stored in, for example, one or more memories or other computer readable medium and implemented on one or more processors. As is known, the processors can be associated with one or more controllers, calculation units and/or other units of a computer system, or implanted in firmware as desired. If implemented in software, the routines can be stored in any computer readable memory such as in RAM, ROM, flash memory, a magnetic disk, a laser disk, or other storage medium, as is also known. Likewise, this software can be delivered to a computing device via any known delivery method including, for example, over a communication channel such as a telephone line, the Internet, a wireless connection, etc., or via a transportable medium, such as a computer readable disk, flash drive, etc.
[0232] More generally, and as understood by those of ordinary skill in the art, the various steps described above can be implemented as various blocks, operations, tools, modules and techniques which, in turn, can be implemented in hardware, firmware, software, or any combination of hardware, firmware, and/or software. When implemented in hardware, some or all of the blocks, operations, techniques, etc. can be implemented in, for example, a custom integrated circuit (IC), an application specific integrated circuit (ASIC), a field programmable logic array (FPGA), a programmable logic array (PLA), etc.
[0233] Results from such genotyping can be stored in a data storage unit, such as a data carrier, including computer databases, data storage disks, or by other convenient data storage means. In certain embodiments, the computer database is an object database, a relational database or a post-relational database. Data can be retrieved from the data storage unit using any convenient data query method.
[0234] When implemented in software, the software can be stored in any known computer readable medium such as on a magnetic disk, an optical disk, or other storage medium, in a RAM or ROM or flash memory of a computer, processor, hard disk drive, optical disk drive, tape drive, etc. Likewise, the software can be delivered to a user or a computing system via any known delivery method including, for example, on a computer readable disk or other transportable computer storage mechanism.
[0235] The steps of the claimed methods can be operational with numerous other general purpose or special purpose computing system environments or configurations. Examples of well known computing systems, environments, and/or configurations that can be suitable for use with the methods or system of the claims include, but are not limited to, personal computers, server computers, hand-held or laptop devices, multiprocessor systems, microprocessor-based systems, set top boxes, programmable consumer electronics, network PCs, minicomputers, mainframe computers, distributed computing environments that include any of the above systems or devices, and the like.
[0236] The steps of the claimed method and system can be described in the general context of computer-executable instructions, such as program modules, being executed by a computer. Generally, program modules include routines, programs, objects, components, and/or data structures that perform particular tasks or implement particular abstract data types. The methods and apparatus can also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network. In both integrated and distributed computing environments, program modules can be located in both local and remote computer storage media including memory storage devices. Numerous alternative embodiments could be implemented, using either current technology or technology developed after the filing date of this application, which would still fall within the scope of the claims defining the disclosure.
[0237] While the risk evaluation system and method, and other elements, have been described as preferably being implemented in software, they can be implemented in hardware, firmware, etc., and can be implemented by any other processor. Thus, the elements described herein can be implemented in a standard multi-purpose CPU or on specifically designed hardware or firmware such as an application-specific integrated circuit (ASIC) or other hard-wired device as desired. When implemented in software, the software routine can be stored in any computer readable memory such as on a magnetic disk, a laser disk, or other storage medium, in a RAM or ROM of a computer or processor, in any database, etc. Likewise, this software can be delivered to a user or a screening system via any known or desired delivery method including, for example, on a computer readable disk or other transportable computer storage mechanism or over a communication channel, for example, a telephone line, the internet, or wireless communication. Modifications and variations can be made in the techniques and structures described and illustrated herein without departing from the spirit and scope of the present disclosure.
ASD Therapeutics
[0238] Research into a cure for Pervasive Developmental Disorders (PDD), such as ASD or Pervasive Developmental Disorders-Not Otherwise Specified (PDD-NOS), such as Asperger Syndrome, Rett Syndrome, fragile X syndrome, and/or Childhood Disintegrative Disorder is ongoing. Ways to help minimize the symptoms of autism and to maximize learning exist, including but not limited to, behavioral therapy, educational and/or school-based options, and medication options, although currently there are no medications that can cure autism spectrum disorders or all of the symptoms. The U.S. Food and Drug Administration has not yet approved any medications specifically for the treatment of autism, but in many cases medication can treat some of the symptoms associated with autism. These treatments can include behavior management therapy to help reinforce wanted behaviors and reduce unwanted behaviors, which is often based on Applied Behavior Analysis (ABA), use of speech-language therapists to help people with autism improve their ability to communicate and interact with others, use of occupational therapists to help people find ways to adjust tasks to match their needs and abilities, and physical therapists design activities and exercise to build motor control and improve posture and balance, free appropriate public education from age 3 through high school or age 21, integration of a team of people, including the parents, teachers, caregivers, school psychologists, and other child development specialists to work together to design an Individualized Education Plan (IEP) to help guide the child's school experiences, selective serotonin reuptake inhibitors (SSRIs), tricyclics, psychoactive/anti-psychotics, stimulants, and anti-anxiety drugs are among the medications that a health care provider might use to treat symptoms of autism spectrum disorders.
[0239] A person skilled in the art will appreciate and understand that the genetic variants described herein in general may not, by themselves, provide an absolute identification of individuals who will develop a developmental disorder or related conditions. The variants described herein can indicate increased and/or decreased likelihood that individuals carrying the at-risk or protective variants of the disclosure will develop symptoms associated with a developmental disorder. This information can be used to, for example, initiate preventive measures at an early stage, perform regular physical and/or mental exams to monitor the progress and/or appearance of symptoms, or to schedule exams at a regular interval to identify early symptoms, so as to be able to apply treatment at an early stage. This is in particular important since developmental disorders and related disorders are heterogeneous disorders with symptoms that can be individually vague. Screening criteria require a number of symptoms to be present over a period of time; therefore, it is important to be able to establish additional risk factors that can aid in the screening, or facilitate the screening through in-depth phenotyping and/or more frequent examination, or both. For example, individuals with early symptoms that typically are not individually associated with a clinical screening of a developmental disorder and carry an at-risk genetic variation can benefit from early therapeutic treatment, or other preventive measure, or more rigorous supervision or more frequent examination. Likewise, individuals that have a family history of the disease, or are carriers of other risk factors associated with a developmental disorder can, in the context of additionally carrying at least one at-risk genetic variation, benefit from early therapy or other treatment.
[0240] Early symptoms of behavioral disorders such as a developmental disorder and related conditions may not be sufficient to fulfill standardized screening criteria. To fulfill those, a certain pattern of symptoms and behavioral disturbance needs to manifest itself over a period of time. Sometimes, certain physical characteristics can also be present. This makes at-risk genetic variants valuable in a screening setting, in particular high-risk variants. Determination of the presence of such variants warrants increased monitoring of the individual in question. Appearance of symptoms combined with the presence of such variants facilitates early screening, which makes early treatment possible. Genetic testing can thus be used to aid in the screening of disease in its early stages, before all criteria for formal screening criteria are all fulfilled. It is well established that early treatment is extremely important for developmental disorders and related disorders, which lends further support to the value of genetic testing for early diagnosis, prognosis, or theranosis of these disorders.
[0241] The present disclosure provides methods for identifying compounds or agents that can be used to treat a developmental disorder. Thus, the genetic variations and associated proteins of the disclosure are useful as targets for the identification and/or development of therapeutic agents. In certain embodiments, such methods include assaying the ability of an agent or compound to modulate the activity and/or expression of a nucleic acid that is associated with at least one genetic variation described herein (Tables 1 and 5), encoded products of the gene sequence, and any other molecules or proteins associated with these genes. This in turn can be used to identify agents or compounds that inhibit, enhance, or alter the undesired activity, localization, binding and/or expression of the encoded nucleic acid product, such as mRNA or polypeptides. For example, in some embodiments, small molecule drugs can be developed to target the aberrant protein(s) or RNA(s) resulting from specific disease-causing mutation(s) within a gene, such as described in: Peltz et al. (2009) RNA Biology 6(3):329-34; Van Goor et al. (2009) Proc. Natl. Acad. Sci. USA 106(44):18825-30; Van Goor et al. (2011) Proc. Natl. Acad. Sci. USA 108(46):18843-8; Ramsey et al. (2011) N. Engl. J. Med. 365(18):1663-72. The proteins associated with the CNVs listed in Tables 1 and 5 are described in Tables 4 and 7 as the accession number (accession) of mRNAs that would encode said proteins. Assays for performing such experiments can be performed in cell-based systems or in cell-free systems, as known to the skilled person. Cell-based systems include cells naturally expressing the nucleic acids of interest, or recombinant cells that have been genetically modified so as to express a certain desired nucleic acid molecule.
[0242] Variant gene expression in a subject can be assessed by expression of a variant-containing nucleic acid sequence or by altered expression of a normal/wild-type nucleic acid sequence due to variants affecting the level or pattern of expression of the normal transcripts, for example, variants in the regulatory or control region of the gene. Assays for gene expression include direct nucleic acid assays (mRNA), assays for expressed protein levels, or assays of collateral compounds involved in a pathway, for example, a signal pathway. Furthermore, the expression of genes that are up- or down-regulated in response to the signal pathway can also be assayed. Some embodiments include operably linking a reporter gene, such as luciferase, to the regulatory region of one or more gene of interest.
[0243] Modulators of gene expression can in some embodiments be identified when a cell is contacted with a candidate compound or agent, and the expression of mRNA is determined. The expression level of mRNA in the presence of the candidate compound or agent is compared to the expression level in the absence of the compound or agent. Based on this comparison, candidate compounds or agents for treating a developmental disorder can be identified as those modulating the gene expression of the variant gene, or gene expression of one or more other genes occurring within the same biological pathway or known, for example, to be binding partners of the variant gene. When expression of mRNA or the encoded protein is statistically significantly greater in the presence of the candidate compound or agent than in its absence, then the candidate compound or agent is identified as a stimulator or up-regulator of expression of the nucleic acid. When nucleic acid expression or protein level is statistically significantly less in the presence of the candidate compound or agent than in its absence, then the candidate compound can be identified as an inhibitor or down-regulator of the nucleic acid expression. The disclosure further provides methods of treatment using a compound identified through drug (compound and/or agent) screening as a gene modulator.
[0244] The genetic variations described herein can be used to identify novel therapeutic targets for a developmental disorder. For example, genes containing, or in linkage disequilibrium with, the genetic variations, or their products, as well as genes or their products that are directly or indirectly regulated by or interact with these variant genes or their products, can be targeted for the development of therapeutic agents to treat a developmental disorder, or prevent or delay onset of symptoms associated with a developmental disorder. Therapeutic agents can comprise one or more of, for example, small non-protein and non-nucleic acids, proteins, peptides, protein fragments, nucleic acids (DNA, RNAJ, PNA (peptide nucleic acids), or their derivatives or mimetics which can modulate the function and/or levels of the target genes or their gene products. In some embodiments, treatment of ASD can comprise treatment of one of the genes, or gene products derived thereof, such as mRNA or a polypeptide, with one or more of the therapeutics disclosed herein. In some embodiments, treatment of ASD can comprise treatment of 2 or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 or more of the genes, or gene products derived there from, with 2 or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 or more of the therapeutics disclosed herein.
RNA Therapeutics
[0245] The nucleic acids and/or variants of the disclosure, or nucleic acids comprising their complementary sequence, can be used as antisense constructs to control gene expression in cells, tissues or organs. The methodology associated with antisense techniques is well known to the skilled artisan, and is described and reviewed in Antisense Drug Technology: Principles, Strategies, and Applications, Crooke, Marcel Dekker Inc., New York (2001) In general, antisense nucleic acids are designed to be complementary to a region of mRNA expressed by a gene, so that the antisense molecule hybridizes to the mRNA, thus blocking translation of the mRNA into protein Several classes of antisense oligonucleotide are known to those skilled in the art, including cleavers and blockers. The former bind to target RNA sites, activate intracellular nucleases {e.g., Rnase H or Rnase L) that cleave the target RNA. Blockers bind to target RNA, inhibit protein translation by steric hindrance of the ribosomes. Examples of blockers include nucleic acids, morpholino compounds, locked nucleic acids and methylphosphonates (Thompson, Drug Discovery Today, 7:912-917 (2002)) Antisense oligonucleotides are useful directly as therapeutic agents, and are also useful for determining and validating gene function, for example, by gene knock-out or gene knock-down experiments. Antisense technology is further described in Lavery et al., Curr. Opin. Drug Discov Devel 6 561-569 (2003), Stephens et al., Curr. Opin. Mol Ther. 5.118-122 (2003), Kurreck, Eur. J. Biochem. 270.1628-44 (2003), Dias et al, Mol Cancer Ter. 1-347-55 (2002), Chen, Methods Mol Med. 75:621-636 (2003), Wang et al., Curr Cancer Drug Targets 1.177-96 (2001), and Bennett, Antisense Nucleic Acid Drug. Dev. 12 215-24 (2002)
[0246] The variants described herein can be used for the selection and design of antisense reagents that are specific for particular variants (e.g., particular genetic variations, or polymorphic markers in LD with particular genetic variations). Using information about the variants described herein, antisense oligonucleotides or other antisense molecules that specifically target mRNA molecules that contain one or more variants of the disclosure can be designed. In this manner, expression of mRNA molecules that contain one or more variant of the present disclosure (markers and/or haplotypes) can be inhibited or blocked In some embodiments, the antisense molecules are designed to specifically bind a particular allelic form (i.e., one or several variants (alleles and/or haplotypes)) of the target nucleic acid, thereby inhibiting translation of a product originating from this specific allele or haplotype, but which do not bind other or alternate variants at the specific polymorphic sites of the target nucleic acid molecule.
[0247] As antisense molecules can be used to inactivate mRNA so as to inhibit gene expression, and thus protein expression, the molecules can be used to treat a disease or disorder, such as a developmental disorder. The methodology can involve cleavage by means of ribozymes containing nucleotide sequences complementary to one or more regions in the mRNA that attenuate the ability of the mRNA to be translated Such mRNA regions include, for example, protein-coding regions, in particular protein-coding regions corresponding to catalytic activity, substrate and/or ligand binding sites, or other functional domains of a protein.
[0248] The phenomenon of RNA interference (RNAi) has been actively studied for the last decade, since its original discovery in C. elegans (Fire et al., Nature 391:806-11 (1998)), and in recent years its potential use in treatment of human disease has been actively pursued (reviewed in Kim & Rossi, Nature Rev, Genet. 8: 173-204 (2007)). RNA interference (RNAi), also called gene silencing, is based on using double-stranded RNA molecules (dsRNA) to turn off specific genes. In the cell, cytoplasmic double-stranded RNA molecules (dsRNA) are processed by cellular complexes into small interfering RNA (siRNA). The siRNA guide the targeting of a protein-RNA complex to specific sites on a target mRNA, leading to cleavage of the mRNA (Thompson, Drug Discovery Today, 7:912-917 (2002)). The siRNA molecules are typically about 20, 21, 22 or 23 nucleotides in length. Thus, one aspect of the disclosure relates to isolated nucleic acid sequences, and the use of those molecules for RNA interference, for example, as small interfering RNA molecules (siRNA). In some embodiments, the isolated nucleic acid sequences can be 18-26 nucleotides in length, preferably 19-25 nucleotides in length, more preferably 20-24 nucleotides in length, and more preferably 21, 22 or 23 nucleotides in length.
[0249] Another pathway for RNAi-mediated gene silencing originates in endogenously encoded primary microRNA (pn-miRNA) transcripts, which are processed in the cell to generate precursor miRNA (pre-miRNA). These miRNA molecules are exported from the nucleus to the cytoplasm, where they undergo processing to generate mature miRNA molecules (miRNA), which direct translational inhibition by recognizing target sites in the 3 untranslated regions of mRNAs, and subsequent mRNA degradation by processing P-bodies (reviewed in Kim & Rossi, Nature Rev. Genet. 8: 173-204 (2007)).
[0250] Clinical applications of RNAi include the incorporation of synthetic siRNA duplexes, which preferably are approximately 20-23 nucleotides in size, and preferably have 3 overlaps of 2 nucleotides. Knockdown of gene expression is established by sequence-specific design for the target mRNA. Several commercial sites for optimal design and synthesis of such molecules are known to those skilled in the art.
[0251] Other applications provide longer siRNA molecules (typically 25-30 nucleotides in length, preferably about 27 nucleotides), as well as small hairpin RNAs (shRNAs; typically about 29 nucleotides in length). The latter are naturally expressed, as described in Amarzguioui et al. (FEBS Lett. 579:5974-81 (2005)). Chemically synthetic siRNAs and shRNAs are substrates for in vivo processing, and in some cases provide more potent gene-silencing than shorter designs (Kim et al., Nature Biotechnol. 23:222-226 (2005); Siola et al., Nature Biotechnol. 23:227-231 (2005)). In general siRNAs provide for transient silencing of gene expression, because their intracellular concentration is diluted by subsequent cell divisions. By contrast, expressed shRNAs mediate long-term, stable knockdown of target transcripts, for as long as transcription of the shRNA takes place (Marques et al., Nature Biotechnol. 23.559-565 (2006), Brummelkamp et al., Science 296. 550-553 (2002)).
[0252] Since RNAi molecules, including siRNA, miRNA and shRNA, act in a sequence-dependent manner, variants described herein can be used to design RNAi reagents that recognize specific nucleic acids comprising specific genetic variations, alleles and/or haplotypes, while not recognizing nucleic acid sequences not comprising the genetic variation, or comprising other alleles or haplotypes. These RNAi reagents can thus recognize and destroy the target nucleic acid sequences. As with antisense reagents, RNAi reagents can be useful as therapeutic agents (i.e., for turning off disease-associated genes or disease-associated gene variants), but can also be useful for characterizing and validating gene function (e.g., by gene knock-out or gene knock-down experiments).
[0253] Delivery of RNAi can be performed by a range of methodologies known to those skilled in the art. Methods utilizing non-viral delivery include cholesterol, stable nucleic acid-lipid particle (SNALP), heavy-chain antibody fragment (Fab), aptamers and nanoparticles Viral delivery methods include use of lentivirus, adenovirus and adeno-associated virus The siRNA molecules are in some embodiments chemically modified to increase their stability. This can include modifications at the 2 position of the ribose, including 2-O-methylpunnes and 2-fluoropyrimidmes, which provide resistance to RNase activity. Other chemical modifications are possible and known to those skilled in the art.
[0254] The following references provide a further summary of RNAi, and possibilities for targeting specific genes using RNAi: Kim & Rossi, Nat. Rev. Genet. 8: 173-184 (2007), Chen & Rajewsky, Nat. Rev. Genet. 8: 93-103 (2007), Reynolds, et al., Nat. Biotechnol 22 326-330 (2004), Chi et al., Proc. Natl. Acad. Sa. USA 100-6343-6346 (2003), Vickers et al., J Biol Chem. 278:7108-7118 (2003), Agami, Curr Opin. Chem. Biol. 6:829-834 (2002), Lavery, et al., Curr. Opin. Drug Discov. Devel. 6:561-569 (2003), Shi, Trends Genet. 19:9-12 (2003), Shuey et al., Drug Discov. Today 7 1040-46 (2002), McManus et al., Nat. Rev. Genet. 3.737-747 (2002), Xia et al., Nat. Biotechnol. 20.1006-10 (2002), Plasterk et al., Curr. Opin Genet. Dev. 10 562-7 (2000), Bosher et al., Nat. Cell Biol. 2:E31-6 (2000), and Hunter, Curr. Biol. 9:R440-442 (1999).
[0255] A genetic defect leading to increased predisposition or risk for development of a disease, including a developmental disorder, or a defect causing the disease, can be corrected permanently by administering to a subject carrying the defect a nucleic acid fragment that incorporates a repair sequence that supplies the normal/wild-type nucleotide(s) at the site of the genetic defect. Such site-specific repair sequence can encompass an RNA/DNA oligonucleotide that operates to promote endogenous repair of a subject's genomic DNA. The administration of the repair sequence can be performed by an appropriate vehicle, such as a complex with polyethylamine, encapsulated in anionic liposomes, a viral vector such as an adenovirus vector, or other pharmaceutical compositions suitable for promoting intracellular uptake of the administered nucleic acid The genetic defect can then be overcome, since the chimeric oligonucleotides induce the incorporation of the normal sequence into the genome of the subject, leading to expression of the normal/wild-type gene product. The replacement is propagated, thus rendering a permanent repair and alleviation of the symptoms associated with the disease or condition.
[0256] Double stranded oligonucleotides are formed by the assembly of two distinct oligonucleotide sequences where the oligonucleotide sequence of one strand is complementary to the oligonucleotide sequence of the second strand; such double stranded oligonucleotides are generally assembled from two separate oligonucleotides (e.g., siRNA), or from a single molecule that folds on itself to form a double stranded structure (e.g., shRNA or short hairpin RNA). These double stranded oligonucleotides known in the art all have a common feature in that each strand of the duplex has a distinct nucleotide sequence, wherein only one nucleotide sequence region (guide sequence or the antisense sequence) has complementarity to a target nucleic acid sequence and the other strand (sense sequence) comprises nucleotide sequence that is homologous to the target nucleic acid sequence.
[0257] Double stranded RNA induced gene silencing can occur on at least three different levels: (i) transcription inactivation, which refers to RNA guided DNA or histone methylation; (ii) siRNA induced mRNA degradation; and (iii) mRNA induced transcriptional attenuation. It is generally considered that the major mechanism of RNA induced silencing (RNA interference, or RNAi) in mammalian cells is mRNA degradation. RNA interference (RNAi) is a mechanism that inhibits gene expression at the stage of translation or by hindering the transcription of specific genes. Specific RNAi pathway proteins are guided by the dsRNA to the targeted messenger RNA (mRNA), where they cleave the target, breaking it down into smaller portions that can no longer be translated into protein. Initial attempts to use RNAi in mammalian cells focused on the use of long strands of dsRNA. However, these attempts to induce RNAi met with limited success, due in part to the induction of the interferon response, which results in a general, as opposed to a target-specific, inhibition of protein synthesis. Thus, long dsRNA is not a viable option for RNAi in mammalian systems. Another outcome is epigenetic changes to a genehistone modification and DNA methylationaffecting the degree the gene is transcribed.
[0258] More recently it has been shown that when short (18-30 bp) RNA duplexes are introduced into mammalian cells in culture, sequence-specific inhibition of target mRNA can be realized without inducing an interferon response. Certain of these short dsRNAs, referred to as small inhibitory RNAs (siRNAs), can act catalytically at sub-molar concentrations to cleave greater than 95% of the target mRNA in the cell. A description of the mechanisms for siRNA activity, as well as some of its applications are described in Provost et al., Ribonuclease Activity and RNA Binding of Recombinant Human Dicer, E.M.B.O. J., 2002 Nov. 1; 21(21): 5864-5874; Tabara et al., The dsRNA Binding Protein RDE-4 Interacts with RDE-1, DCR-1 and a DexH-box Helicase to Direct RNAi in C. elegans, Cell 2002, Jun. 28; 109(7):861-71; Ketting et al., Dicer Functions in RNA Interference and in Synthesis of Small RNA Involved in Developmental Timing in C. elegans; Martinez et al., Single-Stranded Antisense siRNAs Guide Target RNA Cleavage in RNAi, Cell 2002, Sep. 6; 110(5):563; Hutvagner & Zamore, A microRNA in a multiple-turnover RNAi enzyme complex, Science 2002, 297:2056.
[0259] From a mechanistic perspective, introduction of long double stranded RNA into plants and invertebrate cells is broken down into siRNA by a Type III endonuclease known as Dicer. Sharp, RNA interference2001, Genes Dev. 2001, 15:485. Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3 overhangs Bernstein, Caudy, Hammond, & Hannon, Role for a bidentate ribonuclease in the initiation step of RNA interference, Nature 2001, 409:363. The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, Haley, & Zamore, ATP requirements and small interfering RNA structure in the RNA interference pathway, Cell 2001, 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleaves the target to induce silencing. Elbashir, Lendeckel, & Tuschl, RNA interference is mediated by 21- and 22-nucleotide RNAs, Genes Dev 2001, 15:188,
[0260] Generally, the antisense sequence is retained in the active RISC complex and guides the RISC to the target nucleotide sequence by means of complementary base-pairing of the antisense sequence with the target sequence for mediating sequence-specific RNA interference. It is known in the art that in some cell culture systems, certain types of unmodified siRNAs can exhibit off target effects. It is hypothesized that this off-target effect involves the participation of the sense sequence instead of the antisense sequence of the siRNA in the RISC complex (see for example, Schwarz et al., 2003, Cell, 115, 199-208). In this instance the sense sequence is believed to direct the RISC complex to a sequence (off-target sequence) that is distinct from the intended target sequence, resulting in the inhibition of the off-target sequence. In these double stranded nucleic acid sequences, each strand is complementary to a distinct target nucleic acid sequence. However, the off-targets that are affected by these dsRNAs are not entirely predictable and are non-specific.
[0261] The term siRNA refers to small inhibitory RNA duplexes that induce the RNA interference (RNAi) pathway. These molecules can vary in length (generally between 18-30 basepairs) and contain varying degrees of complementarity to their target mRNA in the antisense strand. Some, but not all, siRNA have unpaired overhanging bases on the 5 or 3 end of the sense strand and/or the antisense strand. The term siRNA includes duplexes of two separate strands, as well as single strands that can form hairpin structures comprising a duplex region. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, are a class of 20-25 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology.
[0262] While the two RNA strands do not need to be completely complementary, the strands should be sufficiently complementary to hybridize to form a duplex structure. In some instances, the complementary RNA strand can be less than 30 nucleotides, preferably less than 25 nucleotides in length, more preferably 19 to 24 nucleotides in length, more preferably 20-23 nucleotides in length, and even more preferably 22 nucleotides in length. The dsRNA of the present disclosure can further comprise at least one single-stranded nucleotide overhang. The dsRNA of the present disclosure can further comprise a substituted or chemically modified nucleotide. As discussed in detail below, the dsRNA can be synthesized by standard methods known in the art.
[0263] siRNA can be divided into five (5) groups including non-functional, semi-functional, functional, highly functional, and hyper-functional based on the level or degree of silencing that they induce in cultured cell lines. As used herein, these definitions are based on a set of conditions where the siRNA is transfected into said cell line at a concentration of 100 nM and the level of silencing is tested at a time of roughly 24 hours after transfection, and not exceeding 72 hours after transfection. In this context, non-functional siRNA are defined as those siRNA that induce less than 50% (<50%) target silencing. Semi-functional siRNA induce 50-79% target silencing. Functional siRNA are molecules that induce 80-95% gene silencing. Highly-functional siRNA are molecules that induce greater than 95% gene silencing. Hyperfunctional siRNA are a special class of molecules. For purposes of this document, hyperfunctional siRNA are defined as those molecules that: (1) induce greater than 95% silencing of a specific target when they are transfected at subnanomolar concentrations (i.e., less than one nanomolar); and/or (2) induce functional (or better) levels of silencing for greater than 96 hours. These relative functionalities (though not intended to be absolutes) can be used to compare siRNAs to a particular target for applications such as functional genomics, target identification and therapeutics.
[0264] microRNAs (miRNA) are single-stranded RNA molecules of about 21-23 nucleotides in length, which regulate gene expression. miRNAs are encoded by genes that are transcribed from DNA but not translated into protein (non-coding RNA); instead they are processed from primary transcripts known as pri-miRNA to short stem-loop structures called pre-miRNA and finally to functional miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and their main function is to downregulate gene expression.
Antibody-Based Therapeutics
[0265] The present disclosure embodies agents that modulate a peptide sequence or RNA expressed from a gene associated with a developmental disorder. The term biomarker, as used herein, can comprise a genetic variation of the present disclosure or a gene product, for example, RNA and polypeptides, of any one of the genes listed in Tables 2-7. Such modulating agents include, but are not limited to, proteins, peptides, peptidomimetics, peptoids, or any other forms of a molecule, which bind to, and alter the signaling or function associated with the a developmental disorder associated biomarker, have an inhibitory or stimulatory effect on the developmental disorder associated biomarkers, or have a stimulatory or inhibitory effect on the expression or activity of the a developmental disorder associated biomarkers' ligands, for example, polyclonal antibodies and/or monoclonal antibodies that specifically bind one form of the gene product but not to the other form of the gene product are also provided, or which bind a portion of either the variant or the reference gene product that contains the polymorphic site or sites.
[0266] In some embodiments, the present disclosure provides antibody-based agents targeting a developmental disorder associated biomarkers. The antibody-based agents in any suitable form of an antibody e.g., monoclonal, polyclonal, or synthetic, can be utilized in the therapeutic methods disclosed herein. The antibody-based agents include any target-binding fragment of an antibody and also peptibodies, which are engineered therapeutic molecules that can bind to human drug targets and contain peptides linked to the constant domains of antibodies. In some embodiments, the antibodies used for targeting a developmental disorder associated biomarkers are humanized antibodies. Methods for humanizing antibodies are well known in the art. In another embodiment, the therapeutic antibodies comprise an antibody generated against a developmental disorder associated biomarkers described in the present disclosure, wherein the antibodies are conjugated to another agent or agents, for example, a cytotoxic agent or agents.
[0267] The term antibody as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain antigen-binding sites that specifically bind an antigen. A molecule that specifically binds to a polypeptide of the disclosure is a molecule that binds to that polypeptide or a fragment thereof, but does not substantially bind other molecules in a sample, e.g., a biological sample, which naturally contains the polypeptide. Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(ab)2 fragments which can be generated by treating the antibody with an enzyme such as pepsin. The disclosure provides polyclonal and monoclonal antibodies that bind to a polypeptide of the disclosure. The term monoclonal antibody or monoclonal antibody composition, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of a polypeptide of the disclosure. A monoclonal antibody composition thus typically displays a single binding affinity for a particular polypeptide of the disclosure with which it immunoreacts.
[0268] Polyclonal antibodies can be prepared as described above by immunizing a suitable subject with a desired immunogen, e.g., polypeptide of the disclosure or a fragment thereof. The antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide. If desired, the antibody molecules directed against the polypeptide can be isolated from the mammal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybndoma technique originally described by Kohler and Milstein, Nature 256:495-497 (1975), the human B cell hybridoma technique (Kozbor et al., Immunol. Today 4: 72 (1983)), the EBV-hybndoma technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss (1985) Inc., pp. 77-96) or trioma techniques. The technology for producing hybndomas is well known (see generally Current Protocols in Immunology (1994) Coligan et al., (eds.) John Wiley & Sons, Inc., New York, N.Y.). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an immunogen as described above, and the culture supematants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds a polypeptide of the disclosure.
[0269] Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating a monoclonal antibody to a polypeptide of the disclosure (see, e.g., Current Protocols in Immunology, supra; Galfre et al., Nature 266:55052 (1977); R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, N.Y. (1980); and Lerner, Yale J. Biol. Med. 54:387-402 (1981)). Moreover, the ordinarily skilled worker can appreciate that there are many variations of such methods that also would be useful. Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody to a polypeptide of the disclosure can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with the polypeptide to thereby isolate immunoglobulin library members that bind the polypeptide. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAP.sup.a Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, U.S. Pat. No. 5,223,409; PCT Publication Nos. WO 92/18619, WO 91/17271, WO 92/20791, WO 92/15679; WO 93/01288, WO 92/01047, WO 92/09690, and WO 90/02809; Fuchs et al., Bio/Technology 9: 1370-1372 (1991); Hay et al., Hum. Antibod. Hybndomas 3:81-85 (1992); Huse et al., Science 246: 1275-1281 (1989); and Griffiths et al., EMBO J. 12:725-734 (1993).
[0270] Additionally, recombinant antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the disclosure. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art.
[0271] In general, antibodies of the disclosure (e.g., a monoclonal antibody) can be used to isolate a polypeptide of the disclosure by standard techniques, such as affinity chromatography or immunoprecipitation. A polypeptide-specific antibody can facilitate the purification of natural polypeptide from cells and of recombinants produced polypeptide expressed in host cells Moreover, an antibody specific for a polypeptide of the disclosure can be used to detect the polypeptide (e.g., in a cellular lysate, cell supernatant, or tissue sample) in order to evaluate the abundance and pattern of expression of the polypeptide. Antibodies can be used diagnostically, prognostically, or theranostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen. The antibody can be coupled to a detectable substance to facilitate its detection. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotnazinylamine fluorescein, dansyl chloride or phycoerythnn; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include .sup.125I, .sup.131I, .sup.35S or .sup.3H. Antibodies can also be useful in pharmacogenomic analysis. In such embodiments, antibodies against variant proteins encoded by nucleic acids according to the disclosure, such as variant proteins that are encoded by nucleic acids that contain at least one genetic variation of the disclosure, can be used to identify individuals that require modified treatment modalities.
[0272] Antibodies can furthermore be useful for assessing expression of variant proteins in disease states, such as in active stages of a disease, or in an individual with a predisposition to a disease related to the function of the protein, in particular a developmental disorder. Antibodies specific for a variant protein of the present disclosure that is encoded by a nucleic acid that comprises at least one polymorphic marker or haplotype as described herein can be used to screen for the presence of the variant protein, for example, to screen for a predisposition to a developmental disorder as indicated by the presence of the variant protein.
[0273] Antibodies can be used in other methods. Thus, antibodies are useful as screening tools for evaluating proteins, such as variant proteins of the disclosure, in conjunction with analysis by electrophoretic mobility, isoelectric point, tryptic or other protease digest, or for use in other physical assays known to those skilled in the art. Antibodies can also be used in tissue typing. In one such embodiment, a specific variant protein has been correlated with expression in a specific tissue type, and antibodies specific for the variant protein can then be used to identify the specific tissue type.
[0274] Subcellular localization of proteins, including variant proteins, can also be determined using antibodies, and can be applied to assess aberrant subcellular localization of the protein in cells in various tissues. Such use can be applied in genetic testing, but also in monitoring a particular treatment modality. In the case where treatment is aimed at correcting the expression level or presence of the variant protein or aberrant tissue distribution or developmental expression of the variant protein, antibodies specific for the variant protein or fragments thereof can be used to monitor therapeutic efficacy.
[0275] Antibodies are further useful for inhibiting variant protein function, for example, by blocking the binding of a variant protein to a binding molecule or partner. Such uses can also be applied in a therapeutic context in which treatment involves inhibiting a variant protein's function. An antibody can be for example, be used to block or competitively inhibit binding, thereby modulating (i.e., agonizing or antagonizing) the activity of the protein. Antibodies can be prepared against specific protein fragments containing sites required for specific function or against an intact protein that is associated with a cell or cell membrane.
[0276] The present disclosure also embodies the use of any pharmacologic agent that can be conjugated to an antibody or an antibody binding fragment, and delivered in active form. Examples of such agents include cytotoxins, radioisotopes, hormones such as a steroid, anti-metabolites such as cytosines, and chemotherapeutic agents. Other embodiments can include agents such as a coagulant, a cytokine, growth factor, bacterial endotoxin or a moiety of bacterial endotoxin. The targeting antibody-based agent directs the toxin to, and thereby selectively modulates the cell expressing the targeted surface receptor. In some embodiments, therapeutic antibodies employ cross-linkers that provide high in vivo stability (Thorpe et al., Cancer Res., 48:6396, 1988). In any event, it is proposed that agents such as these can, if desired, be successfully conjugated to antibodies or antibody binding fragments, in a manner that will allow their targeting, internalization, release or presentation at the site of the targeted cells expressing the ASD associated biomarkers as required using known conjugation technology. For administration in vivo, for example, an antibody can be linked with an additional therapeutic payload, such as radionuclide, an enzyme, an immunogenic epitope, or a cytotoxic agent, including bacterial toxins (diphtheria or plant toxins, such as ricin). The in vivo half-life of an antibody or a fragment thereof can be increased by pegylation through conjugation to polyethylene glycol.
Gene Therapy
[0277] In some embodiments, gene therapy can be used as therapeutic to modulate a peptide sequence or RNA expressed from a gene associated with a developmental disorder. Gene therapy involves the use of DNA as a pharmaceutical agent to treat disease. DNA can be used to supplement or alter genes within an individual's cells as a therapy to treat disease. Gene therapy can be used to alter the signaling or function associated with the a developmental disorder associated biomarker, have an inhibitory or stimulatory effect on the developmental disorder associated biomarkers, or have a stimulatory or inhibitory effect on the expression or activity of the a developmental disorder associated biomarkers' ligands. In one embodiment, gene therapy involves using DNA that encodes a functional, therapeutic gene in order to replace a mutated gene. Other forms involve directly correcting a mutation, or using DNA that encodes a therapeutic protein drug (rather than a natural human gene) to provide treatment. DNA that encodes a therapeutic protein can be packaged within a vector, which can used to introduce the DNA inside cells within the body. Once inside, the DNA becomes expressed by the cell machinery, resulting in the production of the therapeutic, which in turn can treat the subject's disease.
[0278] Gene therapy agents and other agents for testing therapeutics can include plasmids, viral vectors, artificial chromosomes and the like containing therapeutic genes or polynucleotides encoding therapeutic products, including coding sequences for small interfering RNA (siRNA), ribozymes and antisense RNA, which in certain further embodiments can comprise an operably linked promoter such as a constitutive promoter or a regulatable promoter, such as an inducible promoter (e.g., IPTG inducible), a tightly regulated promoter (e.g., a promoter that permits little or no detectable transcription in the absence of its cognate inducer or derepressor) or a tissue-specific promoter. Methodologies for preparing, testing and using these and related agents are known in the art. See, e.g., Ausubel (Ed.), Current Protocols in Molecular Biology (2007 John Wiley & Sons, NY); Rosenzweig and Nabel (Eds), Current Protocols in Human Genetics (esp. Ch. 13 therein, Delivery Systems for Gene Therapy, 2008 John Wiley & Sons, NY); Abell, Advances in Amino Acid Mimetics and Peptidomimetics, 1997 Elsevier, N.Y. In another embodiment, gene therapy agents may encompass zinc finger nuclease (ZFN) or transcription activator-like effector nuclease (TALEN) strategies, see for example: Urnov et al. (2010), Nature Reviews Genetics 11(9):636-46; Yusa et al. (2011), Nature 478(7369):391-4; Bedell et al. (2012), Nature ePub September 23, PubMed ID 23000899.
[0279] As a non-limiting example, one such embodiment contemplates introduction of a gene therapy agent for treating ASD (e.g., an engineered therapeutic virus, a therapeutic agent-carrying nanoparticle, etc.) to one or more injection sites in a subject, without the need for imaging, surgery, or histology on biopsy specimens. Of course, periodic monitoring of the circulation for leaked therapeutic agent and/or subsequent analysis of a biopsy specimen, e.g., to assess the effects of the agent on the target tissue, can also be considered. A gene therapy includes a therapeutic polynucleotide administered before, after, or at the same time as any other therapy described herein. In some embodiments, therapeutic genes may include an antisense version of a biomarker disclosed herein, a sequence of a biomarker described herein, or an inhibitor of a biomarker disclosed herein.
Methods of Treatment
[0280] Some embodiments of the present disclosure relates to methods of using pharmaceutical compositions and kits comprising agents that inhibit a developmental disorder associated biomarker or a developmental disorder associated biomarkers to inhibit or decrease a developmental disorder progression. Another embodiment of the present disclosure provides methods, pharmaceutical compositions, and kits for the treatment of animal subjects. The term animal subject as used herein includes humans as well as other mammals. The term treating as used herein includes achieving a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying viral infection. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated a developmental disorder such that an improvement is observed in the animal subject, notwithstanding the fact that the animal subject can still be afflicted with a developmental disorder.
[0281] For embodiments where a prophylactic benefit is desired, a pharmaceutical composition of the disclosure can be administered to a subject at risk of developing a developmental disorder, or to a subject reporting one or more of the physiological symptoms of a developmental disorder, even though a screening of the condition cannot have been made. Administration can prevent a developmental disorder from developing, or it can reduce, lessen, shorten and/or otherwise ameliorate the progression of a developmental disorder, or symptoms that develop. The pharmaceutical composition can modulate or target a developmental disorder's associated biomarker. Wherein, the term modulate includes inhibition of a developmental disorder's associated biomarkers or alternatively activation of a developmental disorder associated biomarkers.
[0282] Reducing the activity of a developmental disorder's associated biomarkers, is also referred to as inhibiting the developmental disorder's associated biomarkers. The term inhibits and its grammatical conjugations, such as inhibitory, do not require complete inhibition, but refer to a reduction in a developmental disorder's associated biomarkers' activities. In some embodiments such reduction is by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 90%, and can be by at least 95% of the activity of the enzyme or other biologically important molecular process in the absence of the inhibitory effect, e.g., in the absence of an inhibitor. Conversely, the phrase does not inhibit and its grammatical conjugations refer to situations where there is less than 20%, less than 10%, and can be less than 5%, of reduction in enzyme activity in the presence of the agent. Further the phrase does not substantially inhibit and its grammatical conjugations refer to situations where there is less than 30%, less than 20%, and in some embodiments less than 10% of reduction in enzyme or other biologically important molecular activity in the presence of the agent.
[0283] Increasing the activity a developmental disorder's associated biomarkers is also referred to as activating the developmental disorder's associated biomarkers. The term activated and its grammatical conjugations, such as activating, do not require complete activation, but refer to an increase in a developmental disorder associated biomarkers' activities. In some embodiments such increase is by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and can be by at least 95% of the activity of the enzyme or other biologically important molecular process in the absence of the activation effect, e.g., in the absence of an activator. Conversely, the phrase does not activate and its grammatical conjugations refer to situations where there can be less than 20%, less than 10%, and less than 5%, of an increase in enzyme or other biologically important molecular activity in the presence of the agent. Further the phrase does not substantially activate and its grammatical conjugations refer to situations where there is less than 30%, less than 20%, and in some embodiments less than 10% of an increase in enzyme or other biologically important molecular activity in the presence of the agent.
[0284] The ability to reduce enzyme or other biologically important molecular activity is a measure of the potency or the activity of an agent, or combination of agents, towards or against the enzyme or other biologically important molecular process. Potency can be measured by cell free, whole cell and/or in vivo assays in terms of IC50, Ki and/or ED50 values. An IC50 value represents the concentration of an agent required to inhibit enzyme activity by half (50%) under a given set of conditions. A Ki value represents the equilibrium affinity constant for the binding of an inhibiting agent to the enzyme or other relevant biomolecule. An ED50 value represents the dose of an agent required to affect a half-maximal response in a biological assay. Further details of these measures will be appreciated by those of ordinary skill in the art, and can be found in standard texts on biochemistry, enzymology, and the like.
[0285] The present disclosure also includes kits that can be used to treat developmental disorders. These kits comprise an agent or combination of agents that inhibits a developmental disorder associated biomarker or a developmental disorder's associated biomarkers and in some embodiments instructions teaching the use of the kit according to the various methods and approaches described herein. Such kits can also include information, such as scientific literature references, package insert materials, clinical trial results, and/or summaries of these and the like, which indicate or establish the activities and/or advantages of the agent. Such information can be based on the results of various studies, for example, studies using experimental animals involving in vivo models and studies based on human clinical trials. Kits described herein can be provided, marketed and/or promoted to health providers, including physicians, nurses, pharmacists, formulary officials, and the like.
[0286] In some aspects a host cell can be used for testing or administering therapeutics. In some embodiments, a host cell can comprise a nucleic acid comprising expression control sequences operably-linked to a coding region. The host cell can be natural or non-natural. The non-natural host used in aspects of the method can be any cell capable of expressing a nucleic acid of the disclosure including, bacterial cells, fungal cells, insect cells, mammalian cells and plant cells. In some aspects the natural host is a mammalian tissue cell and the non-natural host is a different mammalian tissue cell. Other aspects of the method include a natural host that is a first cell normally residing in a first mammalian species and the non-natural host is a second cell normally residing in a second mammalian species. In another alternative aspect, the method uses a first cell and the second cell that are from the same tissue type. In those aspects of the method where the coding region encodes a mammalian protein, the mammalian protein may be a hormone. In other aspects the coding region may encode a neuropeptide, an antibody, an antimetabolites or a protein or nucleotide therapeutic.
[0287] Expression control sequences can be those nucleotide sequences, both 5 and 3 to a coding region, that are required for the transcription and translation of the coding region in a host organism. Regulatory sequences include a promoter, ribosome binding site, optional inducible elements and sequence elements required for efficient 3 processing, including polyadenylation. When the structural gene has been isolated from genomic DNA, the regulatory sequences also include those intronic sequences required for splicing of the introns as part of mRNA formation in the target host.
Formulations, Routes of Administration, and Effective Doses
[0288] Yet another aspect of the present disclosure relates to formulations, routes of administration and effective doses for pharmaceutical compositions comprising an agent or combination of agents of the instant disclosure. Such pharmaceutical compositions can be used to treat a developmental disorder progression and a developmental disorder associated symptoms as described above.
[0289] Compounds of the disclosure can be administered as pharmaceutical formulations including those suitable for oral (including buccal and sub-lingual), rectal, nasal, topical, transdermal patch, pulmonary, vaginal, suppository, or parenteral (including intramuscular, intraarterial, intrathecal, intradermal, intraperitoneal, subcutaneous and intravenous) administration or in a form suitable for administration by aerosolization, inhalation or insufflation. General information on drug delivery systems can be found in Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems (Lippencott Williams & Wilkins, Baltimore Md. (1999).
[0290] In various embodiments, the pharmaceutical composition includes carriers and excipients (including but not limited to buffers, carbohydrates, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents, suspending agents, thickening agents and/or preservatives), water, oils including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, saline solutions, aqueous dextrose and glycerol solutions, flavoring agents, coloring agents, detackifiers and other acceptable additives, adjuvants, or binders, other pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH buffering agents, tonicity adjusting agents, emulsifying agents, wetting agents and the like. Examples of excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. In some embodiments, the pharmaceutical preparation is substantially free of preservatives. In other embodiments, the pharmaceutical preparation can contain at least one preservative. General methodology on pharmaceutical dosage forms is found in Ansel et al., Pharmaceutical Dosage Forms and Drug Delivery Systems (Lippencott, Williams, & Wilkins, Baltimore Md. (1999)). It will be recognized that, while any suitable carrier known to those of ordinary skill in the art can be employed to administer the compositions of this disclosure, the type of carrier will vary depending on the mode of administration.
[0291] Compounds can also be encapsulated within liposomes using well-known technology. Biodegradable microspheres can also be employed as carriers for the pharmaceutical compositions of this disclosure. Suitable biodegradable microspheres are disclosed, for example, in U.S. Pat. Nos. 4,897,268, 5,075,109, 5,928,647, 5,811,128, 5,820,883, 5,853,763, 5,814,344 and 5,942,252.
[0292] The compound can be administered in liposomes or microspheres (or microparticles). Methods for preparing liposomes and microspheres for administration to a subject are well known to those of skill in the art. U.S. Pat. No. 4,789,734, the contents of which are hereby incorporated by reference, describes methods for encapsulating biological materials in liposomes. Essentially, the material is dissolved in an aqueous solution, the appropriate phospholipids and lipids added, along with surfactants if required, and the material dialyzed or sonicated, as necessary. A review of known methods is provided by G. Gregoriadis, Chapter 14, Liposomes, Drug Carriers in Biology and Medicine, pp. 2.sup.87-341 (Academic Press, 1979).
[0293] Microspheres formed of polymers or proteins are well known to those skilled in the art, and can be tailored for passage through the gastrointestinal tract directly into the blood stream. Alternatively, the compound can be incorporated and the microspheres, or composite of microspheres, implanted for slow release over a period of time ranging from days to months. See, for example, U.S. Pat. Nos. 4,906,474, 4,925,673 and 3,625,214, and Jein, TIPS 19:155-157 (1998), the contents of which are hereby incorporated by reference.
[0294] The concentration of drug can be adjusted, the pH of the solution buffered and the isotonicity adjusted to be compatible with intravenous injection, as is well known in the art.
[0295] The compounds of the disclosure can be formulated as a sterile solution or suspension, in suitable vehicles, well known in the art. The pharmaceutical compositions can be sterilized by conventional, well-known sterilization techniques, or can be sterile filtered. The resulting aqueous solutions can be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration. Suitable formulations and additional carriers are described in Remington The Science and Practice of Pharmacy (20th Ed., Lippincott Williams & Wilkins, Baltimore Md.), the teachings of which are incorporated by reference in their entirety herein.
[0296] The agents or their pharmaceutically acceptable salts can be provided alone or in combination with one or more other agents or with one or more other forms. For example, a formulation can comprise one or more agents in particular proportions, depending on the relative potencies of each agent and the intended indication. For example, in compositions for targeting two different host targets, and where potencies are similar, about a 1:1 ratio of agents can be used. The two forms can be formulated together, in the same dosage unit e.g., in one cream, suppository, tablet, capsule, aerosol spray, or packet of powder to be dissolved in a beverage; or each form can be formulated in a separate unit, e.g., two creams, two suppositories, two tablets, two capsules, a tablet and a liquid for dissolving the tablet, two aerosol sprays, or a packet of powder and a liquid for dissolving the powder, etc.
[0297] The term pharmaceutically acceptable salt means those salts which retain the biological effectiveness and properties of the agents used in the present disclosure, and which are not biologically or otherwise undesirable. For example, a pharmaceutically acceptable salt does not interfere with the beneficial effect of an agent of the disclosure in inhibiting a developmental disorder associated biomarkers' components
[0298] Typical salts are those of the inorganic ions, such as, for example, sodium, potassium, calcium, magnesium ions, and the like. Such salts include salts with inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p toluenesulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid or maleic acid. In addition, if the agent(s) contain a carboxy group or other acidic group, it can be converted into a pharmaceutically acceptable addition salt with inorganic or organic bases. Examples of suitable bases include sodium hydroxide, potassium hydroxide, ammonia, cyclohexylamine, dicyclohexyl-amine, ethanolamine, diethanolamine, triethanolamine, and the like.
[0299] A pharmaceutically acceptable ester or amide refers to those which retain biological effectiveness and properties of the agents used in the present disclosure, and which are not biologically or otherwise undesirable. For example, the ester or amide does not interfere with the beneficial effect of an agent of the disclosure in inhibiting a developmental disorder associated biomarkers' components. Typical esters include ethyl, methyl, isobutyl, ethylene glycol, and the like. Typical amides include unsubstituted amides, alkyl amides, dialkyl amides, and the like.
[0300] In some embodiments, an agent can be administered in combination with one or more other compounds, forms, and/or agents, e.g., as described above. Pharmaceutical compositions comprising combinations of a developmental disorder associated biomarkers' inhibitors with one or more other active agents can be formulated to comprise certain molar ratios. For example, molar ratios of about 99:1 to about 1:99 of a developmental disorder's associated biomarkers' inhibitors to the other active agent can be used. In some subset of the embodiments, the range of molar ratios of developmental disorder's associated biomarkers' inhibitors: other active agents are selected from about 80:20 to about 20:80; about 75:25 to about 25:75, about 70:30 to about 30:70, about 66:33 to about 33:66, about 60:40 to about 40:60; about 50:50; and about 90:10 to about 10:90. The molar ratio of a developmental disorder's associated biomarkers' inhibitors: other active agents can be about 1:9, and in some embodiments can be about 1:1. The two agents, forms and/or compounds can be formulated together, in the same dosage unit e.g., in one cream, suppository, tablet, capsule, or packet of powder to be dissolved in a beverage; or each agent, form, and/or compound can be formulated in separate units, e.g., two creams, suppositories, tablets, two capsules, a tablet and a liquid for dissolving the tablet, an aerosol spray a packet of powder and a liquid for dissolving the powder, etc.
[0301] If necessary or desirable, the agents and/or combinations of agents can be administered with still other agents. The choice of agents that can be co-administered with the agents and/or combinations of agents of the instant disclosure can depend, at least in part, on the condition being treated. Agents of particular use in the formulations of the present disclosure include, for example, any agent having a therapeutic effect for a viral infection, including, e.g., drugs used to treat inflammatory conditions. For example, in treatments for influenza, in some embodiments formulations of the instant disclosure can additionally contain one or more conventional anti-inflammatory drugs, such as an NSAID, e.g., ibuprofen, naproxen, acetaminophen, ketoprofen, or aspirin. In some alternative embodiments for the treatment of influenza formulations of the instant disclosure can additionally contain one or more conventional influenza antiviral agents, such as amantadine, rimantadine, zanamivir, and oseltamivir. In treatments for retroviral infections, such as HIV, formulations of the instant disclosure can additionally contain one or more conventional antiviral drug, such as protease inhibitors (lopinavir/ritonavir {Kaletra}, indinavir {Crixivan}, ritonavir {Norvir}, nelfinavir {Viracept}, saquinavir hard gel capsules {Invirase}, atazanavir {Reyataz}, amprenavir {Agenerase}, fosamprenavir {Telzir}, tipranavir {Aptivus}), reverse transcriptase inhibitors, including non-Nucleoside and Nucleoside/nucleotide inhibitors (AZT {zidovudine, Retrovir}, ddI {didanosine, Videx}, 3TC {lamivudine, Epivir}, d4T {stavudine, Zerit}, abacavir {Ziagen}, FTC {emtricitabine, Emtriva}, tenofovir {Viread}, efavirenz {Sustiva} and nevirapine {Viramune}), fusion inhibitors T20 {enfuvirtide, Fuzeon}, integrase inhibitors (MK-0518 and GS-9137), and maturation inhibitors (PA-457 {Bevirimat}). As another example, formulations can additionally contain one or more supplements, such as vitamin C, E or other anti-oxidants.
[0302] The agent(s) (or pharmaceutically acceptable salts, esters or amides thereof) can be administered per se or in the form of a pharmaceutical composition wherein the active agent(s) is in an admixture or mixture with one or more pharmaceutically acceptable carriers. A pharmaceutical composition, as used herein, can be any composition prepared for administration to a subject. Pharmaceutical compositions for use in accordance with the present disclosure can be formulated in conventional manner using one or more physiologically acceptable carriers, comprising excipients, diluents, and/or auxiliaries, e.g., which facilitate processing of the active agents into preparations that can be administered. Proper formulation can depend at least in part upon the route of administration chosen. The agent(s) useful in the present disclosure, or pharmaceutically acceptable salts, esters, or amides thereof, can be delivered to a subject using a number of routes or modes of administration, including oral, buccal, topical, rectal, transdermal, transmucosal, subcutaneous, intravenous, and intramuscular applications, as well as by inhalation.
[0303] For oral administration, the agents can be formulated readily by combining the active agent(s) with pharmaceutically acceptable carriers well known in the art. Such carriers enable the agents of the disclosure to be formulated as tablets, including chewable tablets, pills, dragees, capsules, lozenges, hard candy, liquids, gels, syrups, slurries, powders, suspensions, elixirs, wafers, and the like, for oral ingestion by a subject to be treated. Such formulations can comprise pharmaceutically acceptable carriers including solid diluents or fillers, sterile aqueous media and various non-toxic organic solvents. A solid carrier can be one or more substances which can also act as diluents, flavoring agents, solubilizers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material. In powders, the carrier generally is a finely divided solid which is a mixture with the finely divided active component. In tablets, the active component generally is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted in the shape and size desired. The powders and tablets preferably contain from about one (1) to about seventy (70) percent of the active compound. Suitable carriers include but are not limited to magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. Generally, the agents of the disclosure will be included at concentration levels ranging from about 0.5%, about 5%, about 10%, about 20%, or about 30% to about 50%, about 60%, about 70%, about 80% or about 90% by weight of the total composition of oral dosage forms, in an amount sufficient to provide a desired unit of dosage.
[0304] Aqueous suspensions for oral use can contain agent(s) of this disclosure with pharmaceutically acceptable excipients, such as a suspending agent (e.g., methyl cellulose), a wetting agent (e.g., lecithin, lysolecithin and/or a long-chain fatty alcohol), as well as coloring agents, preservatives, flavoring agents, and the like.
[0305] In some embodiments, oils or non-aqueous solvents can be required to bring the agents into solution, due to, for example, the presence of large lipophilic moieties. Alternatively, emulsions, suspensions, or other preparations, for example, liposomal preparations, can be used. With respect to liposomal preparations, any known methods for preparing liposomes for treatment of a condition can be used. See, for example, Bangham et al., J. Mol. Biol. 23: 238-252 (1965) and Szoka et al., Proc. Natl Acad. Sci. USA 75: 4194-4198 (1978), incorporated herein by reference. Ligands can also be attached to the liposomes to direct these compositions to particular sites of action. Agents of this disclosure can also be integrated into foodstuffs, e.g., cream cheese, butter, salad dressing, or ice cream to facilitate solubilization, administration, and/or compliance in certain subject populations.
[0306] Pharmaceutical preparations for oral use can be obtained as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragree cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; flavoring elements, cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl cellulose, sodium carboxymethylcellulose, and/or polyvinyl pyrrolidone (PVP). If desired, disintegrating agents can be added, such as the cross linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. The agents can also be formulated as a sustained release preparation.
[0307] Dragee cores can be provided with suitable coatings. For this purpose, concentrated sugar solutions can be used, which can optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active agents.
[0308] Pharmaceutical preparations that can be used orally include push fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration should be in dosages suitable for administration.
[0309] Other forms suitable for oral administration include liquid form preparations including emulsions, syrups, elixirs, aqueous solutions, aqueous suspensions, or solid form preparations which are intended to be converted shortly before use to liquid form preparations. Emulsions can be prepared in solutions, for example, in aqueous propylene glycol solutions or can contain emulsifying agents, for example, such as lecithin, sorbitan monooleate, or acacia. Aqueous solutions can be prepared by dissolving the active component in water and adding suitable colorants, flavors, stabilizers, and thickening agents. Aqueous suspensions can be prepared by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well known suspending agents. Suitable fillers or carriers with which the compositions can be administered include agar, alcohol, fats, lactose, starch, cellulose derivatives, polysaccharides, polyvinylpyrrolidone, silica, sterile saline and the like, or mixtures thereof used in suitable amounts. Solid form preparations include solutions, suspensions, and emulsions, and can contain, in addition to the active component, colorants, flavors, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents, and the like.
[0310] A syrup or suspension can be made by adding the active compound to a concentrated, aqueous solution of a sugar, e.g., sucrose, to which can also be added any accessory ingredients. Such accessory ingredients can include flavoring, an agent to retard crystallization of the sugar or an agent to increase the solubility of any other ingredient, e.g., as a polyhydric alcohol, for example, glycerol or sorbitol.
[0311] When formulating compounds of the disclosure for oral administration, it can be desirable to utilize gastroretentive formulations to enhance absorption from the gastrointestinal (GI) tract. A formulation which is retained in the stomach for several hours can release compounds of the disclosure slowly and provide a sustained release that can be preferred in some embodiments of the disclosure. Disclosure of such gastro-retentive formulations are found in Klausner, E. A.; Lavy, E.; Barta, M.; Cserepes, E.; Friedman, M.; Hoffman, A. 2003 Novel gastroretentive dosage forms: evaluation of gastroretentivity and its effect on levodopa in humans. Pharm. Res. 20, 1466-73, Hoffman, A.; Stepensky, D.; Lavy, E.; Eyal, S. Klausner, E.; Friedman, M. 2004 Pharmacokinetic and pharmacodynamic aspects of gastroretentive dosage forms Int. J. Pharm. 11, 141-53, Streubel, A.; Siepmann, J.; Bodmeier, R.; 2006 Gastroretentive drug delivery systems Expert Opin. Drug Deliver. 3, 217-3, and Chavanpatil, M. D.; Jain, P.; Chaudhari, S.; Shear, R.; Vavia, P. R. Novel sustained release, swellable and bioadhesive gastroretentive drug delivery system for olfoxacin Int. J. Pharm. 2006. Expandable, floating and bioadhesive techniques can be utilized to maximize absorption of the compounds of the disclosure.
[0312] The compounds of the disclosure can be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and can be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, for example, solutions in aqueous polyethylene glycol.
[0313] For injectable formulations, the vehicle can be chosen from those known in art to be suitable, including aqueous solutions or oil suspensions, or emulsions, with sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or a sterile aqueous solution, and similar pharmaceutical vehicles. The formulation can also comprise polymer compositions which are biocompatible, biodegradable, such as poly(lactic-co-glycolic)acid. These materials can be made into micro or nanospheres, loaded with drug and further coated or derivatized to provide superior sustained release performance. Vehicles suitable for periocular or intraocular injection include, for example, suspensions of therapeutic agent in injection grade water, liposomes and vehicles suitable for lipophilic substances. Other vehicles for periocular or intraocular injection are well known in the art.
[0314] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition can also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.
[0315] When administration is by injection, the active compound can be formulated in aqueous solutions, specifically in physiologically compatible buffers such as Hanks solution, Ringer's solution, or physiological saline buffer. The solution can contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active compound can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use. In some embodiments, the pharmaceutical composition does not comprise an adjuvant or any other substance added to enhance the immune response stimulated by the peptide. In some embodiments, the pharmaceutical composition comprises a substance that inhibits an immune response to the peptide. Methods of formulation are known in the art, for example, as disclosed in Remington's Pharmaceutical Sciences, latest edition, Mack Publishing Co., Easton P.
[0316] In addition to the formulations described previously, the agents can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation or transcutaneous delivery (for example, subcutaneously or intramuscularly), intramuscular injection or use of a transdermal patch. Thus, for example, the agents can be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0317] In some embodiments, pharmaceutical compositions comprising one or more agents of the present disclosure exert local and regional effects when administered topically or injected at or near particular sites of infection. Direct topical application, e.g., of a viscous liquid, solution, suspension, dimethylsulfoxide (DMSO)-based solutions, liposomal formulations, gel, jelly, cream, lotion, ointment, suppository, foam, or aerosol spray, can be used for local administration, to produce for example, local and/or regional effects. Pharmaceutically appropriate vehicles for such formulation include, for example, lower aliphatic alcohols, polyglycols (e.g., glycerol or polyethylene glycol), esters of fatty acids, oils, fats, silicones, and the like. Such preparations can also include preservatives (e.g., p-hydroxybenzoic acid esters) and/or antioxidants (e.g., ascorbic acid and tocopherol). See also Dermatological Formulations: Percutaneous absorption, Barry (Ed.), Marcel Dekker Incl, 1983.
[0318] Pharmaceutical compositions of the present disclosure can contain a cosmetically or dermatologically acceptable carrier. Such carriers are compatible with skin, nails, mucous membranes, tissues and/or hair, and can include any conventionally used cosmetic or dermatological carrier meeting these requirements. Such carriers can be readily selected by one of ordinary skill in the art. In formulating skin ointments, an agent or combination of agents of the instant disclosure can be formulated in an oleaginous hydrocarbon base, an anhydrous absorption base, a water-in-oil absorption base, an oil-in-water water-removable base and/or a water-soluble base. Examples of such carriers and excipients include, but are not limited to, humectants (e.g., urea), glycols (e.g., propylene glycol), alcohols (e.g., ethanol), fatty acids (e.g., oleic acid), surfactants (e.g., isopropyl myristate and sodium lauryl sulfate), pyrrolidones, glycerol monolaurate, sulfoxides, terpenes (e.g., menthol), amines, amides, alkanes, alkanols, water, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
[0319] Ointments and creams can, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agents. Lotions can be formulated with an aqueous or oily base and will in general also containing one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art. See, e.g., U.S. Pat. Nos. 5,023,252, 4,992,445 and 5,001,139. Such patches can be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
[0320] Lubricants which can be used to form pharmaceutical compositions and dosage forms of the disclosure include, but are not limited to, calcium stearate, magnesium stearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc, hydrogenated vegetable oil (e.g., peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil), zinc stearate, ethyl oleate, ethyl laureate, agar, or mixtures thereof. Additional lubricants include, for example, a syloid silica gel, a coagulated aerosol of synthetic silica, or mixtures thereof. A lubricant can optionally be added, in an amount of less than about 1 weight percent of the pharmaceutical composition.
[0321] The compositions according to the present disclosure can be in any form suitable for topical application, including aqueous, aqueous-alcoholic or oily solutions, lotion or serum dispersions, aqueous, anhydrous or oily gels, emulsions obtained by dispersion of a fatty phase in an aqueous phase (0/W or oil in water) or, conversely, (W/O or water in oil), microemulsions or alternatively microcapsules, microparticles or lipid vesicle dispersions of ionic and/or nonionic type. These compositions can be prepared according to conventional methods. Other than the agents of the disclosure, the amounts of the various constituents of the compositions according to the disclosure are those conventionally used in the art. These compositions in particular constitute protection, treatment or care creams, milks, lotions, gels or foams for the face, for the hands, for the body and/or for the mucous membranes, or for cleansing the skin. The compositions can also consist of solid preparations constituting soaps or cleansing bars.
[0322] Compositions of the present disclosure can also contain adjuvants common to the cosmetic and dermatological fields, such as hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic active agents, preserving agents, antioxidants, solvents, fragrances, fillers, sunscreens, odor-absorbers and dyestuffs. The amounts of these various adjuvants are those conventionally used in the fields considered and, for example, are from about 0.01% to about 20% of the total weight of the composition. Depending on their nature, these adjuvants can be introduced into the fatty phase, into the aqueous phase and/or into the lipid vesicles.
[0323] In some embodiments, ocular viral infections can be effectively treated with ophthalmic solutions, suspensions, ointments or inserts comprising an agent or combination of agents of the present disclosure. Eye drops can be prepared by dissolving the active ingredient in a sterile aqueous solution such as physiological saline, buffering solution, etc., or by combining powder compositions to be dissolved before use. Other vehicles can be chosen, as is known in the art, including but not limited to: balance salt solution, saline solution, water soluble polyethers such as polyethyene glycol, polyvinyls, such as polyvinyl alcohol and povidone, cellulose derivatives such as methylcellulose and hydroxypropyl methylcellulose, petroleum derivatives such as mineral oil and white petrolatum, animal fats such as lanolin, polymers of acrylic acid such as carboxypolymethylene gel, vegetable fats such as peanut oil and polysaccharides such as dextrans, and glycosaminoglycans such as sodium hyaluronate. If desired, additives ordinarily used in the eye drops can be added. Such additives include isotonizing agents (e.g., sodium chloride, etc.), buffer agent (e.g., boric acid, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g., benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.), thickeners (e.g., saccharide such as lactose, mannitol, maltose, etc.; e.g., hyaluronic acid or its salt such as sodium hyaluronate, potassium hyaluronate, etc.; e.g., mucopolysaccharide such as chondroitin sulfate, etc.; e.g., sodium polyacrylate, carboxyvinyl polymer, crosslinked polyacrylate, polyvinyl alcohol, polyvinyl pyrrolidone, methyl cellulose, hydroxy propyl methylcellulose, hydroxyethyl cellulose, carboxymethyl cellulose, hydroxy propyl cellulose or other agents known to those skilled in the art).
[0324] The solubility of the components of the present compositions can be enhanced by a surfactant or other appropriate co-solvent in the composition. Such cosolvents include polysorbate 20, 60, and 80, Pluronic F68, F-84 and P-103, cyclodextrin, or other agents known to those skilled in the art. Such co-solvents can be employed at a level of from about 0.01% to 2% by weight.
[0325] The compositions of the disclosure can be packaged in multidose form. Preservatives can be preferred to prevent microbial contamination during use. Suitable preservatives include: benzalkonium chloride, thimerosal, chlorobutanol, methyl paraben, propyl paraben, phenylethyl alcohol, edetate disodium, sorbic acid, Onamer M, or other agents known to those skilled in the art. In the prior art ophthalmic products, such preservatives can be employed at a level of from 0.004% to 0.02%. In the compositions of the present application the preservative, preferably benzalkonium chloride, can be employed at a level of from 0.001% to less than 0.01%, e.g. from 0.001% to 0.008%, preferably about 0.005% by weight. It has been found that a concentration of benzalkonium chloride of 0.005% can be sufficient to preserve the compositions of the present disclosure from microbial attack.
[0326] In some embodiments, developmental disorder associated symptoms of the ear can be effectively treated with otic solutions, suspensions, ointments or inserts comprising an agent or combination of agents of the present disclosure.
[0327] In some embodiments, the agents of the present disclosure are delivered in soluble rather than suspension form, which allows for more rapid and quantitative absorption to the sites of action. In general, formulations such as jellies, creams, lotions, suppositories and ointments can provide an area with more extended exposure to the agents of the present disclosure, while formulations in solution, e.g., sprays, provide more immediate, short-term exposure.
[0328] In some embodiments relating to topical/local application, the pharmaceutical compositions can include one or more penetration enhancers. For example, the formulations can comprise suitable solid or gel phase carriers or excipients that increase penetration or help delivery of agents or combinations of agents of the disclosure across a permeability barrier, e.g., the skin Many of these penetration-enhancing compounds are known in the art of topical formulation, and include, e.g., water, alcohols (e.g., terpenes like methanol, ethanol, 2-propanol), sulfoxides (e.g., dimethyl sulfoxide, decylmethyl sulfoxide, tetradecylmethyl sulfoxide), pyrrolidones (e.g., 2-pyrrolidone, N-methyl-2-pyrrolidone, N-(2-hydroxyethyl)pyrrolidone), laurocapram, acetone, dimethylacetamide, dimethylformamide, tetrahydrofurfuryl alcohol, L--amino acids, anionic, cationic, amphoteric or nonionic surfactants (e.g., isopropyl myristate and sodium lauryl sulfate), fatty acids, fatty alcohols (e.g., oleic acid), amines, amides, clofibric acid amides, hexamethylene lauramide, proteolytic enzymes, -bisabolol, d-limonene, urea and N,N-diethyl-m-toluamide, and the like. Additional examples include humectants (e.g., urea), glycols (e.g., propylene glycol and polyethylene glycol), glycerol monolaurate, alkanes, alkanols, ORGELASE, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and/or other polymers. In some embodiments, the pharmaceutical compositions will include one or more such penetration enhancers.
[0329] In some embodiments, the pharmaceutical compositions for local/topical application can include one or more antimicrobial preservatives such as quaternary ammonium compounds, organic mercurials, p-hydroxy benzoates, aromatic alcohols, chlorobutanol, and the like.
[0330] Gastrointestinal developmental disorder symptoms can be effectively treated with orally- or rectally delivered solutions, suspensions, ointments, enemas and/or suppositories comprising an agent or combination of agents of the present disclosure.
[0331] Respiratory developmental disorder symptoms can be effectively treated with aerosol solutions, suspensions or dry powders comprising an agent or combination of agents of the present disclosure. Administration by inhalation is particularly useful in treating viral infections of the lung, such as influenza. The aerosol can be administered through the respiratory system or nasal passages. For example, one skilled in the art will recognize that a composition of the present disclosure can be suspended or dissolved in an appropriate carrier, e.g., a pharmaceutically acceptable propellant, and administered directly into the lungs using a nasal spray or inhalant. For example, an aerosol formulation comprising a developmental disorder associated biomarkers' inhibitors can be dissolved, suspended or emulsified in a propellant or a mixture of solvent and propellant, e.g., for administration as a nasal spray or inhalant. Aerosol formulations can contain any acceptable propellant under pressure, such as a cosmetically or dermatologically or pharmaceutically acceptable propellant, as conventionally used in the art.
[0332] An aerosol formulation for nasal administration is generally an aqueous solution designed to be administered to the nasal passages in drops or sprays. Nasal solutions can be similar to nasal secretions in that they are generally isotonic and slightly buffered to maintain a pH of about 5.5 to about 6.5, although pH values outside of this range can additionally be used. Antimicrobial agents or preservatives can also be included in the formulation.
[0333] An aerosol formulation for inhalations and inhalants can be designed so that the agent or combination of agents of the present disclosure is carried into the respiratory tree of the subject when administered by the nasal or oral respiratory route. Inhalation solutions can be administered, for example, by a nebulizer. Inhalations or insufflations, comprising finely powdered or liquid drugs, can be delivered to the respiratory system as a pharmaceutical aerosol of a solution or suspension of the agent or combination of agents in a propellant, e.g., to aid in disbursement. Propellants can be liquefied gases, including halocarbons, for example, fluorocarbons such as fluorinated chlorinated hydrocarbons, hydrochlorofluorocarbons, and hydrochlorocarbons, as well as hydrocarbons and hydrocarbon ethers.
[0334] Halocarbon propellants useful in the present disclosure include fluorocarbon propellants in which all hydrogens are replaced with fluorine, chlorofluorocarbon propellants in which all hydrogens are replaced with chlorine and at least one fluorine, hydrogen-containing fluorocarbon propellants, and hydrogen-containing chlorofluorocarbon propellants. Halocarbon propellants are described in Johnson, U.S. Pat. No. 5,376,359; Byron et al., U.S. Pat. No. 5,190,029; and Purewal et al., U.S. Pat. No. 5,776,434. Hydrocarbon propellants useful in the disclosure include, for example, propane, isobutane, n-butane, pentane, isopentane and neopentane. A blend of hydrocarbons can also be used as a propellant. Ether propellants include, for example, dimethyl ether as well as the ethers. An aerosol formulation of the disclosure can also comprise more than one propellant. For example, the aerosol formulation can comprise more than one propellant from the same class, such as two or more fluorocarbons; or more than one, more than two, more than three propellants from different classes, such as a fluorohydrocarbon and a hydrocarbon. Pharmaceutical compositions of the present disclosure can also be dispensed with a compressed gas, e.g., an inert gas such as carbon dioxide, nitrous oxide or nitrogen.
[0335] Aerosol formulations can also include other components, for example, ethanol, isopropanol, propylene glycol, as well as surfactants or other components such as oils and detergents. These components can serve to stabilize the formulation and/or lubricate valve components.
[0336] The aerosol formulation can be packaged under pressure and can be formulated as an aerosol using solutions, suspensions, emulsions, powders and semisolid preparations. For example, a solution aerosol formulation can comprise a solution of an agent of the disclosure such as a developmental disorder associated biomarkers' inhibitors in (substantially) pure propellant or as a mixture of propellant and solvent. The solvent can be used to dissolve the agent and/or retard the evaporation of the propellant. Solvents useful in the disclosure include, for example, water, ethanol and glycols. Any combination of suitable solvents can be use, optionally combined with preservatives, antioxidants, and/or other aerosol components.
[0337] An aerosol formulation can also be a dispersion or suspension. A suspension aerosol formulation can comprise a suspension of an agent or combination of agents of the instant disclosure, e.g., a developmental disorder associated biomarkers' inhibitors, and a dispersing agent. Dispersing agents useful in the disclosure include, for example, sorbitan trioleate, oleyl alcohol, oleic acid, lecithin and corn oil. A suspension aerosol formulation can also include lubricants, preservatives, antioxidant, and/or other aerosol components.
[0338] An aerosol formulation can similarly be formulated as an emulsion. An emulsion aerosol formulation can include, for example, an alcohol such as ethanol, a surfactant, water and a propellant, as well as an agent or combination of agents of the disclosure, e.g., a developmental disorder associated biomarkers' inhibitors. The surfactant used can be nonionic, anionic or cationic. One example of an emulsion aerosol formulation comprises, for example, ethanol, surfactant, water and propellant. Another example of an emulsion aerosol formulation comprises, for example, vegetable oil, glyceryl monostearate and propane.
[0339] The compounds of the disclosure can be formulated for administration as suppositories. A low melting wax, such as a mixture of triglycerides, fatty acid glycerides, Witepsol S55 (trademark of Dynamite Nobel Chemical, Germany), or cocoa butter is first melted and the active component is dispersed homogeneously, for example, by stirring. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool, and to solidify.
[0340] The compounds of the disclosure can be formulated for vaginal administration. Pessaries, tampons, creams, gels, pastes, foams or sprays containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
[0341] It is envisioned additionally, that the compounds of the disclosure can be attached releasably to biocompatible polymers for use in sustained release formulations on, in or attached to inserts for topical, intraocular, periocular, or systemic administration. The controlled release from a biocompatible polymer can be utilized with a water soluble polymer to form an instillable formulation, as well. The controlled release from a biocompatible polymer, such as for example, PLGA microspheres or nanospheres, can be utilized in a formulation suitable for intra ocular implantation or injection for sustained release administration, as well any suitable biodegradable and biocompatible polymer can be used.
[0342] In one aspect of the disclosure, the subject's carrier status of any of the genetic variation risk variants described herein, or genetic variants identified via other analysis methods within the genes or regulatory loci that are identified by the CNVs described herein, can be used to help determine whether a particular treatment modality for a developmental disorder, such as any one of the above, or a combination thereof, should be administered. The present disclosure also relates to methods of monitoring progress or effectiveness of a treatment option for a developmental disorder. The treatment option can include any of the above mentioned treatment options commonly used. This can be done based on the outcome of determination of the presence of a particular genetic variation risk variant in the individual, or by monitoring expression of genes that are associated with the variants of the present disclosure. Expression levels and/or mRNA levels can thus be determined before and during treatment to monitor its effectiveness. Alternatively, or concomitantly, the status with respect to a genetic variation, and or genotype and/or haplotype status of at least one risk variant for a developmental disorder presented herein can determined before and during treatment to monitor its effectiveness. It can also be appreciated by those skilled in the art that aberrant expression levels of a gene impacted by a CNV or other mutations found as a consequence of targeted sequencing of the CNV-identified gene can be assayed or diagnostically tested for by measuring the protein expression level of said aberrantly expressed gene. In another embodiment, aberrant expression levels of a gene may result from a CNV impacting a DNA sequence (e.g., transcription factor binding site) that regulates a gene who's aberrant expression level is involved in or causes a developmental disorder, or other mutations found as a consequence of targeted sequencing of the CNV-identified gene regulatory sequence, can be assayed or diagnostically tested for by measuring the protein expression level of the gene involved in or causative of a developmental disorder. In some embodiments, a specific CNV mutation within a gene, or other specific mutations found upon targeted sequencing of a CNV-identified gene found to be involved in or causative of a developmental disorder, may cause an aberrant structural change in the expressed protein that results from said gene mutations and the altered protein structure(s) can be assayed via various methods know to those skilled in the art.
[0343] Alternatively, biological networks or metabolic pathways related to the genes within, or associated with, the genetic variations described herein can be monitored by determining mRNA and/or polypeptide levels. This can be done for example, by monitoring expression levels or polypeptides for several genes belonging to the network and/or pathway, in samples taken before and during treatment. Alternatively, metabolites belonging to the biological network or metabolic pathway can be determined before and during treatment. Effectiveness of the treatment is determined by comparing observed changes in expression levels/metabolite levels during treatment to corresponding data from healthy subjects.
[0344] In a further aspect, the genetic variations described herein, and/or those subsequently found (e.g., via other genetic analysis methods such as sequencing) via targeted analysis of those genes initially identified by the genetic variations described herein, can be used to increase power and effectiveness of clinical trials. Thus, individuals who are carriers of at least one at-risk genetic variation can be more likely to respond to a particular treatment modality for a developmental disorder. In some embodiments, individuals who carry at-risk variants for gene(s) in a pathway and/or metabolic network for which a particular treatment is targeting are more likely to be responders to the treatment. In another embodiment, individuals who carry at-risk variants for a gene, which expression and/or function is altered by the at-risk variant, are more likely to be responders to a treatment modality targeting that gene, its expression or its gene product. This application can improve the safety of clinical trials, but can also enhance the chance that a clinical trial can demonstrate statistically significant efficacy, which can be limited to a certain sub-group of the population. Thus, one possible outcome of such a trial is that carriers of certain genetic variants, are statistically significant and likely to show positive response to the therapeutic agent. Further, one or more of the genetic variations employed during clinical trials for a given therapeutic agent can be used in a companion diagnostic test that is administered to the patient prior to administration of the therapeutic agent to determine if the patient is likely to have favorable response to the therapeutic agent.
[0345] In a further aspect, the genetic variations described herein can be used for targeting the selection of pharmaceutical agents for specific individuals. The pharmaceutical agent can be any of the agents described in the above. Personalized selection of treatment modalities, lifestyle changes or combination of the two, can be realized by the utilization of the at-risk genetic variations or surrogate markers in linkage disequilibrium with the genetic variations. Thus, the knowledge of an individual's status for particular genetic variations can be useful for selection of treatment options, for example, for treatments that target genes or gene products affected by one or more of the genetic variations. Certain combinations of variants, including those described herein, but also combinations with other risk variants for a developmental disorder, can be suitable for one selection of treatment options, while other variant combinations can target other treatment options. Such combinations of variants can include one variant, two variants, three variants, or four or more variants, as needed to determine with clinically reliable accuracy the selection of treatment module.
Animal and Cell Models of Developmental disorders
[0346] Also provided herein are engineered cells that can harbor one or more polymorphism described herein, for example, one or more genetic variations associated with a developmental disorder, for example, a SNP or CNV. Such cells can be useful for studying the effect of a polymorphism on physiological function, and for identifying and/or evaluating potential therapeutic agents such as anti-psychotics for the treatment of a developmental disorder.
[0347] Methods are known in the art for generating cells, for example, by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell, for example, a cell of an animal. In some cases, cells can be used to generate transgenic animals using methods known in the art.
[0348] The cells are preferably mammalian cells in which an endogenous gene has been altered to include a genetic variation as described herein. Techniques such as targeted homologous recombination, can be used to insert the heterologous DNA as described in, e.g., Chappel, U.S. Pat. No. 5,272,071; WO 91/06667. In another embodiment induced pluripotent stem cells with specific disease-causing or disease-associated mutations (such as CNVs and SNVs) can be used for disease modeling and drug discovery, for example, as described in Grskovic et al. (2011) Nat. Rev. Drug. Discov. 10(12):915-29.
[0349] Autism Spectrum Disorder is not known to occur naturally in any species other than humans, although recently, an animal model has been developed that shows some features of the disease. This mouse model was created by replacing the normal mouse neuroligin-3 gene with a mutated neuroligin-3 gene associated with autism in humans (Sdhof, M. D., et al., UT Southwestern; Tabuchi et al. (2007) Science 318(5847):71-6). By doing so, a gene was created in mice similar to the human autism disease gene. While the result amounted to a very small change in their genetic makeup, it mimics the same small change occurring in some patients with human autism. This and any other models described in the literature can be used with the methods of the disclosure.
[0350] Pharmaceutical compositions suitable for use in the present disclosure include compositions wherein the active ingredients are present in an effective amount, i.e., in an amount effective to achieve therapeutic and/or prophylactic benefit in a host with at least one a developmental disorder associated symptom. The actual amount effective for a particular application will depend on the condition or conditions being treated, the condition of the subject, the formulation, and the route of administration, as well as other factors known to those of skill in the art. Determination of an effective amount of a developmental disorder associated biomarkers' inhibitors is well within the capabilities of those skilled in the art, in light of the disclosure herein, and will be determined using routine optimization techniques.
[0351] The effective amount for use in humans can be determined from animal models. For example, a dose for humans can be formulated to achieve circulating, liver, topical and/or gastrointestinal concentrations that have been found to be effective in animals. One skilled in the art can determine the effective amount for human use, especially in light of the animal model experimental data described herein. Based on animal data, and other types of similar data, those skilled in the art can determine the effective amounts of compositions of the present disclosure appropriate for humans.
[0352] The effective amount when referring to an agent or combination of agents of the disclosure will generally mean the dose ranges, modes of administration, formulations, etc., that have been recommended or approved by any of the various regulatory or advisory organizations in the medical or pharmaceutical arts (e.g., FDA, AMA) or by the manufacturer or supplier.
[0353] Further, appropriate doses for a developmental disorder's associated biomarkers' inhibitors can be determined based on in vitro experimental results. For example, the in vitro potency of an agent in inhibiting a developmental disorder's associated biomarkers' components, provides information useful in the development of effective in vivo dosages to achieve similar biological effects. In some embodiments, administration of agents of the present disclosure can be intermittent, for example, administration once every two days, every three days, every five days, once a week, once or twice a month, and the like. In some embodiments, the amount, forms, and/or amounts of the different forms can be varied at different times of administration.
[0354] A person of skill in the art would be able to monitor in a subject the effect of administration of a particular agent. Other techniques would be apparent to one of skill in the art, wherein the active ingredients are present in an effective amount, for example, in an amount effective to achieve therapeutic and/or prophylactic benefit in a host with at least one developmental disorder associated symptom. The actual amount effective for a particular application will depend on the condition or conditions being treated, the condition of the subject, the formulation, and the route of administration, as well as other factors known to those of skill in the art. Determination of an effective amount of a developmental disorder's associated biomarkers' inhibitors is well within the capabilities of those skilled in the art, in light of the disclosure herein, and will be determined using routine optimization techniques.
[0355] Further, appropriate doses for a developmental disorder's associated biomarkers' inhibitors can be determined based on in vitro experimental results. For example, the in vitro potency of an agent in inhibiting a developmental disorder's associated biomarkers' components can provide information useful in the development of effective in vivo dosages to achieve similar biological effects.
Kits
[0356] Kits useful in the methods of the disclosure comprise components useful in any of the methods described herein, including for example, primers for nucleic acid amplification, hybridization probes for detecting genetic variation, or other marker detection, restriction enzymes, nucleic acid probes, optionally labeled with suitable labels, allele-specific oligonucleotides, antibodies that bind to an altered polypeptide encoded by a nucleic acid of the disclosure as described herein or to a wild type polypeptide encoded by a nucleic acid of the disclosure as described herein, means for amplification of genetic variations or fragments thereof, means for analyzing the nucleic acid sequence of nucleic acids comprising genetic variations as described herein, means for analyzing the amino acid sequence of a polypeptide encoded by a genetic variation, or a nucleic acid associated with a genetic variation, etc. The kits can for example, include necessary buffers, nucleic acid primers for amplifying nucleic acids, and reagents for allele-specific detection of the fragments amplified using such primers and necessary enzymes (e.g., DNA polymerase). Additionally, kits can provide reagents for assays to be used in combination with the methods of the present disclosure, for example, reagents for use with other screening assays for a developmental disorder.
[0357] In some embodiments, the disclosure pertains to a kit for assaying a sample from a subject to detect the presence of a genetic variation, wherein the kit comprises reagents necessary for selectively detecting at least one particular genetic variation in the genome of the individual. In another embodiment, the disclosure pertains to a kit for assaying a sample from a subject to detect the presence of at least particular allele of at least one polymorphism associated with a genetic variation in the genome of the subject. In some embodiments, the reagents comprise at least one contiguous oligonucleotide that hybridizes to a fragment of the genome of the individual comprising at least genetic variation. In another embodiment, the reagents comprise at least one pair of oligonucleotides that hybridize to opposite strands of a genomic segment obtained from a subject, wherein each oligonucleotide primer pair is designed to selectively amplify a fragment of the genome of the individual that includes at least one genetic variation, or a fragment of a genetic variation. Such oligonucleotides or nucleic acids can be designed using the methods described herein. In another embodiment, the kit comprises one or more labeled nucleic acids capable of allele-specific detection of one or more specific polymorphic markers or haplotypes with a genetic variation, and reagents for detection of the label. In some embodiments, a kit for detecting SNP markers can comprise a detection oligonucleotide probe, that hybridizes to a segment of template DNA containing a SNP polymorphisms to be detected, an enhancer oligonucleotide probe, detection probe, primer and/or an endonuclease, for example, as described by Kutyavin et al. (Nucleic Acid Res. 34:e128 (2006)).
[0358] In some embodiments, the DNA template is amplified by any means of the present disclosure, prior to assessment for the presence of specific genetic variations as described herein. Standard methods well known to the skilled person for performing these methods can be utilized, and are within scope of the disclosure. In one such embodiment, reagents for performing these methods can be included in the reagent kit.
[0359] In a further aspect of the present disclosure, a pharmaceutical pack (kit) is provided, the pack comprising a therapeutic agent and a set of instructions for administration of the therapeutic agent to humans screened for one or more variants of the present disclosure, as disclosed herein. The therapeutic agent can be a small molecule drug, an antibody, a peptide, an antisense or RNAi molecule, or other therapeutic molecules as described herein. In some embodiments, an individual identified as a carrier of at least one variant of the present disclosure is instructed to take a prescribed dose of the therapeutic agent. In one such embodiment, an individual identified as a carrier of at least one variant of the present disclosure is instructed to take a prescribed dose of the therapeutic agent. In another embodiment, an individual identified as a non-carrier of at least one variant of the present disclosure is instructed to take a prescribed dose of the therapeutic agent.
[0360] Also provided herein are articles of manufacture, comprising a probe that hybridizes with a region of human chromosome as described herein and can be used to detect a polymorphism described herein. For example, any of the probes for detecting polymorphisms described herein can be combined with packaging material to generate articles of manufacture or kits. The kit can include one or more other elements including: instructions for use; and other reagents such as a label or an agent useful for attaching a label to the probe. Instructions for use can include instructions for screening applications of the probe for making a diagnosis, prognosis, or theranosis to a developmental disorder in a method described herein. Other instructions can include instructions for attaching a label to the probe, instructions for performing in situ analysis with the probe, and/or instructions for obtaining a sample to be analyzed from a subject. In some cases, the kit can include a labeled probe that hybridizes to a region of human chromosome as described herein.
[0361] The kit can also include one or more additional reference or control probes that hybridize to the same chromosome or another chromosome or portion thereof that can have an abnormality associated with a particular endophenotype. A kit that includes additional probes can further include labels, e.g., one or more of the same or different labels for the probes. In other embodiments, the additional probe or probes provided with the kit can be a labeled probe or probes. When the kit further includes one or more additional probe or probes, the kit can further provide instructions for the use of the additional probe or probes. Kits for use in self-testing can also be provided. Such test kits can include devices and instructions that a subject can use to obtain a biological sample (e.g., buccal cells, blood) without the aid of a health care provider. For example, buccal cells can be obtained using a buccal swab or brush, or using mouthwash.
[0362] Kits as provided herein can also include a mailer (e.g., a postage paid envelope or mailing pack) that can be used to return the sample for analysis, e.g., to a laboratory. The kit can include one or more containers for the sample, or the sample can be in a standard blood collection vial. The kit can also include one or more of an informed consent form, a test requisition form, and instructions on how to use the kit in a method described herein. Methods for using such kits are also included herein. One or more of the forms (e.g., the test requisition form) and the container holding the sample can be coded, for example, with a bar code for identifying the subject who provided the sample.
[0363] In some embodiments, an in vitro screening test can comprise one or more devices, tools, and equipment configured to collect a genetic sample from an individual. In some embodiments of an in vitro screening test, tools to collect a genetic sample can include one or more of a swab, a scalpel, a syringe, a scraper, a container, and other devices and reagents designed to facilitate the collection, storage, and transport of a genetic sample. In some embodiments, an in vitro screening test can include reagents or solutions for collecting, stabilizing, storing, and processing a genetic sample.
[0364] Such reagents and solutions for nucleotide collecting, stabilizing, storing, and processing are well known by those of skill in the art and can be indicated by specific methods used by an in vitro screening test as described herein. In another embodiment, an in vitro screening test as disclosed herein, can comprise a microarray apparatus and reagents, a flow cell apparatus and reagents, a multiplex nucleotide sequencer and reagents, and additional hardware and software necessary to assay a genetic sample for certain genetic markers and to detect and visualize certain genetic markers.
[0365] The present disclosure further relates to kits for using antibodies in the methods described herein. This includes, but is not limited to, kits for detecting the presence of a variant protein in a test sample. One preferred embodiment comprises antibodies such as a labeled or labelable antibody and a compound or agent for detecting variant proteins in a biological sample, means for determining the amount or the presence and/or absence of variant protein in the sample, and means for comparing the amount of variant protein in the sample with a standard, as well as instructions for use of the kit. In certain embodiments, the kit further comprises a set of instructions for using the reagents comprising the kit.
[0366] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The following references contain embodiments of the methods and compositions that can be used herein: The Merck Manual of Diagnosis and Therapy, 18th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-18-2); Benjamin Lewin, Genes IX, published by Jones & Bartlett Publishing, 2007 (ISBN-13: 9780763740634); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
[0367] Standard procedures of the present disclosure are described, e.g., in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual (2 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1986); or Methods in Enzymology: Guide to Molecular Cloning Techniques Vol. 152, S. L. Berger and A. R. Kimmerl (eds.), Academic Press Inc., San Diego, USA (1987)). Current Protocols in Molecular Biology (CPMB) (Fred M. Ausubel, et al. ed., John Wiley and Sons, Inc.), Current Protocols in Protein Science (CPPS) (John E. Coligan, et. al., ed., John Wiley and Sons, Inc.), Current Protocols in Immunology (CPI) (John E. Coligan, et. al., ed. John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), and Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998), which are all incorporated by reference herein in their entireties.
[0368] It should be understood that the following examples should not be construed as being limiting to the particular methodology, protocols, and compositions, etc., described herein and, as such, can vary. The following terms used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the embodiments disclosed herein.
[0369] Disclosed herein are molecules, materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of methods and compositions disclosed herein. It is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed and while specific reference of each various individual and collective combinations and permutation of these molecules and compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a nucleotide or nucleic acid is disclosed and discussed and a number of modifications that can be made to a number of molecules including the nucleotide or nucleic acid are discussed, each and every combination and permutation of nucleotide or nucleic acid and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed molecules and compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.
[0370] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims.
[0371] It is understood that the disclosed methods and compositions are not limited to the particular methodology, protocols, and reagents described as these can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure which will be limited only by the appended claims.
[0372] Unless defined otherwise, all technical and scientific terms used herein have the meanings that would be commonly understood by one of skill in the art in the context of the present specification.
[0373] It must be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to a nucleotide includes a plurality of such nucleotides; reference to the nucleotide is a reference to one or more nucleotides and equivalents thereof known to those skilled in the art, and so forth.
[0374] The term and/or shall in the present context be understood to indicate that either or both of the items connected by it are involved. While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein can be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
EXAMPLES
Example 1Method 1
[0375] One method used to generate the data herein is described herein. A study was performed of a comparison of copy number variants (CNVs) identified in 2 cohorts:
[0376] 1. 1,005 Normal individuals (Normal Variation EngineNVE);
[0377] 2. 682 ASD cases (Data obtained from Sick Kids Hospital, Toronto, Canada);
[0378] Hybridization of genomic DNA samples from the ASD cohort had been performed. For the ASD samples, reference DNA samples were labeled with Cy3 and test subject cases with Cy5. After labeling, samples were combined and co-hybridized to Agilent 1M feature oligonucleotide microarrays, design ID 021529 (Agilent Product Number G4447A) using standard conditions (array Comparative Genomic HybridizationaCGH). Post-hybridization, arrays were scanned at 3 m resolution, using Agilent's DNA microarray scanner, generating tiff images for later analysis. All hybridizations were sex-matched; reference samples were pools of 50 male and 50 female samples, respectively. Genomic DNA for the reference pools was isolated from cell lines.
[0379] Genomic DNA samples from individuals within the Normal cohort (test subjects) were hybridized against a single, sex-matched reference individual as follows. Reference DNA samples were labeled with Cy5 and Test subject DNA samples were labeled with Cy3. After labeling, samples were combined and co-hybridized to Agilent 1M feature oligonucleotide microarrays, design ID 021529 (Agilent Product Number G4447A) using standard conditions (array Comparative Genomic HybridizationaCGH). Post-hybridization, arrays were scanned at 2 m resolution, using Agilent's DNA microarray scanner, generating tiff images for later analysis. All tiff images were analyzed using Agilent Feature Extraction (FE) software, with the following settings: Human Genome Freeze: hg18:NCBI36:Mar2006, FE version: 10.7.3.1, Grid/design file: 021529 D F 20091001, and Protocol: CGH 107 Sep09.
[0380] This procedure generated a variety of output files, one of which is a text-tab delimited file, containing 1,000,000 rows of data, each corresponding to a specific feature on the array. This *.txt file was used to perform CNV calling using DNAcopy, an open source software package implemented in R via BioConductor. Losses or gains were determined according to a threshold log 2ratio, which was set at /+0.35. For example, all losses with a log 2ratio value <=0.35 were counted, as were all gains with a log 2ratio >=+0.35. Note that, in order to maintain consistency with the other data, all log 2ratio values were determined according to Cy3/Cy5 (Test/Reference). A CNV list was thus generated for each individual in the 2 cohorts All CNV lists from the 1,005 controls (Normals) were merged into one master list, containing a non-redundant list of all CNVs found in the Normal cohort (NVE-master). The total number of CNVs (non-redundant) in the Normal cohort was 162,316. All CNVs from the 682 ASD cases were merged into one master list, containing a non-redundant list of all CNVs found in the ASD cohort (ASD-master). The total number of CNVs (non-redundant) in the ASD cohort was 72,183. After subtraction using the NVE-master list, there were 6,950 CNVs left in the ASD-unique set, a reduction of >90%. CNVs of interest (i.e., candidate CNVs causal of ASD) were obtained after annotation using custom designed scripts in order to attach relevant information regarding overlap with known genes, exons, and CNVs generated by a study from the Wellcome Trust Sanger Institute to each CNV region. Various classes of CNVs of interest were generated as follows:
[0381] 1. Direct comparisons were made between NVE-master and ASD-master lists, in order to generate a list of CNVs present only in the ASD-master list (ASD-unique list). This list contains CNVs, which are a subset of the total set of 6,950 ASD-specific CNVs, that are: a) overlapping exons and present in 2 or more ASD cases and, and b) overlapping introns, affecting more than 4 consecutive probes, absent in CNVs defined by the Sanger study and present in a large number of ASD cases;
[0382] 2. A probe-by-probe analysis for the complete data set was performed, in order to obtain lists of CNVs whose frequency between the two cohorts differed significantly (ASD-specific) list. Only CNVs affecting 2 or more probes and overlapping an exon were included);
[0383] 3. For 17 unrelated ASD cases, data was available from both parents. A direct comparison was made between CNVs present in either parent and those present in their offspring, and a list generated of apparent de novo CNVs (CNVs present in an offspring which could not have been inherited from either parent).
[0384] It can be appreciated by those skilled in the art that the number of ASD candidate genes/regions, irrespective of the class in which they are included, may increase or decrease when additional ASD cohorts are analyzed for CNV-specific genes/regions, or similarly if additional Normal cohorts are used to further refine ASD-specific CNVs.
Example 2Method 2
[0385] A study was performed and comprised of a comparison of copy number variants (CNVs) identified in 2 cohorts:
[0386] 1. 1,000 Normal individuals (Normal Variation EngineNVE);
[0387] 2. 676 ASD cases (Data obtained from Sick Kids Hospital, Toronto, Canada);
[0388] The Agilent 1M CGH array was used to detect novel rare CNVs in a total of 676 unrelated ASD cases. A vast majority of these samples had been previously run on other SNP microarrays. The ASD cases were competitively hybridized to a pool of fifty sex-matched Caucasian controls as a reference. For the ASD samples, reference DNA samples were labeled with Cy3 and test subject cases with Cy5. After labeling, samples were combined and co-hybridized to Agilent 1M feature oligonucleotide microarrays, design ID 021529 (Agilent Product Number G4447A) using standard conditions (array Comparative Genomic HybridizationaCGH). Post-hybridization, arrays were scanned at 3 m resolution, using Agilent's DNA microarray scanner, generating tiff images for later analysis. Genomic DNA for the reference pools was isolated from cell lines.
[0389] Genomic DNA samples from individuals within the Normal cohort (test subjects) were hybridized against a single, sex-matched reference individual as follows. Reference DNA samples were labeled with Cy5 and Test subject DNA samples were labeled with Cy3. After labeling, samples were combined and co-hybridized to Agilent 1M feature oligonucleotide microarrays, design ID 021529 (Agilent Product Number G4447A) using standard conditions (array Comparative Genomic HybridizationaCGH). Post-hybridization, arrays were scanned at 2 m resolution, using Agilent's DNA microarray scanner, generating tiff images for later analysis. All tiff images were analyzed using Agilent Feature Extraction (FE) software, with the following settings:
[0390] Human Genome Freeze: hg18:NCBI36:Mar2006, FE version: 10.7.3.1, Grid/design file: 021529 D F 20091001, and Protocol: CGH 107 Sep09.
[0391] The CNV calling was performed using Aberration Detection Module 2 (ADM2) algorithm of DNA Analytics 4.0.85 and a circular binary segmentation (CBS) algorithm implemented in the DNAcopy package. The CNVs detected by both algorithms were defined as stringent and were utilized for further analyses. For CNV calling using the circular binary segmentation (CBS) algorithm implemented in the DNAcopy package, losses were determined according to a threshold log 2ratio, which was set at 0.41. Gains were determined according to a threshold log 2ratio, which was set at 0.32. Any segment whose median log-ratio was less than or equal 0.41 to was classified as a loss and any segment whose median log-ratio was greater than or equal to 0.32 was classified as a gain. Any segment whose absolute (median log-ratio/mad) value was less than 2 was excluded.
[0392] ADM-2 analysis parameter settings were as follows: Aberration Algorithm: ADM-2 Threshold: 6.0, Centralization: OFF, Fuzzy Zero: OFF, Combine Replicates (Intra Array): ON, Combine Replicates (Inter Array): OFF, Genome: hg18, Aberration Filters: minProbes=2 AND minAvgAbsLogRatio=0.25 AND maxAberrations=10000 AND percentPenetrance=0, Feature Level Filters: gIsSaturated=true OR rIsSaturated=true OR gIsFeatNonUnifOL=true OR rIsFeatNonUnifOL=true, Array Level Filters: NONE, Expand Non Unique Probes: ON, Genomic Boundaries: Not Applied. After ADM-2 generation of CNV lists, all nested aberrations were removed, as were all CNVs <5 probes in size (using custom scripts).
[0393] The calls were compared with the CNV data from Illumina 1M single and duo, Affymetrix 500K, Affymetrix 6.0. and Illumina 2.5M arrays. For example, 304 samples in the dataset had previously been run on Illumina 1M single array that was analyzed using two algorithms-iPattern and QuantiSNP. The average number of stringent calls generated for Agilent 1M and Illumina 1M is 36 and 18, respectively. It was found that only 27.56% of the total Agilent 1M call set was detected using the Illumina 1M platform. Conversely, 45.64% of the Illumina 1M calls were not detected using the Agilent 1M platform. The difference in the CNVs detected using multiple platforms is mainly due to the differences in probe distribution and sensitivity of the detection algorithms used.
[0394] The ASD stringent CNVs (23,493 CNVs) were compared to the stringent CNVs from 1,000 PDx controls (49,524 CNVs) typed on the same platform as cases. Stringent CNVs were classified as rare in three steps:
[0395] 1. A CNV was considered to be rare if it was found at a frequency <0.5% of the total sample set including 676 ASD cases and 1,000 PDx controls;
[0396] 2. An additional 4,139 extant controls (SKS) were utilized to filter out common CNVs at 0.1% frequency. The additional controls consisted of 1,782 subjects from the Study on Addiction: Genetics and Environment (SAGE), 1,234 unrelated controls from an Ottawa Heart Institute (OHI) study, 1,123 European controls from a PopGen study. The SAGE controls were genotyped with Illumina Human 1M-single BeadChip arrays and OHI and PopGen controls were genotyped with Affymetrix Genome-Wide Human SNP 6.0 arrays;
[0397] 3. From this list, for all CNVs such that the length overlaps 50% of the length of other common CNV regions including 5238 CNV regions that were genotyped previously (Conrad et al. 2010) and 1320 Copy Number Polymorphisms previously characterized (McCarroll et al. 2008), the classification made was that of a common CNV.
[0398] A total of 1,884 rare CNVs were thus identified. These were then overlapped with CNVs detected using SNP microarrays for the same samples. For CNVs not detected by the other microarrays (or if the overlap percentage between the CNVs detected using the two microarrays was <50%), the classification made was a novel CNV. A total of 946 novel and rare CNVs were thus identified. After removing intergenic CNVs from this list, the final total was 620 novel and rare CNVs (overlapping an exon or an intron of a gene).
[0399] From the list of 620 rare and novel CNVs affecting an intragenic region (exon or intron), a smaller list was generated, for which each genic region was present as a variant in 2 or more ASD cases. A small number of genes of particular interest, based on biological considerations, were added to the list. These genes were: YWHAE, CIB2 and GPHN.
Example 3CD ROM Data
[0400] For each CNV listed in Table 1 and Table 5, the relevant intron(s)/exon(s) sequence for the CNV was obtained from the consensus HG18 sequence. The sequences in the text files on the CD ROM Appendix submitted herein are for complete introns/exons, rather than the specific component relevant to the CNV.
[0401] The sequence file 33655-708.202_PDx_SK_ST25.txt contains genomic sequence information for (in the following order): [0402] A. All distinct CNVs listed in Table 1 (Example 1, method 1); [0403] B. The full genomic extent of the transcripts listed in Table 4 (Example 1, method 1); [0404] C. All distinct CNVs listed in Table 5 (Example 2, method 2); [0405] D. The full genomic extent of the transcripts listed in Table 7 (Example 2, method 2);
[0406] For example, row 1 of Table 1 contains information related to a CNV whose coordinates are chr 17:77787243-77847938 and was discovered as a 60,695 bp loss in patient 1891. The sequence for this CNV is found in 33655-708.202_PDx_SK_ST25.txt and is referred to as SEQ ID 1 (sequence truncated for brevity):
TABLE-US-00008 Sequenceentrystarts: <210>1 <211>60696 <212>DNA <213>Homosapiens <400>1 gtgctcttcggctgtttcgtcatcactggcttctcctacgccttccccaaggccgtcagt 60 gtcttcttcaaggagctcatacaggagtttgggatcggctacagcgacacagcctggatc 120 .. gctccctgcactgctggtttcagtcatgttgcaaggagagtattagcaactcagtagtga 60660 tgaggtttagtggacattttatttaacgttctgtca 60696 Sequenceentryends.
[0407] For an example of a transcript sequence, consider row 1 of Table 4, which relates to the gene CSNK1D, transcript NM 001893. This transcript sequence is referred to as SEQ ID 644 and appears as such in 33655-708.202_PDx_SK_ST25.txt (sequence truncated for brevity):
TABLE-US-00009 Sequenceentrystarts: <210>644 <211>31059 <212>DNA <213>Homosapiens <400>644 agggaagaaaggtagaagtcattatgaatttattatttacacgattgttaaagtacacaa 60 atacagtggcgatacaaacgcacagctcggagactggccgtcagtgcacagctgacacga 120 .. ctccccgccgcggatggactcggatcttccgggcctaaatcccctttcagctgcctaaag 31020 gagccgccgccatcgcgctgtgacgtcacttcccctagc 31059 Sequenceentryends.
The same system applies to Tables 5 and 7.
[0408] The sequence information contained in the CD ROM Appendix can be used to identify a genetic variant associated with a Pervasive Developmental Disorder (PDD). This identification can be done by PCR, FISH, sequencing, array hybridization, or similar genetic analytical techniques. The sequence information contained in the CD ROM Appendix can also be used to design PCR, FISH, sequencing or array reagents for the identification of a genetic variant associated with a Pervasive Developmental Disorder (PDD).