GENETICALLY MANIPULATED CORNEA FOR TRANSPLANTATION
20200197569 · 2020-06-25
Inventors
Cpc classification
A61L27/3683
HUMAN NECESSITIES
A61L2430/16
HUMAN NECESSITIES
A61L27/3604
HUMAN NECESSITIES
C12N2500/90
CHEMISTRY; METALLURGY
A61L27/3641
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
A61L27/3687
HUMAN NECESSITIES
A61L2300/258
HUMAN NECESSITIES
International classification
A61L27/36
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A cornea, which is ex vivo genetically manipulated in order not to elicit an immune response in an allogeneic recipient. The cornea is isolated, for use in transplantation and a method for production of a cornea, which is performed on an initial ex vivo, e.g. isolated cornea, for use in transplantation, e.g. for use in the treatment of cornea defects.
Claims
1. A cornea, ex vivo, for use in transplantation to a recipient that is immunologically non-compatible to an initial live isolated cornea, wherein the initial live cornea is genetically manipulated to contain an expression cassette expressing at least one inhibitory RNA specific for the alpha-chain and/or for the beta-chain of the MHC II gene and/or an expression cassette expressing an inhibitory RNA specific for the class II transactivator gene (CIITA).
2. The cornea for use in transplantation according to claim 1, wherein the cornea is genetically manipulated to additionally contain an expression cassette expressing an inhibitory RNA specific for the 2-microglobulin mRNA.
3. The cornea for use in transplantation according to claim 1, wherein the inhibitory RNA specific for the alpha-chain and/or for the beta-chain of the MHC II gene is specific for at least one of, preferably of all of the alpha-chain and/or beta-chain of HLA-DR, DQ and DP molecules.
4. The cornea for use in transplantation according to claim 1, wherein the initial cornea is of non-human origin or of human origin.
5. The cornea for use in transplantation in the treatment of a defective cornea according to claim 1.
6. A cornea, ex vivo, for use in transplantation to a recipient who is immunologically non-compatible to an initial live isolated cornea, wherein the initial live cornea in vitro is genetically manipulated to contain an expression cassette expressing at least one inhibitory RNA having a sequence of at least 80%, at least 85%, at least 90%, preferably at least 95% sequence identity to SEQ ID NO: 10 or to SEQ ID NO: 11, or a combination of these, for simultaneously targeting and inhibiting expression of HLA-DRA, HLA-DPA1 and HLA-DQA.
7. The cornea of claim 6, which is genetically manipulated to contain at least one expression cassette expressing an inhibitory RNA having a sequence of SEQ ID NO: 10 and at least one expression cassette expressing an inhibitory RNA having a sequence of SEQ ID NO: 11
8. A method for producing a cornea by genetically manipulating an initial isolated live cornea to contain an expression cassette expressing an inhibitory RNA specific for the alpha-chain and/or beta-chain of MHC II gene and/or an expression cassette expressing an inhibitory RNA specific for the class II transactivator gene (CIITA).
9. The method according to claim 8, wherein the inhibitory RNA specific for the alpha-chain and/or for the beta-chain of the MHC II gene is specific for at least one of, preferably of all of the alpha-chain and/or beta-chain of HLA-DR, DQ and DP molecules.
10. The method according to claim 8, wherein the cornea is genetically manipulated to additionally contain an expression cassette expressing an inhibitory RNA specific for the 2-microglobulin mRNA.
11. The method according to claim 8, wherein the initial cornea is maintained in serum-free organ culture medium, at least one nucleic acid construct containing the expression cassettes packaged in viral particles is added to the medium, the cornea is kept in the medium for an incubation period, and the medium is replaced by fresh serum-free medium for an incubation period sufficient for transcription of the expression cassettes.
12. The method according to claim 11, wherein the at least one nucleic acid construct which is added to the medium is a lentiviral vector which is packaged in lentiviral particles.
13. The method according to claim 8, wherein the genetically manipulated cornea produced is transplanted as a replacement cornea to the eye of a recipient.
14. A method for in vitro producing a cornea that is immunologically compatible to a recipient of the cornea as a transplant from a live cornea that in respect of the recipient is initially immunologically incompatible by genetically manipulating the initial isolated live cornea to contain an expression cassette expressing at least one inhibitory RNA having a sequence of at least 80%, at least 85%, at least 90%, preferably at least 95% sequence identity of SEQ ID NO: 10 or of SEQ ID NO: 11, or a combination of these, for simultaneously targeting and inhibiting expression of HLA-DRA, HLA-DPA1 and HLA-DQA.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0006]
[0007]
[0008]
[0009]
DESCRIPTION OF THE INVENTION
[0010] The invention provides a cornea, which is ex vivo, e.g. isolated, for use in transplantation and a method for production of a cornea, which is performed on an initial ex vivo, e.g. isolated cornea, for use as a transplant, respectively for use in transplantation according to the claims. Accordingly, the cornea can be for use in the treatment of cornea defects. The cornea is genetically manipulated in order to only elicit a reduced immune response in an allogeneic recipient, preferably in order to not elicit an immune response in an allogeneic recipient. Specifically, the initial cornea is alive, e.g. an explanted cornea from an allogeneic donor, and kept under cell culture conditions, preferably in a serum-free cell-culture medium. This initial cornea is immunologically not compatible with the later recipient, e.g. the initial cornea is MHC-mismatched with the MHC of the later recipient. The initial cornea is isolated, e.g. maintained in organ culture medium. Optionally, the initial cornea is of non-human origin.
[0011] The cornea is genetically manipulated to contain a nucleic acid construct containing an expression cassette encoding inhibitory RNA sequences, e.g. siRNA, preferably short-hairpin RNA (shRNA), for use in human initial corneas is specific for the transcript of at least one of, preferably of all of the alpha or beta-chain of HLA-DR, DQ and DP molecules, respectively for murine initial corneas encoding inhibitory RNA sequences specific for the transcript of the alpha-chain of the H2E gene, and/or in each case encoding an inhibitory RNA (shRNA) specific for the transcript of the class II transactivator gene (CIITA), preferably further in combination with an expression cassette encoding an inhibitory RNA e.g. siRNA, preferably short-hairpin RNA (shRNA), specific for the transcript of the 2-microglobulin (2m) gene. The cornea obtained by the process is for use as a transplant, e.g. as a replacement for a damaged cornea, in an immunologically non-compatible recipient, especially for use in a recipient whose MHC is not compatible to the MHC of the cornea initially used in the method for production.
[0012] The expression cassettes contain a promoter controlling the transcription of the encoded gene, preferably a constitutive promoter, e.g. the H1 promoter (SEQ ID NO: 5) or the U6 promoter (SEQ ID NO: 13) or the elongation factor short (EFS) promoter (SEQ ID NO: 6) or the EF1alpha promoter (SEQ ID NO: 7).
[0013] For introduction of the nucleic acid construct into the cornea, the nucleic acid construct can be contained in a viral vector, e.g. in a lentiviral vector, preferably packaged in lentiviral particles.
[0014] An ex vivo cornea containing an expression cassette encoding siRNA specific for the transcript of the alpha-chain or of the beta-chain of HLA class II genes, e.g. specific for the transcript of at least one of HLA-DR, DQ and DP molecules, preferably of all of the alpha-chain of HLA-DR, DQ and DP molecules and/or at least one of, preferably all of, the beta-chain of HLA-DR, DQ and DP molecules, and/or an expression cassette encoding siRNA specific for the transcript of the class II transactivator gene (CIITA), preferably also an expression cassette encoding siRNA specific for the transcript of 2m has been found to effect significantly less immunologic responses after transplantation, e.g. essentially no significant immunologic response after transplantation, even e.g. in recipients having neovascularizations in the eye, previous or present inflammation in the eye and/or previous contact with allogenic tissue, e.g. patients who have developed an immune response against allogenic HLA molecules, e.g. patients who had previously received an allogeneic transplant. Generally, the genetically manipulated cornea which is produced by the method of the invention can be transplanted as a cornea replacement into the eye of a patient.
[0015] The introduction of an expression cassette encoding siRNA specific for the transcript of the human alpha-chain or of the beta-chain of HLA class II gene for an initial human cornea, respectively encoding siRNA specific for the transcript of the murine alpha-chain of the H2E gene for an initial murine cornea, and/or, in each case, introduction of an expression cassette encoding siRNA specific for the transcript of the class II transactivator gene (CIITA) has been found to result in the reduction, respectively suppression of the translation of MHC II in the cornea, and introduction of an expression cassette encoding shRNA specific for the transcript of 2m has been found to result in the reduction, respectively suppression of the translation of MHC I in the cornea.
[0016] It was found that transplantation of a cornea expressing siRNA specific for the transcript of the alpha-chain of the H2E gene and/or expressing siRNA specific for the transcript of the class II transactivator gene (CIITA), preferably also expressing shRNA specific for the transcript of 2m, does not induce an immunogenic reaction by the recipient, e.g. no de novo formation of alloantibodies, and does not result in graft rejection in vivo. Preferably, the genetically manipulated cornea of the invention after transplantation does not elicit an immune response in the recipient.
[0017] An shRNA specific for the mouse 2m gene transcript (MM_sh2m) can comprise or consist of SEQ ID NO: 1, corresponding to the nucleotide sequence of 51 nt (nucleotides) starting at nucleotide No. 209 of X01838 (European Nucleotide Archive), an shRNA specific for the mouse alpha-chain of the H2E gene transcript can comprise of consist of SEQ ID NO: 2, corresponding to the nucleotide sequence of 51 nt starting at nucleotide No. 324 of U13648.1 (European Nucleotide Archive).
[0018] An shRNA specific for the human 2m gene transcript (HS_sh2m) can comprise or consist of SEQ ID NO: 3, corresponding to the nucleotide sequence of 47 nt (nucleotides) starting at nucleotide No. 244 of NM_004048.2 (NCBI databank), an shRNA specific for the human class II transactivator gene transcript (HS-shCIITA) can comprise of consist of SEQ ID NO: 4, corresponding to the nucleotide sequence of 51 nt starting at nucleotide No. 400 of NM_000246 at (NCBI databank).
[0019] The shRNA loop contained is TTCAAGAGA.
[0020] A preferred promoter for driving the transcription of the shRNA encoding sequences is the H1 promoter, e.g. comprising or consisting of SEQ ID NO: 5.
[0021] The elongation factor short (EFS) promoter preferably comprises or consists of SEQ ID NO: 6, the EF1-alpha promoter preferably comprises or consists of SEQ ID NO: 7.
[0022] An exemplary lentiviral vector backbone has SEQ ID NO: 8, which contains a shRNA cloning site at nt 5312, and 5629.
[0023] For simultaneously targeting and inhibiting HLA-DRA, HLA-DPA1 and HLA-DQA, shRNA of SEQ ID NO: 10 or of SEQ ID NO: 11 or a combination of these can be used, or a sequence having at least 80%, at least 85%, at least 90%, preferably at least 95% sequence identity.
[0024] For inhibiting CIITA, shRNA of SEQ ID NO: 12 (start nt 400, aa 90) can be used.
[0025] In the process for producing the genetically manipulated cornea, an explanted live cornea is washed, e.g. in serum-free organ culture medium. A preferred organ culture medium is Human Endothelial SFM (Gibco) or Culture Medium II (Biochrom) supplemented with 10 ng/ml FGF-2. The cornea is kept in serum-free organ culture medium and transfected with the nucleic acid construct containing the expression cassettes encoding siRNA specific for the transcript of the alpha-chain of the H2E gene and/or expressing siRNA specific for the transcript of the class II transactivator gene (CIITA), preferably also expressing siRNA specific for the transcript of 2m. Preferably, the nucleic acid construct is contained in a viral vector, e.g. in a lentiviral vector, packaged into lentiviral particles, and introduced into the medium. Following an incubation period, e.g. for 2h at 37 C. under cell culture conditions, the cornea is washed, e.g. in organ culture medium, and optionally incubated in fresh organ culture medium, e.g. for 48h at 37 C. Following this incubation, the cornea can be transplanted into a recipient.
Example: Genetically Manipulating Mouse Cornea In Vitro for Use as a Transplant
[0026] Corneas from C3H/HeJ (MHC haplotype H-2.sup.k) or from Balb/cJ (control, MHC matched) mice were explanted and transduced with lentiviral particles containing nucleic acid constructs encoding an expression cassette for shRNA specific for silencing mRNA for 2-microglobulin of SEQ ID NO: 1, and/or encoding an expression cassette for shRNA of SEQ ID NO: 9 (shRNA specific for the murine_shCIITA, NM_001302618.1 (start 992, aa304), GCTGACCTCCCGTGTAAATGA TTCAAGAGA TCATTTACACGGGAGGTCAGC) specific for silencing murine CIITA transcripts, and/or encoding shRNA of SEQ ID NO: 2 specific for silencing the murine alpha-chain of H2E. The expression cassettes were contained in a lentiviral vector according to SEQ ID NO: 8, which was packaged in lentiviral particles. For transduction, the corneas were incubated in organ culture medium (culture medium II, Biochrom) containing 8 g/mL protamine sulfate for 2h at 37 C. Afterwards, the medium containing the viral was replaced with fresh organ culture medium and the corneas were incubated for 48h at 37 C. to produce the genetically manipulated corneas. Then, the genetically manipulated corneas (MHC haplotype H-2.sup.d) were transplanted into new C3H/HeJ (MHC haplotype H-2.sup.k) mice which were completely mismatched for MHC.
[0027] The organ culture medium could be replaced by cell culture medium.
[0028] From the corneas that were genetically manipulated in vitro, resp. ex vivo, a section was taken and analysed by quantitative RT-PCR for transcripts of 2-microglobulin, of the alpha-chain of H2E, and of the CIITA. The results of the analyses for corneas that were transduced with a lentiviral nucleic acid construct containing an expression cassette for one of shRNA specific for silencing 2-microglobulin (sh2m), shRNA specific for silencing the alpha-chain of H2E (shH2Ea) or shRNA specific for silencing CIITA (shCIITA) are depicted in
[0029]
[0030] 9 weeks after transplantation, mice were killed and the antibody levels in the sera as well as the tissue of the transplanted corneas were analysed. The results, which are depicted in
[0031] Analysis for T-cell infiltration showed that significantly (p<0.05) lower rates of T-cells were observed in MHC-mismatched corneas expressing one of shRNA specific for silencing 2-microglobulin, shRNA specific for silencing CIITA or shRNA specific for silencing the alpha-chain of H2E.
[0032] The results are shown in
[0033]