COMPOUNDS AND METHODS FOR REDUCING MSH3 EXPRESSION

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of MSH3 RNA in a cell or subject, and in certain instances reducing the amount of MSH3 protein in a cell or subject. These compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a repeat expansion disease. Such symptoms and hallmarks include brain atrophy, muscle atrophy, nerve degeneration, uncontrolled movement, seizure, tremors, muscle weakness, muscle cramping, difficulty swallowing, difficulty speaking, decreased memory, decreased cognition, anxiety, and depression. Non-limiting examples of repeat expansion diseases that benefit from these compounds, methods, and pharmaceutical compositions are myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, various polyglutamine disorders, Friedrich's ataxia, Fragile X syndrome, or spinocerebellar ataxia (e.g., SCA1, SCA2, SCA3, SCA6, SCAT, SCA8, SCA10, or SCA17).

Claims

1. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence that is at least 90% complementary to an equal length portion of a MSH3 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-4198.

3. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-2196.

4. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 88, 91, 92, 97, 98, 100, 101, 103, 105, 107, 109, 111, 114, 116, 119, 120, 121, 124, 168, 169, 170, 172, 179, 180, 184, 188, 191, 195, 196, 197, 201, 242, 245, 246, 249, 250, 252, 253, 254, 255, 257, 261, 262, 268, 269, 270, 272, 273, 274, 319, 321, 322, 324, 325, 326, 327, 328, 329, 333, 334, 336, 338, 345, 349, 350, 354, 362, 365, 384, 387, 392, 405, 406, 408, 421, 425, 432, 434, 435, 441, 444, 451, 461, 462, 463, 468, 469, 472, 484, 487, 488, 493, 494, 500, 503, 507, 508, 511, 515, 517, 518, 531, 533, 534, 543, 556, 557, 558, 559, 563, 569, 578, 587, 596, 600, 604, 609, 612, 614, 615, 616, 628, 631, 633, 638, 642, 645, 648, 651, 652, 658, 659, 667, 671, 678, 679, 680, 683, 689, 690, 697, 699, 700, 708, 712, 715, 717, 723, 724, 730, 735, 739, 740, 744, 746, 749, 750, 753, 755, 758, 763, 764, 769, 770, 771, 772, 773, 776, 781, 789, 792, 794, 795, 798, 805, 808, 809, 813, 816, 817, 818, 825, 833, 835, 836, 837, 844, 845, 848, 849, 850, 852, 853, 859, 865, 887, 895, 896, 901, 906, 909, 912, 914, 927, 930, 940, 943, 946, 952, 959, 961, 962, 963, 969, 971, 980, 981, 994, 1000, 1001, 1005, 1008, 1014, 1015, 1017, 1024, 1033, 1038, 1044, 1050, 1051, 1056, 1061, 1066, 1068, 1070, 1072, 1080, 1083, 1085, 1091, 1092, 1094, 1096, 1097, 1104, 1115, 1119, 1125, 1128, 1130, 1133, 1140, 1147, 1150, 1153, 1156, 1161, 1169, 1170, 1174, 1178, 1179, 1180, 1184, 1186, 1199, 1201, 1206, 1208, 1213, 1217, 1222, 1226, 1229, 1231, 1240, 1245, 1248, 1250, 1255, 1258, 1261, 1262, 1264, 1271, 1273, 1283, 1287, 1289, 1295, 1296, 1299, 1309, 1311, 1313, 1314, 1316, 1322, 1324, 1325, 1326, 1331, 1332, 1333, 1342, 1346, 1348, 1353, 1355, 1357, 1359, 1376, 1377, 1378, 1379, 1390, 1393, 1397, 1399, 1401, 1405, 1409, 1413, 1417, 1420, 1421, 1422, 1436, 1437, 1451, 1453, 1459, 1462, 1468, 1476, 1479, 1483, 1488, 1490, 1492, 1494, 1508, 1512, 1520, 1521, 1524, 1529, 1532, 1535, 1538, 1545, 1547, 1548, 1549, 1554, 1557, 1558, 1567, 1585, 1595, 1596, 1605, 1606, 1620, 1622, 1623, 1626, 1628, 1630, 1636, 1637, 1641, 1653, 1656, 1657, 1658, 1664, 1671, 1672, 1675, 1676, 1678, 1679, 1680, 1691, 1694, 1695, 1696, 1697, 1700, 1702, 1705, 1706, 1712, 1716, 1718, 1719, 1722, 1724, 1732, 1735, 1737, 1751, 1757, 1759, 1765, 1773, 1774, 1779, 1786, 1796, 1800, 1805, 1806, 1807, 1811, 1813, 1816, 1818, 1821, 1824, 1826, 1827, 1832, 1836, 1840, 1842, 1846, 1852, 1854, 1857, 1862, 1864, 1874, 1878, 1886, 1888, 1890, 1892, 1893, 1902, 1903, 1911, 1915, 1924, 1926, 1930, 1933, 1939, 1941, 1951, 1953, 1955, 1959, 1962, 1973, 1974, 1976, 1977, 1982, 1987, 1989, 1990, 1994, 2001, 2003, 2007, 2011, 2013, 2015, 2019, 2038, 2039, 2043, 2065, 2067, 2073, 2099, 2100, 2103, 2105, 2112, 2117, 2123, 2125, 2129, 2130, 2146, 2159, 2161, 2164, 2171, 2173, 2177, 2183, 2185, 2187, and 2195.

5. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-355.

6. The oligomeric compound of claim 5, wherein the nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 51, 53, 54, 56, 59, 63, 65, 88, 91, 92, 97, 98, 101, 107, 129, 130, 131, 132, 134, 142, 168, 169, 172, 180, 203, 205, 206, 208, 209, 210, 212, 217, 242, 245, 246, 250, 252, 257, 261, 269, 283, 284, 285, 286, 287, 292, 293, 294, 295, 304, 310, 319, 321, 322, and 324.

7. The oligomeric compound of claim 3, wherein the nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 53, 59, 212, 283, 56, 134, 168, 206, 246, 91, 132, 319, 324, 98, 250, 287, 293, 321, 54, 63, 131, 205, 208, 252, 285, 286, 322, 209, 129, 130, 242, 97, 261, 269, 284, 304, 310, 65, 88, 101, 172, 180, 210, 217, 292, 294, 92, 169, 245, 257, 295, 107, 203, 255, 327, 328, 329, 48, 66, 111, 142, 51, 299, 336, 127, 272, 280, 345, 350, 51, 80, 143, 215, 218, 226, 240, 249, 268, 279, 288, 296, 325, 50, 197, 253, 297, 133, 157, 191, 270, 109, 51, 162, 188, 70, 124, 254, 69, 120, 220, 233, 273, 334, 49, 67, 76, 84, 140, 170, 103, 114, 289, 306, 55, 116, 141, 184, 262, 274, 51, 75, 156, 201, 235, 239, 81, 86, 195, 196, 234, 317, 349, 19, 105, 119, 147, 211, 227, 28, 100, 238, 241, 128, 303, 315, 326, 312, 338, 42, 121, 179, 333, 354, 160, 216, 300, 79, 224, 277, 115, 185, 256, 15, 57, 161, 163, 173, 243, 164, 193, 222, 82, 183, 186, 187, 189, 68, 146, 221, 43, 85, 104, 199, 278, 313, 175, 176, 223, 259, 32, 37, 166, 352, 276, 83, 36, 74, 200, 204, 346, 93, 136, 152, 123, 159, 265, 26, 149, 165, 167, 178, 244, 20, 58, 96, 102, 151, 231, 331, 347, 41, 44, 314, 318, 339, 27, 192, 266, 298, 23, 33, 45, 181, 232, 311, 355, 22, 25, 139, 236, 89, 108, 282, 35, 260, 30, 39, 117, 144, 148, 158, 267, 305, 342, 154, 335, 52, 258, 264, 275, 302, 309, 21, 237, 340, 12, 110, 112, and 337.

8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 4438-4475 of SEQ ID NO: 2; an equal length portion of nucleobases 13141-13213 of SEQ ID NO: 2; an equal length portion of nucleobases 18114-18146 of SEQ ID NO: 2; an equal length portion of nucleobases 18178-18202 of SEQ ID NO: 2; an equal length portion of nucleobases 18245-18290 of SEQ ID NO: 2; an equal length portion of nucleobases 20249-20330 of SEQ ID NO: 2; an equal length portion of nucleobases 23001-23061 of SEQ ID NO: 2; an equal length portion of nucleobases 35859-35907 of SEQ ID NO: 2; an equal length portion of nucleobases 36200-36315 of SEQ ID NO: 2; an equal length portion of nucleobases 37000-37041 of SEQ ID NO: 2; an equal length portion of nucleobases 73448-73497 of SEQ ID NO: 2; an equal length portion of nucleobases 76851-76900 of SEQ ID NO: 2; an equal length portion of nucleobases 89462-89531 of SEQ ID NO: 2; an equal length portion of nucleobases 92554-92591 of SEQ ID NO: 2; an equal length portion of nucleobases 109563-109628 of SEQ ID NO: 2; an equal length portion of nucleobases 116894-116937 of SEQ ID NO: 2 an equal length portion of nucleobases 116894-116951 of SEQ ID NO: 2; an equal length portion of nucleobases 118292-118317 of SEQ ID NO: 2; an equal length portion of nucleobases 122127-122161 of SEQ ID NO: 2; an equal length portion of nucleobases 180800-180823 of SEQ ID NO: 2; or an equal length portion of nucleobases 224684-224713 of SEQ ID NO: 2.

9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 18178-18202 of SEQ ID NO: 2; an equal length portion of nucleobases 18245-18290 of SEQ ID NO: 2; an equal length portion of nucleobases 73448-73497 of SEQ ID NO: 2; an equal length portion of nucleobases 92554-92591 of SEQ ID NO: 2; an equal length portion of nucleobases 109563-109628 of SEQ ID NO: 2; an equal length portion of nucleobases 116894-116937 of SEQ ID NO: 2; an equal length portion of nucleobases 118292-118316 of SEQ ID NO: 2; an equal length portion of nucleobases 122127-122161 of SEQ ID NO: 2; an equal length portion of nucleobases 180800-180823 of SEQ ID NO: 2; or an equal length portion of nucleobases 224684-224713 of SEQ ID NO: 2.

10. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of a sequence selected from: SEQ ID NOs: 19, 203, 422, 478, 583, 603, 706, 1992, 2074, and 2143; SEQ ID NOs: 28, 280, 369, 487, 553, 1102, 1168, 1244, 1300, 1416, 1444, 1522, 1645, 1688, 1753, 1887, 1961, 2018, 2120, 3399, and 3430; SEQ ID NOs: 129, 206, 450, 577, 611, 688, 801, 820, 900, and 3124; SEQ ID NOs: 53, 283, 381, 433, 1906, 2033, 2115, and 2156; SEQ ID NOs: 1159, 1272, 1290, 1374, 1472, 1550, and 1610; SEQ ID NOs: 37, 54, 55, 56, 131, 132, 133, 208, 209, 210, 284, 285, 286, 287, 1176, 1266, 1301, 1385, 1457, 1533, 1594, 1715, 1799, and 2216; SEQ ID NOs: 59, 212, 289, 361, 1145, 1242, 1284, 1423, 1495, 1513, 1638, 1731, 1740, 1823, 1935, 1999, 2054, 2148, 2748, 2817, 2920, and 3015; SEQ ID NOs: 1008, 1096, 2857, 2901, 2983, 3044, 3131, 3255, and 3292; SEQ ID NOs: 1953, 2015, 2067, 2171, 2230, 2815, 2948, 3006, 3092, 3129, 3245, 3307, 3353, 3464, 3551, 3655, 3726, 3803, 3819, 3899, 4004, 4118, and 4181; SEQ ID NOs: 1331, 1405, 3346, 3357, 3488, 3547, and 3634; SEQ ID NOs: 62, 139, 215, 216, 292, 356, 506, 560, 650, 673, 774, 831, 918, 1040, 1105, 1197, 1256, 1282, 1428, 1469, 1570, 1657, 2141, and 3979; SEQ ID NOs: 63, 1076, 1148, 1260, 1312, 1386, 1440, 1541, 1634, 1674, 1797, 1834, and 1898; SEQ ID NOs: 217, 294, 429, 481, 562, 636, 738, 761, 878, 940, 2059, 2167, 2487, and 2507; SEQ ID NOs: 65, 218, 295, 526, 619, 694, 766, 862, 945, 978, 1084, 1172, 1276, 1321, and 1395; SEQ ID NOs: 66, 296, 377, 627, 701, 760, 815, 919, 1028, 1095, 1151, 1243, 1323, 1354, 1496, 1575, 1646, 1666, 1789, 1828, 1907, 1969, 2093, 2192, and 2611; SEQ ID NOs: 69, 222, 299, 412, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135; SEQ ID NOs: 69, 222, 299, 412, 1361, 1448, 1563, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135; SEQ ID NOs: 744, 837, 943, 971, 1068, and 2690; SEQ ID NOs: 699, 764, 850, 906, 1017, 1050, 2784, and 2832; SEQ ID NOs: 119, 120, 196, 197, 273, and 350; SEQ ID NOs: 399, 449, 1704, 1812, 1838, 1957, 1986, 2069, and 2175.

11. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of a sequence selected from: SEQ ID NOs: 53, 283, 381, 433, 1906, 2033, 2115, and 2156; SEQ ID NOs: 1159, 1272, 1290, 1374, 1472, 1550, and 1610; SEQ ID NOs: 62, 139, 215, 216, 292, 356, 506, 560, 650, 673, 774, 831, 918, 1040, 1105, 1197, 1256, 1282, 1428, 1469, 1570, 1657, and 2141; SEQ ID NOs: 65, 218, 295, 526, 619, 694, 766, 862, 945, 978, 1084, 1172, 1276, 1321, and 1395; SEQ ID NOs: 66, 296, 377, 627, 701, 760, 815, 919, 1028, 1095, 1151, 1243, 1323, 1354, 1496, 1575, 1646, 1666, 1789, 1828, 1907, 1969, 2093, and 2192; SEQ ID NOs: 69, 222, 299, 412, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135; SEQ ID NOs: 744, 837, 943, 971, and 1068; SEQ ID NOs: 699, 764, 850, 906, 1017, and 1050; SEQ ID NOs: 119, 120, 196, 197, 273, and 350; or SEQ ID NOs: 399, 449, 1704, 1812, 1838, 1957, 1986, 2069, and 2175.

12. The oligomeric compound of any one of claims 1-11, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to an equal length portion of a nucleobase sequence selected from SEQ ID NOs: 1-3 when measured across the entire nucleobase sequence of the modified oligonucleotide.

13. The oligomeric compound of any one of claims 1-12, wherein at least one modified nucleoside comprises a modified sugar moiety.

14. The oligomeric compound of claim 13, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

15. The oligomeric compound of claim 14, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—.

16. The oligomeric compound of claim 13, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

17. The oligomeric compound of claim 16, wherein the non-bicyclic modified sugar moiety comprises a 2′-MOE sugar moiety or 2′-OMe sugar moiety.

18. The oligomeric compound of any one of claims 1-12, wherein at least one modified nucleoside comprises a sugar surrogate.

19. The oligomeric compound of claim 18, wherein the sugar surrogate is selected from morpholino and PNA.

20. The oligomeric compound of any of claims 1-19, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 1-5 linked 5′-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3′-region consisting of 1-5 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2′-deoxyribosyl sugar moiety.

21. The oligomeric compound of claim 20, wherein the 5′ region consists of 5 linked 5′-region nucleosides; the central region consists of 10 linked central region nucleosides; and the 3′-region consists of 5 linked 3′-region nucleosides; wherein each of the nucleosides of the 5′-region and each of the nucleosides of the 3′-region comprises a 2′-MOE sugar moiety and each of the nucleosides of the central region comprises an unmodified 2′-deoxyribosyl sugar moiety.

22. The oligomeric compound of claim 20, wherein the 5′ region consists of 3 linked 5′-region nucleosides; the central region consists of 10 linked central region nucleosides; and the 3′-region consists of 3 linked 3′-region nucleosides; wherein each of the nucleosides of the 5′-region and each of the nucleosides of the 3′-region comprises a cEt modified sugar moiety and each of the nucleosides of the central region comprises an unmodified 2′-deoxyribosyl sugar moiety.

23. The oligomeric compound of any one of claims 1-22, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

24. The oligomeric compound of claim 23, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

25. The oligomeric compound of claim 23 or 24 wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

26. The oligomeric compound of claim 23 or 25 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

27. The oligomeric compound of any of claim 23, 25, or 26, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

28. The oligomeric compound of any of claims 1-27, wherein the modified oligonucleotide comprises at least one modified nucleobase.

29. The oligomeric compound of claim 28, wherein the modified nucleobase is a 5-methyl cytosine.

30. The oligomeric compound of any of claims 1-29, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

31. The oligomeric compound of any of claims 1-30, wherein the modified oligonucleotide consists of 20 linked nucleosides.

32. The oligomeric compound of any of claims 1-31, consisting of the modified oligonucleotide.

33. The oligomeric compound of any of claims 1-32, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

34. The oligomeric compound of claim 33, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

35. The oligomeric compound of claim 33 or 34, wherein the conjugate linker consists of a single bond.

36. The oligomeric compound of claim 33, wherein the conjugate linker is cleavable.

37. The oligomeric compound of claim 36, wherein the conjugate linker comprises 1-3 linker-nucleosides.

38. The oligomeric compound of any of claims 33-37, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.

39. The oligomeric compound of any of claims 33-37, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

40. The oligomeric compound of any of claims 1-38, comprising a terminal group.

41. The oligomeric compound of any of claims 1-40, wherein the oligomeric compound is a singled-stranded oligomeric compound.

42. The oligomeric compound of any of claim 1-36 or 38-41, wherein the oligomeric compound does not comprise linker-nucleosides.

43. The oligomeric compound of any one of claims 1-42, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.

44. An oligomeric duplex comprising an oligomeric compound of any of claim 1-40 or 42-43.

45. An antisense compound comprising or consisting of an oligomeric compound of any of claims 1-43 or an oligomeric duplex of claim 44.

46. A pharmaceutical composition comprising an oligomeric compound of any of claims 1-43, an oligomeric duplex of claim 44, or an antisense compound of claim 45 and a pharmaceutically acceptable carrier or diluent.

47. The pharmaceutical composition of claim 46, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline (PBS).

48. The pharmaceutical composition of claim 47, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid or PBS.

49. A method comprising administering to a subject a pharmaceutical composition of any of claims 46-48.

50. A method of treating a repeat expansion disease comprising administering to an individual having, or at risk for developing, the repeat expansion disease a therapeutically effective amount of a pharmaceutical composition according to any of claims 46-48, thereby treating the repeat expansion disease.

51. A method of reducing MSH3 RNA or MSH3 protein in a subject having or at risk for developing a repeat expansion disease comprising administering a therapeutically effective amount of a pharmaceutical composition according to any of claims 46-48, thereby reducing MSH3 RNA or MSH3 protein in the subject.

52. A method of reducing MSH3 RNA or MSH3 protein in the central nervous system of a subject having or at risk for developing a repeat expansion disease comprising administering a therapeutically effective amount of a pharmaceutical composition according to any of claims 46-48, thereby reducing MSH3 RNA or MSH3 protein in the central nervous system.

53. The method of any one of claims 50-52, wherein the repeat expansion disease is myotonic dystrophy.

54. The method of claim 53, wherein the myotonic dystrophy is type 1 myotonic dystrophy.

55. The method of claim 53, wherein the myotonic dystrophy is type 2 myotonic dystrophy.

56. The method of any one of claims 50-52, wherein the repeat expansion disease is amyotrophic lateral sclerosis.

57. The method of any one of claims 50-52, wherein the repeat expansion disease is frontotemporal dementia.

58. The method of any one of claims 50-52, wherein the repeat expansion disease is Huntington's disease.

59. The method of any one of claims 50-52, wherein the repeat expansion disease is a polyglutamine disorder.

60. The method of any one of claims 50-52, wherein the repeat expansion disease is a spinocerebellar ataxia.

61. The method of any one of claims 50-52, wherein the repeat expansion disease is Friedreich's ataxia.

62. The method of any one of claims 50-52, wherein the repeat expansion disease is Fragile X syndrome.

63. The method of any of claims 49-62, wherein the administering is by intrathecal administration.

64. The method of any of claims 49-62, wherein at least one symptom or hallmark of the repeat expansion disease is ameliorated.

65. The method of claim 64, wherein the at least one symptom or hallmark is selected from brain atrophy, muscle atrophy, nerve degeneration, uncontrolled movement, seizure, tremors, muscle weakness, muscle cramping, difficulty swallowing, difficulty speaking, decreased memory, decreased cognition, anxiety, depression, and combinations thereof.

66. The method of any of claims 49-65, wherein the method prevents or slows disease regression.

67. A method of reducing MSH3 RNA in a cell comprising contacting the cell with an oligomeric compound according to any of claims 1-43, an oligomeric duplex according to claim 44, or an antisense compound according to claim 45; and thereby reducing MSH3 RNA in the cell.

68. A method of reducing MSH3 protein in a cell comprising contacting the cell with an oligomeric compound according to any of claims 1-43, an oligomeric duplex according to claim 44, or an antisense compound according to claim 45; and thereby reducing MSH3 protein in the cell.

69. A method of preventing or slowing an expansion of a repeat region in a cell, the method comprising contacting the cell with an oligomeric compound according to any of claims 1-43, an oligomeric duplex according to claim 44, or an antisense compound according to claim 45.

70. A method of reducing the number of repeats in a repeat region in a cell, the method comprising contacting the cell with an oligomeric compound according to any of claims 1-43, an oligomeric duplex according to claim 44, or an antisense compound according to claim 45.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0007] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0008] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0009] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

[0010] Unless otherwise indicated, the following terms have the following meanings:

[0011] As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside or nucleoside comprising an unmodified 2′-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0012] As used herein, “2′-MOE” or “2′-MOE sugar moiety” means a 2′-OCH.sub.2CH.sub.2OCH.sub.3 group in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the β-D configuration. “MOE” means O-methoxyethyl.

[0013] As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety.

[0014] As used herein, “2′-OMe” or “2′-O-methyl sugar moiety” means a 2′-OCH.sub.3 group in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-OMe has the β-D stereochemical configuration.

[0015] As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety.

[0016] As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

[0017] As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

[0018] As used herein, “administering” means providing a pharmaceutical agent to a subject.

[0019] As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0020] As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity.

[0021] As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.

[0022] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

[0023] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0024] As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell or a subject.

[0025] As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, “complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) with thymine (T), adenine (A) with uracil (U), cytosine (C) with guanine (G), and 5-methyl cytosine (mC) with guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or portion thereof, means that oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the oligonucleotide.

[0026] As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0027] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0028] As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0029] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

[0030] As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH.sub.3)—O-2′, and wherein the methyl group of the bridge is in the S configuration.

[0031] As used herein, “cEt nucleoside” means a nucleoside comprising cEt modified sugar moiety.

[0032] As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0033] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” Unless otherwise indicated, “gapmer” refers to a sugar motif. Unless otherwise indicated, the sugar moiety of each nucleoside of the gap is a 2′43-D-deoxyribosyl sugar moiety. Thus, the term “MOE gapmer” indicates a gapmer having a gap comprising 2′-β-D-deoxynucleosides and wings comprising 2′-MOE nucleosides. Unless otherwise indicated, a MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0034] As used herein, “hotspot region” means a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

[0035] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0036] As used herein, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0037] As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0038] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0039] As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.

[0040] As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

[0041] As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

[0042] As used herein, “nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

[0043] As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

[0044] As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

[0045] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

[0046] As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0047] As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in a free uptake assay in certain cell lines.

[0048] As used herein “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

[0049] As used herein, “reducing or inhibiting the amount or activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0050] As used herein, “repeat expansion disease” means a disease wherein there is an increase in a number of consecutive repeat units in a region of a gene of a subject, each repeat unit consisting of 3-10 linked nucleosides having the same nucleobase sequence as the other repeat units, and wherein the number of repeat units are increased to an extent that the subject experiences a symptom or hallmark of the repeat expansion disease.

[0051] As used herein, “repeat region” means a region of a gene comprising three or more repeat units, each repeat unit consisting of 3-10 linked nucleosides having the same nucleobase sequence as the other repeat units. Repeat regions may comprise CTG, CUG, CAG, CUG, GGGGCC, CAG, GAA, or ATTCT.

[0052] As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

[0053] As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0054] As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0055] As used herein, “standard cell assay” means the assay described in Example 1 and reasonable variations thereof.

[0056] As used herein, “stereorandom” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0057] As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human.

[0058] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

[0059] As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

[0060] As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.

[0061] As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.

[0062] As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0063] As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0064] As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom or hallmark of a disease.

Certain Embodiments

[0065] The present disclosure provides the following non-limiting numbered embodiments:

Embodiment 1. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence that is at least 90% complementary to an equal length portion of a MSH3 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
Embodiment 2. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-4198.
Embodiment 3. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-2196.
Embodiment 4. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 19, 28, 38, 42, 46, 48, 49, 50, 51, 53, 54, 55, 56, 59, 63, 65, 66, 67, 69, 70, 75, 76, 80, 81, 84, 86, 88, 91, 92, 97, 98, 100, 101, 103, 105, 107, 109, 111, 114, 116, 119, 120, 121, 124, 127, 128, 129, 130, 131, 132, 133, 134, 140, 141, 142, 143, 147, 156, 157, 162, 168, 169, 170, 172, 179, 180, 184, 188, 191, 195, 196, 197, 201, 203, 205, 206, 208, 209, 210, 211, 212, 215, 217, 218, 220, 226, 227, 233, 234, 235, 238, 239, 240, 241, 242, 245, 246, 249, 250, 252, 253, 254, 255, 257, 261, 262, 268, 269, 270, 272, 273, 274, 279, 280, 283, 284, 285, 286, 287, 288, 289, 292, 293, 294, 295, 296, 297, 299, 303, 304, 306, 310, 312, 315, 317, 319, 321, 322, 324, 325, 326, 327, 328, 329, 333, 334, 336, 338, 345, 349, 350, 354, 360, 361, 362, 365, 369, 372, 376, 377, 381, 384, 387, 392, 394, 399, 405, 406, 408, 412, 421, 422, 425, 426, 428, 429, 432, 433, 434, 435, 436, 441, 444, 449, 450, 451, 452, 460, 461, 462, 463, 465, 468, 469, 472, 473, 475, 478, 481, 482, 484, 487, 488, 493, 494, 498, 499, 500, 503, 506, 507, 508, 511, 514, 515, 517, 518, 526, 527, 531, 533, 534, 542, 543, 553, 556, 557, 558, 559, 560, 562, 563, 569, 572, 577, 578, 587, 596, 600, 604, 605, 607, 609, 611, 612, 614, 615, 616, 619, 624, 627, 628, 631, 633, 634, 636, 638, 639, 642, 645, 648, 650, 651, 652, 658, 659, 667, 670, 671, 673, 675, 678, 679, 680, 683, 686, 688, 689, 690, 694, 697, 699, 700, 701, 706, 707, 708, 712, 715, 717, 723, 724, 728, 730, 731, 735, 738, 739, 740, 744, 746, 748, 749, 750, 753, 755, 758, 760, 761, 763, 764, 766, 769, 770, 771, 772, 773, 774, 776, 777, 779, 781, 782, 787, 789, 791, 792, 794, 795, 798, 801, 805, 808, 809, 810, 813, 815, 816, 817, 818, 819, 820, 825, 833, 835, 836, 837, 842, 844, 845, 846, 848, 849, 850, 852, 853, 859, 861, 862, 863, 865, 877, 887, 895, 896, 897, 900, 901, 906, 909, 912, 914, 918, 919, 920, 923, 927, 928, 930, 931, 936, 940, 943, 946, 952, 959, 961, 962, 963, 969, 971, 972, 976, 977, 980, 981, 994, 1000, 1001, 1004, 1005, 1008, 1013, 1014, 1015, 1017, 1024, 1028, 1031, 1033, 1038, 1044, 1050, 1051, 1056, 1061, 1063, 1066, 1068, 1070, 1072, 1075, 1076, 1080, 1083, 1084, 1085, 1091, 1092, 1094, 1096, 1097, 1104, 1105, 1115, 1119, 1125, 1128, 1130, 1133, 1136, 1140, 1145, 1147, 1149, 1150, 1151, 1153, 1156, 1161, 1169, 1170, 1174, 1176, 1177, 1178, 1179, 1180, 1184, 1186, 1193, 1199, 1201, 1204, 1205, 1206, 1208, 1213, 1214, 1217, 1222, 1226, 1229, 1231, 1233, 1240, 1242, 1244, 1245, 1248, 1250, 1255, 1258, 1260, 1261, 1262, 1264, 1266, 1269, 1271, 1272, 1273, 1280, 1282, 1283, 1284, 1287, 1289, 1290, 1291, 1292, 1294, 1295, 1296, 1299, 1300, 1301, 1309, 1310, 1311, 1313, 1314, 1316, 1322, 1323, 1324, 1325, 1326, 1329, 1331, 1332, 1333, 1335, 1342, 1346, 1348, 1350, 1353, 1354, 1355, 1357, 1359, 1361, 1367, 1374, 1376, 1377, 1378, 1379, 1383, 1385, 1386, 1390, 1393, 1395, 1397, 1399, 1401, 1405, 1409, 1411, 1412, 1413, 1417, 1418, 1420, 1421, 1422, 1426, 1428, 1436, 1437, 1440, 1444, 1448, 1451, 1453, 1457, 1459, 1462, 1468, 1469, 1476, 1479, 1483, 1488, 1489, 1490, 1492, 1494, 1495, 1496, 1500, 1502, 1508, 1512, 1513, 1520, 1521, 1522, 1524, 1529, 1532, 1533, 1535, 1538, 1541, 1545, 1547, 1548, 1549, 1550, 1554, 1557, 1558, 1559, 1567, 1570, 1578, 1585, 1589, 1594, 1595, 1596, 1605, 1606, 1610, 1620, 1621, 1622, 1623, 1626, 1628, 1630, 1631, 1634, 1636, 1637, 1638, 1641, 1644, 1645, 1646, 1648, 1651, 1653, 1656, 1657, 1658, 1664, 1666, 1669, 1671, 1672, 1674, 1675, 1676, 1678, 1679, 1680, 1683, 1687, 1688, 1691, 1692, 1694, 1695, 1696, 1697, 1700, 1702, 1705, 1706, 1708, 1709, 1712, 1715, 1716, 1718, 1719, 1722, 1724, 1729, 1731, 1732, 1734, 1735, 1737, 1740, 1745, 1751, 1753, 1754, 1755, 1757, 1759, 1760, 1765, 1766, 1773, 1774, 1779, 1780, 1786, 1787, 1792, 1796, 1797, 1799, 1800, 1805, 1806, 1807, 1811, 1813, 1814, 1816, 1818, 1819, 1821, 1823, 1824, 1826, 1827, 1828, 1832, 1834, 1835, 1836, 1840, 1841, 1842, 1846, 1849, 1852, 1854, 1857, 1861, 1862, 1863, 1864, 1868, 1874, 1878, 1882, 1886, 1888, 1890, 1892, 1893, 1895, 1898, 1902, 1903, 1906, 1907, 1911, 1915, 1924, 1925, 1926, 1930, 1932, 1933, 1935, 1939, 1941, 1942, 1946, 1947, 1951, 1953, 1955, 1957, 1959, 1960, 1962, 1969, 1973, 1974, 1976, 1977, 1982, 1986, 1987, 1989, 1990, 1994, 1999, 2000, 2001, 2003, 2006, 2007, 2010, 2011, 2013, 2015, 2017, 2018, 2019, 2025, 2029, 2033, 2038, 2039, 2043, 2048, 2053, 2054, 2065, 2067, 2068, 2069, 2070, 2073, 2074, 2085, 2093, 2099, 2100, 2103, 2105, 2112, 2115, 2117, 2123, 2125, 2129, 2130, 2141, 2143, 2146, 2148, 2152, 2153, 2156, 2157, 2159, 2161, 2164, 2167, 2171, 2173, 2175, 2177, 2183, 2185, 2187, 2192, 2195, 2201, 2202, 2204, 2207, 2216, 2220, 2224, 2230, 2231, 2232, 2234, 2240, 2243, 2246, 2256, 2263, 2268, 2273, 2287, 2291, 2297, 2298, 2300, 2301, 2307, 2309, 2312, 2315, 2321, 2324, 2325, 2333, 2337, 2339, 2356, 2357, 2359, 2360, 2369, 2379, 2388, 2392, 2399, 2403, 2406, 2426, 2430, 2431, 2432, 2436, 2442, 2446, 2459, 2461, 2473, 2476, 2478, 2489, 2502, 2503, 2505, 2512, 2513, 2523, 2526, 2534, 2539, 2540, 2541, 2542, 2544, 2555, 2561, 2562, 2569, 2570, 2572, 2573, 2574, 2581, 2586, 2589, 2590, 2591, 2596, 2616, 2627, 2630, 2640, 2645, 2655, 2665, 2666, 2668, 2671, 2675, 2679, 2683, 2687, 2690, 2691, 2693, 2697, 2699, 2703, 2704, 2707, 2710, 2711, 2712, 2714, 2715, 2721, 2724, 2729, 2730, 2732, 2735, 2745, 2746, 2748, 2749, 2752, 2753, 2754, 2757, 2761, 2763, 2767, 2769, 2771, 2773, 2774, 2777, 2778, 2791, 2794, 2795, 2796, 2807, 2808, 2811, 2812, 2813, 2815, 2817, 2818, 2826, 2831, 2832, 2833, 2836, 2837, 2846, 2847, 2848, 2857, 2867, 2868, 2870, 2871, 2876, 2881, 2882, 2885, 2890, 2896, 2899, 2901, 2906, 2913, 2916, 2920, 2925, 2927, 2933, 2939, 2940, 2942, 2948, 2950, 2957, 2968, 2969, 2974, 2978, 2983, 2984, 2985, 2988, 2989, 3001, 3004, 3006, 3007, 3011, 3016, 3018, 3026, 3039, 3040, 3041, 3044, 3045, 3051, 3052, 3053, 3062, 3064, 3065, 3066, 3067, 3069, 3076, 3081, 3084, 3086, 3088, 3091, 3092, 3094, 3100, 3102, 3110, 3114, 3116, 3117, 3118, 3121, 3123, 3124, 3125, 3129, 3131, 3133, 3135, 3141, 3144, 3146, 3147, 3150, 3151, 3154, 3155, 3158, 3159, 3162, 3163, 3169, 3171, 3172, 3176, 3179, 3180, 3182, 3185, 3186, 3187, 3196, 3200, 3201, 3202, 3205, 3207, 3212, 3213, 3217, 3224, 3228, 3230, 3233, 3236, 3238, 3239, 3240, 3242, 3243, 3245, 3249, 3255, 3263, 3271, 3273, 3274, 3277, 3282, 3283, 3286, 3292, 3294, 3295, 3299, 3300, 3301, 3307, 3308, 3318, 3323, 3328, 3332, 3337, 3341, 3342, 3344, 3345, 3346, 3348, 3350, 3351, 3352, 3353, 3355, 3356, 3357, 3360, 3365, 3366, 3371, 3372, 3374, 3375, 3377, 3378, 3380, 3383, 3384, 3386, 3388, 3393, 3398, 3399, 3400, 3403, 3404, 3406, 3408, 3412, 3415, 3418, 3419, 3422, 3424, 3428, 3429, 3430, 3432, 3444, 3448, 3450, 3451, 3454, 3460, 3471, 3474, 3476, 3477, 3478, 3479, 3480, 3481, 3483, 3485, 3488, 3490, 3491, 3492, 3493, 3496, 3510, 3511, 3515, 3516, 3517, 3520, 3521, 3522, 3524, 3526, 3527, 3528, 3529, 3530, 3532, 3533, 3536, 3539, 3542, 3543, 3544, 3547, 3548, 3550, 3555, 3556, 3557, 3558, 3560, 3564, 3568, 3569, 3574, 3576, 3578, 3583, 3587, 3594, 3602, 3605, 3607, 3612, 3614, 3617, 3627, 3629, 3630, 3634, 3637, 3640, 3641, 3646, 3655, 3656, 3662, 3663, 3665, 3666, 3667, 3670, 3671, 3672, 3678, 3680, 3684, 3686, 3687, 3692, 3693, 3695, 3696, 3698, 3701, 3702, 3705, 3706, 3707, 3709, 3712, 3717, 3719, 3726, 3727, 3729, 3734, 3747, 3753, 3755, 3758, 3784, 3791, 3798, 3800, 3807, 3811, 3814, 3815, 3816, 3817, 3821, 3822, 3824, 3829, 3837, 3852, 3855, 3860, 3863, 3872, 3875, 3876, 3881, 3886, 3892, 3899, 3900, 3902, 3903, 3914, 3918, 3923, 3930, 3938, 3940, 3942, 3945, 3950, 3953, 3955, 3958, 3967, 3970, 3971, 3977, 3978, 3979, 3980, 3987, 3992, 3993, 3994, 4003, 4004, 4005, 4006, 4008, 4010, 4011, 4012, 4013, 4015, 4020, 4021, 4023, 4024, 4025, 4029, 4032, 4034, 4036, 4037, 4038, 4045, 4047, 4049, 4050, 4051, 4053, 4057, 4059, 4061, 4063, 4067, 4068, 4071, 4073, 4078, 4082, 4089, 4095, 4097, 4098, 4103, 4104, 4105, 4108, 4109, 4111, 4112, 4114, 4122, 4129, 4134, 4141, 4148, 4151, 4153, 4158, 4159, 4161, 4163, 4164, 4166, 4167, 4171, and 4181.
Embodiment 5. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 88, 91, 92, 97, 98, 100, 101, 103, 105, 107, 109, 111, 114, 116, 119, 120, 121, 124, 168, 169, 170, 172, 179, 180, 184, 188, 191, 195, 196, 197, 201, 242, 245, 246, 249, 250, 252, 253, 254, 255, 257, 261, 262, 268, 269, 270, 272, 273, 274, 319, 321, 322, 324, 325, 326, 327, 328, 329, 333, 334, 336, 338, 345, 349, 350, 354, 362, 365, 384, 387, 392, 405, 406, 408, 421, 425, 432, 434, 435, 441, 444, 451, 461, 462, 463, 468, 469, 472, 484, 487, 488, 493, 494, 500, 503, 507, 508, 511, 515, 517, 518, 531, 533, 534, 543, 556, 557, 558, 559, 563, 569, 578, 587, 596, 600, 604, 609, 612, 614, 615, 616, 628, 631, 633, 638, 642, 645, 648, 651, 652, 658, 659, 667, 671, 678, 679, 680, 683, 689, 690, 697, 699, 700, 708, 712, 715, 717, 723, 724, 730, 735, 739, 740, 744, 746, 749, 750, 753, 755, 758, 763, 764, 769, 770, 771, 772, 773, 776, 781, 789, 792, 794, 795, 798, 805, 808, 809, 813, 816, 817, 818, 825, 833, 835, 836, 837, 844, 845, 848, 849, 850, 852, 853, 859, 865, 887, 895, 896, 901, 906, 909, 912, 914, 927, 930, 940, 943, 946, 952, 959, 961, 962, 963, 969, 971, 980, 981, 994, 1000, 1001, 1005, 1008, 1014, 1015, 1017, 1024, 1033, 1038, 1044, 1050, 1051, 1056, 1061, 1066, 1068, 1070, 1072, 1080, 1083, 1085, 1091, 1092, 1094, 1096, 1097, 1104, 1115, 1119, 1125, 1128, 1130, 1133, 1140, 1147, 1150, 1153, 1156, 1161, 1169, 1170, 1174, 1178, 1179, 1180, 1184, 1186, 1199, 1201, 1206, 1208, 1213, 1217, 1222, 1226, 1229, 1231, 1240, 1245, 1248, 1250, 1255, 1258, 1261, 1262, 1264, 1271, 1273, 1283, 1287, 1289, 1295, 1296, 1299, 1309, 1311, 1313, 1314, 1316, 1322, 1324, 1325, 1326, 1331, 1332, 1333, 1342, 1346, 1348, 1353, 1355, 1357, 1359, 1376, 1377, 1378, 1379, 1390, 1393, 1397, 1399, 1401, 1405, 1409, 1413, 1417, 1420, 1421, 1422, 1436, 1437, 1451, 1453, 1459, 1462, 1468, 1476, 1479, 1483, 1488, 1490, 1492, 1494, 1508, 1512, 1520, 1521, 1524, 1529, 1532, 1535, 1538, 1545, 1547, 1548, 1549, 1554, 1557, 1558, 1567, 1585, 1595, 1596, 1605, 1606, 1620, 1622, 1623, 1626, 1628, 1630, 1636, 1637, 1641, 1653, 1656, 1657, 1658, 1664, 1671, 1672, 1675, 1676, 1678, 1679, 1680, 1691, 1694, 1695, 1696, 1697, 1700, 1702, 1705, 1706, 1712, 1716, 1718, 1719, 1722, 1724, 1732, 1735, 1737, 1751, 1757, 1759, 1765, 1773, 1774, 1779, 1786, 1796, 1800, 1805, 1806, 1807, 1811, 1813, 1816, 1818, 1821, 1824, 1826, 1827, 1832, 1836, 1840, 1842, 1846, 1852, 1854, 1857, 1862, 1864, 1874, 1878, 1886, 1888, 1890, 1892, 1893, 1902, 1903, 1911, 1915, 1924, 1926, 1930, 1933, 1939, 1941, 1951, 1953, 1955, 1959, 1962, 1973, 1974, 1976, 1977, 1982, 1987, 1989, 1990, 1994, 2001, 2003, 2007, 2011, 2013, 2015, 2019, 2038, 2039, 2043, 2065, 2067, 2073, 2099, 2100, 2103, 2105, 2112, 2117, 2123, 2125, 2129, 2130, 2146, 2159, 2161, 2164, 2171, 2173, 2177, 2183, 2185, 2187, and 2195.
Embodiment 6. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 2201, 2202, 2204, 2207, 2216, 2220, 2224, 2230, 2231, 2232, 2234, 2240, 2243, 2246, 2256, 2263, 2268, 2273, 2287, 2291, 2297, 2298, 2300, 2301, 2307, 2309, 2312, 2315, 2321, 2324, 2325, 2333, 2337, 2339, 2356, 2357, 2359, 2360, 2369, 2379, 2388, 2392, 2399, 2403, 2406, 2426, 2430, 2431, 2432, 2436, 2442, 2446, 2459, 2461, 2473, 2476, 2478, 2489, 2502, 2503, 2505, 2512, 2513, 2523, 2526, 2534, 2539, 2540, 2541, 2542, 2544, 2555, 2561, 2562, 2569, 2570, 2572, 2573, 2574, 2581, 2586, 2589, 2590, 2591, 2596, 2616, 2627, 2630, 2640, 2645, 2655, 2665, 2666, 2668, 2671, 2675, 2679, 2683, 2687, 2690, 2691, 2693, 2697, 2699, 2703, 2704, 2707, 2710, 2711, 2712, 2714, 2715, 2721, 2724, 2729, 2730, 2732, 2735, 2745, 2746, 2748, 2749, 2752, 2753, 2754, 2757, 2761, 2763, 2767, 2769, 2771, 2773, 2774, 2777, 2778, 2791, 2794, 2795, 2796, 2807, 2808, 2811, 2812, 2813, 2815, 2817, 2818, 2826, 2831, 2832, 2833, 2836, 2837, 2846, 2847, 2848, 2857, 2867, 2868, 2870, 2871, 2876, 2881, 2882, 2885, 2890, 2896, 2899, 2901, 2906, 2913, 2916, 2920, 2925, 2927, 2933, 2939, 2940, 2942, 2948, 2950, 2957, 2968, 2969, 2974, 2978, 2983, 2984, 2985, 2988, 2989, 3001, 3004, 3006, 3007, 3011, 3016, 3018, 3026, 3039, 3040, 3041, 3044, 3045, 3051, 3052, 3053, 3062, 3064, 3065, 3066, 3067, 3069, 3076, 3081, 3084, 3086, 3088, 3091, 3092, 3094, 3100, 3102, 3110, 3114, 3116, 3117, 3118, 3121, 3123, 3124, 3125, 3129, 3131, 3133, 3135, 3141, 3144, 3146, 3147, 3150, 3151, 3154, 3155, 3158, 3159, 3162, 3163, 3169, 3171, 3172, 3176, 3179, 3180, 3182, 3185, 3186, 3187, 3196, 3200, 3201, 3202, 3205, 3207, 3212, 3213, 3217, 3224, 3228, 3230, 3233, 3236, 3238, 3239, 3240, 3242, 3243, 3245, 3249, 3255, 3263, 3271, 3273, 3274, 3277, 3282, 3283, 3286, 3292, 3294, 3295, 3299, 3300, 3301, 3307, 3308, 3318, 3323, 3328, 3332, 3337, 3341, 3342, 3344, 3345, 3346, 3348, 3350, 3351, 3352, 3353, 3355, 3356, 3357, 3360, 3365, 3366, 3371, 3372, 3374, 3375, 3377, 3378, 3380, 3383, 3384, 3386, 3388, 3393, 3398, 3399, 3400, 3403, 3404, 3406, 3408, 3412, 3415, 3418, 3419, 3422, 3424, 3428, 3429, 3430, 3432, 3444, 3448, 3450, 3451, 3454, 3460, 3471, 3474, 3476, 3477, 3478, 3479, 3480, 3481, 3483, 3485, 3488, 3490, 3491, 3492, 3493, 3496, 3510, 3511, 3515, 3516, 3517, 3520, 3521, 3522, 3524, 3526, 3527, 3528, 3529, 3530, 3532, 3533, 3536, 3539, 3542, 3543, 3544, 3547, 3548, 3550, 3555, 3556, 3557, 3558, 3560, 3564, 3568, 3569, 3574, 3576, 3578, 3583, 3587, 3594, 3602, 3605, 3607, 3612, 3614, 3617, 3627, 3629, 3630, 3634, 3637, 3640, 3641, 3646, 3655, 3656, 3662, 3663, 3665, 3666, 3667, 3670, 3671, 3672, 3678, 3680, 3684, 3686, 3687, 3692, 3693, 3695, 3696, 3698, 3701, 3702, 3705, 3706, 3707, 3709, 3712, 3717, 3719, 3726, 3727, 3729, 3734, 3747, 3753, 3755, 3758, 3784, 3791, 3798, 3800, 3807, 3811, 3814, 3815, 3816, 3817, 3821, 3822, 3824, 3829, 3837, 3852, 3855, 3860, 3863, 3872, 3875, 3876, 3881, 3886, 3892, 3899, 3900, 3902, 3903, 3914, 3918, 3923, 3930, 3938, 3940, 3942, 3945, 3950, 3953, 3955, 3958, 3967, 3970, 3971, 3977, 3978, 3979, 3980, 3987, 3992, 3993, 3994, 4003, 4004, 4005, 4006, 4008, 4010, 4011, 4012, 4013, 4015, 4020, 4021, 4023, 4024, 4025, 4029, 4032, 4034, 4036, 4037, 4038, 4045, 4047, 4049, 4050, 4051, 4053, 4057, 4059, 4061, 4063, 4067, 4068, 4071, 4073, 4078, 4082, 4089, 4095, 4097, 4098, 4103, 4104, 4105, 4108, 4109, 4111, 4112, 4114, 4122, 4129, 4134, 4141, 4148, 4151, 4153, 4158, 4159, 4161, 4163, 4164, 4166, 4167, 4171, and 14181.
Embodiment 7. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and has a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 10-355.
Embodiment 8. The oligomeric compound of embodiment 7, wherein the nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 51, 53, 54, 56, 59, 63, 65, 88, 91, 92, 97, 98, 101, 107, 129, 130, 131, 132, 134, 142, 168, 169, 172, 180, 203, 205, 206, 208, 209, 210, 212, 217, 242, 245, 246, 250, 252, 257, 261, 269, 283, 284, 285, 286, 287, 292, 293, 294, 295, 304, 310, 319, 321, 322, and 324.
Embodiment 9. The oligomeric compound of embodiment 7, wherein the nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 53, 59, 212, 283, 56, 134, 168, 206, 246, 91, 132, 319, 324, 98, 250, 287, 293, 321, 54, 63, 131, 205, 208, 252, 285, 286, 322, 209, 129, 130, 242, 97, 261, 269, 284, 304, 310, 65, 88, 101, 172, 180, 210, 217, 292, 294, 92, 169, 245, 257, 295, 107, 203, 255, 327, 328, 329, 48, 66, 111, 142, 51, 299, 336, 127, 272, 280, 345, 350, 51, 80, 143, 215, 218, 226, 240, 249, 268, 279, 288, 296, 325, 50, 197, 253, 297, 133, 157, 191, 270, 109, 51, 162, 188, 70, 124, 254, 69, 120, 220, 233, 273, 334, 49, 67, 76, 84, 140, 170, 103, 114, 289, 306, 55, 116, 141, 184, 262, 274, 51, 75, 156, 201, 235, 239, 81, 86, 195, 196, 234, 317, 349, 19, 105, 119, 147, 211, 227, 28, 100, 238, 241, 128, 303, 315, 326, 312, 338, 42, 121, 179, 333, 354, 160, 216, 300, 79, 224, 277, 115, 185, 256, 15, 57, 161, 163, 173, 243, 164, 193, 222, 82, 183, 186, 187, 189, 68, 146, 221, 43, 85, 104, 199, 278, 313, 175, 176, 223, 259, 32, 37, 166, 352, 276, 83, 36, 74, 200, 204, 346, 93, 136, 152, 123, 159, 265, 26, 149, 165, 167, 178, 244, 20, 58, 96, 102, 151, 231, 331, 347, 41, 44, 314, 318, 339, 27, 192, 266, 298, 23, 33, 45, 181, 232, 311, 355, 22, 25, 139, 236, 89, 108, 282, 35, 260, 30, 39, 117, 144, 148, 158, 267, 305, 342, 154, 335, 52, 258, 264, 275, 302, 309, 21, 237, 340, 12, 110, 112, and 337.
Embodiment 10. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: [0066] an equal length portion of nucleobases 4438-4475 of SEQ ID NO: 2; [0067] an equal length portion of nucleobases 13141-13213 of SEQ ID NO: 2; [0068] an equal length portion of nucleobases 18114-18146 of SEQ ID NO: 2; [0069] an equal length portion of nucleobases 18178-18202 of SEQ ID NO: 2; [0070] an equal length portion of nucleobases 18245-18290 of SEQ ID NO: 2; [0071] an equal length portion of nucleobases 20249-20330 of SEQ ID NO: 2; [0072] an equal length portion of nucleobases 23001-23061 of SEQ ID NO: 2; [0073] an equal length portion of nucleobases 35859-35907 of SEQ ID NO: 2; [0074] an equal length portion of nucleobases 36200-36315 of SEQ ID NO: 2; [0075] an equal length portion of nucleobases 37000-37041 of SEQ ID NO: 2; [0076] an equal length portion of nucleobases 73448-73497 of SEQ ID NO: 2; [0077] an equal length portion of nucleobases 76851-76900 of SEQ ID NO: 2; [0078] an equal length portion of nucleobases 89462-89531 of SEQ ID NO: 2; [0079] an equal length portion of nucleobases 92554-92591 of SEQ ID NO: 2; [0080] an equal length portion of nucleobases 109563-109628 of SEQ ID NO: 2; [0081] an equal length portion of nucleobases 116894-116937 of SEQ ID NO: 2 an equal length portion of nucleobases 116894-116951 of SEQ ID NO: 2; [0082] an equal length portion of nucleobases 118292-118317 of SEQ ID NO: 2; [0083] an equal length portion of nucleobases 122127-122161 of SEQ ID NO: 2; [0084] an equal length portion of nucleobases 180800-180823 of SEQ ID NO: 2; or [0085] an equal length portion of nucleobases 224684-224713 of SEQ ID NO: 2.
Embodiment 11. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: [0086] an equal length portion of nucleobases 18178-18202 of SEQ ID NO: 2; [0087] an equal length portion of nucleobases 18245-18290 of SEQ ID NO: 2; [0088] an equal length portion of nucleobases 73448-73497 of SEQ ID NO: 2; [0089] an equal length portion of nucleobases 92554-92591 of SEQ ID NO: 2; [0090] an equal length portion of nucleobases 109563-109628 of SEQ ID NO: 2; [0091] an equal length portion of nucleobases 116894-116937 of SEQ ID NO: 2; [0092] an equal length portion of nucleobases 118292-118316 of SEQ ID NO: 2; [0093] an equal length portion of nucleobases 122127-122161 of SEQ ID NO: 2; [0094] an equal length portion of nucleobases 180800-180823 of SEQ ID NO: 2; or [0095] an equal length portion of nucleobases 224684-224713 of SEQ ID NO: 2.
Embodiment 12. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of a sequence selected from: [0096] SEQ ID NOs: 19, 203, 422, 478, 583, 603, 706, 1992, 2074, and 2143; [0097] SEQ ID NOs: 28, 280, 369, 487, 553, 1102, 1168, 1244, 1300, 1416, 1444, 1522, 1645, 1688, 1753, 1887, 1961, 2018, 2120, 3399, and 3430; [0098] SEQ ID NOs: 129, 206, 450, 577, 611, 688, 801, 820, 900, and 3124; [0099] SEQ ID NOs: 53, 283, 381, 433, 1906, 2033, 2115, and 2156; [0100] SEQ ID NOs: 1159, 1272, 1290, 1374, 1472, 1550, and 1610; [0101] SEQ ID NOs: 37, 54, 55, 56, 131, 132, 133, 208, 209, 210, 284, 285, 286, 287, 1176, 1266, 1301, 1385, 1457, 1533, 1594, 1715, 1799, and 2216; [0102] SEQ ID NOs: 59, 212, 289, 361, 1145, 1242, 1284, 1423, 1495, 1513, 1638, 1731, 1740, 1823, 1935, 1999, 2054, 2148, 2748, 2817, 2920, and 3015; [0103] SEQ ID NOs: 1008, 1096, 2857, 2901, 2983, 3044, 3131, 3255, and 3292; [0104] SEQ ID NOs: 1953, 2015, 2067, 2171, 2230, 2815, 2948, 3006, 3092, 3129, 3245, 3307, 3353, 3464, 3551, 3655, 3726, 3803, 3819, 3899, 4004, 4118, and 4181; [0105] SEQ ID NOs: 1331, 1405, 3346, 3357, 3488, 3547, and 3634; [0106] SEQ ID NOs: 62, 139, 215, 216, 292, 356, 506, 560, 650, 673, 774, 831, 918, 1040, 1105, 1197, 1256, 1282, 1428, 1469, 1570, 1657, 2141, and 3979; [0107] SEQ ID NOs: 63, 1076, 1148, 1260, 1312, 1386, 1440, 1541, 1634, 1674, 1797, 1834, and 1898; [0108] SEQ ID NOs: 217, 294, 429, 481, 562, 636, 738, 761, 878, 940, 2059, 2167, 2487, and 2507; [0109] SEQ ID NOs: 65, 218, 295, 526, 619, 694, 766, 862, 945, 978, 1084, 1172, 1276, 1321, and 1395; [0110] SEQ ID NOs: 66, 296, 377, 627, 701, 760, 815, 919, 1028, 1095, 1151, 1243, 1323, 1354, 1496, 1575, 1646, 1666, 1789, 1828, 1907, 1969, 2093, 2192, and 2611; [0111] SEQ ID NOs: 69, 222, 299, 412, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135; [0112] SEQ ID NOs: 69, 222, 299, 412, 1361, 1448, 1563, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135; [0113] SEQ ID NOs: 744, 837, 943, 971, 1068, and 2690; [0114] SEQ ID NOs: 699, 764, 850, 906, 1017, 1050, 2784, and 2832; [0115] SEQ ID NOs: 119, 120, 196, 197, 273, and 350; and SEQ ID NOs: 399, 449, 1704, 1812, 1838, 1957, 1986, 2069, and 2175.
Embodiment 13. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 contiguous nucleobases of a sequence selected from: [0116] SEQ ID NOs: 53, 283, 381, 433, 1906, 2033, 2115, and 2156; [0117] SEQ ID NOs: 1159, 1272, 1290, 1374, 1472, 1550, and 1610; [0118] SEQ ID NOs: 62, 139, 215, 216, 292, 356, 506, 560, 650, 673, 774, 831, 918, 1040, 1105, 1197, 1256, 1282, 1428, 1469, 1570, 1657, and 2141; [0119] SEQ ID NOs: 65, 218, 295, 526, 619, 694, 766, 862, 945, 978, 1084, 1172, 1276, 1321, and 1395; [0120] SEQ ID NOs: 66, 296, 377, 627, 701, 760, 815, 919, 1028, 1095, 1151, 1243, 1323, 1354, 1496, 1575, 1646, 1666, 1789, 1828, 1907, 1969, 2093, and 2192; [0121] SEQ ID NOs: 69, 222, 299, 412, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135; [0122] SEQ ID NOs: 744, 837, 943, 971, and 1068; [0123] SEQ ID NOs: 699, 764, 850, 906, 1017, and 1050; [0124] SEQ ID NOs: 119, 120, 196, 197, 273, and 350; and [0125] SEQ ID NOs: 399, 449, 1704, 1812, 1838, 1957, 1986, 2069, and 2175.
Embodiment 14. The oligomeric compound of any one of embodiments 1-13, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to an equal length portion of a nucleobase sequence selected from SEQ ID NOs: 1-3 when measured across the entire nucleobase sequence of the modified oligonucleotide.
Embodiment 15. The oligomeric compound of any one of embodiments 1-14, wherein at least one modified nucleoside comprises a modified sugar moiety.
Embodiment 16. The oligomeric compound of embodiment 15, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
Embodiment 17. The oligomeric compound of embodiment 16, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—.
Embodiment 18. The oligomeric compound of embodiment 15, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.
Embodiment 19. The oligomeric compound of embodiment 18, wherein the non-bicyclic modified sugar moiety comprises a 2′-MOE sugar moiety or 2′-OMe sugar moiety.
Embodiment 20. The oligomeric compound of any one of embodiments 1-14, wherein at least one modified nucleoside comprises a sugar surrogate.
Embodiment 21. The oligomeric compound of embodiment 20, wherein the sugar surrogate is selected from morpholino and PNA.
Embodiment 22. The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide has a sugar motif comprising: [0126] a 5′-region consisting of 1-5 linked 5′-region nucleosides; [0127] a central region consisting of 6-10 linked central region nucleosides; and [0128] a 3′-region consisting of 1-5 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2′-deoxyribosyl sugar moiety.
Embodiment 23. The oligomeric compound of embodiment 22, wherein the 5′ region consists of 5 linked 5′-region nucleosides; the central region consists of 10 linked central region nucleosides; and the 3′-region consists of 5 linked 3′-region nucleosides; wherein each of the nucleosides of the 5′-region and each of the nucleosides of the 3′-region comprises a 2′-MOE sugar moiety and each of the nucleosides of the central region comprises an unmodified 2′-deoxyribosyl sugar moiety.
Embodiment 24. The oligomeric compound of embodiment 22, wherein the 5′ region consists of 3 linked 5′-region nucleosides; the central region consists of 10 linked central region nucleosides; and the 3′-region consists of 3 linked 3′-region nucleosides; wherein each of the nucleosides of the 5′-region and each of the nucleosides of the 3′-region comprises a cEt modified sugar moiety and each of the nucleosides of the central region comprises an unmodified 2′-deoxyribosyl sugar moiety.
Embodiment 25. The oligomeric compound of any one of embodiments 1-24, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
Embodiment 26. The oligomeric compound of embodiment 25, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
Embodiment 27. The oligomeric compound of embodiment 25 or 26 wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
Embodiment 28. The oligomeric compound of embodiment 25 or 27 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
Embodiment 29. The oligomeric compound of any of embodiments 25, 27, or 28, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
Embodiment 30. The oligomeric compound of any of embodiments 1-29, wherein the modified oligonucleotide comprises at least one modified nucleobase.
Embodiment 31. The oligomeric compound of embodiment 30, wherein the modified nucleobase is a 5-methyl cytosine.
Embodiment 32. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.
Embodiment 33. The oligomeric compound of any of embodiments 1-32, wherein the modified oligonucleotide consists of 20 linked nucleosides.
Embodiment 34. The oligomeric compound of any of embodiments 1-32, wherein the modified oligonucleotide consists of 16 linked nucleosides.
Embodiment 35. The oligomeric compound of any of embodiments 1-34, consisting of the modified oligonucleotide.
Embodiment 36. The oligomeric compound of any of embodiments 1-35, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
Embodiment 37. The oligomeric compound of embodiment 36, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
Embodiment 38. The oligomeric compound of embodiments 36 or 37, wherein the conjugate linker consists of a single bond.
Embodiment 39. The oligomeric compound of embodiment 36, wherein the conjugate linker is cleavable.
Embodiment 40. The oligomeric compound of embodiment 36, wherein the conjugate linker comprises 1-3 linker-nucleosides.
Embodiment 41. The oligomeric compound of any of embodiments 36-40, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
Embodiment 42. The oligomeric compound of any of embodiments 36-40, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
Embodiment 43. The oligomeric compound of any of embodiments 1-41, comprising a terminal group.
Embodiment 44. The oligomeric compound of any of embodiments 1-43, wherein the oligomeric compound is a singled-stranded oligomeric compound.
Embodiment 45. The oligomeric compound of any of embodiments 1-39 or 41-44, wherein the oligomeric compound does not comprise linker-nucleosides.
Embodiment 46. The oligomeric compound of any one of embodiments 1-45, wherein the modified oligonucleotide of the oligomeric compound is a salt, and wherein the salt is a sodium salt or a potassium salt.
Embodiment 47. An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-43 or 45-46.
Embodiment 48. An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-46 or an oligomeric duplex of embodiment 47.
Embodiment 49. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-46 or an oligomeric duplex of embodiment 47 and a pharmaceutically acceptable carrier or diluent.
Embodiment 50. The pharmaceutical composition of embodiment 49, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or PBS.
Embodiment 51. The pharmaceutical composition of embodiment 50, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.
Embodiment 52. A method comprising administering to a subject a pharmaceutical composition of any of embodiments 49-51.
Embodiment 53. A method of treating a repeat expansion disease comprising administering to an individual having, or at risk for developing, the repeat expansion disease a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 49-51; thereby treating the repeat expansion disease.
Embodiment 54. A method of reducing MSH3 RNA or MSH3 protein in a subject having or at risk for developing a repeat expansion disease comprising administering a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 49-51; and thereby reducing MSH3 RNA or MSH3 protein in the subject.
Embodiment 55. A method of reducing MSH3 RNA or MSH3 protein in the central nervous system of a subject having or at risk for developing a repeat expansion disease comprising administering a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 49-51; and thereby reducing MSH3 RNA or MSH3 protein in the central nervous system.
Embodiment 56. The method of any one of embodiments 53-55, wherein the repeat expansion disease is myotonic dystrophy.
Embodiment 57. The method of embodiment 56, wherein the myotonic dystrophy is type 1 myotonic dystrophy.
Embodiment 58. The method of embodiment 56, wherein the myotonic dystrophy is type 2 myotonic dystrophy.
Embodiment 59. The method of any one of embodiments 53-55, wherein the repeat expansion disease is amyotrophic lateral sclerosis.
Embodiment 60. The method of any one of embodiments 53-55, wherein the repeat expansion disease is frontotemporal dementia.
Embodiment 61. The method of any one of embodiments 53-55, wherein the repeat expansion disease is Huntington's disease.
Embodiment 62. The method of any one of embodiments 53-55, wherein the repeat expansion disease is a polyglutamine disorder.
Embodiment 63. The method of any one of embodiments 53-55, wherein the repeat expansion disease is a spinocerebellar ataxia.
Embodiment 64. The method of any one of embodiments 53-55, wherein the repeat expansion disease is Friedreich's ataxia.
Embodiment 65. The method of any one of embodiments 53-55, wherein the repeat expansion disease is Fragile X syndrome.
Embodiment 66. The method of any of embodiments 52-65, wherein the administering is by intrathecal administration.
Embodiment 67. The method of any of embodiments 52-66, wherein at least one symptom or hallmark of the repeat expansion disease is ameliorated.
Embodiment 68. The method of embodiment 67, wherein the at least one symptom or hallmark is selected from brain atrophy, muscle atrophy, nerve degeneration, uncontrolled movement, seizure, tremors, muscle weakness, muscle cramping, difficulty swallowing, difficulty speaking, anxiety, depression, and combinations thereof.
Embodiment 69. The method of any of embodiments 52-68, wherein the method prevents or slows disease regression.
Embodiment 70. A method of reducing MSH3 RNA in a cell comprising contacting the cell with an oligomeric compound according to any of embodiments 1-46, an oligomeric duplex according to embodiment 47, or an antisense compound according to embodiment 48; and thereby reducing MSH3 RNA in the cell.
Embodiment 71. A method of reducing MSH3 protein in a cell comprising contacting the cell with an oligomeric compound according to any of embodiments 1-46, an oligomeric duplex according to embodiment 47, or an antisense compound according to embodiment 48; and thereby reducing MSH3 protein in the cell.
Embodiment 72. A method of preventing or slowing an expansion of a repeat region in a cell, the method comprising contacting the cell with an oligomeric compound according to any of embodiments 1-46, an oligomeric duplex according to embodiment 47, or an antisense compound according to embodiment 48.
Embodiment 73. A method of reducing the number of repeats in a repeat region in a cell, the method comprising contacting the cell with an oligomeric compound according to any of embodiments 1-46, an oligomeric duplex according to embodiment 47, or an antisense compound according to embodiment 48.

I. Certain Oligonucleotides

[0129] In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

[0130] A. Certain Modified Nucleosides

[0131] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

[0132] 1. Certain Sugar Moieties

[0133] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0134] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH.sub.3 (“OMe” or “O-methyl”), and 2′-O(CH.sub.2).sub.2OCH.sub.3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O—C.sub.1-C.sub.10 alkoxy, O—C.sub.1-C.sub.10 substituted alkoxy, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.10 substituted alkyl, S-alkyl, N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.).

[0135] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CH═CH.sub.2, OCH.sub.2CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0136] In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(═O)—N(H)CH.sub.3 (“NMA”).

[0137] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.

[0138] Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH.sub.2-2′, 4′-(CH.sub.2).sub.2-2′, 4′-(CH.sub.2).sub.3-2′, 4′-CH.sub.2—O-2′ (“LNA”), 4′-CH.sub.2—S-2′, 4′-(CH.sub.2).sub.2—O-2′ (“ENA”), 4′-CH(CH.sub.3)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH.sub.2—O—CH.sub.2-2′, 4′-CH.sub.2—N(R)-2′, 4′-CH(CH.sub.2OCH.sub.3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH.sub.3)(CH.sub.3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH.sub.2—N(OCH.sub.3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH.sub.2—C(═CH.sub.2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R.sub.aR.sub.b)—N(R)—O-2′, 4′-C(R.sub.aR.sub.b)—O—N(R)-2′, 4′-CH.sub.2—O—N(R)-2′, and 4′-CH.sub.2—N(R)—O- 2′, wherein each R, R.sub.a, and R.sub.b is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

[0139] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—;

[0140] wherein:

[0141] x is 0, 1, or 2;

[0142] n is 1, 2, 3, or 4;

[0143] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and

[0144] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.

[0145] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Wengel et al., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. Pat. No. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

[0146] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

##STR00001##

α-L-methyleneoxy (4′-CH.sub.2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0147] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

[0148] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

[0149] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

##STR00002##

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

##STR00003##

wherein, independently, for each of said modified THP nucleoside:

[0150] Bx is a nucleobase moiety;

[0151] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group;

q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and

[0152] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0153] In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0154] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

##STR00004##

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

[0155] In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

[0156] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0157] 2. Certain Modified Nucleobases

[0158] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

[0159] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH.sub.3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0160] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

[0161] 3. Certain Modified Internucleoside Linkages

[0162] In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH.sub.2—O—); and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). In certain embodiments, a modified internucleoside linkage is any of those described in WO 2021/030778. Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0163] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

##STR00005##

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0164] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH.sub.2—N(CH.sub.3)—O-5′), amide-3 (3′-CH.sub.2—C(═O)—N(H)-5′), amide-4 (3′-CH.sub.2—N(H)—C(═O)-5′), formacetal (3′-O—CH.sub.2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH.sub.2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

[0165] B. Certain Motifs

[0166] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

[0167] 1. Certain Sugar Motifs

[0168] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

[0169] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

[0170] In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides.

[0171] In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxynucleoside. In certain embodiments, at least one nucleoside of the gap of a gapmer is a modified nucleoside.

[0172] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxynucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2′-deoxynucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.

[0173] In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

[0174] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleosides sugars. Thus, a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5′-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3′-wing.

[0175] In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

[0176] In certain embodiments, modified oligonucleotides have a sugar motif selected from 5′ to 3′: eeeeeddddddddddeeeee; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “e” represents a 2′-MOE sugar moiety.

[0177] In certain embodiments, modified oligonucleotides have the sugar motif from 5′ to 3′: kkkddddddddddkkk; wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety.

[0178] 2. Certain Nucleobase Motifs

[0179] In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0180] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

[0181] In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

[0182] 3. Certain Internucleoside Linkage Motifs

[0183] In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0184] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sssssssssssssss, wherein each “s” represents a phosphorothioate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sssssssssssssssssss, wherein each “s” represents a phosphorothioate internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sooosssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

[0185] C. Certain Lengths

[0186] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0187] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0188] D. Certain Modified Oligonucleotides

[0189] In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

[0190] E. Certain Populations of Modified Oligonucleotides

[0191] Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

[0192] F. Nucleobase Sequence

[0193] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

II. Certain Oligomeric Compounds

[0194] In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

[0195] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

[0196] A. Certain Conjugate Groups

[0197] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

[0198] 1. Conjugate Moieties

[0199] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0200] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0201] 2. Conjugate Linkers

[0202] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0203] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0204] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0205] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0206] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0207] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

[0208] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0209] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0210] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

[0211] B. Certain Terminal Groups

[0212] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phophate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphanates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.

III. Oligomeric Duplexes

[0213] In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

IV. Antisense Activity

[0214] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

[0215] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

[0216] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0217] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0218] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.

V. Certain Target Nucleic Acids

[0219] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

[0220] A. Complementarity/Mismatches to the Target Nucleic Acid

[0221] It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

[0222] In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.

[0223] In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.

[0224] B. MSH3

[0225] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a MSH3 nucleic acid. In certain embodiments, the MSH3 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_002439.4). In certain embodiments, the MSH3 nucleic acid has the sequence set forth in SEQ ID NO: 2 (GENBANK Accession No. NC_000005.10 truncated from nucleotides 80652001 to 80880000). In certain embodiments, the MSH3 nucleic acid has the sequence set forth in SEQ ID NO: 3 (GENBANK Accession No. NM_002439.1).

[0226] In certain embodiments an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is capable of reducing a MSH3 RNA in a cell. In certain embodiments an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is capable of reducing MSH3 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO:3 is capable of ameliorating one or more symptom or hallmark of a repeat expansion disease when it is introduced to a cell in a subject. In certain embodiments, the repeat expansion disease is myotonic dystrophy (DM1 and DM2), amyotrophic lateral sclerosis, frontotemporal dementia, Huntington's disease, various polyglutamine disorders, ataxias (e.g., Friedrich's ataxia), spinocerebellar ataxia (e.g., SCA1, SCA2, SCA3, SCA6, SCAT, SCAB, SCA10, or SCA17), or Fragile X syndrome. In certain embodiments, the one or more symptoms or hallmarks are selected from brain atrophy, muscle atrophy, nerve degeneration, uncontrolled movement, seizure, tremors, muscle weakness, muscle cramping, difficulty swallowing, difficulty speaking, decreased memory, decreased cognition, anxiety, and depression, and combinations thereof.

[0227] In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is capable of reducing a detectable amount of MSH3 RNA in the CSF of a subject when the oligomeric compound is administered to the CSF of the subject. The detectable amount of MSH3 RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is capable of reducing a detectable amount of MSH3 protein in the CSF of the subject when the oligomeric compound is administered to the CSF of the subject. The detectable amount of MSH3 protein may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0228] C. Certain Target Nucleic Acids in Certain Tissues

[0229] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system (CNS). Such tissues include brain tissues, such as, cortex, substantia nigra, striatum, midbrain, and brainstem and spinal cord.

IV. Certain Pharmaceutical Compositions

[0230] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0231] In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0232] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0233] In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0234] In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

[0235] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0236] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0237] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0238] In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0239] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0240] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

[0241] In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

[0242] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with Na+ ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 80 mg of Compound No. 221967 equals the number of fully protonated molecules that weighs 80 mg. This would be equivalent to 84.64 mg of solvent-free, sodium-acetate free, anhydrous sodiated Compound No. 221967. When an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

V. Certain Hotspot Regions

[0243] In certain embodiments, nucleobases in the ranges specified below comprise a hotspot region of MSH3 nucleic acid. In certain embodiments, modified oligonucleotides that are complementary to a hotspot region of a MSH3 nucleic acid achieve an average of more than 73% reduction of MSH3 RNA in vitro in a standard cell assay.

1. Nucleobases 4,438-4,475 of SEQ ID NO: 2

[0244] In certain embodiments, nucleobases 4,438-4,475 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 4,438-4,475 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0245] The nucleobase sequences of SEQ ID NOs: 19, 203, 422, 478, 583, 603, 706, 1992, 2074, and 2143 are complementary to nucleobases 4,438-4,475 of SEQ ID NO: 2.

[0246] The nucleobase sequences of Compound Nos: 221976, 1161134, 1479858, 1480295, 1480396, 1480420, 1480609, 1480880, 1481004, 1481232, and 1481601 are complementary to nucleobases 4,438-4,475 of SEQ ID NO: 2.

[0247] In certain embodiments, modified oligonucleotides complementary to nucleobases 4,438-4,475 of SEQ ID NO: 2 achieve an average of 77% reduction of MSH3 RNA in vitro in the standard cell assay.

2. Nucleobases 13,141-13,213 of SEQ ID NO: 2

[0248] In certain embodiments, nucleobases 13,141-13,213 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 13,141-13,213 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0249] The nucleobase sequences of SEQ ID NOs: 28, 280, 369, 487, 553, 1102, 1168, 1244, 1300, 1416, 1444, 1522, 1645, 1688, 1753, 1887, 1961, 2018, 2120, 3399, and 3430 are complementary to nucleobases 13,141-13,213 of SEQ ID NO: 2.

[0250] The nucleobase sequences of Compound Nos: 221986, 1161135, 1479803, 1480030, 1480032, 1480059, 1480166, 1480255, 1480390, 1480483, 1480809, 1480912, 1480932, 1481058, 1481073, 1481189, 1481335, 1481341, 1481428, 1481579, 1566494, and 1568354 are complementary to nucleobases 13,141-13,213 of SEQ ID NO: 2.

[0251] In certain embodiments, modified oligonucleotides complementary to nucleobases 13,141-13,213 of SEQ ID NO: 2 achieve an average of 76% reduction of MSH3 RNA in vitro in the standard cell assay.

3. Nucleobases 18,114-18,146 of SEQ ID NO: 2

[0252] In certain embodiments, nucleobases 18,114-18,146 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 18,114-18,146 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0253] The nucleobase sequences of SEQ ID NOs: 129, 206, 450, 577, 611, 688, 801, 820, 900, and 3124 are complementary to nucleobases 18,114-18,146 of SEQ ID NO: 2.

[0254] The nucleobase sequences of Compound Nos: 1161146, 1161147, 1479947, 1480077, 1480142, 1480467, 1480489, 1481223, 1481402, and 1566584 are complementary to nucleobases 18,114-18,146 of SEQ ID NO: 2.

[0255] In certain embodiments, modified oligonucleotides complementary to nucleobases 18,114-18,146 of SEQ ID NO: 2 achieve an average of 89% reduction of MSH3 RNA in vitro in the standard cell assay.

4. Nucleobases 18,178-18,202 of SEQ ID NO: 2

[0256] In certain embodiments, nucleobases 18,178-18,202 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 18,178-18,202 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0257] The nucleobase sequences of SEQ ID NOs: 53, 283, 381, 433, 1906, 2033, 2115, and 2156 are complementary to nucleobases 18,178-18,202 of SEQ ID NO: 2.

[0258] The nucleobase sequences of Compound Nos: 1161148, 1161149, 1480039, 1480288, 1480622, 1481506, 1481592, and 1481595 are complementary to nucleobases 18,178-18,202 of SEQ ID NO: 2.

[0259] In certain embodiments, modified oligonucleotides complementary to nucleobases 18,178-18,202 of SEQ ID NO: 2 achieve an average of 97% reduction of MSH3 RNA in vitro in the standard cell assay.

5. Nucleobases 18,245-18,290 of SEQ ID NO: 2

[0260] In certain embodiments, nucleobases 18,245-18,290 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 18,245-18,290 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0261] The nucleobase sequences of SEQ ID NOs: 1159, 1272, 1290, 1374, 1472, 1550, and 1610 are complementary to nucleobases 18,245-18,290 of SEQ ID NO: 2.

[0262] The nucleobase sequences of Compound Nos: 1480218, 1480314, 1480434, 1480625, 1480752, 1480892, and 1481513 are complementary to nucleobases 18,245-18,290 of SEQ ID NO: 2.

[0263] In certain embodiments, modified oligonucleotides complementary to nucleobases 18,245-18,290 of SEQ ID NO: 2 achieve an average of 78% reduction of MSH3 RNA in vitro in the standard cell assay.

6. Nucleobases 20,249-20,330 of SEQ ID NO: 2

[0264] In certain embodiments, nucleobases 20,249-20,330 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 20,249-20,330 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0265] The nucleobase sequences of SEQ ID NOs: 37, 54, 55, 56, 131, 132, 133, 208, 209, 210, 284, 285, 286, 287, 1176, 1266, 1301, 1385, 1457, 1533, 1594, 1715, 1799, and 2216 are complementary to nucleobases 20,249-20,330 of SEQ ID NO: 2.

[0266] The nucleobase sequences of Compound Nos: 222004, 1161152, 1161153, 1161154, 1161155, 1161156, 1161157, 1161158, 1161159, 1161160, 1161161, 1161162, 1161163, 1161164, 1479983, 1480366, 1480490, 1480494, 1480665, 1480944, 1481014, 1481408, 1481484, and 1567062 are complementary to nucleobases 20,249-20,330 of SEQ ID NO: 2.

[0267] In certain embodiments, modified oligonucleotides complementary to nucleobases 20,249-20,330 of SEQ ID NO: 2 achieve an average of 91% reduction of MSH3 RNA in vitro in the standard cell assay.

7. Nucleobases 23,001-23,061 of SEQ ID NO: 2

[0268] In certain embodiments, nucleobases 23,001-23,061 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 23,001-23,061 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0269] The nucleobase sequences of SEQ ID NOs: 59, 212, 289, 361, 1145, 1242, 1284, 1423, 1495, 1513, 1638, 1731, 1740, 1823, 1935, 1999, 2054, 2148, 2748, 2817, 2920, and 3015 are complementary to nucleobases 23,001-23,061 of SEQ ID NO: 2.

[0270] The nucleobase sequences of Compound Nos: 1161171, 1161172, 1161173, 1479835, 1479906, 1480003, 1480011, 1480147, 1480204, 1480223, 1480470, 1480564, 1480696, 1480903, 1481139, 1481356, 1481430, 1481537, 1566675, 1566814, 1567535, and 1568299 are complementary to nucleobases 23,001-23,061 of SEQ ID NO: 2.

[0271] In certain embodiments, modified oligonucleotides complementary to nucleobases 23,001-23,061 of SEQ ID NO: 2 achieve an average of 90% reduction of MSH3 RNA in vitro in the standard cell assay.

8. Nucleobases 35,859-35,907 of SEQ ID NO: 2

[0272] In certain embodiments, nucleobases 35,859-35,907 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 35,859-35,907 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0273] The nucleobase sequences of SEQ ID NOs: 1008, 1096, 2857, 2901, 2983, 3044, 3131, 3255, and 3292 are complementary to nucleobases 35,859-35,907 of SEQ ID NO: 2.

[0274] The nucleobase sequences of Compound Nos: 1480790, 1480925, 1566458, 1566738, 1566867, 1567040, 1567275, 1568161, and 1568374 are complementary to nucleobases 35,859-35,907 of SEQ ID NO: 2.

[0275] In certain embodiments, modified oligonucleotides complementary to nucleobases 35,859-35,907 of SEQ ID NO: 2 achieve an average of 92% reduction of MSH3 RNA in vitro in the standard cell assay.

9. Nucleobases 36,200-36,315 of SEQ ID NO: 2

[0276] In certain embodiments, nucleobases 36,200-36,315 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 36,200-36,315 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0277] The nucleobase sequences of SEQ ID NOs: 1953, 2015, 2067, 2171, 2230, 2815, 2948, 3006, 3092, 3129, 3245, 3307, 3353, 3464, 3551, 3655, 3726, 3803, 3819, 3899, 4004, 4118, and 4181 are complementary to nucleobases 36,200-36,315 of SEQ ID NO: 2.

[0278] The nucleobase sequences of Compound Nos: 1480377, 1480948, 1480973, 1481256, 1566607, 1566616, 1566734, 1566802, 1566808, 1567607, 1567645, 1567887, 1567918, 1567922, 1567953, 1568024, 1568051, 1569039, 1569123, 1569584, 1569891, 1570345, and 1570729 are complementary to nucleobases 36,200-36,315 of SEQ ID NO: 2.

[0279] In certain embodiments, modified oligonucleotides complementary to nucleobases 36,200-36,315 of SEQ ID NO: 2 achieve an average of 85% reduction of MSH3 RNA in vitro in the standard cell assay.

10. Nucleobases 37,000-37,041 of SEQ ID NO: 2

[0280] In certain embodiments, nucleobases 37,000-37,041 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 37,000-37,041 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0281] The nucleobase sequences of SEQ ID NOs: 1331, 1405, 3346, 3357, 3488, 3547, and 3634 are complementary to nucleobases 37,000-37,041 of SEQ ID NO: 2.

[0282] The nucleobase sequences of Compound Nos: 1481055, 1481156, 1566840, 1567834, 1568166, 1569247, and 1570571 are complementary to nucleobases 37,000-37,041 of SEQ ID NO: 2.

[0283] In certain embodiments, modified oligonucleotides complementary to nucleobases 37,000-37,041 of SEQ ID NO: 2 achieve an average of 88% reduction of MSH3 RNA in vitro in the standard cell assay.

11. Nucleobases 73,448-73,497 of SEQ ID NO: 2

[0284] In certain embodiments, nucleobases 73,448-73,497 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 73,448-73,497 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0285] The nucleobase sequences of SEQ ID NOs: 62, 139, 215, 216, 292, 356, 506, 560, 650, 673, 774, 831, 918, 1040, 1105, 1197, 1256, 1282, 1428, 1469, 1570, 1657, 2141, and 3979 are complementary to nucleobases 73,448-73,497 of SEQ ID NO: 2.

[0286] The nucleobase sequences of Compound Nos: 1161183, 1161184, 1161185, 1161186, 1161187, 1479807, 1480007, 1480060, 1480233, 1480402, 1480502, 1480688, 1480816, 1481115, 1481122, 1481144, 1481153, 1481433, 1481516, 1481529, 1481564, 1481585, 1481603, and 1566904 are complementary to nucleobases 73,448-73,497 of SEQ ID NO: 2.

[0287] In certain embodiments, modified oligonucleotides complementary to nucleobases 73,448-73,497 of SEQ ID NO: 2 achieve an average of 74% reduction of MSH3 RNA in vitro in the standard cell assay.

12. Nucleobases 76,851-76,900 of SEQ ID NO: 2

[0288] In certain embodiments, nucleobases 76,851-76,900 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 76,851-76,900 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0289] The nucleobase sequences of SEQ ID NOs: 63, 1076, 1148, 1260, 1312, 1386, 1440, 1541, 1634, 1674, 1797, 1834, and 1898 are complementary to nucleobases 76,851-76,900 of SEQ ID NO: 2.

[0290] The nucleobase sequences of Compound Nos: 1161189, 1479897, 1479934, 1480148, 1480263, 1480331, 1480520, 1480562, 1480664, 1480666, 1481027, 1481226, and 1481471 are complementary to nucleobases 76,851-76,900 of SEQ ID NO: 2.

[0291] In certain embodiments, modified oligonucleotides complementary to nucleobases 76,851-76,900 of SEQ ID NO: 2 achieve an average of 82% reduction of MSH3 RNA in vitro in the standard cell assay.

13. Nucleobases 89,462-89,531 of SEQ ID NO: 2

[0292] In certain embodiments, nucleobases 89,462-89,531 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 89,462-89,531 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0293] The nucleobase sequences of SEQ ID NOs: 217, 294, 429, 481, 562, 636, 738, 761, 878, 940, 2059, 2167, 2487, and 2507 are complementary to nucleobases 89,462-89,531 of SEQ ID NO: 2.

[0294] The nucleobase sequences of Compound Nos: 1161191, 1161192, 1480231, 1480305, 1480808, 1480942, 1481006, 1481069, 1481161, 1481207, 1481536, 1481558, 1566481, and 1568431 are complementary to nucleobases 89,462-89,531 of SEQ ID NO: 2.

[0295] In certain embodiments, modified oligonucleotides complementary to nucleobases 89,462-89,531 of SEQ ID NO: 2 achieve an average of 80% reduction of MSH3 RNA in vitro in the standard cell assay.

14. Nucleobases 92,554-92,591 of SEQ ID NO: 2

[0296] In certain embodiments, nucleobases 92,554-92,591 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 92,554-92,591 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0297] The nucleobase sequences of SEQ ID NOs: 65, 218, 295, 526, 619, 694, 766, 862, 945, 978, 1084, 1172, 1276, 1321, and 1395 are complementary to nucleobases 92,554-92,591 of SEQ ID NO: 2.

[0298] The nucleobase sequences of Compound Nos: 1161195, 1161196, 1161197, 1480048, 1480196, 1480422, 1480587, 1480707, 1480770, 1480897, 1480928, 1480956, 1480970, 1481082, and 1481560 are complementary to nucleobases 92,554-92,591 of SEQ ID NO: 2.

[0299] In certain embodiments, modified oligonucleotides complementary to nucleobases 92,554-92,591 of SEQ ID NO: 2 achieve an average of 78% reduction of MSH3 RNA in vitro in the standard cell assay.

15. Nucleobases 109,563-109,628 of SEQ ID NO: 2

[0300] In certain embodiments, nucleobases 109,563-109,628 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 109,563-109,628 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0301] The nucleobase sequences of SEQ ID NOs: 66, 296, 377, 627, 701, 760, 815, 919, 1028, 1095, 1151, 1243, 1323, 1354, 1496, 1575, 1646, 1666, 1789, 1828, 1907, 1969, 2093, 2192, and 2611 are complementary to nucleobases 109,563-109,628 of SEQ ID NO: 2.

[0302] The nucleobase sequences of Compound Nos: 1161200, 1161201, 1479802, 1479825, 1479843, 1479878, 1480050, 1480164, 1480182, 1480220, 1480389, 1480513, 1480747, 1480886, 1480911, 1480923, 1480957, 1481017, 1481269, 1481274, 1481306, 1481385, 1481442, 1481582, and 1567156 are complementary to nucleobases 109,563-109,628 of SEQ ID NO: 2.

[0303] In certain embodiments, modified oligonucleotides complementary to nucleobases 109,563-109,628 of SEQ ID NO: 2 achieve an average of 79% reduction of MSH3 RNA in vitro in the standard cell assay.

16. Nucleobases 116,894-116,937 of SEQ ID NO: 2

[0304] In certain embodiments, nucleobases 116,894-116,937 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 116,894-116,937 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0305] The nucleobase sequences of SEQ ID NOs: 69, 222, 299, 412, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135 are complementary to nucleobases 116,894-116,937 of SEQ ID NO: 2.

[0306] The nucleobase sequences of Compound Nos: 1161211, 1161212, 1161213, 1479931, 1480286, 1480385, 1480458, 1480628, 1480775, 1480960, 1480982, and 1481340 are complementary to nucleobases 116,894-116,937 of SEQ ID NO: 2.

[0307] In certain embodiments, modified oligonucleotides complementary to nucleobases 116,894-116,937 of SEQ ID NO: 2 achieve an average of 77% reduction of MSH3 RNA in vitro in the standard cell assay.

17. Nucleobases 116,894-116,951 of SEQ ID NO: 2

[0308] In certain embodiments, nucleobases 116,894-116,951 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 116,894-116,951 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0309] The nucleobase sequences of SEQ ID NOs: 69, 222, 299, 412, 1361, 1448, 1563, 1621, 1687, 1792, 1819, 1932, 2006, 2094, and 2135 are complementary to nucleobases 116,894-116,951 of SEQ ID NO: 2.

[0310] The nucleobase sequences of Compound Nos: 1161211, 1161212, 1161213, 1479917, 1479931, 1480115, 1480286, 1480385, 1480458, 1480628, 1480775, 1480960, 1480982, 1481008, and 1481340 are complementary to nucleobases 116,894-116,951 of SEQ ID NO: 2.

[0311] In certain embodiments, modified oligonucleotides complementary to nucleobases 116,894-116,951 of SEQ ID NO: 2 achieve an average of 78% reduction of MSH3 RNA in vitro in the standard cell assay.

18. Nucleobases 118,292-118,317 of SEQ ID NO: 2

[0312] In certain embodiments, nucleobases 118,292-118,317 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 118,292-118,317 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0313] The nucleobase sequences of SEQ ID NOs: 744, 837, 943, 971, 1068, and 2690 are complementary to nucleobases 118,292-118,317 of SEQ ID NO: 2.

[0314] The nucleobase sequences of Compound Nos: 1479889, 1479891, 1480330, 1480367, 1481050, and 1567540 are complementary to nucleobases 118,292-118,317 of SEQ ID NO: 2.

[0315] In certain embodiments, modified oligonucleotides complementary to nucleobases 118,292-118,317 of SEQ ID NO: 2 achieve an average of 89% reduction of MSH3 RNA in vitro in the standard cell assay.

19. Nucleobases 122,127-122,161 of SEQ ID NO: 2

[0316] In certain embodiments, nucleobases 122,127-122,161 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 122,127-122,161 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0317] The nucleobase sequences of SEQ ID NOs: 699, 764, 850, 906, 1017, 1050, 2784, and 2832 are complementary to nucleobases 122,127-122,161 of SEQ ID NO: 2.

[0318] The nucleobase sequences of Compound Nos: 1479970, 1480224, 1480294, 1480691, 1480706, 1480984, 1567437, and 1568371 are complementary to nucleobases 122,127-122,161 of SEQ ID NO: 2.

[0319] In certain embodiments, modified oligonucleotides complementary to nucleobases 122,127-122,161 of SEQ ID NO: 2 achieve an average of 82% reduction of MSH3 RNA in vitro in the standard cell assay.

20. Nucleobases 180,800-180,823 of SEQ ID NO: 2

[0320] In certain embodiments, nucleobases 180,800-180,823 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 180,800-180,823 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0321] The nucleobase sequences of SEQ ID NOs: 119, 120, 196, 197, 273, and 350 are complementary to nucleobases 180,800-180,823 of SEQ ID NO: 2.

[0322] The nucleobase sequences of Compound Nos: 1161413, 1161414, 1161415, 1161416, 1161417, and 1161418 are complementary to nucleobases 180,800-180,823 of SEQ ID NO: 2.

[0323] In certain embodiments, modified oligonucleotides complementary to nucleobases 180,800-180,823 of SEQ ID NO: 2 achieve an average of 80% reduction of MSH3 RNA in vitro in the standard cell assay.

21. Nucleobases 224,684-224,713 of SEQ ID NO: 2

[0324] In certain embodiments, nucleobases 224,684-224,713 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 224,684-224,713 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0325] The nucleobase sequences of SEQ ID NOs: 399, 449, 1704, 1812, 1838, 1957, 1986, 2069, and 2175 are complementary to nucleobases 224,684-224,713 of SEQ ID NO: 2.

[0326] The nucleobase sequences of Compound Nos: 1480134, 1480258, 1480450, 1480479, 1480647, 1480782, 1481116, 1481365, and 1481626 are complementary to nucleobases 224,684-224,713 of SEQ ID NO: 2.

[0327] In certain embodiments, modified oligonucleotides complementary to nucleobases 224,684-224,713 of SEQ ID NO: 2 achieve an average of 77% reduction of MSH3 RNA in vitro in the standard cell assay.

Nonlimiting Disclosure and Incorporation by Reference

[0328] Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0329] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0330] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

[0331] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 13 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0332] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

EXAMPLES

[0333] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Effects of 5-10-5 MOE Gapmer Modified Oligonucleotides on Human MSH3 In Vitro, Single Dose

[0334] Modified oligonucleotides complementary to an MSH3 nucleic acid were synthesized and tested for their effect on MSH3 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using the same culture conditions.

[0335] The modified oligonucleotides in Tables 1 and 2 below are 5-10-5 MOE gapmers (i.e., they have a central gap segment of ten 2′-deoxynucleosides flanked on each side by wing segments, each wing segment consisting of five 2′-MOE modified nucleosides). The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P═S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

[0336] “Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either the human MSH3 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM_002439.4) or to the human MSH3 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NC_000005.10 truncated from nucleotides 80652001 to 80880000) or to both. In some cases, the modified oligonucleotide is complementary to the human MSH3 mRNA, designated herein as SEQ ID NO:3 (GENBANK Accession No. NM_002439.1). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

[0337] Cultured A549 cells were transfected using Lipofectin with 100 nM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and MSH3 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set HTS7138 (forward sequence AGCTAGAAACCCGGATGTCAAG, designated herein as SEQ ID NO: 4; reverse sequence GATGAGCGCCTCTGTTTGCT, designated herein as SEQ ID NO: 5; probe sequence TGCTGCTTCCTTCGGCCTTGTCC, designated herein as SEQ ID NO: 6) was used to measure RNA levels. MSH3 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent of MSH3 RNA, relative to untreated control cells (% UTC). The values marked by the symbol “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00001 TABLE 1 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with phosphorothioate linkages in A549 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 221967 3484 3503 223852 223871 GTCTTCATTTTAATGAAGAA 76 10 221968 2861 2880 161709 161728 CATCCACAATCCCAATTGTC 65 11 221969 2120 2139 116076 116095 TTAAGTAATGCTCCACTGGA 60 12 221970 507 526 13211 13230 CTTTGAGGAAGGGCAGAATC 72 13 221971 4430 4449 N/A N/A TTTATAGCAAGTATTCATTA 99 14 221972 2888 2907 N/A N/A CTGCAGCACCCATCCTTGTG 34 15 221973 2085 2104 116041 116060 ATTTCTAAAATAACGGTCCG 75 16 221974 1337 1356 27010 27029 GCTCTACTGGCTGCAGGCTT  27.sup.† 17 221975 1494 1513 73526 73545 TTTGCATAAAACTCTGTAAC 72 18 221976 363 382 4456 4475 ACTTTCTTTTTAACAGGCCC 26 19 221977 1412 1431 N/A N/A CATCCTGCACACTAACAGAT 47 20 221978 2491 2510 126812 126831 AAAATCAAGCCATTCAGCAC 59 21 221979 3894 3913 224262 224281 GATAAACTGGTTGCATAATA 52 22 221980 1069 1088 20820 20839 TTTTGTATAAAGGGCAGTCA 51 23 221981 2867 2886 161715 161734 AAATGCCATCCACAATCCCA 68 24 221982 2937 2956 202173 202192 GTGTCAGTCAGTTCTTCCAT 52 25 221983 2105 2124 116061 116080 CTGGACTGAGGAGTTCAGGA 46 26 221984 1638 1657 N/A N/A TTAAAATTCTCAGGTTTGGA 50 27 221986 444 463 13148 13167 CTGGTCCTCAGACATTTCTT 27 28 221988 3722 3741 224090 224109 CTGTCCATAAAATTTTCTAA 82 29 221990 3463 3482 223831 223850 AGAAGTCTGTGTTTCTTCCA 55 30 221992 1452 1471 73484 73503 TCAAAATAAATGTTATCCAT 84 31 221994 1579 1598 76896 76915 GATGGCAGCCAAAGAGCAAA 40 32 221996 3864 3883 224232 224251 AGTTCAATGGATAGATTCCT 51 33 221998 4345 4364 224713 224732 TGACAATATTTAACCTTTTA 80 34 222000 2600 2619 135649 135668 AGTAATCTCCTTGCTTAGCG 54 35 222002 997 1016 20748 20767 AGTTTCAGTTTGCTTCACAA 43 36 222004 898 917 20269 20288 GTTGTGATCTAAATGGCAAT 40 37 222006 2826 2845 161674 161693 ACATAGGAGCCAATCTGAGC 72 38 222008 2031 2050 115987 116006 GGTATTATTGCTTGAAATTC 55 39 222010 1941 1960 109643 109662 CTACAGAGTCCCCTCTCTAT 63 40 222012 2524 2543 135573 135592 CAAGGAGTGATAATGTTCAC 48 41 222014 536 555 13240 13259 TCTCCTGCAGAGATTCTGTC 30 42 222016 3863 3882 224231 224250 GTTCAATGGATAGATTCCTG 38 43 222018 2469 2488 126790 126809 CAGTCAAGGACTAGCTGCTC 48 44 222020 1725 1744 N/A N/A TTCATATCAGTCTGATTCTG 51 45

TABLE-US-00002 TABLE 2 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with phosphorothioate linkages in A549 cells SEQ ID SEQ ID NO: 3 NO: 3 MSH3 SEQ Compound Start Stop (% ID Number Site Site Sequence (5′ to 3′) UTC) No. 221966 8 27 CGGCGAGACATGGCAGGGCT 23 46

Example 2: Effects of 3-10-3 cEt Gapmer Modified Oligonucleotides on Human MSH3 RNA In Vitro, Single Dose

[0338] Modified oligonucleotides complementary to an MSH3 nucleic acid were synthesized and tested for their effect on MSH3 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using the same culture conditions.

[0339] The modified oligonucleotides were designed as indicated in Tables 3-6 below. The modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2′-deoxynucleosides flanked on each side by wing segments, each wing segment consisting of three cEt modified nucleosides). The internucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P═S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

[0340] “Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either the human MSH3 mRNA, designated herein as SEQ ID NO: 1 (described herein above) or to the human MSH3 genomic sequence, designated herein as SEQ ID NO: 2 (described herein above) or to both. ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

[0341] Cultured A431 cells at a density 10,000 cells per well were treated by free uptake with 2000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and MSH3 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS40982 (forward sequence TTTTATTGGCATTGTGGGAGTG, designated herein as SEQ ID NO: 7; reverse sequence TTGACATCCGGGTTTCTAGC, designated herein as SEQ ID NO: 8; probe sequence AGGCGAGGTTGTGTTTGATAGTTTCCA, designated herein as SEQ ID NO: 9) was used to measure RNA levels. MSH3 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent of MSH3 RNA, relative to untreated control cells (% UTC). The values marked by the symbol “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00003 TABLE 3 Reduction of MSH3 RNA by 3-10-3 cEt gapmers with phosphorothioate linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop Sequence (% ID Number Site Site Site Site (5′ to 3′) UTC) No. 1161128 26 41 2673 2688 AGGAGCGCGAGCCCGC  71  47 1161132 153 168 2800 2815 ACTGGAAGAATCGGCT  13  48 1161136 494 509 13198 13213 ATCGCAGCAGAATTCT  21  49 1161140 521 536 13225 13240 CTGGACTCTACTTTGA  16  50 1161142 538 553 13242 13257 TCCTGCAGAGATTCTG  15  51 1161145 628 643 13332 13347 CGTTTCGAATCTTCAG  58  52 1161149 746 761 18183 18198 GCTTTTGGACCGTTTG   0  53 1161153 880 895 20251 20266 ATATTGAGCTCTCGGG   6  54 1161157 904 919 20275 20290 AAGTTGTGATCTAAAT  23  55 1161161 923 938 20294 20309 AGGTATACTTGCTGTC   2  56 1161165 1050 1065 20801 20816 TCCGGGAAAAGAGTGA  34  57 1161169 1089 1104 20840 20855 CTCCAATAAGTGTAGA  47  58 1161173 1171 1186 23046 23061 AGAAGATAGCTGGTAG   1  59 1161177 1274 1289 26947 26962 ATCAAACACAACCTCG    4.sup.†  60 1161181 1360 1375 27033 27048 AAGGCCGAAGGAAGCA 108  61 1161185 1430 1445 73462 73477 GACTCGAATTCTGTCA  65  62 1161189 1549 1564 76866 76881 AAGTTAACAATGCCAG   6  63 1161193 1761 1776 92533 92548 GGTCTAAAACCCACAG  84  64 1161197 1798 1813 92570 92585 TTCTTTAACTTCCGTC  10  65 1161201 1868 1883 109570 109585 GAGAACTTCCGATACA  13  66 1161205 2069 2084 116025 116040 GAGCAAGTCTGACTGA  21  67 1161209 2124 2139 116080 116095 TTAAGTAATGCTCCAC  37  68 1161213 2252 2267 116922 116937 ATGCATTCGGATCTCG  20  69 1161217 2377 2392 123737 123752 ACCTTTACCCAATCAG  19  70 1161221 2410 2425 126731 126746 GAGTGAAAGCGGCTCA  67  71 1161225 2522 2537 135571 135586 GTGATAATGTTCACTG 112  72 1161229 2589 2604 135638 135653 TAGCGACCTTGGCCAG  68  73 1161233 2696 2711 140805 140820 ATATTGATCCTGTTCT  43  74 1161237 2784 2799 161632 161647 TTATGTAGGAGCTCTT  24  75 1161241 2851 2866 161699 161714 ATTGTCGCTTCTTCTG  21  76 1161245 2863 2878 161711 161726 TCCACAATCCCAATTG  71  77 1161249 2901 2916 202137 202152 ATATATTGTCTGCAGC  64  78 1161253 3042 3057 202278 202293 TAGCATAGGCAATGGC  32  79 1161257 3100 3115 212832 212847 GGATAATGGGTGACAA  15  80 1161261 3170 3185 212902 212917 ACTGACCAAGAATCCC  25  81 1161265 3273 3288 221178 221193 ATCCATAACTCCTTGC  36  82 1161269 3552 3567 223920 223935 GTTACTGGAGAGTTAT  42  83 1161273 3694 3709 224062 224077 AGTCTATTCAAGAGTG  21  84 1161277 3831 3846 224199 224214 GCCAATTATCTGAACT  38  85 1161281 3867 3882 224235 224250 GTTCAATGGATAGATT  25  86 1161285 4357 4372 224725 224740 TAATCCTATGACAATA  69  87 1161289 N/A N/A 9964 9979 CGATATAATGGTGTGC  10  88 1161293 N/A N/A 13640 13655 CTCAATAAAGAATCCC  53  89 1161297 N/A N/A 18570 18585 TCCAATTAACTTTGGA  82  90 1161301 N/A N/A 29039 29054 TACCATTTCTAGCAAG   4  91 29353 29368 1161305 N/A N/A 35211 35226 GATAGTAAGACTGATT  11  92 1161309 N/A N/A 41982 41997 CATACTAACTTACCAT  44  93 1161313 N/A N/A 48797 48812 ATCAATAAACCTACTG  62  94 1161317 N/A N/A 50475 50490 ATGCGATACCTAGCAC  84  95 1161321 N/A N/A 58187 58202 ATCTATAAAACCCGTA  47  96 1161325 N/A N/A 61345 61360 ATGTAACATGCCTCTC   9  97 62026 62041 1161329 N/A N/A 70415 70430 GTATATTGATGTAGGT   5  98 1161333 N/A N/A 72658 72673 TATAGTAAATTAGGTT  88  99 1161337 N/A N/A 77689 77704 GTTAATCACTCTTGTA  27 100 1161341 N/A N/A 79306 79321 GTTTATCAAGAGGTTA  10 101 1161345 N/A N/A 86816 86831 CTTAGTAAAAGGCCCC  47 102 1161349 N/A N/A 99041 99056 GATAATGTAAGAGCCC  22 103 1161353 N/A N/A 106028 106043 ATAATTATGGAGGTCT  38 104 1161357 N/A N/A 108367 108382 GGACTAAATGTATCAT  26 105 1161361 N/A N/A 113498 113513 GTAATTACTAACCACA  68 106 1161365 N/A N/A 118028 118043 GTTATATAGAGCTCTA  12 107 1161369 N/A N/A 125175 125190 TAAATTACTGGGAGGC  53 108 1161373 N/A N/A 128934 128949 GTCGGGTTGATTACTT  18 109 1161377 N/A N/A 134572 134587 TATAGTAACTACTCTG  60 110 1161381 N/A N/A 143282 143297 GCATTATATACTACCA  13 111 1161385 N/A N/A 148454 148469 ACATAAAATCTATCGG  60 112 1161389 N/A N/A 153751 153766 TACAATAATGAGCTCG  91 113 1161393 N/A N/A 167892 167907 AATATGCAGGGACACA  22 114 169690 169705 1161397 N/A N/A 167908 167923 TGGCATACTCAGTAAG  33 115 169706 169721 1161401 N/A N/A 169369 169384 TATATTAGTAGCTGTA  23 116 1161405 N/A N/A 174220 174235 ACATTTAAGCTTAGCA  55 117 1161409 N/A N/A 180670 180685 GTGGTATTAACATCCA  97 118 182418 182433 1161413 N/A N/A 180800 180815 AGTAGAGGCAATGATT  26 119 182544 182559 1161417 N/A N/A 180807 180822 ATTGTTAAGTAGAGGC  20 120 182551 182566 1161421 N/A N/A 195215 195230 GAAATTATGCAAGGGT  30 121 1161425 N/A N/A 200699 200714 TCCAATAACTAGCGGC  80 122 1161429 N/A N/A 206995 207010 GTAAATTTGTCAGGGA  45 123 1161433 N/A N/A 217515 217530 GTAATTATGTACTCCT  19 124

TABLE-US-00004 TABLE 4 Reduction of MSH3 RNA by 3-10-3 cEt gapmers with phosphorothioate linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop Sequence (% ID Number Site Site Site Site (5′ to 3′) UTC) No. 1161129 103 118 2750 2765 GCAGCGAGGCCGCCCG  80 125 1161133 202 217 2849 2864 TGGTCGGCTGCACCTG  81 126 1161137 498 513 13202 13217 CAGAATCGCAGCAGAA  14 127 1161141 525 540 13229 13244 CTGTCTGGACTCTACT  28 128 1161142 538 553 13242 13257 TCCTGCAGAGATTCTG  18  51 1161146 682 697 18119 18134 GATGATCCAAACTGAC   8 129 1161150 771 786 18208 18223 ATTGTAATTCTAGCGG   8 130 1161154 881 896 20252 20267 AATATTGAGCTCTCGG   6 131 1161158 907 922 20278 20293 ATAAAGTTGTGATCTA   4 132 1161162 927 942 20298 20313 GAGTAGGTATACTTGC  17 133 1161166 1058 1073 20809 20824 AGTCAATTTCCGGGAA   2 134 1161170 1125 1140 23000 23015 CAGCATCATCCAGCTT  86 135 1161174 1173 1188 23048 23063 ACAGAAGATAGCTGGT  44 136 1161178 1299 1314 26972 26987 AACGAGAAGCAGAGTC   20.sup.† 137 1161182 1369 1384 27042 27057 TGCTCGGACAAGGCCG 112 138 1161186 1431 1446 73463 73478 CGACTCGAATTCTGTC  52 139 1161190 1587 1602 76904 76919 TTATGATGGCAGCCAA  21 140 1161194 1773 1788 92545 92560 AAGTTTTAGTGTGGTC  23 141 1161198 1826 1841 92598 92613 TAATTTAAGGAGTGGC  13 142 1161202 1927 1942 109629 109644 ATGTCGGGCAATTTAC  15 143 1161206 2084 2099 116040 116055 TAAAATAACGGTCCGG  56 144 1161210 2127 2142 116083 116098 TCTTTAAGTAATGCTC  64 145 1161214 2301 2316 116971 116986 TCACATATTGTGCAGA  37 146 1161218 2378 2393 123738 123753 AACCTTTACCCAATCA  26 147 1161222 2466 2481 126787 126802 GGACTAGCTGCTCCCG  56 148 1161226 2524 2539 135573 135588 GAGTGATAATGTTCAC  46 149 1161230 2606 2621 135655 135670 GCAGTAATCTCCTTGC 106 150 1161234 2697 2712 140806 140821 CATATTGATCCTGTTC  47 151 1161238 2804 2819 161652 161667 GGTAATCAATGCAACT  44 152 1161242 2853 2868 161701 161716 CAATTGTCGCTTCTTC  67 153 1161246 2892 2907 202128 202143 CTGCAGCACCCATCCT  57 154 1161250 2985 3000 202221 202236 AGATAACCAAGGACTG  70 155 1161254 3043 3058 202279 202294 GTAGCATAGGCAATGG  24 156 1161258 3101 3116 212833 212848 CGGATAATGGGTGACA  17 157 1161262 3248 3263 221153 221168 TCTAGTTATTTGGTAA  56 158 1161266 3291 3306 221196 221211 CTAGTTTAGCCACATT  45 159 1161270 3555 3570 223923 223938 GCTGTTACTGGAGAGT  31 160 1161274 3787 3802 224155 224170 TTATATCACCCTCCAA  34 161 1161278 3847 3862 224215 224230 CCAGATTCACCCAGTT  18 162 1161282 3899 3914 224267 224282 GGATAAACTGGTTGCA  34 163 1161286 4359 4374 224727 224742 CTTAATCCTATGACAA  35 164 1161290 N/A N/A 9968 9983 AATACGATATAATGGT  46 165 1161294 N/A N/A 14619 14634 AGCAATAATGTATACG  40 166 1161298 N/A N/A 20070 20085 CCTGTATAGAAGCCTA  46 167 1161302 N/A N/A 29041 29056 ATTACCATTTCTAGCA   2 168 29355 29370 1161306 N/A N/A 36063 36078 AACTATAACAGAGTCA  11 169 1161310 N/A N/A 42287 42302 CTTACTAATTACTTCC  21 170 1161314 N/A N/A 49685 49700 GGAGATAAGCAAGCCC  82 171 1161318 N/A N/A 54942 54957 AGTTATATTGATGTGT  10 172 1161322 N/A N/A 59123 59138 AGTCTATACTAGGTAA  34 173 1161326 N/A N/A 61978 61993 GGTAATAAACCTTGCA  72 174 1161330 N/A N/A 71715 71730 TATATTACCATGCATG  39 175 1161334 N/A N/A 73977 73992 GATACTAATGAGCCAT  39 176 1161338 N/A N/A 77858 77873 TCAATATAATGGAGGG  65 177 1161342 N/A N/A 79766 79781 AGTAATCACCTTAAGA  46 178 1161346 N/A N/A 87329 87344 AACAATTAGGCAGTGA  30 179 1161350 N/A N/A 102327 102342 TATATTATGGCTCCAT  10 180 1161354 N/A N/A 106850 106865 ACATATAAGACAGCCT  51 181 1161358 N/A N/A 108423 108438 GATTTTACCAACGGCT  73 182 1161362 N/A N/A 114294 114309 AGCAATAATATGTTAG  36 183 1161366 N/A N/A 118934 118949 TACAATTAGTTGATCT  23 184 1161370 N/A N/A 126568 126583 TTAATTATGGTCCTGA  33 185 1161374 N/A N/A 129946 129961 CTTAGTAATTAGAGTA  36 186 1161378 N/A N/A 136888 136903 AATAATCTAGATGCCT  36 187 1161382 N/A N/A 143641 143656 CTTAGGTTGCTATGGT  18 188 1161386 N/A N/A 148609 148624 AGAATATATGACCCCC  36 189 1161390 N/A N/A 156822 156837 GTAAGTAAGTCTGACA 127 190 1161394 N/A N/A 167893 167908 GAATATGCAGGGACAC  17 191 169691 169706 1161398 N/A N/A 167909 167924 TTGGCATACTCAGTAA  50 192 169707 169722 1161402 N/A N/A 170234 170249 AAGTATAACATGTCTG  35 193 1161406 N/A N/A 179103 179118 AATTTTATAACGAGCT  65 194 1161410 N/A N/A 180671 180686 AGTGGTATTAACATCC  25 195 182419 182434 1161414 N/A N/A 180804 180819 GTTAAGTAGAGGCAAT  25 196 182548 182563 1161418 N/A N/A 180808 180823 AATTGTTAAGTAGAGG  16 197 182552 182567 1161422 N/A N/A 195842 195857 AGATTTAAAACACGGA  78 198 1161426 N/A N/A 201007 201022 ATTAGGTAATACTCAG  38 199 1161430 N/A N/A 212569 212584 TGAGAATTAGTTGCAG  43 200 1161434 N/A N/A 217615 217630 TCATTATATGCTGGTC  24 201

TABLE-US-00005 TABLE 5 Reduction of MSH3 RNA by 3-10-3 cEt gapmers with phosphorothioate linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop Sequence (% ID Number Site Site Site Site (5′ to 3′) UTC) No. 1161130 144 159 2791 2806 ATCGGCTCAAAACCGC  62 202 1161134 363 378 4456 4471 TCTTTTTAACAGGCCC  12 203 1161138 499 514 13203 13218 GCAGAATCGCAGCAGA  43 204 1161142 538 553 13242 13257 TCCTGCAGAGATTCTG  13  51 1161143 594 609 13298 13313 CGTGTAGAAGACTGAT   6 205 1161147 688 703 18125 18140 GTATTTGATGATCCAA   2 206 1161151 874 889 20245 20260 AGCTCTCGGGCTGCAA  80 207 1161155 882 897 20253 20268 AAATATTGAGCTCTCG   6 208 1161159 908 923 20279 20294 CATAAAGTTGTGATCT   7 209 1161163 943 958 20314 20329 TGAACAAACAGTCTGT  10 210 1161167 1087 1102 20838 20853 CCAATAAGTGTAGATT  26 211 1161171 1159 1174 23034 23049 GTAGAAGTATCAGTCA   1 212 1161175 1268 1283 26941 26956 CACAACCTCGCCTGTG   51.sup.† 213 1161179 1303 1318 26976 26991 TCTGAACGAGAAGCAG   49.sup.† 214 1161183 1428 1443 73460 73475 CTCGAATTCTGTCATC  15 215 1161187 1442 1457 73474 73489 ATCCATCCTTTCGACT  31 216 1161191 1654 1669 89469 89484 CTTGATAGCTGTTTAA  10 217 1161195 1795 1810 92567 92582 TTTAACTTCCGTCTCC  15 218 1161199 1845 1860 109547 109562 GCCGGGCATTTATTTC  66 219 1161203 1928 1943 109630 109645 TATGTCGGGCAATTTA  20 220 1161207 2087 2102 116043 116058 TTCTAAAATAACGGTC  37 221 1161211 2237 2252 116907 116922 GTCAATAACACCTTGA  35 222 1161215 2357 2372 123717 123732 TATACAAGATACAGCA  39 223 1161219 2403 2418 126724 126739 AGCGGCTCACAGCTTT  32 224 1161223 2468 2483 126789 126804 AAGGACTAGCTGCTCC  79 225 1161227 2536 2551 135585 135600 GCTTTACACAAGGAGT  15 226 1161231 2669 2684 140778 140793 ATCAATCACAGGGTGC  26 227 1161235 2698 2713 140807 140822 ACATATTGATCCTGTT 100 228 1161239 2823 2838 161671 161686 AGCCAATCTGAGCCAT  62 229 1161243 2859 2874 161707 161722 CAATCCCAATTGTCGC  68 230 1161247 2899 2914 202135 202150 ATATTGTCTGCAGCAC  47 231 1161251 2986 3001 202222 202237 AAGATAACCAAGGACT  51 232 1161255 3082 3097 212814 212829 AGGGTTAAGGATTTCA  20 233 1161259 3102 3117 212834 212849 GCGGATAATGGGTGAC  25 234 1161263 3249 3264 221154 221169 CTCTAGTTATTTGGTA  24 235 1161267 3339 3354 221244 221259 CTTTTGACTTGTGAGC  52 236 1161271 3561 3576 223929 223944 AGATAGGCTGTTACTG  59 237 1161275 3788 3803 224156 224171 TTTATATCACCCTCCA  27 238 1161279 3859 3874 224227 224242 GATAGATTCCTGCCAG  24 239 1161283 3900 3915 224268 224283 TGGATAAACTGGTTGC  15 240 1161287 4362 4377 224730 224745 CTGCTTAATCCTATGA  27 241 1161291 N/A N/A 10035 10050 ATTAGGTAGCATATGG   8 242 1161295 N/A N/A 17063 17078 AGCAATAAGAAGACGG  34 243 1161299 N/A N/A 22063 22078 GTTAATAGTTTGGAGC  46 244 1161303 N/A N/A 29313 29328 ACAATATAGAAGCCTA  11 245 1161307 N/A N/A 38773 38788 CTTAGGTTAAGGTCTT   3 246 1161311 N/A N/A 44034 44049 CTCGGGTTTCAACGGA  67 247 1161315 N/A N/A 49774 49789 ATTAGTAAGAAGTCTC  77 248 1161319 N/A N/A 57178 57193 ATCGCTAATGTGGGTC  15 249 1161323 N/A N/A 61343 61358 GTAACATGCCTCTCTG   5 250 62024 62039 1161327 N/A N/A 63213 63228 ACCTATAAAGTAGTGC  64 251 1161331 N/A N/A 72225 72240 AGTATATAGATGCCAC   6 252 1161335 N/A N/A 76241 76256 TCATCCTTGCACCCTA  16 253 N/A N/A 77078 77093 1161339 N/A N/A 78047 78062 GGAGAACGCACATCAA  19 254 1161343 N/A N/A 79875 79890 GATAACATAGCTTTGT  12 255 1161347 N/A N/A 93584 93599 AGGTATAACTATTCAG  33 256 1161351 N/A N/A 102463 102478 ATTATACCTTGACCAG  11 257 1161355 N/A N/A 107134 107149 GATAACAATTTGTGCT  58 258 1161359 N/A N/A 110090 110105 CATACTAACTACCACC  39 259 1161363 N/A N/A 116325 116340 GTACTATATCTGTCCT  54 260 1161367 N/A N/A 122073 122088 GTATTATTGCAACCAA   9 261 1161371 N/A N/A 126934 126949 TATTTTATGGTGGGTC  23 262 1161375 N/A N/A 130731 130746 CATAACAATCAATGCT  68 263 1161379 N/A N/A 138302 138317 ATTAGGTTCAATAGGC  58 264 1161383 N/A N/A 144692 144707 CACTATAATAAGTTCA  45 265 1161387 N/A N/A 151469 151484 TCTGATAAAGGAACGC  50 266 1161391 N/A N/A 157348 157363 AAGTATTAACTTGGTA  56 267 1161395 N/A N/A 167894 167909 AGAATATGCAGGGACA  15 268 169692 169707 1161399 N/A N/A 167912 167927 TTCTTGGCATACTCAG   9 269 169710 169725 1161403 N/A N/A 171438 171453 GATATATTGAAGTGCC  17 270 1161407 N/A N/A 180668 180683 GGTATTAACATCCACA  65 271 182416 182431 1161411 N/A N/A 180690 180705 TTTCTTAGGTACACAG  14 272 182438 182453 1161415 N/A N/A 180805 180820 TGTTAAGTAGAGGCAA  20 273 182549 182564 1161419 N/A N/A 184119 184134 ATTACGATATCCTTGT  23 274 1161423 N/A N/A 198783 198798 ACAGAACAAGTACCAT  58 275 1161427 N/A N/A 201129 201144 TGATTTAACCATGGTC  41 276 1161431 N/A N/A 215634 215649 GATATTAGTAGTAGCC  32 277 1161435 N/A N/A 218324 218339 TATAATCTAGATCCCA  38 278

TABLE-US-00006 TABLE 6 Reduction of MSH3 RNA by 3-10-3 cEt gapmers with phosphorothioate linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1161131  150  165 2797 2812 GGAAGAATCGGCTCAA  15 279 1161135  457  472 13161 13176 GAAACATTCCTGGTCC  14 280 1161139  519  534 13223 13238 GGACTCTACTTTGAGG  63 281 1161142  538  553 13242 13257 TCCTGCAGAGATTCTG  23  51 1161144  627  642 13331 13346 GTTTCGAATCTTCAGA  53 282 1161148  745  760 18182 18197 CTTTTGGACCGTTTGT   1 283 1161152  878  893 20249 20264 ATTGAGCTCTCGGGCT   9 284 1161156  900  915 20271 20286 TGTGATCTAAATGGCA   6 285 1161160  921  936 20292 20307 GTATACTTGCTGTCAT   6 286 1161164  944  959 20315 20330 ATGAACAAACAGTCTG   5 287 1161168 1088 1103 20839 20854 TCCAATAAGTGTAGAT  15 288 1161172 1164 1179 23039 23054 AGCTGGTAGAAGTATC  22 289 1161176 1273 1288 26946 26961 TCAAACACAACCTCGC  11† 290 1161180 1317 1332 26990 27005 TCCGGGTTTCTAGCTC   4† 291 1161184 1429 1444 73461 73476 ACTCGAATTCTGTCAT  10 292 1161188 1487 1502 73519 73534 CTCTGTAACTGCCTGG   5 293 1161192 1659 1674 89474 89489 TTTTACTTGATAGCTG  10 294 1161196 1797 1812 92569 92584 TCTTTAACTTCCGTCT  11 295 1161200 1861 1876 109563 109578 TCCGATACAGCATCAA  15 296 1161204 1983 1998 115939 115954 AGAAGAACTCTTGGGT  16 297 1161208 2123 2138 116079 116094 TAAGTAATGCTCCACT  50 298 1161212 2238 2253 116908 116923 CGTCAATAACACCTTG  13 299 1161216 2358 2373 123718 123733 GTATACAAGATACAGC  31 300 1161220 2409 2424 126730 126745 AGTGAAAGCGGCTCAC  67 301 1161224 2472 2487 126793 126808 AGTCAAGGACTAGCTG  58 302 1161228 2551 2566 135600 135615 GCTAGGTGATGCACTG  28 303 1161232 2694 2709 140803 140818 ATTGATCCTGTTCTCC   9 304 1161236 2699 2714 140808 140823 GACATATTGATCCTGT  56 305 1161240 2829 2844 161677 161692 CATAGGAGCCAATCTG  22 306 1161244 2862 2877 161710 161725 CCACAATCCCAATTGT  65 307 1161248 2900 2915 202136 202151 TATATTGTCTGCAGCA  66 308 1161252 3040 3055 202276 202291 GCATAGGCAATGGCAA  58 309 1161256 3083 3098 212815 212830 CAGGGTTAAGGATTTC   9 310 1161260 3105 3120 212837 212852 CTGGCGGATAATGGGT  51 311 1161264 3272 3287 221177 221192 TCCATAACTCCTTGCT  29 312 1161268 3384 3399 223752 223767 AATACTTGAGTCTCTT  38 313 1161272 3566 3581 223934 223949 CACAAAGATAGGCTGT  48 314 1161276 3789 3804 224157 224172 TTTTATATCACCCTCC  28 315 1161280 3860 3875 224228 224243 GGATAGATTCCTGCCA  87 316 1161284 3901 3916 224269 224284 GTGGATAAACTGGTTG  25 317 1161288 N/A N/A 4715 4730 GCAGAATTGTAGCTCT  48 318 1161292 N/A N/A 11619 11634 GTATATTTGTATCGCT   4 319 1161296 N/A N/A 18041 18056 CACAATAATAAGTTCC 104 320 1161300 N/A N/A 28500 28515 GATATACACACACGGA   5 321 1161304 N/A N/A 32726 32741 TACGATAATGATGCCC   6 322 1161308 N/A N/A 40266 40281 TCTATCTAACATATAC  71 323 40293 40308 1161312 N/A N/A 45332 45347 GTAAGTAAACCAGGTG   4 324 1161316 N/A N/A 50471 50486 GATACCTAGCACTCCT  15 325 1161320 N/A N/A 58079 58094 GTAATTAATGCTGGTT  28 326 1161324 N/A N/A 61344 61359 TGTAACATGCCTCTCT  12 327 62025 62040 1161328 N/A N/A 67792 67807 GGATATAAGAATTGGT  12 328 1161332 N/A N/A 72650 72665 ATTAGGTTAACTCTCA  12 329 1161336 N/A N/A 76649 76664 ATTACTAATACCCAGG  84 330 1161340 N/A N/A 78097 78112 TAGGATAAAGTTGCTT  47 331 1161344 N/A N/A 86410 86425 ATTATAATGTTGCACA  89 332 1161348 N/A N/A 95796 95811 TACGCTAAAACCCAGA  30 333 1161352 N/A N/A 102762 102777 AGAGAACATTGACCAC  20 334 1161356 N/A N/A 107952 107967 TATACTAACTTCAGGC  57 335 1161360 N/A N/A 112728 112743 AGTTATTATGGGTTCC  13 336 1161364 N/A N/A 116799 116814 AATACATATTCGAAGT  60 337 1161368 N/A N/A 124783 124798 CACTATTACCAGCTAC  29 338 1161372 N/A N/A 128914 128929 TACAATAAAGCTCCCT  48 339 1161376 N/A N/A 132793 132808 ACAAATAATACGATTC  59 340 1161380 N/A N/A 142065 142080 AACAATTAGTAAACCC  72 341 1161384 N/A N/A 144693 144708 GCACTATAATAAGTTC  56 342 1161388 N/A N/A 152136 152151 CATAGTAACTAAAGCA  95 343 1161392 N/A N/A 161046 161061 GCAGAATTGTAACTCT 100 344 1161396 N/A N/A 167895 167910 AAGAATATGCAGGGAC  14 345 169693 169708 1161400 N/A N/A 169122 169137 GTAACTAATATTACCA  43 346 1161404 N/A N/A 172913 172928 TATACTAAAGGGCAGT  47 347 1161408 N/A N/A 180669 180684 TGGTATTAACATCCAC  66 348 182417 182432 1161412 N/A N/A 180695 180710 TAGCATTTCTTAGGTA  25 349 182443 182458 1161416 N/A N/A 180806 180821 TTGTTAAGTAGAGGCA  14 350 182550 182565 1161420 N/A N/A 186095 186110 GATATTAATTTCACGA 374 351 1161424 N/A N/A 199028 199043 GCATCGGAAAATGGTT  40 352 1161428 N/A N/A 202072 202087 CTTATTAGGAAGCCGA  65 353 1161432 N/A N/A 215635 215650 TGATATTAGTAGTAGC  30 354 1161436 N/A N/A 223297 223312 GCAGAATAGCAACCCA  51 355

Example 3: Effects of Modified Oligonucleotides on Human MSH3 RNA In Vitro, Multiple Doses

[0342] Modified oligonucleotides selected from the examples above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with various concentrations of modified oligonucleotide as specified in Tables 7-9 below. After a treatment period of approximately 48 hours, MSH3 RNA levels were measured as previously described using the Human MSH3 primer-probe set RTS40982 (described herein above). MSH3 RNA levels were normalized to total RNA, as measured by RIBOGREEN®. Results are presented in the tables below as percent MSH3 RNA levels, relative to untreated control (% UTC). Where possible, the half maximal inhibitory concentration (IC.sub.50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in excel.

TABLE-US-00007 TABLE 7 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 31 nM 125 nM 500 nM 2000 nM μM 1161142 42 25 11 6 <0.03 1161149 8 2 1 1 <0.03 1161150 57 23 9 4 <0.03 1161153 24 13 6 2 <0.03 1161154 46 13 5 2 <0.03 1161158 60 18 4 1 <0.03 1161161 13 3 2 2 <0.03 1161166 34 10 2 1 <0.03 1161173 19 5 1 1 <0.03 1161189 19 6 3 3 <0.03 1161197 47 19 8 6 <0.03 1161289 45 25 13 7 <0.03 1161301 41 27 8 3 <0.03 1161302 51 23 8 1 <0.03 1161305 56 31 10 5 0.04 1161325 72 31 16 6 0.07 1161329 19 5 3 2 <0.03 1161341 45 10 5 3 <0.03 1161365 29 11 8 4 <0.03

TABLE-US-00008 TABLE 8 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 31 nM 125 nM 500 nM 2000 nM μM 1161142 65 36 16 12 0.06 1161143 51 24 13 6 <0.03 1161146 60 37 16 10 0.05 1161147 25 6 3 2 <0.03 1161155 49 21 9 4 <0.03 1161159 52 19 11 4 <0.03 1161163 98 48 20 7 0.19 1161171 25 7 2 1 <0.03 1161191 98 34 19 10 0.15 1161198 51 23 16 17 <0.03 1161291 64 31 15 6 0.05 1161306 56 48 25 13 0.07 1161307 41 15 5 3 <0.03 1161318 77 37 14 10 0.10 1161323 34 15 5 4 <0.03 1161331 48 20 9 6 <0.03 1161350 71 39 21 11 0.09 1161367 55 25 11 9 <0.03 1161399 61 33 16 8 0.05

TABLE-US-00009 TABLE 9 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 31 nM 125 nM 500 nM 2000 nM μM 1161134 50 32 17 11 <0.03 1161142 67 39 22 13 0.08 1161148 28 7 3 2 <0.03 1161152 75 43 20 8 0.11 1161156 48 17 7 4 <0.03 1161160 54 25 12 6 <0.03 1161164 74 37 13 5 0.09 1161184 77 44 21 11 0.12 1161188 39 11 4 2 <0.03 1161192 75 44 24 13 0.12 1161196 68 38 19 10 0.08 1161232 49 23 7 2 <0.03 1161256 33 12 5 3 <0.03 1161292 44 19 8 5 <0.03 1161300 61 34 13 6 0.05 1161303 76 52 19 7 0.13 1161304 47 23 5 1 <0.03 1161312 54 21 7 4 <0.03 1161351 60 29 22 17 0.04

Example 4: Effects of 5-10-5 MOE Gapmer Modified Oligonucleotides on Human MSH3 In Vitro, Single Dose

[0343] Modified oligonucleotides complementary to an MSH3 nucleic acid were synthesized and tested for their effect on MSH3 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using the same culture conditions.

[0344] The modified oligonucleotides in Tables 10 to 33 below are 5-10-5 MOE gapmers (i.e., they have a central gap segment of ten 2′-β-D-deoxynucleosides flanked on each side by wing segments, each wing segment consisting of five 2′-MOE modified nucleosides). The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

[0345] “Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either SEQ ID NO: 1 (GENBANK Accession No. NM_002439.4), to SEQ ID NO: 2 (GENBANK Accession No. NC_000005.10 truncated from nucleotides 80652001 to 80880000), or to both.

[0346] Cultured A431 cells were treated using free uptake with 4000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and MSH3 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS40982 (described herein above) was used to measure RNA levels. MSH3 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent MSH3 RNA, relative to untreated control cells (% UTC). The values marked by the symbol “f” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00010 TABLE 10 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479807 1444 1463 73476 73495 AATGTTATCCATCCTTTCGA  33 356 1479811 N/A N/A 123277 123296 TCTGAGATATGATCCTCCCC  49 357 1479866 1942 1961 109644 109663 GCTACAGAGTCCCCTCTCTA  31 358 1479875 N/A N/A 76051 76070 ACCTAATGTTCTCCCCATCA  99 359 1479903 1058 1077 20809 20828 GGGCAGTCAATTTCCGGGAA  12 360 1479906 1126 1145 23001 23020 ATTTACAGCATCATCCAGCT  17 361 1479909 N/A N/A 182503 182522 TTTGACTTACTTCAAGTGCT  20 362 1479964 N/A N/A 186633 186652 GAATGTATTAATCCATGCTC  34 363 1479971 N/A N/A 148081 148100 TAGCATCAATCAATAAGATC  96 364 1479990 N/A N/A 46649 46668 AGCTTTATACACCCTTTCTC  17 365 1480024 N/A N/A 143002 143021 TGTTTCTAACCACCTTGCTT  97 366 1480051 N/A N/A 119718 119737 TAACAAGATCCACATACCAT  81 367 1480056 N/A N/A 166766 166785 TCATTTCATCTCTATCCTAC  54 368 1480059  439  458 13143 13162 CCTCAGACATTTCTTTGGCT  15 369 1480085 N/A N/A 80722 80741 CAGATTTTTAAACCAAGCCA  41 370 1480112 3724 3743 224092 224111 TACTGTCCATAAAATTTTCT  72 371 1480117 2496 2515 126817 126836 TCTAGAAAATCAAGCCATTC  28 372 1480118 N/A N/A 116999 117018 TAAGCTTGACATTACCTCCT  57 373 1480139 N/A N/A 102696 102715 AGATCTATTTCCTAACACAA  62 374 1480170 4392 4411 224760 224779 GAATGACAAATAATTTCATC  49 375 1480174  550  569 13254 13273 CAGAACTGCAAATCTCTCCT  17 376 1480182 1861 1880 109563 109582 AACTTCCGATACAGCATCAA  24 377 1480194 N/A N/A 3515 3534 ACATCTATACCATCCTAAGA  58 378 1480195 N/A N/A 202312 202331 TTACCGGATACTTACATCTC  93 379 1480257 3172 3191 212904 212923 ATCCTCACTGACCAAGAATC  51 380 1480288  741  760 18178 18197 CTTTTGGACCGTTTGTTAGC   7 381 1480296 N/A N/A 131270 131289 GCAATTTTATCACTATGCTA  70 382 1480308 3276 3295 221181 221200 ACATTTAATCCATAACTCCT  54 383 1480355 N/A N/A 138235 138254 GCTGCTACACATTTTCCACT  15 384 1480364 N/A N/A 38788 38807 ACCGAACTGATTTCATGATC  38 385 1480368 N/A N/A 111983 112002 TTCAAACTAATCTTTAGGTA  82 386 1480378 N/A N/A 70411 70430 GTATATTGATGTAGGTATAT  18 387 1480379 N/A N/A 13757 13776 TACTTTCTATCTATCAAGCT  63 388 1480404 N/A N/A 106249 106268 TAGCATCCAAAATATGAGCT  59 389 1480418 2856 2875 161704 161723 ACAATCCCAATTGTCGCTTC  44 390 1480432 2702 2721 140811 140830 TATTTGGGACATATTGATCC  52 391 1480485 N/A N/A 36158 36177 ACCACAGGACATTCTTCCAC  26 392 1480497 N/A N/A 170355 170374 CCACAATAATATATGAGGGT  33 393 1480550  851  870 18288 18307 CTGCATCTTCCCCAAAGAAT  24 394 1480595 N/A N/A 212047 212066 AAGGAGTATATTTCCTTGCC  69 395 1480599 N/A N/A 164378 164397 TCTGAAATATACTTCCTTCC  80 396 1480610 N/A N/A 3489 3508 ATCCACCCAAACTGTATTTC  38 397 1480633 N/A N/A 63218 63237 AGGTACTCAACCTATAAAGT  56 398 1480647 4317 4336 224685 224704 GACCTTATTCCTTCTGTGCT  18 399 1480662 1279 1298 26952 26971 CTGGAAACTATCAAACACAA  11† 400 1480683 N/A N/A 201141 201160 ACAGCTTTTCTTTAACTGAT  55 401 1480697 1805 1824 92577 92596 GGGTCACCCACTTCTTTAAC  69 402 1480717 N/A N/A 3166 3185 TGCATAACCTTTGCCTATCT  62 403 1480726 3788 3807 224156 224175 AATTTTTATATCACCCTCCA  38 404 1480750 N/A N/A 124735 124754 GTACCATTTTCATCTCATGT  17 405 1480768 N/A N/A 72414 72433 TCATGTTCATATTTTGGTCA   9 406 1480783 N/A N/A 140698 140717 ATGTTTCAATTTACTAGGCA 132 407 1480789 N/A N/A 216005 216024 TTGCTTTTATCATTCTGTAC  23 408 1480817 3445 3464 223813 223832 CATGTTGAACTCCTCTGTCC  47 409 1480818 N/A N/A 160078 160097 GCACCTAATATATCTCCATT  40 410 1480836 N/A N/A 3294 3313 ACTCTTCGACCACCAAGGAA  73 411 1480982 2224 2243 116894 116913 ACCTTGAATTTCATCCTTCC  14 412 1480985 N/A N/A 63355 63374 AAGTCATCATCTCAGTGAAA  34 413 1481001 2986 3005 202222 202241 ATCCAAGATAACCAAGGACT 109 414 1481015 1623 1642 76940 76959 TTGGAGAGCATCTTTTCCAA  81 415 1481018 N/A N/A 96525 96544 CTGAAGAATCTTCTTGCCTA  44 416 1481094 N/A N/A 85050 85069 GCATTTCTAAATCCTGCCAA  40 417 1481100 N/A N/A 92494 92513 ATATCAGTCTAAGAAAGACC  65 418 1481112 N/A N/A 5765 5784 CCTGTAGTTATTTCATACTA  60 419 1481154 N/A N/A 19347 19366 CAAGTCTTTACTTCCCATCC  49 420 1481155 N/A N/A 23213 23232 AGGTACACTTCATCAGATAT  17 421 1481232  351  370 4444 4463 ACAGGCCCATCATTTTCCAA  21 422 1481247 N/A N/A 3347 3366 GGGCAGCTTTCTTCTAGTCA 101 423 1481260 N/A N/A 175850 175869 CCTTCATCATACCTACTACA  48 424 1481413 N/A N/A 29356 29375 CTCATATTACCATTTCTAGC   5 425 1481454 2026 2045 115982 116001 TATTGCTTGAAATTCTGACT   9 426 1481468 2590 2609 135639 135658 TTGCTTAGCGACCTTGGCCA 100 427 1481490 2747 2766 161595 161614 CGGTAATTATCATTACTCTC  26 428 1481536 1684 1703 89499 89518 TGTTGTTCCATTAATTGTCA  15 429 1481544 N/A N/A 221286 221305 CAGCATAATCACTCTGACCT 100 430 1481570 N/A N/A 20349 20368 AAGCTGACCTTATATCCTTT  65 431 1481590 N/A N/A 54572 54591 ACACAATCATCCTAACACAT  23 432 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433

TABLE-US-00011 TABLE 11 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479842 N/A N/A 170057 170076 CAGGTAATTAATATTAGCAA  15 434 1479853 N/A N/A 105967 105986 ACCACAAATTTCTCATCACT  28 435 1479868  850  869 18287 18306 TGCATCTTCCCCAAAGAATC  28 436 1479873 N/A N/A 92493 92512 TATCAGTCTAAGAAAGACCA  69 437 1479893 N/A N/A 158693 158712 GACTCAGTATTATAATGCTA  41 438 1479924 1802 1821 92574 92593 TCACCCACTTCTTTAACTTC  66 439 1479928 N/A N/A 36153 36172 AGGACATTCTTCCACATGTC  82 440 1479968 N/A N/A 46648 46667 GCTTTATACACCCTTTCTCT   7 441 1479985 N/A N/A 63348 63367 CATCTCAGTGAAACTTTCCC  42 442 1480009 N/A N/A 80433 80452 TTAAGCTATTTCTTTCACTA  45 443 1480029 N/A N/A 54477 54496 CCTGACATTATATTTGCCTT  13 444 1480038 N/A N/A 23148 23167 GAACATCTAACATTTGTTCC  53 445 1480058 N/A N/A 102641 102660 GCCAAGAATTATCTTAGCAT  57 446 1480091 1276 1295 26949 26968 GAAACTATCAAACACAACCT  17† 447 1480108 N/A N/A 202311 202330 TACCGGATACTTACATCTCT  59 448 1480134 4316 4335 224684 224703 ACCTTATTCCTTCTGTGCTC  16 449 1480142  688  707 18125 18144 ACTTGTATTTGATGATCCAA   3 450 1480186 N/A N/A 215612 215631 ATTCAACATTTATTCCACCC  22 451 1480226 2169 2188 116839 116858 AATAATTCAGTTTTATCCCC  19 452 1480254 2574 2593 135623 135642 GCCAGGGAGAAAATGCAGTC  55 453 1480265 1941 1960 109643 109662 CTACAGAGTCCCCTCTCTAT  39  40 1480272 N/A N/A 76019 76038 CAGCACACAGACTACTTGCT  71 454 1480275 N/A N/A 3165 3184 GCATAACCTTTGCCTATCTC  46 455 1480276 N/A N/A 140697 140716 TGTTTCAATTTACTAGGCAT  78 456 1480292 N/A N/A 63217 63236 GGTACTCAACCTATAAAGTA  35 457 1480323 N/A N/A 211049 211068 ACCCACTAGATTTCTTCACT  47 458 1480336 3444 3463 223812 223831 ATGTTGAACTCCTCTGTCCA  42 459 1480338 1056 1075 20807 20826 GCAGTCAATTTCCGGGAAAA   1 460 1480405 N/A N/A 130822 130841 CTGGTATTCAATCCTCTGAT  17 461 1480408 N/A N/A 122591 122610 TGTGATTACATACTACAGCT  13 462 1480443 N/A N/A 13709 13728 TGCCCATCATGATTTTCCAC  30 463 1480447 2701 2720 140810 140829 ATTTGGGACATATTGATCCT  85 464 1480462 2025 2044 115981 116000 ATTGCTTGAAATTCTGACTT   9 465 1480516 N/A N/A 3514 3533 CATCTATACCATCCTAAGAA  86 466 1480525 N/A N/A 221285 221304 AGCATAATCACTCTGACCTT  65 467 1480526 N/A N/A 70282 70301 TGCAGAACACTTTCTTGGTC  16 468 1480577 N/A N/A 29355 29374 TCATATTACCATTTCTAGCA   3 469 1480586 N/A N/A 72373 72392 TGCTCATTATATATTACTAC  49 470 1480612 N/A N/A 116997 117016 AGCTTGACATTACCTCCTGT  56 471 1480620 N/A N/A 142986 143005 GCTTAACATTTCCTTCATAC  20 472 1480641 1620 1639 76937 76956 GAGAGCATCTTTTCCAAGTT  30 473 1480648 3275 3294 221180 221199 CATTTAATCCATAACTCCTT  76 474 1480784  548  567 13252 13271 GAACTGCAAATCTCTCCTGC  12 475 1480787 N/A N/A 164218 164237 GCAGTTTCACATTTCTGTAT  46 476 1480865 3171 3190 212903 212922 TCCTCACTGACCAAGAATCC  53 477 1480880  350  369 4443 4462 CAGGCCCATCATTTTCCAAT  18 478 1480931 2849 2868 161697 161716 CAATTGTCGCTTCTTCTGCA  46 479 1480933 1125 1144 23000 23019 TTTACAGCATCATCCAGCTT  31 480 1480942 1683 1702 89498 89517 GTTGTTCCATTAATTGTCAT   7 481 1480966 2746 2765 161594 161613 GGTAATTATCATTACTCTCT  20 482 1481019 N/A N/A 96095 96114 CGTCATCCATTATTTGTTCT  68 483 1481067 N/A N/A 166761 166780 TCATCTCTATCCTACCAAAT  28 484 1481166 N/A N/A 3292 3311 TCTTCGACCACCAAGGAAAA 107 485 1481185 3787 3806 224155 224174 ATTTTTATATCACCCTCCAA  38 486 1481189 N/A N/A 13141 13160 TCAGACATTTCTTTGGCTCT   8 487 1481230 N/A N/A 119716 119735 ACAAGATCCACATACCATCA  24 488 1481238 2929 2948 202165 202184 CAGTTCTTCCATAAATGTAC  38 489 1481265 N/A N/A 3345 3364 GCAGCTTTCTTCTAGTCACC  33 490 1481286 N/A N/A 5762 5781 GTAGTTATTTCATACTAACA  31 491 1481289 N/A N/A 182170 182189 GCCAACACATTTTCTATTAC  54 492 1481308 N/A N/A 124694 124713 GTACTAATAAATATTCCACA  23 493 1481325 N/A N/A 38787 38806 CCGAACTGATTTCATGATCT  11 494 1481334 N/A N/A 20348 20367 AGCTGACCTTATATCCTTTT  59 495 1481338 1858 1877 109560 109579 TTCCGATACAGCATCAAGCC  43 496 1481351 2492 2511 126813 126832 GAAAATCAAGCCATTCAGCA  45 497 1481352 4388 4407 224756 224775 GACAAATAATTTCATCCAAC  18 498 1481388 3695 3714 224063 224082 GTGGAAGTCTATTCAAGAGT  27 499 1481389 N/A N/A 84421 84440 ATGTATTACATTTATTCGCT   7 500 1481392 N/A N/A 186394 186413 AGATCTTTATCCCTATGTAC  51 501 1481438 N/A N/A 200922 200941 CTGGTAACTACTTTCTCAGC  90 502 1481440 N/A N/A 138232 138251 GCTACACATTTTCCACTGTT  18 503 1481451 N/A N/A 3488 3507 TCCACCCAAACTGTATTTCA  50 504 1481507 N/A N/A 19316 19335 ACATGCTACCTCATCACTCT  95 505 1481529 1443 1462 73475 73494 ATGTTATCCATCCTTTCGAC  14 506 1481531 N/A N/A 111537 111556 ATATGCATCAATTTTCAGGC   8 507 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433 1481630 N/A N/A 175591 175610 ACAACTTACTCATTTAGTGC  19 508 1481632 N/A N/A 148080 148099 AGCATCAATCAATAAGATCT  80 509

TABLE-US-00012 TABLE 12 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479900 N/A N/A 211048 211067 CCCACTAGATTTCTTCACTA  54 510 1479925 N/A N/A 37565 37584 TCTCAAATTTTGCTTGGACT   3 511 1479955 2928 2947 202164 202183 AGTTCTTCCATAAATGTACT 115 512 1480005 N/A N/A 215611 215630 TTCAACATTTATTCCACCCC  49 513 1480033 1054 1073 20805 20824 AGTCAATTTCCGGGAAAAGA   3 514 1480067 N/A N/A 36106 36125 GCTAGTTTTTAACCAAGTAT  28 515 1480071 N/A N/A 200921 200940 TGGTAACTACTTTCTCAGCA  34 516 1480079 N/A N/A 70281 70300 GCAGAACACTTTCTTGGTCT   7 517 1480081 N/A N/A 118594 118613 TGGGTAACTTATCTAACTAC  28 518 1480083 N/A N/A 3253 3272 AAAGACGCACCCCTTGCCCA 143 519 1480104 3782 3801 224150 224169 TATATCACCCTCCAAAAGCT  76 520 1480119 N/A N/A 23128 23147 TCACCTGCAAAGTACTTACC 131† 521 1480136 N/A N/A 3485 3504 ACCCAAACTGTATTTCAGAC  53 522 1480167 2491 2510 126812 126831 AAAATCAAGCCATTCAGCAC 103  21 1480178 N/A N/A 3344 3363 CAGCTTTCTTCTAGTCACCC  61 523 1480188 N/A N/A 202309 202328 CCGGATACTTACATCTCTGA  64 524 1480193 N/A N/A 138201 138220 TTGCATCCAAATTCTTACTT  62 525 1480196 1800 1819 92572 92591 ACCCACTTCTTTAACTTCCG   8 526 1480209 2165 2184 116835 116854 ATTCAGTTTTATCCCCAACT  14 527 1480228 1990 2009 115946 115965 TTTGACAATCAAGAAGAACT  31 528 1480260 N/A N/A 142696 142715 TGGACAACTTTTTCCCAAAC  53 529 1480283 1938 1957 109640 109659 CAGAGTCCCCTCTCTATGTC  42 530 1480353 N/A N/A 164184 164203 AATGCTGATTTTCTCCACTA  26 531 1480354 1618 1637 76935 76954 GAGCATCTTTTCCAAGTTGA  33 532 1480360 N/A N/A 79806 79825 GCAACTGAATTTTTCATCTA  24 533 1480398 N/A N/A 105946 105965 CGGTTAGGTATAATTCCATC  11 534 1480403 3443 3462 223811 223830 TGTTGAACTCCTCTGTCCAC  40 535 1480415 N/A N/A 148079 148098 GCATCAATCAATAAGATCTT  90 536 1480515 N/A N/A 175467 175486 AGTACAAATACTCCACAGTC  45 537 1480560 N/A N/A 140442 140461 GTTTACCTTTACAAGATCTT  49 538 1480570 3644 3663 224012 224031 ACTTGAAAAAGACTGTCTTC  81 539 1480588 N/A N/A 72372 72391 GCTCATTATATATTACTACA  55 540 1480645  546  565 13250 13269 ACTGCAAATCTCTCCTGCAG  98 541 1480663 1123 1142 22998 23017 TACAGCATCATCCAGCTTGA  13 542 1480709 N/A N/A 124658 124677 GCTGTATATACTTCCCTAAT  14 543 1480727 N/A N/A 95119 95138 GCATCCCTTACACTGTTGTC  54 544 1480734 N/A N/A 63215 63234 TACTCAACCTATAAAGTAGT  68 545 1480811 1854 1873 109556 109575 GATACAGCATCAAGCCGGGC  47 546 1480819 3170 3189 212902 212921 CCTCACTGACCAAGAATCCC  69 547 1480895 4384 4403 224752 224771 AATAATTTCATCCAACAATC  84 548 1480896 2697 2716 140806 140825 GGGACATATTGATCCTGTTC  59 549 1480901 2745 2764 161593 161612 GTAATTATCATTACTCTCTC  40 550 1480908 N/A N/A 116996 117015 GCTTGACATTACCTCCTGTC  84 551 1480913 3937 3956 224305 224324 GGCCAATTCTTTCTACTTAT 144 552 1480932  438  457 13142 13161 CTCAGACATTTCTTTGGCTC   6 553 1480947 N/A N/A 181922 181941 ATAACATCTTATACCTGGCT  38 554 1481031 N/A N/A 75985 76004 CCAAGCACTCTCCTACTTAA  44 555 1481035 N/A N/A 13706 13725 CCATCATGATTTTCCACGGT  11 556 1481046 N/A N/A 29042 29061 TTGATATTACCATTTCTAGC   2 557 1481051 N/A N/A 122590 122609 GTGATTACATACTACAGCTT  18 558 1481138 N/A N/A 63347 63366 ATCTCAGTGAAACTTTCCCC  25 559 1481144 1442 1461 73474 73493 TGTTATCCATCCTTTCGACT  18 560 1481147 N/A N/A 3164 3183 CATAACCTTTGCCTATCTCC  59 561 1481161 1676 1695 89491 89510 CATTAATTGTCATAAATTCC  20 562 1481201 N/A N/A 54259 54278 CCACAAGTTCATTAACAAGC   8 563 1481203 N/A N/A 169791 169810 GGAGAATTAACTTATCCCTC  84 564 1481214 N/A N/A 158649 158668 GCACAATGACATACATATCT  44 565 1481236 N/A N/A 186393 186412 GATCTTTATCCCTATGTACA  59 566 1481237 N/A N/A 221284 221303 GCATAATCACTCTGACCTTT  60 567 1481241 N/A N/A 130680 130699 CTCTAGCTAAATTTCAGCCA  62 568 1481259 N/A N/A 20347 20366 GCTGACCTTATATCCTTTTG  27 569 1481278 N/A N/A 46517 46536 TGGCATTCATTCTTCCAGTC  31 570 1481315  849  868 18286 18305 GCATCTTCCCCAAAGAATCT  41 571 1481320 2846 2865 161694 161713 TTGTCGCTTCTTCTGCAGGA  26 572 1481329 N/A N/A 111535 111554 ATGCATCAATTTTCAGGCTC  39 573 1481342 3273 3292 221178 221197 TTTAATCCATAACTCCTTGC 105 574 1481373 N/A N/A 92407 92426 AATGTCATATATACCTAGCA  53 575 1481376 N/A N/A 19274 19293 CCCAAACTATAGAATCATCA  55 576 1481402  686  705 18123 18142 TTGTATTTGATGATCCAAAC   9 577 1481455 N/A N/A 102575 102594 AAGGTATTACTCATTTGCTC  23 578 1481460 N/A N/A 3513 3532 ATCTATACCATCCTAAGAAA  92 579 1481524 N/A N/A 12938 12957 AGATGCAATTTCACTCATTC  44 580 1481526 2563 2582 135612 135631 AATGCAGTCAACAGTTGCTA  91 581 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433 1481596 N/A N/A 166750 166769 CTACCAAATTTCCCTATCCA  87 582 1481601  347  366 4440 4459 GCCCATCATTTTCCAATGGT  67 583 1481628 1275 1294 26948 26967 AAACTATCAAACACAACCTC  43† 584 1481649 N/A N/A 84346 84365 TCTGTCTTAAATCCTATCAC  72 585

TABLE-US-00013 TABLE 13 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479822 N/A N/A 181921 181940 TAACATCTTATACCTGGCTT  47 586 1479910 N/A N/A 92406 92425 ATGTCATATATACCTAGCAC  25 587 1479936  545  564 13249 13268 CTGCAAATCTCTCCTGCAGA  57 588 1479951 3355 3374 221260 221279 ATTTATTAATCCTTCCAGCT  42 589 1479961 N/A N/A 215610 215629 TCAACATTTATTCCACCCCT  47 590 1479980 N/A N/A 147867 147886 AGTTCTTACAACAATGTCAC  41 591 1479986 N/A N/A 122242 122261 GTGAGATAATATCTCCTGTC  40 592 1479994 2542 2561 135591 135610 GTGATGCACTGCTTTACACA  39 593 1480031 N/A N/A 3163 3182 ATAACCTTTGCCTATCTCCT  94 594 1480036 N/A N/A 13705 13724 CATCATGATTTTCCACGGTA  37 595 1480049 N/A N/A 118413 118432 AGCATAGCACTTTATGATTA  12 596 1480080 N/A N/A 116995 117014 CTTGACATTACCTCCTGTCC  75 597 1480110 N/A N/A 202308 202327 CGGATACTTACATCTCTGAT  94 598 1480172 1273 1292 26946 26965 ACTATCAAACACAACCTCGC  10† 599 1480206 N/A N/A 79677 79696 CCACTCATGAACACCACATT  29 600 1480277 3441 3460 223809 223828 TTGAACTCCTCTGTCCACTT  46 601 1480278 N/A N/A 63346 63365 TCTCAGTGAAACTTTCCCCG  64 602 1480295 346 365 4439 4458 CCCATCATTTTCCAATGGTC  36 603 1480302 N/A N/A 175466 175485 GTACAAATACTCCACAGTCA  19 604 1480306 1852 1871 109554 109573 TACAGCATCAAGCCGGGCAT  27 605 1480328 N/A N/A 138165 138184 TGAACAATCCTATACACATC  73 606 1480345 2844 2863 161692 161711 GTCGCTTCTTCTGCAGGAAC  26 607 1480352 N/A N/A 75930 75949 ACTGTTCCTTCATATGTCTA  50 608 1480369 N/A N/A 36000 36019 GACAAATTATAACTACACAT  20 609 1480448 N/A N/A 3484 3503 CCCAAACTGTATTTCAGACT  41 610 1480467  684  703 18121 18140 GTATTTGATGATCCAAACTG   6 611 1480500 N/A N/A 140055 140074 ACCTAAAATTTTCATACGCT  23 612 1480507 N/A N/A 186127 186146 TTGCTTTGAACCATCAGACT  55 613 1480536 N/A N/A 37553 37572 CTTGGACTTTATTCCTGTTA   2 614 1480650 N/A N/A 94996 95015 TCATCAGTTTCCCATGTCTT  27 615 1480670 N/A N/A 164183 164202 ATGCTGATTTTCTCCACTAC  27 616 1480700 2927 2946 202163 202182 GTTCTTCCATAAATGTACTC  45 617 1480762  848  867 18285 18304 CATCTTCCCCAAAGAATCTA  82 618 1480770 1799 1818 92571 92590 CCCACTTCTTTAACTTCCGT  10 619 1480781 N/A N/A 123750 123769 TTTAAACCTACCTTCCAACC 112 620 1480854 N/A N/A 23126 23145 ACCTGCAAAGTACTTACCAC 794 621 1480855 1989 2008 115945 115964 TTGACAATCAAGAAGAACTC  37 622 1480875 N/A N/A 69644 69663 TGTACTACACTATAACTGCA  95 623 1480885 1122 1141 22997 23016 ACAGCATCATCCAGCTTGAT  16 624 1480915 4380 4399 224748 224767 ATTTCATCCAACAATCTTTA  45 625 1480922 3781 3800 224149 224168 ATATCACCCTCCAAAAGCTT  44 626 1480923 1907 1926 109609 109628 GTAGATGATTTTCTATCTGA  14 627 1480936 N/A N/A 102464 102483 AGTAGATTATACCTTGACCA  16 628 1480946 N/A N/A 3512 3531 TCTATACCATCCTAAGAAAC  86 629 1480961 N/A N/A 200854 200873 ACACATACTTCACATTTGAC  64 630 1480979 N/A N/A 20346 20365 CTGACCTTATATCCTTTTGC  14 631 1480992 N/A N/A 105942 105961 TAGGTATAATTCCATCTTCA  34 632 1481032 N/A N/A 45728 45747 CATCTATATTTCTCTACATC  25 633 1481037 3270 3289 221175 221194 AATCCATAACTCCTTGCTGC  28 634 1481045 N/A N/A 211047 211066 CCACTAGATTTCTTCACTAT  56 635 1481069 1673 1692 89488 89507 TAATTGTCATAAATTCCATT  16 636 1481105 2490 2509 126811 126830 AAATCAAGCCATTCAGCACT  61 637 1481132 N/A N/A 111355 111374 CCAACTCATATATCTTTCTC  23 638 1481162 2742 2761 161590 161609 ATTATCATTACTCTCTCTGA  30 639 1481204 N/A N/A 166749 166768 TACCAAATTTCCCTATCCAT 105 640 1481239 N/A N/A 3252 3271 AAGACGCACCCCTTGCCCAC 118 641 1481267 N/A N/A 116834 116853 TTCAGTTTTATCCCCAACTC  14 642 1481303 N/A N/A 72261 72280 GCTACAACTCCTTCTTTTTA  74 643 1481327 1617 1636 76934 76953 AGCATCTTTTCCAAGTTGAA  46 644 1481377 N/A N/A 53557 53576 GGCAAACTAATACATTCCAC  21 645 1481390 3936 3955 224304 224323 GCCAATTCTTTCTACTTATA  45 646 1481409 1026 1045 20777 20796 CTGTTGTCTCCAATGGCCTT  31 647 1481416 N/A N/A 19255 19274 ACAAGCATTCATGACTTCCA  26 648 1481424 N/A N/A 3342 3361 GCTTTCTTCTAGTCACCCAA  32 649 1481433 1441 1460 73473 73492 GTTATCCATCCTTTCGACTC  15 650 1481462 N/A N/A 63213 63232 CTCAACCTATAAAGTAGTGC  23 651 1481482 N/A N/A 12937 12956 GATGCAATTTCACTCATTCC  15 652 1481486 N/A N/A 29001 29020 ACATTCATACCTTCTGATCC  50 653 1481519 3169 3188 212901 212920 CTCACTGACCAAGAATCCCA  66 654 1481527 3633 3652 224001 224020 ACTGTCTTCAGAAAAACCTC  66 655 1481534 N/A N/A 4530 4549 GAATCCCCCACAACTCACCA 110 656 1481538 2694 2713 140803 140822 ACATATTGATCCTGTTCTCC  53 657 1481562 N/A N/A 169656 169675 GTGCTTCTATAAACATGACC  25 658 1481569 N/A N/A 130664 130683 GCCAATATTCTTTTTCTGGA  17 659 1481573 N/A N/A 142693 142712 ACAACTTTTTCCCAAACTCT  47 660 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433 1481613 N/A N/A 158644 158663 ATGACATACATATCTAACCA  65 661 1481635 N/A N/A 84345 84364 CTGTCTTAAATCCTATCACC  70 662

TABLE-US-00014 TABLE 14 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479804 N/A N/A 116994 117013 TTGACATTACCTCCTGTCCT  90 663 1479860 3269 3288 221174 221193 ATCCATAACTCCTTGCTGCA  44 664 1479883 N/A N/A 123749 123768 TTAAACCTACCTTCCAACCT  65 665 1479886 N/A N/A 175384 175403 TGTCTATTATCTTCCAATTC 102 666 1479952 N/A N/A 118339 118358 GAGGTAACTCTTCCATGGTC  14 667 1479960 N/A N/A 3250 3269 GACGCACCCCTTGCCCACAA  96 668 1479979 N/A N/A 69641 69660 ACTACACTATAACTGCATCT  46 669 1480002 4377 4396 224745 224764 TCATCCAACAATCTTTAAAC  27 670 1480028 N/A N/A 101139 101158 GTCTCATTTTCACCTGATTA  29 671 1480035 N/A N/A 200853 200872 CACATACTTCACATTTGACC  40 672 1480060 1437 1456 73469 73488 TCCATCCTTTCGACTCGAAT   9 673 1480066 N/A N/A 84344 84363 TGTCTTAAATCCTATCACCT  53 674 1480086 2690 2709 140799 140818 ATTGATCCTGTTCTCCCAGC  15 675 1480094 2924 2943 202160 202179 CTTCCATAAATGTACTCTGT  50 676 1480101 2740 2759 161588 161607 TATCATTACTCTCTCTGAGT  60 677 1480124 N/A N/A 12936 12955 ATGCAATTTCACTCATTCCT  13 678 1480127 N/A N/A 45614 45633 ACATTGCCTTTACAATTGCT   9 679 1480128 N/A N/A 53361 53380 ACAGTCAATTCTTACAAGCA  18 680 1480138 1272 1291 26945 26964 CTATCAAACACAACCTCGCC  12† 681 1480145 3861 3880 224229 224248 TCAATGGATAGATTCCTGCC  31 682 1480162 N/A N/A 35954 35973 AGCTCTTTAATTCCTCCCCT  18 683 1480181 N/A N/A 4528 4547 ATCCCCCACAACTCACCAGA  82 684 1480221 N/A N/A 115926 115945 CTTGGGTAGAACACTGAAAA  54 685 1480449 2538 2557 135587 135606 TGCACTGCTTTACACAAGGA   9 686 1480486 N/A N/A 215609 215628 CAACATTTATTCCACCCCTA  33 687 1480489  682  701 18119 18138 ATTTGATGATCCAAACTGAC  12 688 1480528 N/A N/A 211037 211056 TCTTCACTATACCTTTTCCC  29 689 1480551 N/A N/A 37552 37571 TTGGACTTTATTCCTGTTAA   2 690 1480555 N/A N/A 3162 3181 TAACCTTTGCCTATCTCCTC  62 691 1480559 1843 1862 109545 109564 AAGCCGGGCATTTATTTCCC  37 692 1480576 N/A N/A 130313 130332 ATGCTACCATCCTTTTCATT  32 693 1480587 1798 1817 92570 92589 CCACTTCTTTAACTTCCGTC   8 694 1480592  536  555 13240 13259 TCTCCTGCAGAGATTCTGTC 110  42 1480615 N/A N/A 169655 169674 TGCTTCTATAAACATGACCT  36 695 1480643 N/A N/A 13404 13423 ACAGTACTTCAGAACCCACT  53 696 1480651 N/A N/A 163587 163606 GCAGCAGCAATCTTACAACT  27 697 1480657 N/A N/A 105641 105660 TTGATCTTACTATACAACTT  37 698 1480706 N/A N/A 122142 122161 AGTGAAGTTCTATCACACCA  15 699 1480718 N/A N/A 116833 116852 TCAGTTTTATCCCCAACTCT  27 700 1480747 1906 1925 109608 109627 TAGATGATTTTCTATCTGAC  21 701 1480804 N/A N/A 3476 3495 GTATTTCAGACTTTATAATC  61 702 1480812 3439 3458 223807 223826 GAACTCCTCTGTCCACTTCT  40 703 1480927 N/A N/A 158256 158275 GCAGAATACTAAGATAAGCT  37 704 1480969 3780 3799 224148 224167 TATCACCCTCCAAAAGCTTG  39 705 1481004  345  364 4438 4457 CCATCATTTTCCAATGGTCT   8 706 1481026 1120 1139 22995 23014 AGCATCATCCAGCTTGATTA  13 707 1481038 N/A N/A 29000 29019 CATTCATACCTTCTGATCCA  25 708 1481041 N/A N/A 186120 186139 GAACCATCAGACTATGGCAA  85 709 1481060 N/A N/A 72092 72111 CCTGCACATATCCCTCACTA  75 710 1481086 N/A N/A 181920 181939 AACATCTTATACCTGGCTTT  46 711 1481124 N/A N/A 111354 111373 CAACTCATATATCTTTCTCC  26 712 1481125 3168 3187 212900 212919 TCACTGACCAAGAATCCCAT  45 713 1481127 N/A N/A 3340 3359 TTTCTTCTAGTCACCCAATC  88 714 1481137 N/A N/A 63024 63043 TCCAAAGGCTTTATCTGTTC   4 715 1481141 N/A N/A 138161 138180 CAATCCTATACACATCTCCA  32 716 1481152 N/A N/A 20345 20364 TGACCTTATATCCTTTTGCC   7 717 1481157 3354 3373 221259 221278 TTTATTAATCCTTCCAGCTC  60 718 1481171 N/A N/A 147789 147808 GCTAAATATCTTTCCCAGCA  51 719 1481199 2487 2506 126808 126827 TCAAGCCATTCAGCACTGCA  34 720 1481209 N/A N/A 79676 79695 CACTCATGAACACCACATTT  46 721 1481219 N/A N/A 92405 92424 TGTCATATATACCTAGCACA  41 722 1481240 N/A N/A 94921 94940 TTGGTAATTATCATCATCCA  26 723 1481275 N/A N/A 19253 19272 AAGCATTCATGACTTCCAAC  13 724 1481282 2835 2854 161683 161702 TCTGCAGGAACATAGGAGCC  62 725 1481285 N/A N/A 75922 75941 TTCATATGTCTATATGGCTC  45 726 1481301 N/A N/A 202306 202325 GATACTTACATCTCTGATGA  86 727 1481331 1616 1635 76933 76952 GCATCTTTTCCAAGTTGAAT  24 728 1481332 N/A N/A 3511 3530 CTATACCATCCTAAGAAACT  72 729 1481361 N/A N/A 141811 141830 CTTCACTATTTTTACCCAGC  24 730 1481363 1017 1036 20768 20787 CCAATGGCCTTTAATGCTGC  16 731 1481411 N/A N/A 140028 140047 TAAAACATCTTTCTACGGTC  31 732 1481423  847  866 18284 18303 ATCTTCCCCAAAGAATCTAT  99 733 1481483 3632 3651 224000 224019 CTGTCTTCAGAAAAACCTCT  43 734 1481514 N/A N/A 166636 166655 TCATAACCATTGCATTGCAC  15 735 1481555 N/A N/A 63345 63364 CTCAGTGAAACTTTCCCCGA  56 736 1481556 N/A N/A 23118 23137 AGTACTTACCACAATGCCAA 107† 737 1481558 1668 1687 89483 89502 GTCATAAATTCCATTTTACT   6 738 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433

TABLE-US-00015 TABLE 15 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479819 N/A N/A 211036 211055 CTTCACTATACCTTTTCCCT  21 739 1479834 N/A N/A 35953 35972 GCTCTTTAATTCCTCCCCTT  20 740 1479851 N/A N/A 123748 123767 TAAACCTACCTTCCAACCTT  64 741 1479865 N/A N/A 3161 3180 AACCTTTGCCTATCTCCTCA  43 742 1479867 N/A N/A 200852 200871 ACATACTTCACATTTGACCT  39 743 1479889 N/A N/A 118297 118316 TTGGCACTTACACTTACTTT   7 744 1479894 3631 3650 223999 224018 TGTCTTCAGAAAAACCTCTC  56 745 1479908 N/A N/A 116832 116851 CAGTTTTATCCCCAACTCTA  14 746 1479946 N/A N/A 3247 3266 GCACCCCTTGCCCACAAGCC  51 747 1479949 1016 1035 20767 20786 CAATGGCCTTTAATGCTGCA  13 748 1479954 N/A N/A 4408 4427 CTGTCAATTTCTGTAGCCTA  13 749 1480046 N/A N/A 72091 72110 CTGCACATATCCCTCACTAA  17 750 1480062 3166 3185 212898 212917 ACTGACCAAGAATCCCATGT  35 751 1480064 3353 3372 221258 221277 TTATTAATCCTTCCAGCTCT 117 752 1480093 N/A N/A 20344 20363 GACCTTATATCCTTTTGCCA  10 753 1480116 N/A N/A 13374 13393 ACTGGATACTCATCTATAGC  65 754 1480141 N/A N/A 62712 62731 TGGTTACTCAATTACAGTTC   5 755 1480180 N/A N/A 157408 157427 ACTTATTGTTCAATTTGGCT  38 756 1480199 N/A N/A 3510 3529 TATACCATCCTAAGAAACTT  77 757 1480200 N/A N/A 111353 111372 AACTCATATATCTTTCTCCC  19 758 1480203 3432 3451 223800 223819 TCTGTCCACTTCTGCAGGTC  49 759 1480220 1905 1924 109607 109626 AGATGATTTTCTATCTGACC   7 760 1480231 1661 1680 89476 89495 ATTCCATTTTACTTGATAGC  13 761 1480236 2482 2501 126803 126822 CCATTCAGCACTGCAGTCAA  52 762 1480274 N/A N/A 130311 130330 GCTACCATCCTTTTCATTCC  14 763 1480294 N/A N/A 122139 122158 GAAGTTCTATCACACCATTC   6 764 1480409 2922 2941 202158 202177 TCCATAAATGTACTCTGTCC  38 765 1480422 1797 1816 92569 92588 CACTTCTTTAACTTCCGTCT   9 766 1480446 N/A N/A 169633 169652 AGGTTGATAAACTAACAGCT  52 767 1480505 N/A N/A 94920 94939 TGGTAATTATCATCATCCAA  33 768 1480558 N/A N/A 22974 22993 GGGATTCACATTTAATAATA  23 769 1480590 N/A N/A 115370 115389 GCTTCACAATAACCATGTAA  22 770 1480626 N/A N/A 141809 141828 TCACTATTTTTACCCAGCTT  26 771 1480680 N/A N/A 68971 68990 GTAAAAGTATTCTTCCACAT  10 772 1480687 N/A N/A 215177 215196 TGGGATTATATATACTGCAT  28 773 1480688 1436 1455 73468 73487 CCATCCTTTCGACTCGAATT   7 774 1480728 N/A N/A 3339 3358 TTCTTCTAGTCACCCAATCC  51 775 1480731 N/A N/A 92205 92224 ATTGCATACTTTCCTACCTT  20 776 1480735 2689 2708 140798 140817 TTGATCCTGTTCTCCCAGCA  14 777 1480741 N/A N/A 63344 63363 TCAGTGAAACTTTCCCCGAT  58 778 1480748 1606 1625 76923 76942 CAAGTTGAATTCTTTGAGGT  14 779 1480755 N/A N/A 181866 181885 CAGAGTCTTTGATACCATTC  38 780 1480759 N/A N/A 28433 28452 TTCAACTTATGAATTTATCC   4 781 1480766  530  549 13234 13253 GCAGAGATTCTGTCTGGACT  14 782 1480778 3776 3795 224144 224163 ACCCTCCAAAAGCTTGGGAA  50 783 1480822 N/A N/A 19225 19244 CATCTGCAATACTTTCCCTA  61 784 1480829 N/A N/A 109542 109561 CCGGGCATTTATTTCCCTGT  52 785 1480832 N/A N/A 37130 37149 CTTGACCCATATTTTCCTAA  42 786 1480907 2537 2556 135586 135605 GCACTGCTTTACACAAGGAG  15 787 1480919 N/A N/A 105134 105153 CCTGCAACAAATATCTCATA  41 788 1480976 N/A N/A 12934 12953 GCAATTTCACTCATTCCTGA  13 789 1480996 N/A N/A 185190 185209 CTTCACTTTTACTAACAGCT  68 790 1481029 3860 3879 224228 224247 CAATGGATAGATTCCTGCCA  30 791 1481047 N/A N/A 147276 147295 TTGCACTTTTAACCCAAGGT  22 792 1481107 N/A N/A 53050 53069 TGCTTGCTACTCTATAAAAC  58 793 1481133 N/A N/A 175238 175257 ATATCTCTTTTCATCAACGC  18 794 1481140 2826 2845 161674 161693 ACATAGGAGCCAATCTGAGC  24  38 1481145 N/A N/A 79633 79652 CCAGTTTGATCACTATCTTT  11 795 1481164 N/A N/A 116991 117010 ACATTACCTCCTGTCCTGAT  39 796 1481173 N/A N/A 75434 75453 ACTTTCTTGCAATAAGCATT  50 797 1481175 N/A N/A 140027 140046 AAAACATCTTTCTACGGTCT  21 798 1481208 3063 3082 202299 202318 ACATCTCTGATGAAATACTC  34 799 1481210 N/A N/A 3471 3490 TCAGACTTTATAATCTAAAC  73 800 1481223  681  700 18118 18137 TTTGATGATCCAAACTGACT  30 801 1481229 N/A N/A 166577 166596 GTATCATTAGATACCCTGTC  39 802 1481270 1271 1290 26944 26963 TATCAAACACAACCTCGCCT   5† 803 1481277 N/A N/A 4526 4545 CCCCCACAACTCACCAGAGT  54 804 1481374 N/A N/A 45594 45613 CCAACATGTTTCCTTAACTT   7 805 1481399 4376 4395 224744 224763 CATCCAACAATCTTTAAACT  63 806 1481403  842  861 18279 18298 CCCCAAAGAATCTATACTTA  60 807 1481446 N/A N/A 84343 84362 GTCTTAAATCCTATCACCTC  21 808 1481532 N/A N/A 100780 100799 TCCAATATATAACCAGACAA  20 809 1481550 3267 3286 221172 221191 CCATAACTCCTTGCTGCAAT  21 810 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433 1481594 N/A N/A 138044 138063 AGTAGATATACCAATCTACT 111 811 1481612 N/A N/A 23117 23136 GTACTTACCACAATGCCAAT  52† 812 1481622 N/A N/A 163448 163467 ACATTCTTGCTATTCGGCTC  24 813 1481645 2739 2758 161587 161606 ATCATTACTCTCTCTGAGTC  31 814

TABLE-US-00016 TABLE 16 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479825 1904 1923 109606 109625 GATGATTTTCTATCTGACCA  21 815 1479847 N/A N/A 22698 22717 TGGTTCATTTCACACAGTAC  10 816 1479876 N/A N/A 109540 109559 GGGCATTTATTTCCCTGTGA  23 817 1479885 N/A N/A 115329 115348 GACACTTTTATATACTCTTA  13 818 1479927 2738 2757 161586 161605 TCATTACTCTCTCTGAGTCC  27 819 1479947  679  698 18116 18135 TGATGATCCAAACTGACTGA  17 820 1479991 1002 1021 20753 20772 GCTGCAGTTTCAGTTTGCTT  79 821 1480027 N/A N/A 68916 68935 CTACCACTTACACTTACAGT  59 822 1480043 4374 4393 224742 224761 TCCAACAATCTTTAAACTGC  31 823 1480074 N/A N/A 200845 200864 TCACATTTGACCTACAGCAC  56 824 1480102 N/A N/A 19222 19241 CTGCAATACTTTCCCTAAGT  27 825 1480130 N/A N/A 94912 94931 ATCATCATCCAAACCATGTC  39 826 1480144 2921 2940 202157 202176 CCATAAATGTACTCTGTCCT  42 827 1480156 N/A N/A 3241 3260 CTTGCCCACAAGCCCCCTCA  75 828 1480175 N/A N/A 3509 3528 ATACCATCCTAAGAAACTTT  84 829 1480227 N/A N/A 3470 3489 CAGACTTTATAATCTAAACT  99 830 1480233 1435 1454 73467 73486 CATCCTTTCGACTCGAATTC  45 831 1480235 3163 3182 212895 212914 GACCAAGAATCCCATGTGGT  62 832 1480256 N/A N/A 12013 12032 ACACAGTATTTCACCGTTTA  26 833 1480298 N/A N/A 146528 146547 GCTCAGACATATTTTATGGT  44 834 1480315 N/A N/A 111352 111371 ACTCATATATCTTTCTCCCC  29 835 1480324 N/A N/A 79626 79645 GATCACTATCTTTATTAATC  26 836 1480330 N/A N/A 118296 118315 TGGCACTTACACTTACTTTC  11 837 1480333 N/A N/A 13373 13392 CTGGATACTCATCTATAGCA  72 838 1480350 N/A N/A 213788 213807 CCATCCCTATTACTTTTCCA  33 839 1480375 N/A N/A 4525 4544 CCCCACAACTCACCAGAGTT 182 840 1480388 3628 3647 223996 224015 CTTCAGAAAAACCTCTCTGT  89 841 1480410 2825 2844 161673 161692 CATAGGAGCCAATCTGAGCC  30 842 1480436 N/A N/A 83723 83742 TTTCTAACTTCATACATCTC  72 843 1480472 N/A N/A 45547 45566 ACTGACATATTTGTAAGGAC   3 844 1480501 N/A N/A 27774 27793 TAGCACTTAATACATCATGC   3 845 1480563  518  537 13222 13241 TCTGGACTCTACTTTGAGGA  19 846 1480619 1581 1600 76898 76917 ATGATGGCAGCCAAAGAGCA  33 847 1480638 N/A N/A 169449 169468 TCAGACTAATGATAACTTCC  25 848 1480679 N/A N/A 63343 63362 CAGTGAAACTTTCCCCGATC  24 849 1480691 N/A N/A 122138 122157 AAGTTCTATCACACCATTCA  15 850 1480704 N/A N/A 116990 117009 CATTACCTCCTGTCCTGATA  79 851 1480712 N/A N/A 185104 185123 ACAATGTTTTACTAATGCCT  30 852 1480719 N/A N/A 35921 35940 TTGCTCCTATTCCCAACTAT  30 853 1480724 N/A N/A 138037 138056 ATACCAATCTACTTTCCTAC  49 854 1480753 N/A N/A 166336 166355 CCTATAGTTTCCCACAGTCT  56 855 1480763 N/A N/A 100667 100686 GAGGAACCACACTAATCCTT  85 856 1480776 3062 3081 202298 202317 CATCTCTGATGAAATACTCA  75 857 1480820  841  860 18278 18297 CCCAAAGAATCTATACTTAT 100 858 1480851 N/A N/A 62626 62645 TTGTCACTTATCCTTGAGGC  20 859 1480857 N/A N/A 23115 23134 ACTTACCACAATGCCAATAA  46† 860 1480921 2688 2707 140797 140816 TGATCCTGTTCTCCCAGCAA  28 861 1480928 1796 1815 92568 92587 ACTTCTTTAACTTCCGTCTC  21 862 1480937 2517 2536 135566 135585 TGATAATGTTCACTGAATTT  29 863 1480972 N/A N/A 3155 3174 TGCCTATCTCCTCAAACGGA  87 864 1480983 N/A N/A 130310 130329 CTACCATCCTTTTCATTCCT  26 865 1481021 N/A N/A 210824 210843 GTTTCACTTTTCCCCACTCA  31 866 1481077 N/A N/A 116831 116850 AGTTTTATCCCCAACTCTAA  53 867 1481078 N/A N/A 141808 141827 CACTATTTTTACCCAGCTTC  51 868 1481080 3858 3877 224226 224245 ATGGATAGATTCCTGCCAGA  87 869 1481083 N/A N/A 174970 174989 AGTACACATATCATAATGCA  32 870 1481092 N/A N/A 155466 155485 CCATCACTATGACCTCTGTC  79 871 1481111 N/A N/A 105133 105152 CTGCAACAAATATCTCATAT  36 872 1481129 N/A N/A 4400 4419 TTCTGTAGCCTATATCGGGA 162 873 1481178 3262 3281 221167 221186 ACTCCTTGCTGCAATTCCTC  43 874 1481191 N/A N/A 92132 92151 CCATTTTATAAACCAATGCT  61 875 1481197 N/A N/A 75303 75322 TGCTAACAACACCTTTCCGT  73 876 1481198  972  991 20343 20362 ACCTTATATCCTTTTGCCAC  14 877 1481207 1649 1668 89464 89483 TTGATAGCTGTTTAAAATTC  45 878 1481213 N/A N/A 163425 163444 AACAAGATTTCCTTCCAGGC  32 879 1481218 3347 3366 221252 221271 ATCCTTCCAGCTCTTTTGAC  92 880 1481228 3765 3784 224133 224152 GCTTGGGAATTATATTCTGC  52 881 1481266 N/A N/A 123747 123766 AAACCTACCTTCCAACCTTT  83 882 1481268 N/A N/A 140005 140024 TGTATCTTTTACTTTGATAC 146 883 1481344 N/A N/A 53031 53050 CGTTCTATCAACATATACTT  39 884 1481378 1266 1285 26939 26958 AACACAACCTCGCCTGTGGC  11† 885 1481379 N/A N/A 3338 3357 TCTTCTAGTCACCCAATCCA 151 886 1481492 N/A N/A 180847 180866 GAGGACTTTTCATATTGAAT  27 887 1481494 N/A N/A 37129 37148 TTGACCCATATTTTCCTAAC 106 888 1481563 2468 2487 126789 126808 AGTCAAGGACTAGCTGCTCC  39 889 1481589 3431 3450 223799 223818 CTGTCCACTTCTGCAGGTCT  53 890 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   4 433 1481616 N/A N/A 72090 72109 TGCACATATCCCTCACTAAT  45 891

TABLE-US-00017 TABLE 17 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1231144 2464 2483 126785 126804 AAGGACTAGCTGCTCCCGGA  54 892 1231184 3162 3181 212894 212913 ACCAAGAATCCCATGTGGTA  78 893 1479821 2824 2843 161672 161691 ATAGGAGCCAATCTGAGCCA  32 894 1479829 N/A N/A 63342 63361 AGTGAAACTTTCCCCGATCA  29 895 1479938 N/A N/A 61115 61134 GCATGATCTATACCGACTTT   4 896 1479981 2737 2756 161585 161604 CATTACTCTCTCTGAGTCCT  17 897 1480061 N/A N/A 184969 184988 GACAACAATTTATCCTTGCC  44 898 1480063 N/A N/A 135561 135580 ATGTTCACTGAATTTCCTAC  32 899 1480077  677  696 18114 18133 ATGATCCAAACTGACTGAGA  17 900 1480092 N/A N/A 35903 35922 ATTGGCATTCTCTAAGCTCC  21 901 1480111 3626 3645 223994 224013 TCAGAAAAACCTCTCTGTTT  86 902 1480125 2915 2934 202151 202170 ATGTACTCTGTCCTTTATAT  44 903 1480157 N/A N/A 4523 4542 CCACAACTCACCAGAGTTGC 103 904 1480189 N/A N/A 138036 138055 TACCAATCTACTTTCCTACA 100 905 1480224 N/A N/A 122130 122149 TCACACCATTCATTTTTAGC  16 906 1480230 N/A N/A 213722 213741 TGCAGCATACCAATTGCGCA 148 907 1480271 N/A N/A 3468 3487 GACTTTATAATCTAAACTAC  97 908 1480325 N/A N/A 165870 165889 TTGTCACAAACTTTTACCTA  29 909 1480327 N/A N/A 72080 72099 CCTCACTAATCACATCCCTC  68 910 1480335 N/A N/A 169029 169048 TAAGTATCATGATTATCCCA  36 911 1480392 N/A N/A 65908 65927 TCTGTTTTATCTCATAAGCA  14 912 1480397 N/A N/A 154836 154855 GGGACATATTCATATGTTCA  78 913 1480406 N/A N/A 116623 116642 GCTTTTTAACTTCATGATTC  14 914 1480445 N/A N/A 83717 83736 ACTTCATACATCTCGCTCTT  44 915 1480452 N/A N/A 37128 37147 TGACCCATATTTTCCTAACA  55 916 1480493 N/A N/A 3336 3355 TTCTAGTCACCCAATCCAGC  62 917 1480502 1432 1451 73464 73483 CCTTTCGACTCGAATTCTGT  25 918 1480513 1903 1922 109605 109624 ATGATTTTCTATCTGACCAA  15 919 1480518 2687 2706 140796 140815 GATCCTGTTCTCCCAGCAAC  27 920 1480522 N/A N/A 11947 11966 CTGCACACATTTATCACCTC  32 921 1480539 N/A N/A 146396 146415 CAGCTAGACATTATTTGTAC  41 922 1480541  517  536 13221 13240 CTGGACTCTACTTTGAGGAA  10 923 1480596 N/A N/A 100664 100683 GAACCACACTAATCCTTTTA  59 924 1480597 N/A N/A 130197 130216 TCACCAGTAACCTCACCATC  31 925 1480600 N/A N/A 13362 13381 TCTATAGCAGTTACATACCT  98 926 1480613 N/A N/A 91992 92011 TTGCCACTTAAAATTTGGGT  25 927 1480629  993 1012 20744 20763 TCAGTTTGCTTCACAACTCC  18 928 1480649 3059 3078 202295 202314 CTCTGATGAAATACTCAAGT  60 929 1480720 N/A N/A 180759 180778 TTGGACATACTTCAAGTGCT  26 930 1480810  971  990 20342 20361 CCTTATATCCTTTTGCCACC  11 931 1480868 N/A N/A 139752 139771 CTGTAATCTATCATTCTGTA  72 932 1480872 3346 3365 221251 221270 TCCTTCCAGCTCTTTTGACT  60 933 1480894 N/A N/A 79580 79599 TTCCAATGAAATATACCCTC  51 934 1480898 N/A N/A 111348 111367 ATATATCTTTCTCCCCAGGA  39 935 1480916 3764 3783 224132 224151 CTTGGGAATTATATTCTGCC  28 936 1480951 N/A N/A 3151 3170 TATCTCCTCAAACGGAAGTA  91 937 1480954 N/A N/A 116989 117008 ATTACCTCCTGTCCTGATAC  52 938 1480975 1265 1284 26938 26957 ACACAACCTCGCCTGTGGCA   3† 939 1481006 N/A N/A 89462 89481 GATAGCTGTTTAAAATTCCT  15 940 1481011 1228 1247 23103 23122 GCCAATAAAAATGTTGCCCT  23† 941 1481024 N/A N/A 141796 141815 CCAGCTTCTATCACTCTCTT  53 942 1481050 N/A N/A 118294 118313 GCACTTACACTTACTTTCTC   9 943 1481052 N/A N/A 200826 200845 CCATAATGTACCTTTCATTT  51 944 1481082 1795 1814 92567 92586 CTTCTTTAACTTCCGTCTCC  37 945 1481103 N/A N/A 19189 19208 GTTCAAATTTCACTTTCAAC  13 946 1481118 4373 4392 224741 224760 CCAACAATCTTTAAACTGCT  36 947 1481158 3388 3407 223756 223775 CTTTGCAAAATACTTGAGTC  55 948 1481188  840  859 18277 18296 CCAAAGAATCTATACTTATA  47 949 1481212 N/A N/A 4399 4418 TCTGTAGCCTATATCGGGAA  95 950 1481245 N/A N/A 75302 75321 GCTAACAACACCTTTCCGTT  50 951 1481255 N/A N/A 52914 52933 CCAGACCATTATTCTGTGCT  21 952 1481261 N/A N/A 105131 105150 GCAACAAATATCTCATATAC  42 953 1481297 3850 3869 224218 224237 ATTCCTGCCAGATTCACCCA  53 954 1481299 3260 3279 221165 221184 TCCTTGCTGCAATTCCTCTA  45 955 1481313 N/A N/A 108809 108828 ATAAGCTTTCACATTCTCCT  49 956 1481321 N/A N/A 3240 3259 TTGCCCACAAGCCCCCTCAT  93 957 1481326 N/A N/A 123746 123765 AACCTACCTTCCAACCTTTA  90 958 1481364 N/A N/A 27773 27792 AGCACTTAATACATCATGCC  13 959 1481387 N/A N/A 115028 115047 GAACTCCATAATTTCAACAT  31 960 1481420 N/A N/A 174969 174988 GTACACATATCATAATGCAC  27 961 1481436 N/A N/A 45529 45548 ACATCACTACTATAACCTGA  23 962 1481444 N/A N/A 22615 22634 GCATGCCTTATCTTTCCTAA  24 963 1481458 N/A N/A 162998 163017 CACAAAGCTTGACTATGCAC  41 964 1481533 N/A N/A 210804 210823 CCTCCACCATTTTAAAGTTT  80 965 1481566 1575 1594 76892 76911 GCAGCCAAAGAGCAAATCAC  63 966 1481576 N/A N/A 94911 94930 TCATCATCCAAACCATGTCT  49 967 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2 433 1481620 N/A N/A 3508 3527 TACCATCCTAAGAAACTTTA  88 968

TABLE-US-00018 TABLE 18 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479839 N/A N/A 111232 111251 AGAAGCAGTACTTATCATTC  20  969 1479852 N/A N/A 135558 135577 TTCACTGAATTTCCTACGGA 114  970 1479891 N/A N/A 118293 118312 CACTTACACTTACTTTCTCC  14  971 1479898 3384 3403 223752 223771 GCAAAATACTTGAGTCTCTT  21  972 1479902 N/A N/A 174893 174912 AATCTGCTTCTTATTCAGGA  43  973 1479963 N/A N/A 71643 71662 GTGGTACTTTATCATAACCA  44  974 1479972 N/A N/A 129978 129997 ACTGTATCATACTTTTACTT  36  975 1480016 4372 4391 224740 224759 CAACAATCTTTAAACTGCTT  29  976 1480019 3617 3636 223985 224004 CCTCTCTGTTTCCAATAGGA  26  977 1480048 1794 1813 92566 92585 TTCTTTAACTTCCGTCTCCC  43  978 1480099 N/A N/A 3507 3526 ACCATCCTAAGAAACTTTAT 137  979 1480120 N/A N/A 180312 180331 GCAGAACTTTTTCATCAGAA  11  980 1480129 N/A N/A 162863 162882 CAGGATATTTCACTCATATT  26  981 1480154 N/A N/A 91991 92010 TGCCACTTAAAATTTGGGTC  32  982 1480168  675  694 18112 18131 GATCCAAACTGACTGAGATC  62  983 1480201 N/A N/A 19188 19207 TTCAAATTTCACTTTCAACC  95  984 1480214 N/A N/A 3239 3258 TGCCCACAAGCCCCCTCATC 139  985 1480267 N/A N/A 26919 26938 AGGCTGCACTCCCTAAAAAC  13†  986 1480289 N/A N/A 52628 52647 TCACCACCACCTTATTTGCC  55  987 1480291 N/A N/A 213414 213433 GTCAAACCACTTTACCTGTC  66  988 1480300 N/A N/A 11946 11965 TGCACACATTTATCACCTCT  32  989 1480320 N/A N/A 139663 139682 CTGGATTTAATATATTCCTT 150  990 1480346 2312 2331 116982 117001 CCTGTCCTGATACTGTCACA  59  991 1480370 2913 2932 202149 202168 GTACTCTGTCCTTTATATAT  97  992 1480423 N/A N/A 3335 3354 TCTAGTCACCCAATCCAGCA  53  993 1480431 N/A N/A 169026 169045 GTATCATGATTATCCCATCT  15  994 1480433 2682 2701 140791 140810 TGTTCTCCCAGCAACACATC  34  995 1480473 N/A N/A 152925 152944 GCTGCCTAATCATATACATA  83  996 1480474 3161 3180 212893 212912 CCAAGAATCCCATGTGGTAA  44  997 1480478 N/A N/A 100663 100682 AACCACACTAATCCTTTTAC  76  998 1480481 N/A N/A 104829 104848 ATAGCTTCACCTTTCACATA  44  999 1480504 N/A N/A 65893 65912 AAGCAACTACCAATGTTCCA  28 1000 1480533 N/A N/A 93739 93758 GCTCAAAATTTTATTCCTTA   7 1001 1480538 N/A N/A 184497 184516 ACACCTTTATTCCTCTGTGT  63 1002 1480624 N/A N/A 138032 138051 AATCTACTTTCCTACAAGCA  69 1003 1480634  992 1011 20743 20762 CAGTTTGCTTCACAACTCCC  20 1004 1480711 N/A N/A 116615 116634 ACTTCATGATTCCCATGGTA  25 1005 1480751  491  510 13195 13214 AATCGCAGCAGAATTCTTTC  91 1006 1480788 3258 3277 221163 221182 CTTGCTGCAATTCCTCTAGT  50 1007 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1480849 N/A N/A 165864 165883 CAAACTTTTACCTAATGTCT  46 1009 1480853 2461 2480 126782 126801 GACTAGCTGCTCCCGGAGCT  33 1010 1480858 N/A N/A 123745 123764 ACCTACCTTCCAACCTTTAC  89 1011 1480861 N/A N/A 146350 146369 CTGTTCATCTTTACCAGCTT  38 1012 1480878 1202 1221 23077 23096 TGTCCCTAACATTTTCCTTA   3 1013 1480900 N/A N/A 27697 27716 CCAGACATATATCATAACCA   3 1014 1480929 N/A N/A 61061 61080 TGGACAGTATCCTCTGGGAA  21 1015 1480965 N/A N/A 161583 161602 TTACTCTCTCTGAGTCCTCC  41 1016 1480984 N/A N/A 122128 122147 ACACCATTCATTTTTAGCCT  13 1017 1481053 N/A N/A 82347 82366 ATTCTAGATACTATCACTCC  64 1018 1481054 N/A N/A 200699 200718 CTGTTCCAATAACTAGCGGC  74 1019 1481065 N/A N/A 4522 4541 CACAACTCACCAGAGTTGCC  96 1020 1481070 N/A N/A 4328 4347 AGCAATTTAAACCTTACAAC  76 1021 1481084 N/A N/A 3150 3169 ATCTCCTCAAACGGAAGTAC  99 1022 1481085 N/A N/A 63341 63360 GTGAAACTTTCCCCGATCAC  58 1023 1481095 N/A N/A 22458 22477 CCATAATGTTTAATTCCACA   4 1024 1481119 N/A N/A 74834 74853 TCTTAAGATTTATCAGGTCT  93 1025 1481206 N/A N/A 13360 13379 TATAGCAGTTACATACCTTT  98 1026 1481300 N/A N/A 108104 108123 CTGTTGACATCATACACACT  74 1027 1481306 1901 1920 109603 109622 GATTTTCTATCTGACCAAAC  12 1028 1481307 3057 3076 202293 202312 CTGATGAAATACTCAAGTGT  71 1029 1481337 N/A N/A 89459 89478 AGCTGTTTAAAATTCCTGTA  79 1030 1481339  967  986 20338 20357 ATATCCTTTTGCCACCAGGC  18 1031 1481348  837  856 18274 18293 AAGAATCTATACTTATATCC  66 1032 1481401 N/A N/A 45464 45483 TAAGAATCTTTCTTTGCAAC  29 1033 1481432 3848 3867 224216 224235 TCCTGCCAGATTCACCCAGT  39 1034 1481461 2805 2824 161653 161672 ATGATGGTAATCAATGCAAC  45 1035 1481478 1568 1587 76885 76904 AAGAGCAAATCACAGGCTTC  52 1036 1481501 3345 3364 221250 221269 CCTTCCAGCTCTTTTGACTT  87 1037 1481502 N/A N/A 79443 79462 AGCAGAGCACTTTATGTCTT  18 1038 1481511 N/A N/A 3431 3450 GAACTGCACAATATGACTGC  75 1039 1481516 1431 1450 73463 73482 CTTTCGACTCGAATTCTGTC  36 1040 1481518 N/A N/A 141407 141426 TCTCTGCTATACAACAAGCT  65 1041 1481547 3763 3782 224131 224150 TTGGGAATTATATTCTGCCA  43 1042 1481572 N/A N/A 37127 37146 GACCCATATTTTCCTAACAC  50 1043 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481615 N/A N/A 115026 115045 ACTCCATAATTTCAACATAC  27 1044 1481633 N/A N/A 208093 208112 TGCTTATGTACACTTAAGTA  55 1045

TABLE-US-00019 TABLE 19 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ SEQ SEQ SEQ ID ID ID ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479808 N/A N/A 3430 3449 AACTGCACAATATGACTGCT  87 1046 1479828 N/A N/A 93615 93634 TCACCATCACACCATATTCA  71 1047 1479846 3257 3276 221162 221181 TTGCTGCAATTCCTCTAGTT  96 1048 1479920 N/A N/A 3238 3257 GCCCACAAGCCCCCTCATCA 145 1049 1479970 N/A N/A 122127 122146 CACCATTCATTTTTAGCCTT  13 1050 1479976 N/A N/A 19174 19193 TCAACCTTCTTGACTAGGGC  23 1051 1479999 N/A N/A 146349 146368 TGTTCATCTTTACCAGCTTC  52 1052 1480001 N/A N/A 3141 3160 AACGGAAGTACTAAAACCTC 141 1053 1480004 N/A N/A 3506 3525 CCATCCTAAGAAACTTTATC  97 1054 1480018 3762 3781 224130 224149 TGGGAATTATATTCTGCCAC  33 1055 1480034 N/A N/A 174356 174375 ATCTTATGCAAATATCTCAT  30 1056 1480073 N/A N/A 63340 63359 TGAAACTTTCCCCGATCACC  46 1057 1480076 N/A N/A 161577 161596 TCTCTGAGTCCTCCTGAAAA  72 1058 1480089 N/A N/A 3334 3353 CTAGTCACCCAATCCAGCAC 109 1059 1480090 4368 4387 224736 224755 AATCTTTAAACTGCTTAATC  49 1060 1480095 N/A N/A 141347 141366 CTGTTCCTAATACTTCATTA  28 1061 1480103 N/A N/A 71642 71661 TGGTACTTTATCATAACCAT  57 1062 1480122  991  1010 20742 20761 AGTTTGCTTCACAACTCCCA   5 1063 1480152 N/A N/A 78790 78809 TAGTTTCCTTATCCCAACAT  52 1064 1480216 N/A N/A 13359 13378 ATAGCAGTTACATACCTTTT 152 1065 1480245 N/A N/A 129975 129994 GTATCATACTTTTACTTTAC  12 1066 1480287 2449 2468 126770 126789 CCGGAGCTGATTCAGATGTC  61 1067 1480367 N/A N/A 118292 118311 ACTTACACTTACTTTCTCCA  14 1068 1480411 3847 3866 224215 224234 CCTGCCAGATTCACCCAGTT  43 1069 1480416 N/A N/A 179021 179040 GCATAGTCCCATTTTAACTT  27 1070 1480427 N/A N/A 200631 200650 TGGCTACTTTTTCAAAGTTC  64 1071 1480428 N/A N/A 11945 11964 GCACACATTTATCACCTCTT   7 1072 1480451 N/A N/A 152923 152942 TGCCTAATCATATACATATC 148 1073 1480461 N/A N/A 107956 107975 AGAGCTTCTATACTAACTTC  51 1074 1480476 1201 1220 23076 23095 GTCCCTAACATTTTCCTTAT   3 1075 1480520 1564 1583 76881 76900 GCAAATCACAGGCTTCTCTA  12 1076 1480531 3054 3073 202290 202309 ATGAAATACTCAAGTGTAGC  43 1077 1480537  416  435 4509 4528 AGTTGCCAGACATTCCCAGA  31 1078 1480571 2681 2700 140790 140809 GTTCTCCCAGCAACACATCA  44 1079 1480603 N/A N/A 116359 116378 CCTGTGTTTTACCTTTCCAT  17 1080 1480614 N/A N/A 137831 137850 AAGCATAATATCCTACCAAT  61 1081 1480689  666  685 18103 18122 TGACTGAGATCAAAAAGTGT 112 1082 1480705 N/A N/A 111227 111246 CAGTACTTATCATTCTAGTA  16 1083 1480707 1793 1812 92565 92584 TCTTTAACTTCCGTCTCCCA  30 1084 1480721 N/A N/A 114943 114962 TGGTAACACTTTCTTTGTAT  20 1085 1480736 N/A N/A 184253 184272 ATACAACTTACTCAATCCAC  42 1086 1480793 N/A N/A 139444 139463 GCATCTAGAACATATTCATT  60 1087 1480799 2909 2928 202145 202164 TCTGTCCTTTATATATATTG  56 1088 1480805 N/A N/A 37125 37144 CCCATATTTTCCTAACACTC  88 1089 1480814 N/A N/A 162862 162881 AGGATATTTCACTCATATTC  58 1090 1480848 N/A N/A 27107 27126 TCGGTATTATATTCCAGTGA   5 1091 1480860 N/A N/A 52312 52331 TTGTTTTCTACACTTAGCCA  20 1092 1480866 N/A N/A 65886 65905 TACCAATGTTCCATCATCAC  31 1093 1480869 N/A N/A 45277 45296 CAGGCACCTTTCTTATGGCA  17 1094 1480886 1899 1918 109601 109620 TTTTCTATCTGACCAAACAC  32 1095 1480925 N/A N/A 35859 35878 CCGCTTTTTCCTTTAGGGAA   4 1096 1480926 N/A N/A 90784 90803 GTCTCTTTATTCCTACTACT  20 1097 1480938 N/A N/A 123744 123763 CCTACCTTCCAACCTTTACC  71 1098 1480958 N/A N/A 3872 3891 ACATAAGTCCTTCACCAGCT  58 1099 1480971 2793 2812 161641 161660 AATGCAACTTGTTTTATGTA  33 1100 1481005 N/A N/A 169025 169044 TATCATGATTATCCCATCTT  44 1101 1481073  490  509 13194 13213 ATCGCAGCAGAATTCTTTCA  48 1102 1481090 3323 3342 221228 221247 GAGCTGCTTTCTTCAAAATT  69 1103 1481108 N/A N/A 22232 22251 TCTGGACATATCTTTGGACA  24 1104 1481122 1430 1449 73462 73481 TTTCGACTCGAATTCTGTCA  26 1105 1481163 N/A N/A 135557 135576 TCACTGAATTTCCTACGGAA  83 1106 1481179  945  964 20316 20335 CGTACATGAACAAACAGTCT  45 1107 1481281 N/A N/A 104825 104844 CTTCACCTTTCACATACACC  59 1108 1481298 N/A N/A 82345 82364 TCTAGATACTATCACTCCAA  55 1109 1481311 N/A N/A 207998 208017 GTGCATTACTCATAAAGCAA  43 1110 1481322 N/A N/A 26918 26937 GGCTGCACTCCCTAAAAACA  12† 1111 1481328 N/A N/A 100662 100681 ACCACACTAATCCTTTTACA  53 1112 1481372  835  854 18272 18291 GAATCTATACTTATATCCAC  48 1113 1481394 N/A N/A 89144 89163 TGGTCTTTTATCATTAGCCA  38 1114 1481427 N/A N/A 60980 60999 GCCGAGTAATTCATTCTCTC  30 1115 1481434 3151 3170 212883 212902 CATGTGGTAATTCCCCACCT  74 1116 1481459 N/A N/A 165766 165785 AGGGTGATACTCTAATTCTT  39 1117 1481489 N/A N/A 73930 73949 GGTCAAAACTCCTTCCACTC  65 1118 1481521 N/A N/A 223325 223344 GCATAACACAGACTTACTTT  28 1119 1481522 3615 3634 223983 224002 TCTCTGTTTCCAATAGGAAT  46 1120 1481559 N/A N/A 212942 212961 CTGCAGGAATATTTCATACC  93 1121 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481647 2311 2330 116981 117000 CTGTCCTGATACTGTCACAT  41 1122

TABLE-US-00020 TABLE 20 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479810 3256 3275 221161 221180 TGCTGCAATTCCTCTAGTTA  47 1123 1479816 N/A N/A 37124 37143 CCATATTTTCCTAACACTCC  54 1124 1479923 N/A N/A 107955 107974 GAGCTTCTATACTAACTTCA  22 1125 1479937 N/A N/A 3505 3524 CATCCTAAGAAACTTTATCC  71 1126 1479965 3321 3340 221226 221245 GCTGCTTTCTTCAAAATTTC 104 1127 1479966 N/A N/A 141214 141233 TGCAAAGGCATCTCTGATTC  29 1128 1479978 2304 2323 116974 116993 GATACTGTCACATATTGTGC  49 1129 1479982 N/A N/A 139204 139223 TGAGTACCTTTATTTCTACA  20 1130 1479995 N/A N/A 3333 3352 TAGTCACCCAATCCAGCACT  51 1131 1479997 N/A N/A 100661 100680 CCACACTAATCCTTTTACAT  69 1132 1480012 N/A N/A 88107 88126 ATGCAGTAATTCAATATCCT  16 1133 1480017 N/A N/A 13357 13376 AGCAGTTACATACCTTTTGA 113 1134 1480026  415  434 4508 4527 GTTGCCAGACATTCCCAGAT  45 1135 1480054 3845 3864 224213 224232 TGCCAGATTCACCCAGTTGC  25 1136 1480106 2779 2798 161627 161646 TATGTAGGAGCTCTTTCCAC  32 1137 1480123 N/A N/A 11705 11724 CCTGTGAATTTTCTAGCCAC  86 1138 1480149 3755 3774 224123 224142 TATATTCTGCCACTTAAGGC  52 1139 1480160 N/A N/A 21925 21944 CACACAGTATCATTTAAGGC  17 1140 1480184 N/A N/A 3140 3159 ACGGAAGTACTAAAACCTCA  63 1141 1480198 N/A N/A 178967 178986 TCTCTCATATAATCCTTCCT  47 1142 1480210 N/A N/A 114798 114817 GAGACTTTTTACCCTTTACT  43 1143 1480211 4367 4386 224735 224754 ATCTTTAAACTGCTTAATCC  42 1144 1480223 1171 1190 23046 23065 GCACAGAAGATAGCTGGTAG   0 1145 1480285 3148 3167 212880 212899 GTGGTAATTCCCCACCTGGT  50 1146 1480316 N/A N/A 17937 17956 CGGCAAACTATCCATAGGTT   6 1147 1480331 1560 1579 76877 76896 ATCACAGGCTTCTCTAAGTT  31 1148 1480363 3608 3627 223976 223995 TTCCAATAGGAATATACCAT  21 1149 1480381 N/A N/A 184252 184271 TACAACTTACTCAATCCACA  29 1150 1480389 1898 1917 109600 109619 TTTCTATCTGACCAAACACA  23 1151 1480391 N/A N/A 174350 174369 TGCAAATATCTCATTCTGCT  94 1152 1480463 N/A N/A 45001 45020 ATAGAATTTTCCCCACTGGT   3 1153 1480503 N/A N/A 3538 3557 CAGGAAGGACTCCATGATTA  57 1154 1480535 N/A N/A 3429 3448 ACTGCACAATATGACTGCTT 125 1155 1480543 N/A N/A 82075 82094 GCATATAACACATTTTAGGT   4 1156 1480546 2908 2927 202144 202163 CTGTCCTTTATATATATTGT  40 1157 1480575 N/A N/A 64365 64384 AAAGACTTCCATTTAGAGCA  33 1158 1480625  834  853 18271 18290 AATCTATACTTATATCCACA  36 1159 1480682 N/A N/A 200537 200556 GATGAAACTTTCATATCCCT  39 1160 1480699 N/A N/A 137829 137848 GCATAATATCCTACCAATGA  28 1161 1480713 N/A N/A 27089 27108 GATGTGCCAACTTACCTAAC  32 1162 1480716 N/A N/A 73900 73919 GTCAAAACCATCAACTTACT  40 1163 1480742 3029 3048 202265 202284 CAATGGCAATTCCATCATGA  34 1164 1480785 N/A N/A 93613 93632 ACCATCACACCATATTCACT  63 1165 1480791 N/A N/A 205213 205232 GTGTAAGACTCATTCAACAT  37 1166 1480807 N/A N/A 26917 26936 GCTGCACTCCCTAAAAACAA  23† 1167 1480809  489  508 13193 13212 TCGCAGCAGAATTCTTTCAA  34 1168 1480850 N/A N/A 63339 63358 GAAACTTTCCCCGATCACCT  23 1169 1480874 N/A N/A 116357 116376 TGTGTTTTACCTTTCCATCA   9 1170 1480881 N/A N/A 51375 51394 AAGCAATTTAATCACCCACA  42 1171 1480956 1792 1811 92564 92583 CTTTAACTTCCGTCTCCCAA  38 1172 1480974 N/A N/A 161575 161594 TCTGAGTCCTCCTGAAAATT  76 1173 1480977 N/A N/A 89633 89652 AAGACACTATATTTTCACCT  28 1174 1481013 N/A N/A 60978 60997 CGAGTAATTCATTCTCTCCT  44 1175 1481014  923  942 20294 20313 GAGTAGGTATACTTGCTGTC  11 1176 1481022 2432 2451 126753 126772 GTCTGTAATTTTCTACAATA   6 1177 1481056 N/A N/A 18660 18679 GAGGAACTTCTATACATCTC  13 1178 1481068 N/A N/A 35805 35824 GCAGTACACTCATCTCTTCC   6 1179 1481142 N/A N/A 71640 71659 GTACTTTATCATAACCATAC   8 1180 1481151 2680 2699 140789 140808 TTCTCCCAGCAACACATCAA  38 1181 1481231 N/A N/A 110597 110616 AGTCAAGATAACTACATCAA  54 1182 1481262 N/A N/A 146300 146319 GCACCCATTCCATACCACAT  35 1183 1481280 N/A N/A 223044 223063 ACACACAGTAACCATCCAAC  27 1184 1481310 N/A N/A 212941 212960 TGCAGGAATATTTCATACCT  77 1185 1481346 N/A N/A 165761 165780 GATACTCTAATTCTTGTCAT  27 1186 1481370 N/A N/A 123743 123762 CTACCTTCCAACCTTTACCC  41 1187 1481380 N/A N/A 78614 78633 CCAACCATACAGATTGATCT  87 1188 1481381 N/A N/A 135555 135574 ACTGAATTTCCTACGGAAGC  54 1189 1481384 N/A N/A 152922 152941 GCCTAATCATATACATATCA 113 1190 1481404 N/A N/A 169022 169041 CATGATTATCCCATCTTGCA  39 1191 1481426 N/A N/A 3234 3253 ACAAGCCCCCTCATCAGAAT  56 1192 1481470  990 1009 20741 20760 GTTTGCTTCACAACTCCCAC   6 1193 1481540 N/A N/A 104824 104843 TTCACCTTTCACATACACCA  48 1194 1481542 N/A N/A 121368 121387 CTAACAAGCCTCCTTTGGCT  61 1195 1481571 N/A N/A 129046 129065 ATTGGAATCTCTTCCTGGTC  37 1196 1481585 1429 1448 73461 73480 TTCGACTCGAATTCTGTCAT  58 1197 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481600 N/A N/A 162855 162874 TTCACTCATATTCCTAACAC  43 1198 1481604 N/A N/A 118238 118257 GCAGCCACTTTTCTACTACA  28 1199

TABLE-US-00021 TABLE 21 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479849 N/A N/A 3136 3155 AAGTACTAAAACCTCAGCGC  80 1200 1479914 N/A N/A 116259 116278 ATGTAACACTTTTAGGGTCC  16 1201 1479974 3754 3773 224122 224141 ATATTCTGCCACTTAAGGCT  75 1202 1480082 N/A N/A 165415 165434 TTTGCAGTATCACCTGTACT  50 1203 1480087 2778 2797 161626 161645 ATGTAGGAGCTCTTTCCACC  20 1204 1480161  989 1008 20740 20759 TTTGCTTCACAACTCCCACC  18 1205 1480191 N/A N/A 146103 146122 GACTCATTTTCTTCCCACCC  26 1206 1480205 N/A N/A 73896 73915 AAACCATCAACTTACTAGCT  73 1207 1480207 N/A N/A 51222 51241 GGGCACTAATCACTTTATCA  17 1208 1480247 N/A N/A 107952 107971 CTTCTATACTAACTTCAGGC  34 1209 1480264 N/A N/A 63336 63355 ACTTTCCCCGATCACCTGGT  66 1210 1480270 N/A N/A 26915 26934 TGCACTCCCTAAAAACAAAT  52† 1211 1480281 N/A N/A 200502 200521 GCTTCAGAATCACAATGGTT  59 1212 1480332 N/A N/A 17936 17955 GGCAAACTATCCATAGGTTA  16 1213 1480351 3027 3046 202263 202282 ATGGCAATTCCATCATGAGT  25 1214 1480373 N/A N/A 21767 21786 GCATCAAATAACACACTGCA  35 1215 1480394 N/A N/A 162616 162635 CAGATCTGTTTTTATCTGCT  50 1216 1480417 N/A N/A 78353 78372 GCATGTCTTCACTTATTCTC  26 1217 1480438 N/A N/A 118237 118256 CAGCCACTTTTCTACTACAT  80 1218 1480444 N/A N/A 60977 60996 GAGTAATTCATTCTCTCCTC  43 1219 1480514 3300 3319 221205 221224 CCAGGAACATCTGCTAGTTT  53 1220 1480523 2303 2322 116973 116992 ATACTGTCACATATTGTGCA  67 1221 1480561 N/A N/A 204949 204968 GCAACGATATCCTTTCTTAC  30 1222 1480566 N/A N/A 174349 174368 GCAAATATCTCATTCTGCTA  69 1223 1480572 N/A N/A 3428 3447 CTGCACAATATGACTGCTTT  56 1224 1480578  414  433 4507 4526 TTGCCAGACATTCCCAGATC  46 1225 1480581 N/A N/A 89630 89649 ACACTATATTTTCACCTGTA  26 1226 1480583 N/A N/A 82063 82082 TTTTAGGTATCCATTCTTCA  62 1227 1480598 2679 2698 140788 140807 TCTCCCAGCAACACATCAAT  44 1228 1480617 N/A N/A 35804 35823 CAGTACACTCATCTCTTCCC  24 1229 1480639 3255 3274 221160 221179 GCTGCAATTCCTCTAGTTAT  37 1230 1480667 N/A N/A 71607 71626 CCTCAATGTTACACTATTTC  24 1231 1480695 N/A N/A 168775 168794 GTGTATTAATAATTTATCCT  38 1232 1480698 3844 3863 224212 224231 GCCAGATTCACCCAGTTGCC  25 1233 1480710 N/A N/A 3332 3351 AGTCACCCAATCCAGCACTT  50 1234 1480723 N/A N/A 141113 141132 ATTCCAACTCTATTTGCATA  54 1235 1480745 N/A N/A 37067 37086 GTGACCACACTTCCTGGAAT  32 1236 1480774 N/A N/A 161570 161589 GTCCTCCTGAAAATTAGAAA  92 1237 1480821 N/A N/A 137775 137794 GTAACCACATTTCTGAACTT  61 1238 1480833 N/A N/A 152873 152892 GAGTATCATTCACTATTGCC  35 1239 1480883 N/A N/A 139203 139222 GAGTACCTTTATTTCTACAT  23 1240 1480891 N/A N/A 13356 13375 GCAGTTACATACCTTTTGAT  57 1241 1480903 1169 1188 23044 23063 ACAGAAGATAGCTGGTAGAA   8 1242 1480911 1897 1916 109599 109618 TTCTATCTGACCAAACACAC  34 1243 1480912  488  507 13192 13211 CGCAGCAGAATTCTTTCAAT  30 1244 1480940 N/A N/A 121129 121148 GATGCATAATGACTAACACA  14 1245 1480943 3606 3625 223974 223993 CCAATAGGAATATACCATGG  53 1246 1480945 N/A N/A 104823 104842 TCACCTTTCACATACACCAT  81 1247 1480955 N/A N/A 88105 88124 GCAGTAATTCAATATCCTTT   6 1248 1480978 N/A N/A 100512 100531 AGCTGAAGTATCATTAACTC  35 1249 1480987 N/A N/A 184251 184270 ACAACTTACTCAATCCACAT  24 1250 1480993 N/A N/A 3534 3553 AAGGACTCCATGATTAGTCA 107 1251 1481044 N/A N/A 123742 123761 TACCTTCCAACCTTTACCCA  68 1252 1481071 N/A N/A 222866 222885 GTCTTCTAATAATTCTCTCA  31 1253 1481089 N/A N/A 3230 3249 GCCCCCTCATCAGAATGGGA  64 1254 1481102 N/A N/A 64197 64216 CTAGCATTTTTTATTAGTCA  17 1255 1481153 1428 1447 73460 73479 TCGACTCGAATTCTGTCATC  36 1256 1481181 4361 4380 224729 224748 AAACTGCTTAATCCTATGAC  35 1257 1481196 N/A N/A 126571 126590 ACATTCTTTAATTATGGTCC  14 1258 1481202 3147 3166 212879 212898 TGGTAATTCCCCACCTGGTG  49 1259 1481226 1559 1578 76876 76895 TCACAGGCTTCTCTAAGTTA  25 1260 1481304 N/A N/A 178966 178985 CTCTCATATAATCCTTCCTT   7 1261 1481314 N/A N/A 11649 11668 TCACCTTGTTTACTATTACT  27 1262 1481345 N/A N/A 27088 27107 ATGTGCCAACTTACCTAACA  38 1263 1481357 N/A N/A 114688 114707 CATGCATCTAATTTCTCTCC  24 1264 1481393 N/A N/A 93612 93631 CCATCACACCATATTCACTC  38 1265 1481408  921  940 20292 20311 GTAGGTATACTTGCTGTCAT   3 1266 1481441 N/A N/A 135476 135495 AAGCAATCACTTTATCAGCT  55 1267 1481469 N/A N/A 212938 212957 AGGAATATTTCATACCTGGA  60 1268 1481472 2904 2923 202140 202159 CCTTTATATATATTGTCTGC  21 1269 1481475 N/A N/A 110483 110502 TGAGCATCATCATATTAGCC  38 1270 1481488 N/A N/A 18659 18678 AGGAACTTCTATACATCTCA  23 1271 1481513  831  850 18268 18287 CTATACTTATATCCACATTC  19 1272 1481515 N/A N/A 44758 44777 GTTCATTTATACATAGAGCA  17 1273 1481520 N/A N/A 3504 3523 ATCCTAAGAAACTTTATCCA 127 1274 1481551 N/A N/A 128420 128439 TAACTTCTTATTTCTGCATC  72 1275 1481560 1790 1809 92562 92581 TTAACTTCCGTCTCCCAAAT  34 1276 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433

TABLE-US-00022 TABLE 22 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479879 N/A N/A 140990 141009 TAGCACCAATTCCACATTTC  42 1277 1479887 N/A N/A 64124 64143 CTACCAGCTACTCTTATGGC  49 1278 1479911 N/A N/A 183939 183958 ACTGTCACATAACCTCCACA  53 1279 1479957  988 1007 20739 20758 TTGCTTCACAACTCCCACCT   9 1280 1479977 N/A N/A 89629 89648 CACTATATTTTCACCTGTAC  35 1281 1480007 1427 1446 73459 73478 CGACTCGAATTCTGTCATCC  29 1282 1480096 N/A N/A 11645 11664 CTTGTTTACTATTACTCTCT  10 1283 1480147 1167 1186 23042 23061 AGAAGATAGCTGGTAGAAGT  27 1284 1480150 N/A N/A 135475 135494 AGCAATCACTTTATCAGCTA 107 1285 1480155 N/A N/A 113803 113822 AGAGGATATATACTCCACCA  34 1286 1480158 N/A N/A 35603 35622 CAGACCTCATATCATTTCCA  15 1287 1480159 N/A N/A 43711 43730 CAGCAATTACACACATGCTT  63 1288 1480197 N/A N/A 161727 161746 CTTACCTTGTGAAAATGCCA  27 1289 1480218  828  847 18265 18284 TACTTATATCCACATTCCAC   9 1290 1480219 3254 3273 221159 221178 CTGCAATTCCTCTAGTTATT  23 1291 1480261 2893 2912 202129 202148 ATTGTCTGCAGCACCCATCC  21 1292 1480293 N/A N/A 63334 63353 TTTCCCCGATCACCTGGTGT  60 1293 1480339 3843 3862 224211 224230 CCAGATTCACCCAGTTGCCA  25 1294 1480340 N/A N/A 178939 178958 TTGCAATAAGATCACACTAC  28 1295 1480429 N/A N/A 168574 168593 GTCAACACATCTTATTTATA  14 1296 1480453 N/A N/A 118234 118253 CCACTTTTCTACTACATATC 152 1297 1480465 N/A N/A 3331 3350 GTCACCCAATCCAGCACTTT  54 1298 1480471 N/A N/A 82060 82079 TAGGTATCCATTCTTCAGTT  12 1299 1480483  487  506 13191 13210 GCAGCAGAATTCTTTCAATT  21 1300 1480494  919  938 20290 20309 AGGTATACTTGCTGTCATAA   1 1301 1480508 N/A N/A 2964 2983 AGTCCCAGACAGAACCTACT  50 1302 1480511 N/A N/A 3200 3219 CTGAGTTCCTGTCTCAGGCC 140 1303 1480556 N/A N/A 51207 51226 TATCAAGTACTTCCTCAACT  36 1304 1480573 N/A N/A 3533 3552 AGGACTCCATGATTAGTCAC  74 1305 1480579 N/A N/A 199997 200016 TAAGCATTATACTTAAGTGC  61 1306 1480582 N/A N/A 27085 27104 TGCCAACTTACCTAACAGAT  60 1307 1480607 3753 3772 224121 224140 TATTCTGCCACTTAAGGCTT  66 1308 1480630 N/A N/A 165228 165247 GTTGACCACTACTTTTCTTC  27 1309 1480637 3604 3623 223972 223991 AATAGGAATATACCATGGTC  16 1310 1480660 N/A N/A 107951 107970 TTCTATACTAACTTCAGGCC  25 1311 1480664 1558 1577 76875 76894 CACAGGCTTCTCTAAGTTAA  32 1312 1480690 N/A N/A 222685 222704 CTTGCATATATTTCTACAGC  15 1313 1480749 N/A N/A 60905 60924 TGGCTTTAATATCTCCATAT  11 1314 1480758  413  432 4506 4525 TGCCAGACATTCCCAGATCA  83 1315 1480771 N/A N/A 71600 71619 GTTACACTATTTCTAAGATT  16 1316 1480882 N/A N/A 104812 104831 ATACACCATTCATTCTTACA  39 1317 1480906 N/A N/A 18569 18588 TCATCCAATTAACTTTGGAT  67 1318 1480930 1503 1522 73535 73554 ACTGTATCTTTTGCATAAAA  62 1319 1480962 N/A N/A 93611 93630 CATCACACCATATTCACTCT  54 1320 1480970 1786 1805 92558 92577 CTTCCGTCTCCCAAATGAAG  37 1321 1481016 N/A N/A 78349 78368 GTCTTCACTTATTCTCTAAC  13 1322 1481017 1896 1915 109598 109617 TCTATCTGACCAAACACACT  22 1323 1481036 N/A N/A 121037 121056 CCACAACTATTCAATCTGTA  14 1324 1481048 N/A N/A 139202 139221 AGTACCTTTATTTCTACATC  13 1325 1481049 N/A N/A 126500 126519 ATGCATTTCAAATTATACCC  20 1326 1481062 N/A N/A 126835 126854 TTTTCATTGTAAACTCACTC  58 1327 1481123 N/A N/A 212937 212956 GGAATATTTCATACCTGGAT  68 1328 1481128 2286 2305 116956 116975 GCAGAAGGATTTTTTAGTAT  11 1329 1481150 N/A N/A 3503 3522 TCCTAAGAAACTTTATCCAC  69 1330 1481156 N/A N/A 37004 37023 CCATGTTATTCATATCTATA   3 1331 1481176 N/A N/A 88098 88117 TTCAATATCCTTTATCAGCC   9 1332 1481193 N/A N/A 21613 21632 TACCACTATATTTTATAGGC   6 1333 1481195 4360 4379 224728 224747 AACTGCTTAATCCTATGACA  44 1334 1481216 2777 2796 161625 161644 TGTAGGAGCTCTTTCCACCC  11 1335 1481224 3144 3163 212876 212895 TAATTCCCCACCTGGTGTGA  33 1336 1481254 N/A N/A 145717 145736 GTTCCATTAAAATACTATCA  73 1337 1481316 N/A N/A 204946 204965 ACGATATCCTTTCTTACTGC  35 1338 1481319 2678 2697 140787 140806 CTCCCAGCAACACATCAATC  60 1339 1481323 N/A N/A 137763 137782 CTGAACTTACTCATAACACC  62 1340 1481355 N/A N/A 161477 161496 GCAAAACATTACTTTGTAGC  40 1341 1481414 N/A N/A 116246 116265 AGGGTCCAATCACATTTCTA  24 1342 1481425 N/A N/A 100511 100530 GCTGAAGTATCATTAACTCC  33 1343 1481463 N/A N/A 26914 26933 GCACTCCCTAAAAACAAATA  65† 1344 1481467 N/A N/A 152230 152249 GCTCTACATAAACTAATGCA  71 1345 1481509 N/A N/A 17685 17704 GGGCAAAACCACTTTGAGCA  20 1346 1481517 N/A N/A 13355 13374 CAGTTACATACCTTTTGATT  60 1347 1481548 N/A N/A 110481 110500 AGCATCATCATATTAGCCAA  26 1348 1481552 N/A N/A 3424 3443 ACAATATGACTGCTTTTAAC  54 1349 1481575 3025 3044 202261 202280 GGCAATTCCATCATGAGTGC  17 1350 1481583 3299 3318 221204 221223 CAGGAACATCTGCTAGTTTA  36 1351 1481584 N/A N/A 123741 123760 ACCTTCCAACCTTTACCCAA  57 1352 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481609 N/A N/A 174124 174143 GTAGCATTTTTAACTAGCAC  23 1353

TABLE-US-00023 TABLE 23 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479802 1895 1914 109597 109616 CTATCTGACCAAACACACTA  24 1354 1479806 N/A N/A 63311 63330 ATGGCTCTGCTCACTAGGAT  15 1355 1479820 N/A N/A 93607 93626 ACACCATATTCACTCTGGTC  54 1356 1479827 N/A N/A 20737 20756 GCTTCACAACTCCCACCTTC   9 1357 1479845 N/A N/A 3199 3218 TGAGTTCCTGTCTCAGGCCT  64 1358 1479850 N/A N/A 126499 126518 TGCATTTCAAATTATACCCA  13 1359 1479895 N/A N/A 89565 89584 CGATTTATAATCAACTAGCC  47 1360 1479917 2262 2281 116932 116951 CGTATTTCTTGCAAATGCAT  15 1361 1479940 N/A N/A 178881 178900 CTGCACATATAATCAAGCAA  45 1362 1479962 N/A N/A 135291 135310 ATCACAGATTTCATCTGACC  63 1363 1479987 N/A N/A 161376 161395 CACACAGCTATTCCTGGGTA  45 1364 1480006 N/A N/A 3530 3549 ACTCCATGATTAGTCACATC  43 1365 1480042 N/A N/A 71599 71618 TTACACTATTTCTAAGATTT  38 1366 1480055 3116 3135 212848 212867 TTTCTAGTTCACAAACTGGC  28 1367 1480057 N/A N/A 204945 204964 CGATATCCTTTCTTACTGCT  34 1368 1480065 N/A N/A 27083 27102 CCAACTTACCTAACAGATGT  36 1369 1480185 N/A N/A 81962 81981 GACATCATATTTTCCTTGTC  46 1370 1480259 N/A N/A 220897 220916 TAGGATCTATCTTTTAGTTC  38 1371 1480266 N/A N/A 183937 183956 TGTCACATAACCTCCACAGT  39 1372 1480384 N/A N/A 137762 137781 TGAACTTACTCATAACACCA  49 1373 1480434  826  845 18263 18282 CTTATATCCACATTCCACAC  10 1374 1480442 N/A N/A 3423 3442 CAATATGACTGCTTTTAACC  49 1375 1480456 N/A N/A 100432 100451 GACTTAGTTATTCTTATCTC  18 1376 1480487 N/A N/A 42160 42179 AGGGTTTAATTTTACAGTAT   2 1377 1480495 N/A N/A 18390 18409 ATCAGCTTTTATATAAGGTC   8 1378 1480496 N/A N/A 17635 17654 TGTTTTATACTTCCAAGCAC  23 1379 1480548 N/A N/A 13354 13373 AGTTACATACCTTTTGATTA 126 1380 1480574 1496 1515 73528 73547 CTTTTGCATAAAACTCTGTA  81 1381 1480584 3752 3771 224120 224139 ATTCTGCCACTTAAGGCTTT 116 1382 1480591 3602 3621 223970 223989 TAGGAATATACCATGGTCAT  13 1383 1480627 N/A N/A 126834 126853 TTTCATTGTAAACTCACTCT  41 1384 1480665  909  928 20280 20299 GCTGTCATAAAGTTGTGATC   7 1385 1480666 1557 1576 76874 76893 ACAGGCTTCTCTAAGTTAAC  17 1386 1480685 N/A N/A 78347 78366 CTTCACTTATTCTCTAACTA  41 1387 1480686 N/A N/A 168518 168537 ACTGCACATCTACTTAGTAC  44 1388 1480754 N/A N/A 199637 199656 TGGCTTTACATATATGTCAT  56 1389 1480792 N/A N/A 110448 110467 GTTGCAGCATTTTATATATA  22 1390 1480797 N/A N/A 165227 165246 TTGACCACTACTTTTCTTCT  45 1391 1480835 N/A N/A 2963 2982 GTCCCAGACAGAACCTACTA  77 1392 1480870 N/A N/A 63371 63390 CCTCAGGTCTCCATTCAAGT  30 1393 1480887 N/A N/A 150021 150040 GTACTAACAACCATTTGTTC  47 1394 1480897 1782 1801 92554 92573 CGTCTCCCAAATGAAGTTTT  14 1395 1480914 N/A N/A 202127 202146 TGTCTGCAGCACCCATCCTA  42 1396 1480941 N/A N/A 144510 144529 CGTAAGTTCTTTCTCAACAC  21 1397 1480950 N/A N/A 87460 87479 GGTCTACAAATATCTGCCAT  57 1398 1480989 N/A N/A 60438 60457 ATCAAATCTTATTACCAGGA   2 1399 1480990 3290 3309 221195 221214 CTGCTAGTTTAGCCACATTT  47 1400 1481007 N/A N/A 123740 123759 CCTTCCAACCTTTACCCAAT  28 1401 1481010 2677 2696 140786 140805 TCCCAGCAACACATCAATCA  50 1402 1481034 N/A N/A 26458 26477 GTAACCAGACCACCAGTACT  60 1403 1481042 N/A N/A 3330 3349 TCACCCAATCCAGCACTTTT  81 1404 1481055 N/A N/A 37000 37019 GTTATTCATATCTATATGCT   7 1405 1481101 N/A N/A 140857 140876 CATCGACTTATTTTTTGGCA  31 1406 1481110 N/A N/A 174123 174142 TAGCATTTTTAACTAGCACC  31 1407 1481121 4359 4378 224727 224746 ACTGCTTAATCCTATGACAA  49 1408 1481243 N/A N/A 222498 222517 TTCTCATAGATACTTTTCCC  26 1409 1481249 2875 2894 161723 161742 CCTTGTGAAAATGCCATCCA  39 1410 1481253 2776 2795 161624 161643 GTAGGAGCTCTTTCCACCCA  14 1411 1481271  412  431 4505 4524 GCCAGACATTCCCAGATCAC  29 1412 1481272 N/A N/A 120606 120625 ATAGCAACTTTTCCTGGTCT  14 1413 1481288 N/A N/A 112708 112727 TGTGACTAGCACTATTTACA  43 1414 1481302 3024 3043 202260 202279 GCAATTCCATCATGAGTGCT 105 1415 1481341  468  487 13172 13191 TTTTCCAGAGACTTTGAAAC  48 1416 1481349 N/A N/A 118028 118047 TTCTGTTATATAGAGCTCTA  18 1417 1481382 3842 3861 224210 224229 CAGATTCACCCAGTTGCCAA  21 1418 1481391 N/A N/A 11262 11281 CTAGTTTTACCCATTGCAGT  45 1419 1481419 N/A N/A 107605 107624 CTTGCTATTAATCTTAGGTT  29 1420 1481449 N/A N/A 21612 21631 ACCACTATATTTTATAGGCA   1 1421 1481473 N/A N/A 35090 35109 TTAGATTACTATCATCTCTA  16 1422 1481537 1159 1178 23034 23053 GCTGGTAGAAGTATCAGTCA  42 1423 1481539 N/A N/A 139191 139210 TTCTACATCATCTATATCCT  33 1424 1481567 N/A N/A 51141 51160 CCTGTCATTTATTATGGACA  35 1425 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481593 2142 2161 116098 116117 GCAGCTTGTTCATTGAGTAT  26 1426 1481602 N/A N/A 212936 212955 GAATATTTCATACCTGGATC  67 1427 1481603 1423 1442 73455 73474 TCGAATTCTGTCATCCTGCA   6 1428 1481614 N/A N/A 104273 104292 TCTTGTTTAACCCATATCCT  47 1429 1481637 N/A N/A 3502 3521 CCTAAGAAACTTTATCCACC  75 1430

TABLE-US-00024 TABLE 24 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479805 N/A N/A 212935 212954 AATATTTCATACCTGGATCC 104 1431 1479840 N/A N/A 204931 204950 ACTGCTTTTTCAACACTGTA  52 1432 1479861 N/A N/A 93097 93116 CCAACTTTACTCACTCTACT  47 1433 1479881 N/A N/A 78346 78365 TTCACTTATTCTCTAACTAC 120 1434 1479896 N/A N/A 26438 26457 GTAGTAAATTACTACTTCAT  56 1435 1479901 N/A N/A 21611 21630 CCACTATATTTTATAGGCAT   4 1436 1479915 N/A N/A 36963 36982 CCATTCCACATTTACTTGGC   9 1437 1479926 N/A N/A 63301 63320 TCACTAGGATCCATGAGGAT  73 1438 1479933 3004 3023 202240 202259 CGTCCCTCTTCCTAGTTCAT  56 1439 1479934 1552 1571 76869 76888 CTTCTCTAAGTTAACAATGC  23 1440 1479950 N/A N/A 220896 220915 AGGATCTATCTTTTAGTTCA  47 1441 1480014 3745 3764 224113 224132 CACTTAAGGCTTTACTGGAC  87 1442 1480015 N/A N/A 59067 59086 CTACACTTTTGATTATACCT  32 1443 1480032  465  484 13169 13188 TCCAGAGACTTTGAAACATT  18 1444 1480040 N/A N/A 3186 3205 CAGGCCTGCCATTAAAAACC  77 1445 1480044 1494 1513 73526 73545 TTTGCATAAAACTCTGTAAC  79   18 1480069 2870 2889 161718 161737 TGAAAATGCCATCCACAATC  64 1446 1480078 N/A N/A 2962 2981 TCCCAGACAGAACCTACTAT 105 1447 1480115 2256 2275 116926 116945 TCTTGCAAATGCATTCGGAT  15 1448 1480131 3592 3611 223960 223979 CCATGGTCATAATTTTATGC  77 1449 1480208 N/A N/A 149572 149591 GACAGATTTTTTCCAGCCCC  85 1450 1480322 N/A N/A 100328 100347 GACATTTTCTTTCTACTCCC  27 1451 1480347 N/A N/A 13353 13372 GTTACATACCTTTTGATTAA 148 1452 1480400 N/A N/A 11247 11266 GCAGTCATTCACTAATCAGA  12 1453 1480401 2775 2794 161623 161642 TAGGAGCTCTTTCCACCCAT  36 1454 1480419 N/A N/A 27080 27099 ACTTACCTAACAGATGTGGC  82 1455 1480455 N/A N/A 107604 107623 TTGCTATTAATCTTAGGTTC  36 1456 1480490  899  918 20270 20289 AGTTGTGATCTAAATGGCAA   8 1457 1480530 N/A N/A 144508 144527 TAAGTTCTTTCTCAACACTA  49 1458 1480569 N/A N/A 63370 63389 CTCAGGTCTCCATTCAAGTC  28 1459 1480676 N/A N/A 165069 165088 GTCTCAGAACATTAATCTTC  52 1460 1480681 N/A N/A 3501 3520 CTAAGAAACTTTATCCACCC  60 1461 1480684 N/A N/A 81743 81762 GCATTGATTTGAATTTACCT  13 1462 1480702 3834 3853 224202 224221 CCCAGTTGCCAATTATCTGA  53 1463 1480714 N/A N/A 202125 202144 TCTGCAGCACCCATCCTACA  68 1464 1480715 N/A N/A 178793 178812 ATTCTAAATTTCTACAGGCT  59 1465 1480767 3287 3306 221192 221211 CTAGTTTAGCCACATTTAAT  42 1466 1480777 N/A N/A 168472 168491 GAACAAGCACAATTTCTGTC  40 1467 1480813 N/A N/A 17602 17621 GCACATTCTATAAATTCTTA  29 1468 1480816 1422 1441 73454 73473 CGAATTCTGTCATCCTGCAC  28 1469 1480823 N/A N/A 126833 126852 TTCATTGTAAACTCACTCTA 109 1470 1480884 N/A N/A 183936 183955 GTCACATAACCTCCACAGTA  60 1471 1480892  816  835 18253 18272 CATTCCACACACAAAACTGC  42 1472 1480934 N/A N/A 103726 103745 CCAATCCTTTTGATTACCAA  33 1473 1480953 N/A N/A 135290 135309 TCACAGATTTCATCTGACCC  73 1474 1480994 N/A N/A 3328 3347 ACCCAATCCAGCACTTTTTT  70 1475 1481040 N/A N/A 140856 140875 ATCGACTTATTTTTTGGCAT  30 1476 1481075 2379 2398 123739 123758 CTTCCAACCTTTACCCAATC  40 1477 1481087 2676 2695 140785 140804 CCCAGCAACACATCAATCAC  66 1478 1481148 N/A N/A 125750 125769 TGTTGCACTTTAATTTGCCA  16 1479 1481182 N/A N/A 173314 173333 AAGCATACCAAATACTTCCA  54 1480 1481187 N/A N/A 42007 42026 CATTTGCTACTCTCTCCATA  35 1481 1481220 N/A N/A 3420 3439 TATGACTGCTTTTAACCGTA  77 1482 1481225 N/A N/A 71475 71494 CCAGAATTTATCTTTGTGGA  15 1483 1481244 N/A N/A 222497 222516 TCTCATAGATACTTTTCCCT  36 1484 1481246 N/A N/A 161375 161394 ACACAGCTATTCCTGGGTAT 104 1485 1481258 N/A N/A 49321 49340 AGGATAACTACACTTTCTTC  69 1486 1481283 N/A N/A 120543 120562 GCCTTGATTCATTATAAGCA 114 1487 1481309 N/A N/A 18389 18408 TCAGCTTTTATATAAGGTCA  17 1488 1481324 4356 4375 224724 224743 GCTTAATCCTATGACAATAT  22 1489 1481330 N/A N/A 34790 34809 GCTGTTTTTACCTTTAGGTA   2 1490 1481343 N/A N/A 112323 112342 CTTGAGATCCTCTATCATTA  79 1491 1481358 N/A N/A 118026 118045 CTGTTATATAGAGCTCTATG  14 1492 1481369 N/A N/A 139187 139206 ACATCATCTATATCCTTTCA  46 1493 1481371 N/A N/A 86630 86649 GTGTAAGACATAATTTTTCA   8 1494 1481430 1158 1177 23033 23052 CTGGTAGAAGTATCAGTCAT  20 1495 1481442 1891 1910 109593 109612 CTGACCAAACACACTAGATT  19 1496 1481443 2133 2152 116089 116108 TCATTGAGTATCTTTAAGTA  73 1497 1481466 N/A N/A 137094 137113 GAAGATTTTCACTTTGGAAC  40 1498 1481485 3113 3132 212845 212864 CTAGTTCACAAACTGGCGGA  76 1499 1481493  411  430 4504 4523 CCAGACATTCCCAGATCACT  30 1500 1481530 N/A N/A 20736 20755 CTTCACAACTCCCACCTTCA  44 1501 1481565 1733 1752 92505 92524 CTTTGGTTTTCATATCAGTC  19 1502 1481581 N/A N/A 198903 198922 TCCTTGCTATTATAATAACT 134 1503 1481587 1763 1782 92535 92554 TAGTGTGGTCTAAAACCCAC  92 1504 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481621 N/A N/A 3526 3545 CATGATTAGTCACATCTATA  67 1505 1481646 N/A N/A 110123 110142 TAATCCTTTACTCACCTTCA  89 1506

TABLE-US-00025 TABLE 25 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479854 2772 2791 161620 161639 GAGCTCTTTCCACCCATGTT  77 1507 1479869 N/A N/A 63256 63275 GCTGTATTCAATGCCTGGAA  11 1508 1479905 N/A N/A 183439 183458 CCGCTTATTCAATCTGCCTT  35 1509 1479935 N/A N/A 140840 140859 GCATAAGGTACTTACTGATA  93 1510 1479941  410  429 4503 4522 CAGACATTCCCAGATCACTT  40 1511 1479988 N/A N/A 33566 33585 TGGTAAGACTTTCCCAGACT  11 1512 1480003 1157 1176 23032 23051 TGGTAGAAGTATCAGTCATT   2 1513 1480008 N/A N/A 178674 178693 TGGGCAACTCATCCTCTAAC  66 1514 1480022 2378 2397 123738 123757 TTCCAACCTTTACCCAATCA  37 1515 1480041 3833 3852 224201 224220 CCAGTTGCCAATTATCTGAA  52 1516 1480052 N/A N/A 161282 161301 GCATATTCTCCCTATTGCTT  65 1517 1480088 1762 1781 92534 92553 AGTGTGGTCTAAAACCCACA  99 1518 1480098 N/A N/A 202122 202141 GCAGCACCCATCCTACAAGC 125 1519 1480133 N/A N/A 41993 42012 TCCATATGCCAATTCCATAC   9 1520 1480163 N/A N/A 59060 59079 TTTGATTATACCTTTGCTTC  14 1521 1480166  464  483 13168 13187 CCAGAGACTTTGAAACATTC   5 1522 1480171 N/A N/A 222496 222515 CTCATAGATACTTTTCCCTC  31 1523 1480202 N/A N/A 36962 36981 CATTCCACATTTACTTGGCT   7 1524 1480212 N/A N/A 218687 218706 GCAGCAGACAGATAAGAGCT  66 1525 1480240 4350 4369 224718 224737 TCCTATGACAATATTTAACC  47 1526 1480244 2132 2151 116088 116107 CATTGAGTATCTTTAAGTAA  47 1527 1480252 2866 2885 161714 161733 AATGCCATCCACAATCCCAA  57 1528 1480268 N/A N/A 9870 9889 AAGGGCTATTATTCTCTACC  15 1529 1480284 N/A N/A 3181 3200 CTGCCATTAAAAACCTGCAT  98 1530 1480297 N/A N/A 144436 144455 ACAGTTCTATATCAACTCCT  42 1531 1480344 N/A N/A 81342 81361 GTGTTAACTCATATCAGGTC  10 1532 1480366  886  905 20257 20276 ATGGCAATAAATATTGAGCT   2 1533 1480383 N/A N/A 17572 17591 GAACCATGATTCTCTTGGTA  71 1534 1480393 N/A N/A 78250 78269 TCAGCAACTTTATTTTTGGC  11 1535 1480430 N/A N/A 3500 3519 TAAGAAACTTTATCCACCCA  62 1536 1480460 N/A N/A 20735 20754 TTCACAACTCCCACCTTCAA  53 1537 1480498 N/A N/A 120527 120546 AGCAATCTCTCATATTCTTC  10 1538 1480534 N/A N/A 3525 3544 ATGATTAGTCACATCTATAC  72 1539 1480542 N/A N/A 149045 149064 CCAGACTTGATTTCTGCTCT 117 1540 1480562 1550 1569 76867 76886 TCTCTAAGTTAACAATGCCA  20 1541 1480565 N/A N/A 86462 86481 TCTACCAATTATCTCAGGGT  38 1542 1480585 N/A N/A 126831 126850 CATTGTAAACTCACTCTAGA  85 1543 1480604 N/A N/A 110090 110109 TTTGCATACTAACTACCACC  40 1544 1480653 N/A N/A 63369 63388 TCAGGTCTCCATTCAAGTCA  20 1545 1480654 N/A N/A 26337 26356 ATGCCAACTTGAACCTGCTC  40 1546 1480655 N/A N/A 204326 204345 CTGAGTTACATCTTTTTGCA  20 1547 1480658 N/A N/A 118024 118043 GTTATATAGAGCTCTATGTG  12 1548 1480746 N/A N/A 100085 100104 ACACTTTGCATACATACCTT  25 1549 1480752  815  834 18252 18271 ATTCCACACACAAAACTGCA  26 1550 1480757 N/A N/A 198708 198727 CAGCCACATCTTTTCTTGTA  69 1551 1480765 N/A N/A 89547 89566 CCCTTGTATTTGCCTGACCT  82 1552 1480806  624  643 13328 13347 CGTTTCGAATCTTCAGAAGA  78 1553 1480838 N/A N/A 134983 135002 AGGTACTTTTTTCACTTATC  19 1554 1480871 N/A N/A 173309 173328 TACCAAATACTTCCATGCAT  76 1555 1480877 N/A N/A 135669 135688 ATGAAAAATATCTTACCTGC  96 1556 1480902 N/A N/A 103680 103699 GCAGCAGTCAATTCACTTCC  23 1557 1480920 N/A N/A 112318 112337 GATCCTCTATCATTATCACC  30 1558 1480924 3591 3610 223959 223978 CATGGTCATAATTTTATGCT  29 1559 1480959 3286 3305 221191 221210 TAGTTTAGCCACATTTAATC  54 1560 1480967 N/A N/A 125685 125704 CTGATGTTCTAACTCATCTC  98 1561 1480999 N/A N/A 93072 93091 AAGCATTTCACACCTAACCC  48 1562 1481008 2254 2273 116924 116943 TTGCAAATGCATTCGGATCT  31 1563 1481009 2675 2694 140784 140803 CCAGCAACACATCAATCACA  31 1564 1481012 N/A N/A 71368 71387 TAATGTTACTTTCACTGCAT  41 1565 1481030 N/A N/A 168357 168376 ACCCAATATATTCTTCTAGC  36 1566 1481072 N/A N/A 107580 107599 CCAGAATCTTTAATTGTCCT  28 1567 1481099 N/A N/A 3327 3346 CCCAATCCAGCACTTTTTTA  78 1568 1481113 3186 3205 212918 212937 TCCAGTTTGCTTTCATCCTC  62 1569 1481115 1421 1440 73453 73472 GAATTCTGTCATCCTGCACA  28 1570 1481126 N/A N/A 139184 139203 TCATCTATATCCTTTCAATC  61 1571 1481184 2997 3016 202233 202252 CTTCCTAGTTCATCCAAGAT  65 1572 1481190 3083 3102 212815 212834 CAAACAGGGTTAAGGATTTC  61 1573 1481221 N/A N/A 18309 18328 GCCTGAAAAGACGACTTACC  93 1574 1481274 1890 1909 109592 109611 TGACCAAACACACTAGATTC  31 1575 1481291 1345 1364 27018 27037 AAGCAGCAGCTCTACTGGCT  72 1576 1481317 N/A N/A 165065 165084 CAGAACATTAATCTTCTCCA  50 1577 1481368 1491 1510 73523 73542 GCATAAAACTCTGTAACTGC  19 1578 1481417 N/A N/A 49320 49339 GGATAACTACACTTTCTTCA  32 1579 1481452 N/A N/A 21598 21617 TAGGCATTTAACTCTGTCTT  58 1580 1481476 3744 3763 224112 224131 ACTTAAGGCTTTACTGGACT  48 1581 1481577 N/A N/A 3418 3437 TGACTGCTTTTAACCGTAGT  82 1582 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481631 N/A N/A 2960 2979 CCAGACAGAACCTACTATGT  98 1583

TABLE-US-00026 TABLE 26 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479809 N/A N/A 3524 3543 TGATTAGTCACATCTATACC  60 1584 1479813 N/A N/A 9365 9384 GCAGTAGAATCTATCCACAA  26 1585 1479899 N/A N/A 18307 18326 CTGAAAAGACGACTTACCTC  70 1586 1479907 N/A N/A 140839 140858 CATAAGGTACTTACTGATAA 145 1587 1479912 N/A N/A 161022 161041 ACAACTTAATTTTCTAGGAC  76 1588 1479916 3590 3609 223958 223977 ATGGTCATAATTTTATGCTC  23 1589 1479919 N/A N/A 3406 3425 ACCGTAGTGATTTCAAATAT  65 1590 1479921 N/A N/A 112315 112334 CCTCTATCATTATCACCATA  55 1591 1479930 2376 2395 123736 123755 CCAACCTTTACCCAATCAGT  44 1592 1479939  409  428 4502 4521 AGACATTCCCAGATCACTTC  43 1593 1479983  885  904 20256 20275 TGGCAATAAATATTGAGCTC  11 1594 1479993 N/A N/A 17509 17528 CCACATTTTCAACATTAGTA  10 1595 1479996 N/A N/A 36961 36980 ATTCCACATTTACTTGGCTC   6 1596 1480000 N/A N/A 196608 196627 GCACAATATCTTTACCTGCT 110 1597 1480013 N/A N/A 173308 173327 ACCAAATACTTCCATGCATT  37 1598 1480025 3185 3204 212917 212936 CCAGTTTGCTTTCATCCTCA  31 1599 1480045 N/A N/A 217596 217615 CTCCACTTTAAATTATGGTA  41 1600 1480047 N/A N/A 71287 71306 TCTGTATCACGACCACAGTC  67 1601 1480068 2865 2884 161713 161732 ATGCCATCCACAATCCCAAT  40 1602 1480177 N/A N/A 93070 93089 GCATTTCACACCTAACCCCT  41 1603 1480190 N/A N/A 126830 126849 ATTGTAAACTCACTCTAGAA 126 1604 1480192 N/A N/A 204325 204344 TGAGTTACATCTTTTTGCAA  20 1605 1480232 N/A N/A 25355 25374 ACCCACAATATCTATCACCC  22 1606 1480242 N/A N/A 120518 120537 TCATATTCTTCTCCTGGGAC  54 1607 1480248 N/A N/A 139181 139200 TCTATATCCTTTCAATCTCC  77 1608 1480279 N/A N/A 58651 58670 GTGCACATATTCTCAGTTAA 120 1609 1480314  808  827 18245 18264 ACACAAAACTGCATCTTTGT  14 1610 1480334 3832 3851 224200 224219 CAGTTGCCAATTATCTGAAC  68 1611 1480357 N/A N/A 168356 168375 CCCAATATATTCTTCTAGCT  33 1612 1480359 N/A N/A 134384 134403 CACTACATATTCTTTACAAC  42 1613 1480362 N/A N/A 144434 144453 AGTTCTATATCAACTCCTAC  55 1614 1480365 N/A N/A 103678 103697 AGCAGTCAATTCACTTCCAT  54 1615 1480372 N/A N/A 202121 202140 CAGCACCCATCCTACAAGCA  65 1616 1480387 3743 3762 224111 224130 CTTAAGGCTTTACTGGACTT  56 1617 1480399 1343 1362 27016 27035 GCAGCAGCTCTACTGGCTGC  87 1618 1480421 N/A N/A 178581 178600 ACTCAATGTTAACTATAGCT  41 1619 1480437 N/A N/A 85647 85666 AAGGGTTATATCTACCAGCA  15 1620 1480458 2234 2253 116904 116923 CGTCAATAACACCTTGAATT  11 1621 1480589 N/A N/A 41979 41998 CCATACTAACTTACCATTGC   7 1622 1480621 N/A N/A 148833 148852 TCTTGCTTATTTATTACCAA  22 1623 1480623 2131 2150 116087 116106 ATTGAGTATCTTTAAGTAAT  58 1624 1480671 N/A N/A 48845 48864 CAGGAAGATCTTTTCTCCAC  32 1625 1480739 N/A N/A 63368 63387 CAGGTCTCCATTCAAGTCAT  17 1626 1480743 N/A N/A 110089 110108 TTGCATACTAACTACCACCA  34 1627 1480769 N/A N/A 81341 81360 TGTTAACTCATATCAGGTCT  13 1628 1480779 2996 3015 202232 202251 TTCCTAGTTCATCCAAGATA  50 1629 1480780 N/A N/A 78236 78255 TTTGGCTTAATATACTGTTC  11 1630 1480840 3081 3100 212813 212832 AACAGGGTTAAGGATTTCAC  16 1631 1480863 N/A N/A 32695 32714 TGCTATTCAACATAATAGTC  58 1632 1480888 3285 3304 221190 221209 AGTTTAGCCACATTTAATCC  37 1633 1481027 1549 1568 76866 76885 CTCTAAGTTAACAATGCCAG   9 1634 1481033 N/A N/A 135666 135685 AAAAATATCTTACCTGCAGT 100 1635 1481066 N/A N/A 222495 222514 TCATAGATACTTTTCCCTCA  21 1636 1481076 N/A N/A 21582 21601 TCTTAATTCTGACTTCAGCC  12 1637 1481139 1155 1174 23030 23049 GTAGAAGTATCAGTCATTAT   5 1638 1481192 1760 1779 92532 92551 TGTGGTCTAAAACCCACAGC  77 1639 1481194 N/A N/A 100080 100099 TTGCATACATACCTTCACCT  38 1640 1481211 N/A N/A 125680 125699 GTTCTAACTCATCTCTGTCA  20 1641 1481215 N/A N/A 3326 3345 CCAATCCAGCACTTTTTTAA  85 1642 1481251 N/A N/A 3180 3199 TGCCATTAAAAACCTGCATA 124 1643 1481257 2771 2790 161619 161638 AGCTCTTTCCACCCATGTTT  16 1644 1481335  463  482 13167 13186 CAGAGACTTTGAAACATTCC   5 1645 1481385 1889 1908 109591 109610 GACCAAACACACTAGATTCT  25 1646 1481415 N/A N/A 2955 2974 CAGAACCTACTATGTGCGGC  61 1647 1481422 2674 2693 140783 140802 CAGCAACACATCAATCACAG  24 1648 1481450 N/A N/A 165064 165083 AGAACATTAATCTTCTCCAC  43 1649 1481456 N/A N/A 89542 89561 GTATTTGCCTGACCTGATTC 107 1650 1481477 1490 1509 73522 73541 CATAAAACTCTGTAACTGCC  18 1651 1481481 4348 4367 224716 224735 CTATGACAATATTTAACCTT  52 1652 1481495 N/A N/A 63255 63274 CTGTATTCAATGCCTGGAAC  16 1653 1481510 N/A N/A 20734 20753 TCACAACTCCCACCTTCAAC  76 1654 1481543 N/A N/A 183345 183364 CTGGTGACTACTCATTTGTA  39 1655 1481553 N/A N/A 117850 117869 CATTCAACAATCTTTTGGCA  23 1656 1481564 N/A N/A 73448 73467 CTGTCATCCTGCACACTGAA   8 1657 1481568 N/A N/A 107472 107491 GCATATCTTTCAATGACTTA  26 1658 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481608  621  640 13325 13344 TTCGAATCTTCAGAAGAAAC  72 1659 1481611 N/A N/A 3499 3518 AAGAAACTTTATCCACCCAA  47 1660

TABLE-US-00027 TABLE 27 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479837 3737 3756 224105 224124 GCTTTACTGGACTTACTGTC  42 1661 1479844 N/A N/A 99955 99974 ATGGTTATTTACAACCTCAC  69 1662 1479855 N/A N/A 17492 17511 GTACTCCTACTATTCTTACC  37 1663 1479864 N/A N/A 8540 8559 ACCATGACTTCCTTTATGCT  16 1664 1479872 N/A N/A 63233 63252 TGCCTAGTATAAAACAGGTA  63 1665 1479878 1871 1890 109573 109592 CTGAATGGAGAACTTCCGAT   8 1666 1479929  170  189 2817 2836 TGGATTTCAGGCTTCCCGTA  32 1667 1479944 N/A N/A 89538 89557 TTGCCTGACCTGATTCTGTA  53 1668 1479953  790  809 18227 18246 GTGCTGCTGCTTCATTTCTA   9 1669 1479967 3184 3203 212916 212935 CAGTTTGCTTTCATCCTCAC  58 1670 1480037 N/A N/A 165063 165082 GAACATTAATCTTCTCCACC   6 1671 1480105 N/A N/A 48424 48443 GCAAACATTTTCCTACAGCA   4 1672 1480107 N/A N/A 178433 178452 CTGCACACATTATAACCTCA  35 1673 1480148 1548 1567 76865 76884 TCTAAGTTAACAATGCCAGA   9 1674 1480153 N/A N/A 217576 217595 GTTCTCATATCTTCAAGGTA  18 1675 1480234 N/A N/A 203625 203644 ATGAAACTGTATTACTGCAC  20 1676 1480238 N/A N/A 25354 25373 CCCACAATATCTATCACCCT  34 1677 1480241 N/A N/A 81256 81275 ACAGACAGTTATCTTGGCAC  20 1678 1480280 N/A N/A 30158 30177 GCTAACTTTTGAATTTCCTC   5 1679 1480301 N/A N/A 222187 222206 TAGGCATTACTATTTCAATA  12 1680 1480303 N/A N/A 20732 20751 ACAACTCCCACCTTCAACAA  74 1681 1480307 N/A N/A 126829 126848 TTGTAAACTCACTCTAGAAA 100 1682 1480319 2673 2692 140782 140801 AGCAACACATCAATCACAGG  15 1683 1480348 1325 1344 26998 27017 GCAGGCTTGACATCCGGGTT   4† 1684 1480349 N/A N/A 135663 135682 AATATCTTACCTGCAGTAAT  77 1685 1480380 N/A N/A 85636 85655 CTACCAGCATCCTAAGGTAT 123 1686 1480385 2233 2252 116903 116922 GTCAATAACACCTTGAATTT  24 1687 1480390  462  481 13166 13185 AGAGACTTTGAAACATTCCT   2 1688 1480412 N/A N/A 160998 161017 CTGTACTGATCAATTATAGT  53 1689 1480414 N/A N/A 148831 148850 TTGCTTATTTATTACCAATC  42 1690 1480425 N/A N/A 120412 120431 GCCGAAACTCTTACTCACTC  11 1691 1480492 3831 3850 224199 224218 AGTTGCCAATTATCTGAACT  30 1692 1480499 N/A N/A 202120 202139 AGCACCCATCCTACAAGCAA  93 1693 1480521 N/A N/A 117445 117464 GTAGTTTTTCACTCTAGACT   6 1694 1480554 N/A N/A 78201 78220 TTGGTCATATATTAATAGCT   9 1695 1480580 N/A N/A 39667 39686 TGTCTTACTTATTATTGGCC   7 1696 1480594 N/A N/A 139085 139104 TACTATCACATCTTTCAGCA  26 1697 1480605 2127 2146 116083 116102 AGTATCTTTAAGTAATGCTC  41 1698 1480642 N/A N/A 18306 18325 TGAAAAGACGACTTACCTCT  56 1699 1480659 N/A N/A 71271 71290 AGTCTCTTAATTTCTAGGGC  18 1700 1480740 N/A N/A 110088 110107 TGCATACTAACTACCACCAC  33 1701 1480764 N/A N/A 168243 168262 GTGAACTATTTAACTGAACA  21 1702 1480772 N/A N/A 92992 93011 TTGCTAACTTGATCCCACCA  52 1703 1480782 4326 4345 224694 224713 AAATTTCATGACCTTATTCC  32 1704 1480795 N/A N/A 36830 36849 CCGACCACTTAATAACATTT  13 1705 1480796 N/A N/A 112285 112304 TTGGTACATATTCCAGGGCA  18 1706 1480837 N/A N/A 3497 3516 GAAACTTTATCCACCCAAAC  39 1707 1480839 3284 3303 221189 221208 GTTTAGCCACATTTAATCCA  28 1708 1480856 3589 3608 223957 223976 TGGTCATAATTTTATGCTCA  29 1709 1480864 N/A N/A 212811 212830 CAGGGTTAAGGATTTCACCT  53 1710 1480876 N/A N/A 3179 3198 GCCATTAAAAACCTGCATAA  49 1711 1480904 N/A N/A 57928 57947 CCACAAATTTTGCCTCCAAC  17 1712 1480917 2864 2883 161712 161731 TGCCATCCACAATCCCAATT  51 1713 1480918 N/A N/A 3304 3323 AATCAGTAAAACTCTTCGAC  50 1714 1480944  883  902 20254 20273 GCAATAAATATTGAGCTCTC  12 1715 1480952 N/A N/A 103677 103696 GCAGTCAATTCACTTCCATT  10 1716 1480964  408  427 4501 4520 GACATTCCCAGATCACTTCC  37 1717 1480968 N/A N/A 144433 144452 GTTCTATATCAACTCCTACT  26 1718 1480981 N/A N/A 63367 63386 AGGTCTCCATTCAAGTCATC  26 1719 1481063 2375 2394 123735 123754 CAACCTTTACCCAATCAGTT  32 1720 1481064 2995 3014 202231 202250 TCCTAGTTCATCCAAGATAA  36 1721 1481159 N/A N/A 107299 107318 CCAGACTTAATCCCTTTACT  23 1722 1481168 N/A N/A 140836 140855 AAGGTACTTACTGATAAATC  50 1723 1481186 N/A N/A 172634 172653 TTTGTTTCACTTCATACCCT  24 1724 1481235 N/A N/A 3523 3542 GATTAGTCACATCTATACCA  64 1725 1481248 N/A N/A 125512 125531 AGGCCAACATATTTATCAAA  61 1726 1481263 N/A N/A 191631 191650 CAGGACATATACTCCATGCC  57 1727 1481292 N/A N/A 73445 73464 TCATCCTGCACACTGAAAGA  46 1728 1481296  582  601 13286 13305 AGACTGATATCATCAAAATC  23 1729 1481312 N/A N/A 20854 20873 GTCCAAAAAGGATATCTTCT  99 1730 1481356 1152 1171 23027 23046 GAAGTATCAGTCATTATCTC   3 1731 1481386 N/A N/A 134244 134263 CAGTGCAATTTTACAGACTC  23 1732 1481487 1758 1777 92530 92549 TGGTCTAAAACCCACAGCAA  78 1733 1481512 1489 1508 73521 73540 ATAAAACTCTGTAACTGCCT  16 1734 1481545 N/A N/A 183258 183277 GTTCTTACCAAACTTTTCCT  28 1735 1481554 2768 2787 161616 161635 TCTTTCCACCCATGTTTGGT  47 1736 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481641 N/A N/A 3405 3424 CCGTAGTGATTTCAAATATT  22 1737

TABLE-US-00028 TABLE 28 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479812 N/A N/A 191630 191649 AGGACATATACTCCATGCCA  79 1738 1479832 N/A N/A 63364 63383 TCTCCATTCAAGTCATCATC  47 1739 1479835 1150 1169 23025 23044 AGTATCAGTCATTATCTCAT   1 1740 1479848 N/A N/A 164978 164997 TTACATCTTTACCTTTGATC  65 1741 1479856 N/A N/A 57913 57932 CCAACAGCACCTTTTTCACT  33 1742 1479888 N/A N/A 168143 168162 TCATGGCTCCATTTTAAGCC  67 1743 1479904 N/A N/A 3522 3541 ATTAGTCACATCTATACCAT  80 1744 1479943 3282 3301 221187 221206 TTAGCCACATTTAATCCATA  22 1745 1479948 N/A N/A 20853 20872 TCCAAAAAGGATATCTTCTC 104 1746 1480023 N/A N/A 133282 133301 GTGCCTACTTTCTACATTTA  57 1747 1480100 N/A N/A 3403 3422 GTAGTGATTTCAAATATTGA  50 1748 1480135 N/A N/A 135655 135674 ACCTGCAGTAATCTCCTTGC  71 1749 1480173 3736 3755 224104 224123 CTTTACTGGACTTACTGTCC 155 1750 1480183 N/A N/A 110087 110106 GCATACTAACTACCACCACA  14 1751 1480246 N/A N/A 112164 112183 GACATCACCCACTATGTGGT  52 1752 1480255  459  478 13163 13182 GACTTTGAAACATTCCTGGT  16 1753 1480313 3828 3847 224196 224215 TGCCAATTATCTGAACTGAA  15 1754 1480343  581  600 13285 13304 GACTGATATCATCAAAATCA  20 1755 1480407 N/A N/A 3496 3515 AAACTTTATCCACCCAAACT  85 1756 1480466 N/A N/A 48387 48406 CCATTTAGTCACTACCATCT   7 1757 1480468 N/A N/A 85347 85366 ACTCCATATTACTCTAACCC  70 1758 1480482 N/A N/A 30087 30106 GCAGATTTAACTTTTGACTT   5 1759 1480545 3579 3598 223947 223966 TTTATGCTCACATGTCACAC  21 1760 1480611 N/A N/A 63232 63251 GCCTAGTATAAAACAGGTAC  99 1761 1480632 N/A N/A 172569 172588 TTCAACACATGATTTCTCCA  45 1762 1480646  407  426 4500 4519 ACATTCCCAGATCACTTCCT  54 1763 1480677 N/A N/A 148830 148849 TGCTTATTTATTACCAATCT  55 1764 1480692 N/A N/A 120411 120430 CCGAAACTCTTACTCACTCC  12 1765 1480703 2671 2690 140780 140799 CAACACATCAATCACAGGGT  14 1766 1480744 3180 3199 212912 212931 TTGCTTTCATCCTCACTGAC  45 1767 1480760 N/A N/A 160177 160196 TAGCCACACATTTCCAGTCT  55 1768 1480773 2994 3013 202230 202249 CCTAGTTCATCCAAGATAAC 156 1769 1480802 N/A N/A 217550 217569 GCAACCACTCTTCTATAATC  89 1770 1480824 2125 2144 116081 116100 TATCTTTAAGTAATGCTCCA  89 1771 1480847 N/A N/A 89534 89553 CTGACCTGATTCTGTAGGAT  55 1772 1480899 N/A N/A 36645 36664 GCATAACAATTCCTCTGATA   2 1773 1480909 N/A N/A 125510 125529 GCCAACATATTTATCAAAGC  12 1774 1480980 N/A N/A 103567 103586 TGATCCAGCATATCTAGTTA  41 1775 1480998 N/A N/A 140835 140854 AGGTACTTACTGATAAATCT  94 1776 1481000 N/A N/A 183252 183271 ACCAAACTTTTCCTACGGGA  31 1777 1481025 N/A N/A 99954 99973 TGGTTATTTACAACCTCACA  82 1778 1481057 N/A N/A 117416 117435 TAGCAGCTATACTCTTAACT  20 1779 1481059 1487 1506 73519 73538 AAAACTCTGTAACTGCCTGG  14 1780 1481097 N/A N/A 3303 3322 ATCAGTAAAACTCTTCGACC  62 1781 1481120 N/A N/A 202118 202137 CACCCATCCTACAAGCAAGA  84 1782 1481134 N/A N/A 92844 92863 AGGCATCTATCCTCACTTTC  40 1783 1481136 N/A N/A 212808 212827 GGTTAAGGATTTCACCTAAA  52 1784 1481143 N/A N/A 71270 71289 GTCTCTTAATTTCTAGGGCT  40 1785 1481146 N/A N/A 81167 81186 CCATAAGTTTATTTCCAGAC   4 1786 1481165  785  804 18222 18241 GCTGCTTCATTTCTATGTAT  22 1787 1481205 2372 2391 123732 123751 CCTTTACCCAATCAGTTGGT  68 1788 1481269 1870 1889 109572 109591 TGAATGGAGAACTTCCGATA  38 1789 1481290  167  186 2814 2833 ATTTCAGGCTTCCCGTAGAC  31 1790 1481336 2862 2881 161710 161729 CCATCCACAATCCCAATTGT  64 1791 1481340 2231 2250 116901 116920 CAATAACACCTTGAATTTCA  21 1792 1481350 1757 1776 92529 92548 GGTCTAAAACCCACAGCAAA  59 1793 1481437 N/A N/A 18304 18323 AAAAGACGACTTACCTCTGC 111 1794 1481453 N/A N/A 3178 3197 CCATTAAAAACCTGCATAAC 107 1795 1481457 N/A N/A 202692 202711 TGTGTAGCATTCTAATGATC  21 1796 1481471 1547 1566 76864 76883 CTAAGTTAACAATGCCAGAA   5 1797 1481479 N/A N/A 178432 178451 TGCACACATTATAACCTCAT  40 1798 1481484  880  899 20251 20270 ATAAATATTGAGCTCTCGGG  14 1799 1481500 N/A N/A 78200 78219 TGGTCATATATTAATAGCTC   9 1800 1481505 N/A N/A 126827 126846 GTAAACTCACTCTAGAAAAT  81 1801 1481508 1312 1331 26985 27004 CCGGGTTTCTAGCTCTGAAC   3† 1802 1481580  987 1006 20738 20757 TGCTTCACAACTCCCACCTT  38 1803 1481586 N/A N/A 17488 17507 TCCTACTATTCTTACCTTTC  46 1804 1481591 N/A N/A 8539 8558 CCATGACTTCCTTTATGCTA  20 1805 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481597 N/A N/A 143714 143733 TGGTACTTATTAACTTGTTT  18 1806 1481606 N/A N/A 23944 23963 ATGGTATTTTATATCAGCCA  25 1807 1481607 N/A N/A 138875 138894 CATGAAATTTCACCATCACC  42 1808 1481619 N/A N/A 222083 222102 GCCAAGATTTTCTATTCGAT  31 1809 1481623 N/A N/A 39653 39672 TTGGCCCTTTGATCTATCTT  44 1810 1481624 N/A N/A 72898 72917 ACTGCTATTTTATATCACCT   8 1811 1481626 4325 4344 224693 224712 AATTTCATGACCTTATTCCT  31 1812 1481627 N/A N/A 107213 107232 TGGGAATTTACTACTTCACT  22 1813 1481643 2767 2786 161615 161634 CTTTCCACCCATGTTTGGTC  29 1814

TABLE-US-00029 TABLE 29 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479838 N/A N/A 3400 3419 GTGATTTCAAATATTGAGCC  35 1815 1479859 N/A N/A 202551 202570 ACGGTATTATGACTACAGCA  20 1816 1479884 N/A N/A 63231 63250 CCTAGTATAAAACAGGTACT  67 1817 1479918 N/A N/A 222082 222101 CCAAGATTTTCTATTCGATC  20 1818 1479931 2229 2248 116899 116918 ATAACACCTTGAATTTCATC  20 1819 1479945 N/A N/A 18303 18322 AAAGACGACTTACCTCTGCA  99 1820 1479956 N/A N/A 63363 63382 CTCCATTCAAGTCATCATCT  24 1821 1479959 N/A N/A 3302 3321 TCAGTAAAACTCTTCGACCA  81 1822 1480011 1149 1168 23024 23043 GTATCAGTCATTATCTCATC   1 1823 1480075 N/A N/A 48382 48401 TAGTCACTACCATCTCTACT  27 1824 1480097  878  897 20249 20268 AAATATTGAGCTCTCGGGCT  41 1825 1480121 N/A N/A 110055 110074 GCAGATTTTTCCATAGTTTA  13 1826 1480126 N/A N/A 6464 6483 GTCTTATTTCAACAACATTC  12 1827 1480164 1869 1888 109571 109590 GAATGGAGAACTTCCGATAC  20 1828 1480165 N/A N/A 217547 217566 ACCACTCTTCTATAATCGCC  43 1829 1480176 1756 1775 92528 92547 GTCTAAAACCCACAGCAAAC  70 1830 1480213 N/A N/A 212806 212825 TTAAGGATTTCACCTAAAGC 103 1831 1480217 N/A N/A 133248 133267 TCAGATATTCTGTACGACCT  16 1832 1480225 2669 2688 140778 140797 ACACATCAATCACAGGGTGC  63 1833 1480263 1545 1564 76862 76881 AAGTTAACAATGCCAGAAAT  19 1834 1480361 3568 3587 223936 223955 ATGTCACACAAAGATAGGCT  23 1835 1480386 N/A N/A 36609 36628 GTTATCACTTCATTTTGGCA   2 1836 1480435 N/A N/A 168124 168143 CCTCATCCTTATTTATTCAC  70 1837 1480450 4324 4343 224692 224711 ATTTCATGACCTTATTCCTT  37 1838 1480469 N/A N/A 3521 3540 TTAGTCACATCTATACCATC  70 1839 1480475 N/A N/A 182994 183013 GTAATCATTTTATACTCCTA  23 1840 1480480 2861 2880 161709 161728 CATCCACAATCCCAATTGTC  74   11 1480484  770  789 18207 18226 TGTATTGTAATTCTAGCGGC   8 1841 1480488 N/A N/A 120368 120387 CCACACTTAACCCATTCCTC  26 1842 1480656 2371 2390 123731 123750 CTTTACCCAATCAGTTGGTA  74 1843 1480668 N/A N/A 148829 148848 GCTTATTTATTACCAATCTC  32 1844 1480672 1842 1861 109544 109563 AGCCGGGCATTTATTTCCCT  52 1845 1480694 N/A N/A 23931 23950 TCAGCCAATTATCATTTCTC  20 1846 1480725 N/A N/A 3494 3513 ACTTTATCCACCCAAACTGT 142 1847 1480732 N/A N/A 20354 20373 AGCCAAAGCTGACCTTATAT  76 1848 1480738 3827 3846 224195 224214 GCCAATTATCTGAACTGAAA  19 1849 1480845 N/A N/A 160176 160195 AGCCACACATTTCCAGTCTC  51 1850 1480852 N/A N/A 126822 126841 CTCACTCTAGAAAATCAAGC  72 1851 1480893 N/A N/A 125509 125528 CCAACATATTTATCAAAGCT  11 1852 1480991 1709 1728 89524 89543 TCTGTAGGATTTCCAGATTC  45 1853 1480995 N/A N/A 143282 143301 ACATGCATTATATACTACCA  27 1854 1481043 N/A N/A 178430 178449 CACACATTATAACCTCATGC  35 1855 1481061 N/A N/A 29371 29390 TCTTGATCACCATTTCTCAT  46 1856 1481074 N/A N/A 138874 138893 ATGAAATTTCACCATCACCA  26 1857 1481081 N/A N/A 107154 107173 TCATTTCTTATCCCTACATT  72 1858 1481096 N/A N/A 81097 81116 CTGTCTTTTTTTAATCCCAC  58 1859 1481098 N/A N/A 14937 14956 TCATCAGATACATTACATTC  65 1860 1481160 1485 1504 73517 73536 AACTCTGTAACTGCCTGGAA   7 1861 1481170 N/A N/A 186977 186996 GCAAATTCTTATTTTAGGGC  18 1862 1481172 2752 2771 161600 161619 TGGTCCGGTAATTATCATTA  23 1863 1481180 N/A N/A 102864 102883 ATGCAACATTCTATTACTTC  14 1864 1481183 N/A N/A 140832 140851 TACTTACTGATAAATCTGTA  81 1865 1481217 1307 1326 26980 26999 TTTCTAGCTCTGAACGAGAA  15† 1866 1481222 N/A N/A 3175 3194 TTAAAAACCTGCATAACCTT  82 1867 1481227 3178 3197 212910 212929 GCTTTCATCCTCACTGACCA  25 1868 1481233 N/A N/A 117314 117333 ATCAAAGACTAACTTCTCTT  63 1869 1481252  142  161 2789 2808 GAATCGGCTCAAAACCGCTT  48 1870 1481273 N/A N/A 20852 20871 CCAAAAAGGATATCTTCTCC 101 1871 1481276 N/A N/A 85344 85363 CCATATTACTCTAACCCTGC  54 1872 1481294 N/A N/A 71164 71183 ATTTTAGGTTCACTTACCTT 114 1873 1481295 N/A N/A 112011 112030 GTTACCAGATCATTTCTACT  18 1874 1481360  405  424 4498 4517 ATTCCCAGATCACTTCCTCC  62 1875 1481362 3281 3300 221186 221205 TAGCCACATTTAATCCATAA  37 1876 1481366 N/A N/A 77978 77997 CAGCAACCTTGAACCAGCAC  42 1877 1481396 N/A N/A 39384 39403 CGTTAAGACCTTATTTTCTT   2 1878 1481406 3735 3754 224103 224122 TTTACTGGACTTACTGTCCA 131 1879 1481410 N/A N/A 202117 202136 ACCCATCCTACAAGCAAGAT  89 1880 1481412 N/A N/A 135654 135673 CCTGCAGTAATCTCCTTGCT  93 1881 1481431 2118 2137 116074 116093 AAGTAATGCTCCACTGGACT  21 1882 1481480  577  596 13281 13300 GATATCATCAAAATCAGTAC  37 1883 1481504 2993 3012 202229 202248 CTAGTTCATCCAAGATAACC  61 1884 1481525 N/A N/A 57912 57931 CAACAGCACCTTTTTCACTC  31 1885 1481535 N/A N/A 99774 99793 TGCTGAAGTCCTTATCCCTC  28 1886 1481579  458  477 13162 13181 ACTTTGAAACATTCCTGGTC  35 1887 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481610 N/A N/A 171328 171347 ACCATGTAAGCATTTCACCA  22 1888 1481617 N/A N/A 164898 164917 GTCTCAGAATAATTCTACTT  33 1889 1481639 N/A N/A 72897 72916 CTGCTATTTTATATCACCTA  14 1890

TABLE-US-00030 TABLE 30 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479818 N/A N/A 81095 81114 GTCTTTTTTTAATCCCACCC  60 1891 1479824 N/A N/A 125497 125516 TCAAAGCTTTATCTTCTGGA  11 1892 1479826 N/A N/A 71159 71178 AGGTTCACTTACCTTCGGTC  25 1893 1479831 N/A N/A 178429 178448 ACACATTATAACCTCATGCA  41 1894 1479841  555  574 13259 13278 TTTGGCAGAACTGCAAATCT  23 1895 1479858  363  382 4456 4475 ACTTTCTTTTTAACAGGCCC  11   19 1479871 N/A N/A 112010 112029 TTACCAGATCATTTCTACTC  46 1896 1479877 N/A N/A 6395 6414 ATCATCAATTCTCTTCATCT  31 1897 1479897 1534 1553 76851 76870 GCCAGAAATAATTTGAGAAC  27 1898 1479913 1287 1306 26960 26979 GCAGAGTCCTGGAAACTATC   1† 1899 1479958 N/A N/A 20353 20372 GCCAAAGCTGACCTTATATC  58 1900 1479973 N/A N/A 20847 20866 AAGGATATCTTCTCCAATAA  70 1901 1479992 N/A N/A 23916 23935 TTCTCTTTAACTATCCCCTC  23 1902 1479998 N/A N/A 117190 117209 GTTGCATTACTTTAACAAGA  11 1903 1480010 N/A N/A 63225 63244 ATAAAACAGGTACTCAACCT 110 1904 1480021 N/A N/A 222081 222100 CAAGATTTTCTATTCGATCA  33 1905 1480039  746  765 18183 18202 AGATGCTTTTGGACCGTTTG   2 1906 1480050 1868 1887 109570 109589 AATGGAGAACTTCCGATACA  28 1907 1480053 N/A N/A 3520 3539 TAGTCACATCTATACCATCC  49 1908 1480072 1705 1724 89520 89539 TAGGATTTCCAGATTCCTTA  74 1909 1480143 N/A N/A 202316 202335 CAGTTTACCGGATACTTACA  64 1910 1480243 N/A N/A 39275 39294 CTGTACTGAAACACTATTCA  13 1911 1480262 N/A N/A 3371 3390 CAGTCTTAAAAACTGGAGAC  55 1912 1480309 N/A N/A 3301 3320 CAGTAAAACTCTTCGACCAC  48 1913 1480311 N/A N/A 126821 126840 TCACTCTAGAAAATCAAGCC  50 1914 1480317 N/A N/A 168004 168023 ACATACACTTCTCTAGCATT  29 1915 1480341 2361 2380 123721 123740 TCAGTTGGTATACAAGATAC  39 1916 1480358 N/A N/A 14893 14912 TGCTGAACTCAATTTAACCT  41 1917 1480374 1746 1765 92518 92537 CACAGCAAACTTCCTTTGGT  47 1918 1480376 3177 3196 212909 212928 CTTTCATCCTCACTGACCAA  40 1919 1480424 N/A N/A 29370 29389 CTTGATCACCATTTCTCATA  64 1920 1480454  140  159 2787 2806 ATCGGCTCAAAACCGCTTGC  78 1921 1480459 N/A N/A 99575 99594 AGGAGCTACATCTACAAGCC  57 1922 1480477 N/A N/A 47858 47877 GCCTAGTTATCATCAATATC  36 1923 1480506 N/A N/A 171325 171344 ATGTAAGCATTTCACCAGAT  17 1924 1480509 2658 2677 140767 140786 ACAGGGTGCCTTCCATTTTT  25 1925 1480510 N/A N/A 120257 120276 TCCACATTTTAAACCAGTAA   9 1926 1480529 N/A N/A 143281 143300 CATGCATTATATACTACCAA  36 1927 1480547 N/A N/A 76964 76983 TTTGGAGGAATCACTTACTC  58 1928 1480549 3734 3753 224102 224121 TTACTGGACTTACTGTCCAT  65 1929 1480557 N/A N/A 138864 138883 ACCATCACCATGAATATGCA  29 1930 1480602 N/A N/A 212805 212824 TAAGGATTTCACCTAAAGCA  51 1931 1480628 2228 2247 116898 116917 TAACACCTTGAATTTCATCC  15 1932 1480661 N/A N/A 217514 217533 TCTGTAATTATGTACTCCTT  26 1933 1480693 N/A N/A 202115 202134 CCATCCTACAAGCAAGATGA  72 1934 1480696 1145 1164 23020 23039 CAGTCATTATCTCATCAACA   2 1935 1480701 N/A N/A 109677 109696 GATTTCTATCACACTTACTT  60 1936 1480733 N/A N/A 18302 18321 AAGACGACTTACCTCTGCAT 139 1937 1480737 3826 3845 224194 224213 CCAATTATCTGAACTGAAAC  38 1938 1480786 N/A N/A 148547 148566 GGTCAAGAAATTTCACTCAT  22 1939 1480803 N/A N/A 140831 140850 ACTTACTGATAAATCTGTAT  75 1940 1480830 N/A N/A 85188 85207 GAGTTCATAAATTCATCACT  17 1941 1480841 1484 1503 73516 73535 ACTCTGTAACTGCCTGGAAA   9 1942 1480843 2860 2879 161708 161727 ATCCACAATCCCAATTGTCG  71 1943 1480949 N/A N/A 160174 160193 CCACACATTTCCAGTCTCCC  44 1944 1480963 N/A N/A 3493 3512 CTTTATCCACCCAAACTGTA  96 1945 1480986 2090 2109 116046 116065 CAGGAATTTCTAAAATAACG  28 1946 1480997 3524 3543 223892 223911 GTTGGTATTTTTAATTCTCC  18 1947 1481039 N/A N/A 164782 164801 CTGACAACTCCATTTATCTC  49 1948 1481079 N/A N/A 92603 92622 CTTTTACCTTAATTTAAGGA  51 1949 1481130 N/A N/A 186976 186995 CAAATTCTTATTTTAGGGCT  48 1950 1481174 N/A N/A 102853 102872 TATTACTTCATCATTTGGGC  19 1951 1481242 2992 3011 202228 202247 TAGTTCATCCAAGATAACCA  63 1952 1481256 N/A N/A 36291 36310 AGGTTATTCTTATTCCCCAA   2 1953 1481318 2751 2770 161599 161618 GGTCCGGTAATTATCATTAC  46 1954 1481347 N/A N/A 133105 133124 TCCAAAGATTTCTACAGTGC  17 1955 1481359 N/A N/A 72684 72703 AATCTGTTTCTATCACAGTC  63 1956 1481365 4323 4342 224691 224710 TTTCATGACCTTATTCCTTC  20 1957 1481367 N/A N/A 3171 3190 AAACCTGCATAACCTTTGCC  58 1958 1481397 N/A N/A 182778 182797 TGGACATACTTTTATTAGGC  20 1959 1481398 3280 3299 221185 221204 AGCCACATTTAATCCATAAC  24 1960 1481428  457  476 13161 13180 CTTTGAAACATTCCTGGTCC  37 1961 1481448 N/A N/A 57910 57929 ACAGCACCTTTTTCACTCCA  11 1962 1481503 2604 2623 135653 135672 CTGCAGTAATCTCCTTGCTT  95 1963 1481528 N/A N/A 107153 107172 CATTTCTTATCCCTACATTT  52 1964 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481640 N/A N/A 63362 63381 TCCATTCAAGTCATCATCTC  45 1965 1481642  876  895 20247 20266 ATATTGAGCTCTCGGGCTGC  36 1966

TABLE-US-00031 TABLE 31 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479801 N/A N/A 76963 76982 TTGGAGGAATCACTTACTCA  86 1967 1479823 N/A N/A 221834 221853 GTACTGACTACATACTAGCT  49 1968 1479843 1865 1884 109567 109586 GGAGAACTTCCGATACAGCA  11 1969 1479863 1745 1764 92517 92536 ACAGCAAACTTCCTTTGGTT  58 1970 1479874 N/A N/A 117002 117021 AAGTAAGCTTGACATTACCT  77 1971 1479882 N/A N/A 92601 92620 TTTACCTTAATTTAAGGAGT  78 1972 1479892 N/A N/A 39245 39264 CTGATCTTATATTTAATGGC   3 1973 1479969 N/A N/A 47811 47830 AGATCCCATTAATATTTGCT   9 1974 1479984 N/A N/A 20235 20254 CGGGCTGCAATCTAAAAAAT  80 1975 1480070 N/A N/A 112008 112027 ACCAGATCATTTCTACTCTT  21 1976 1480113 N/A N/A 85187 85206 AGTTCATAAATTCATCACTT   9 1977 1480132 2598 2617 135647 135666 TAATCTCCTTGCTTAGCGAC  44 1978 1480137 N/A N/A 3492 3511 TTTATCCACCCAAACTGTAT  68 1979 1480146 N/A N/A 212804 212823 AAGGATTTCACCTAAAGCAA  73 1980 1480187 N/A N/A 140830 140849 CTTACTGATAAATCTGTATT  87 1981 1480215 N/A N/A 160119 160138 GTGTAATTCCTTTCTCTTAA  27 1982 1480222 N/A N/A 20352 20371 CCAAAGCTGACCTTATATCC  82 1983 1480229 N/A N/A 217394 217413 ACTCTATTTCTTTACAGGCT  47 1984 1480249 N/A N/A 3519 3538 AGTCACATCTATACCATCCT  55 1985 1480258 4322 4341 224690 224709 TTCATGACCTTATTCCTTCT  20 1986 1480269 N/A N/A 6388 6407 ATTCTCTTCATCTATCACCC  18 1987 1480273 2991 3010 202227 202246 AGTTCATCCAAGATAACCAA  66 1988 1480282 N/A N/A 102815 102834 ATACAACCATTAATACTCCA  25 1989 1480342 N/A N/A 14892 14911 GCTGAACTCAATTTAACCTT  12 1990 1480382 N/A N/A 76367 76386 GACTTCCAATTATCTGCACT  55 1991 1480396  354  373 4447 4466 TTAACAGGCCCATCATTTTC  34 1992 1480457 N/A N/A 178053 178072 CACCACAGATCTCATGGGCA 110 1993 1480491 N/A N/A 70703 70722 CATGTCTATTATATCCAACA   7 1994 1480517 N/A N/A 148485 148504 GCAGCACACATCAAGGGTTC  49 1995 1480519 1283 1302 26956 26975 AGTCCTGGAAACTATCAAAC  17† 1996 1480540 N/A N/A 18301 18320 AGACGACTTACCTCTGCATC  85 1997 1480552 N/A N/A 63222 63241 AAACAGGTACTCAACCTATA  70 1998 1480564 1144 1163 23019 23038 AGTCATTATCTCATCAACAT   3 1999 1480601 1483 1502 73515 73534 CTCTGTAACTGCCTGGAAAG  13 2000 1480606 N/A N/A 120096 120115 CCACATTTCATTCAAGGTTA   9 2001 1480640 1949 1968 109651 109670 GATAAATGCTACAGAGTCCC  43 2002 1480674 N/A N/A 23877 23896 ACCATAGTCATTCATGTTTA   3 2003 1480729 N/A N/A 3351 3370 CTAAGGGCAGCTTTCTTCTA  95 2004 1480756 3499 3518 223867 223886 TTGTTCACAAATGTAGTCTT  32 2005 1480775 2227 2246 116897 116916 AACACCTTGAATTTCATCCT  16 2006 1480826 N/A N/A 57249 57268 CCACAAATTCCATTAGCTCA  14 2007 1480827 2859 2878 161707 161726 TCCACAATCCCAATTGTCGC  43 2008 1480831 N/A N/A 99196 99215 CTGATATCTTATCCCTGTTA  43 2009 1480867  554  573 13258 13277 TTGGCAGAACTGCAAATCTC  19 2010 1480873 N/A N/A 125401 125420 GCATATTTCATTCATTAGCT  15 2011 1480879 N/A N/A 143280 143299 ATGCATTATATACTACCAAC  37 2012 1480910 N/A N/A 167105 167124 CTTCTACTCCATTCTACTGC  24 2013 1480935 N/A N/A 81066 81085 TCTTGATTACTCACTTTGTA  32 2014 1480973 N/A N/A 36241 36260 GCAGCATACACATCTATCTT  3 2015 1481003 2357 2376 123717 123736 TTGGTATACAAGATACAGCA  31 2016 1481020 3079 3098 N/A N/A CAGGGTTAAGGATTTCACAT  22 2017 1481058  445  464 13149 13168 CCTGGTCCTCAGACATTTCT  21 2018 1481091 N/A N/A 182776 182795 GACATACTTTTATTAGGCAA  13 2019 1481200 N/A N/A 29366 29385 ATCACCATTTCTCATATTAC  51 2020 1481250 1703 1722 89518 89537 GGATTTCCAGATTCCTTAAT  44 2021 1481279 3732 3751 224100 224119 ACTGGACTTACTGTCCATAA  91 2022 1481305 N/A N/A 63361 63380 CCATTCAAGTCATCATCTCA  44 2023 1481353 N/A N/A 20844 20863 GATATCTTCTCCAATAAGTG  56 2024 1481375 2088 2107 116044 116063 GGAATTTCTAAAATAACGGT  11 2025 1481395 N/A N/A 126820 126839 CACTCTAGAAAATCAAGCCA  58 2026 1481407 2656 2675 140765 140784 AGGGTGCCTTCCATTTTTTA  62 2027 1481429 N/A N/A 132825 132844 ACTTATCTATTTCTCACTGA  61 2028 1481439 3792 3811 224160 224179 AGTAAATTTTTATATCACCC  17 2029 1481465 N/A N/A 3170 3189 AACCTGCATAACCTTTGCCT  85 2030 1481496 3279 3298 221184 221203 GCCACATTTAATCCATAACT  53 2031 1481499  139  158 2786 2805 TCGGCTCAAAACCGCTTGCC  62 2032 1481506  745  764 18182 18201 GATGCTTTTGGACCGTTTGT   3 2033 1481523 2750 2769 161598 161617 GTCCGGTAATTATCATTACT  49 2034 1481546 N/A N/A 186951 186970 CTTGAACTTTTCTATGTATC  72 2035 1481549 N/A N/A 138681 138700 TCTGCACTCTTCTTTTATAC  64 2036 1481557 3175 3194 212907 212926 TTCATCCTCACTGACCAAGA  34 2037 1481561 N/A N/A 171323 171342 GTAAGCATTTCACCAGATTC  25 2038 1481574 N/A N/A 106595 106614 GCAGTATGTTCACTATCAAT  14 2039 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481598 N/A N/A 202056 202075 CCGAACATTATTTTATGAAC  52 2040 1481625 N/A N/A 164781 164800 TGACAACTCCATTTATCTCA  61 2041 1481629 N/A N/A 3300 3319 AGTAAAACTCTTCGACCACC  72 2042 1481634 N/A N/A 72488 72507 CTTTCTTTATCATCTCACTC  18 2043

TABLE-US-00032 TABLE 32 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479814 N/A N/A 85052 85071 TTGCATTTCTAAATCCTGCC  46 2044 1479817 N/A N/A 170750 170769 CTGCCATTATCCCATTCTGT  50 2045 1479830 N/A N/A 212803 212822 AGGATTTCACCTAAAGCAAT  95 2046 1479833 N/A N/A 221578 221597 TCTTCAGTAACCTTTGGCAT  31 2047 1479862  552  571 13256 13275 GGCAGAACTGCAAATCTCTC   6 2048 1479922 N/A N/A 186939 186958 TATGTATCTATTTCTTGGCA  53 2049 1480020  138  157 2785 2804 CGGCTCAAAACCGCTTGCCT 132 2050 1480030 444 463 13148 13167 CTGGTCCTCAGACATTTCTT  55   28 1480084 N/A N/A 148382 148401 GTTGGCAATAACCACCTCTC  69 2051 1480140 N/A N/A 126819 126838 ACTCTAGAAAATCAAGCCAT  74 2052 1480151 1463 1482 73495 73514 CATGGCTGTATTCAAAATAA  30 2053 1480204 1135 1154 23010 23029 CTCATCAACATTTACAGCAT  19 2054 1480237 N/A N/A 3169 3188 ACCTGCATAACCTTTGCCTA  72 2055 1480250 N/A N/A 18300 18319 GACGACTTACCTCTGCATCT 183 2056 1480253 N/A N/A 112003 112022 ATCATTTCTACTCTTCACCC  57 2057 1480290 N/A N/A 106571 106590 TTGGTTTTAACCCAACCTTC  82 2058 1480305 1697 1716 89512 89531 CCAGATTCCTTAATGTTGTT  31 2059 1480310 N/A N/A 217231 217250 GCAAGATTTATATTTAAGCC  51 2060 1480318 N/A N/A 3491 3510 TTATCCACCCAAACTGTATT  82 2061 1480321 N/A N/A 20126 20145 AGGATTTGTACACTTAATCT 102 2062 1480326 N/A N/A 140829 140848 TTACTGATAAATCTGTATTA 101 2063 1480329 N/A N/A 20351 20370 CAAAGCTGACCTTATATCCT 101 2064 1480337 N/A N/A 47028 47047 AGGAAACTCTTTATCCAGGC  12 2065 1480371 N/A N/A 143279 143298 TGCATTATATACTACCAACA  75 2066 1480377 N/A N/A 36240 36259 CAGCATACACATCTATCTTT   3 2067 1480440 3731 3750 224099 224118 CTGGACTTACTGTCCATAAA  28 2068 1480479 4320 4339 224688 224707 CATGACCTTATTCCTTCTGT  19 2069 1480527 2047 2066 116003 116022 GTGGGAATTAACAGCAGGTA  14 2070 1480553 N/A N/A 138678 138697 GCACTCTTCTTTTATACCTT  65 2071 1480567 N/A N/A 14889 14908 GAACTCAATTTAACCTTGTC  38 2072 1480608 N/A N/A 119870 119889 GCCAATATTTACATAGAGAC  10 2073 1480609  353  372 4446 4465 TAACAGGCCCATCATTTTCC  13 2074 1480618 3449 3468 223817 223836 CTTCCATGTTGAACTCCTCT  56 2075 1480635 2749 2768 161597 161616 TCCGGTAATTATCATTACTC  50 2076 1480669 1744 1763 92516 92535 CAGCAAACTTCCTTTGGTTT  41 2077 1480673 2596 2615 135645 135664 ATCTCCTTGCTTAGCGACCT  61 2078 1480675 N/A N/A 3349 3368 AAGGGCAGCTTTCTTCTAGT  64 2079 1480678 N/A N/A 202314 202333 GTTTACCGGATACTTACATC  78 2080 1480800 N/A N/A 23777 23796 ACATTGTCCACACATATGTC  61 2081 1480801 3278 3297 221183 221202 CCACATTTAATCCATAACTC  44 2082 1480815 2352 2371 123712 123731 ATACAAGATACAGCAGAGTT  51 2083 1480828 N/A N/A 76960 76979 GAGGAATCACTTACTCAGGT 108 2084 1480834 3791 3810 224159 224178 GTAAATTTTTATATCACCCT  28 2085 1480844 2858 2877 161706 161725 CCACAATCCCAATTGTCGCT  66 2086 1480846 N/A N/A 96822 96841 CTGGAACACAGACTCATCTC 146 2087 1480859 N/A N/A 20843 20862 ATATCTTCTCCAATAAGTGT  31 2088 1480862 N/A N/A 124819 124838 TGTCAAAATTTCCCTTCATC  31 2089 1480890 N/A N/A 76298 76317 TCTGATCAATTTCATGTCTC 111 2090 1480905 2988 3007 202224 202243 TCATCCAAGATAACCAAGGA  49 2091 1480939 1281 1300 26954 26973 TCCTGGAAACTATCAAACAC  52† 2092 1480957 1864 1883 109566 109585 GAGAACTTCCGATACAGCAT  14 2093 1480960 2226 2245 116896 116915 ACACCTTGAATTTCATCCTT  39 2094 1481002 N/A N/A 29365 29384 TCACCATTTCTCATATTACC  47 2095 1481023 3174 3193 212906 212925 TCATCCTCACTGACCAAGAA  46 2096 1481028 N/A N/A 102814 102833 TACAACCATTAATACTCCAA  36 2097 1481088 N/A N/A 70415 70434 TTATGTATATTGATGTAGGT  42 2098 1481093 N/A N/A 177996 178015 GCCATAAATTTCATATCCTA  22 2099 1481106 N/A N/A 63359 63378 ATTCAAGTCATCATCTCAGT  30 2100 1481109 N/A N/A 63221 63240 AACAGGTACTCAACCTATAA  68 2101 1481117 N/A N/A 55403 55422 TGAACATATACTTACCCACA 138 2102 1481167 N/A N/A 39222 39241 GCTGAATTCTTATTACTTCT   2 2103 1481234 N/A N/A 182710 182729 AGCTGTTAAATCCTTTGTTC  59 2104 1481264 N/A N/A 80922 80941 GCATCTTAACAACAACAGAC  19 2105 1481333 N/A N/A 6383 6402 CTTCATCTATCACCCACTTC  58 2106 1481354 2655 2674 140764 140783 GGGTGCCTTCCATTTTTTAT  87 2107 1481405 1945 1964 109647 109666 AATGCTACAGAGTCCCCTCT 112 2108 1481421 N/A N/A 166965 166984 GCACTGATTTCATACGCACA  33 2109 1481447 N/A N/A 117001 117020 AGTAAGCTTGACATTACCTC  87 2110 1481474 N/A N/A 72484 72503 CTTTATCATCTCACTCCCAT  40 2111 1481491 N/A N/A 160080 160099 TTGCACCTAATATATCTCCA  28 2112 1481497 N/A N/A 202055 202074 CGAACATTATTTTATGAACA  65 2113 1481578 N/A N/A 3299 3318 GTAAAACTCTTCGACCACCA  56 2114 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   2  433 1481595  743  762 18180 18199 TGCTTTTGGACCGTTTGTTA   8 2115 1481618 N/A N/A 164691 164710 TTCCACTTAAACTAGCACTA  68 2116 1481636 N/A N/A 131720 131739 GGTCAATTTTTTTCTCACTC  12 2117 1481638 1807 1826 92579 92598 CTGGGTCACCCACTTCTTTA  59 2118 1481648 N/A N/A 3518 3537 GTCACATCTATACCATCCTA  53 2119

TABLE-US-00033 TABLE 33 Reduction of MSH3 RNA by 5-10-5 MOE gapmers with mixed internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1479803  440  459 13144 13163 TCCTCAGACATTTCTTTGGC  34 2120 1479815 N/A N/A 140699 140718 TATGTTTCAATTTACTAGGC 168 2121 1479836 N/A N/A 216805 216824 GCTGAACTATAAATTCGAAC  42 2122 1479857 N/A N/A 39219 39238 GAATTCTTATTACTTCTGAT   7 2123 1479870 N/A N/A 166767 166786 CTCATTTCATCTCTATCCTA  32 2124 1479880 N/A N/A 164517 164536 TCAATAGTTTACCATGGCTC  14 2125 1479890 2857 2876 161705 161724 CACAATCCCAATTGTCGCTT  68 2126 1479932 N/A N/A 14728 14747 CATCAAACAGCTTATCACCT 111 2127 1479975 3789 3808 224157 224176 AAATTTTTATATCACCCTCC  37 2128 1479989 N/A N/A 46651 46670 CCAGCTTTATACACCCTTTC   3 2129 1480109 N/A N/A 76167 76186 TCATTAGACTATTTTGCTCA  29 2130 1480114 2595 2614 135644 135663 TCTCCTTGCTTAGCGACCTT  50 2131 1480169 1943 1962 109645 109664 TGCTACAGAGTCCCCTCTCT  48 2132 1480179 N/A N/A 201942 201961 TGTCTAACATCATACTGTAC  85 2133 1480251 N/A N/A 54574 54593 TGACACAATCATCCTAACAC  32 2134 1480286 2225 2244 116895 116914 CACCTTGAATTTCATCCTTC  45 2135 1480299 1742 1761 92514 92533 GCAAACTTCCTTTGGTTTTC  32 2136 1480304 N/A N/A 123407 123426 ATGGCTTTTTCATTAACCAC  48 2137 1480312 N/A N/A 117000 117019 GTAAGCTTGACATTACCTCC  83 2138 1480356 N/A N/A 20350 20369 AAAGCTGACCTTATATCCTT  79 2139 1480395 2987 3006 202223 202242 CATCCAAGATAACCAAGGAC 136 2140 1480402 1446 1465 73478 73497 TAAATGTTATCCATCCTTTC  19 2141 1480413 N/A N/A 175853 175872 CCTCCTTCATCATACCTACT  86 2142 1480420  352  371 4445 4464 AACAGGCCCATCATTTTCCA  11 2143 1480426 N/A N/A 3298 3317 TAAAACTCTTCGACCACCAA  72 2144 1480439 3446 3465 223814 223833 CCATGTTGAACTCCTCTGTC  41 2145 1480441 N/A N/A 5859 5878 GTGGCAAATTCTCTCAAGTC  25 2146 1480464 2748 2767 161596 161615 CCGGTAATTATCATTACTCT  37 2147 1480470 1130 1149 23005 23024 CAACATTTACAGCATCATCC   2 2148 1480512 N/A N/A 160079 160098 TGCACCTAATATATCTCCAT  85 2149 1480524 N/A N/A 182709 182728 GCTGTTAAATCCTTTGTTCA  39 2150 1480532 N/A N/A 63357 63376 TCAAGTCATCATCTCAGTGA  33 2151 1480544 2033 2052 115989 116008 CAGGTATTATTGCTTGAAAT  14 2152 1480568  551  570 13255 13274 GCAGAACTGCAAATCTCTCC  10 2153 1480593 N/A N/A 186938 186957 ATGTATCTATTTCTTGGCAT  32 2154 1480616 N/A N/A 3168 3187 CCTGCATAACCTTTGCCTAT 145 2155 1480622  742 761 18179 18198 GCTTTTGGACCGTTTGTTAG   3 2156 1480631 2497 2516 126818 126837 CTCTAGAAAATCAAGCCATT  28 2157 1480636 3173 3192 212905 212924 CATCCTCACTGACCAAGAAT  85 2158 1480644 N/A N/A 119761 119780 ACTGGATTTACAGACTGGCA  10 2159 1480652 N/A N/A 63220 63239 ACAGGTACTCAACCTATAAA  56 2160 1480708 N/A N/A 143278 143297 GCATTATATACTACCAACAA  22 2161 1480722 N/A N/A 212797 212816 TCACCTAAAGCAATAAGACA  90 2162 1480730 N/A N/A 96821 96840 TGGAACACAGACTCATCTCA  90 2163 1480761 N/A N/A 29364 29383 CACCATTTCTCATATTACCA  25 2164 1480794 1280 1299 26953 26972 CCTGGAAACTATCAAACACA  16† 2165 1480798 N/A N/A 202313 202332 TTTACCGGATACTTACATCT  75 2166 1480808 1685 1704 89500 89519 ATGTTGTTCCATTAATTGTC   9 2167 1480825 N/A N/A 148380 148399 TGGCAATAACCACCTCTCCA  61 2168 1480842 3277 3296 221182 221201 CACATTTAATCCATAACTCC  54 2169 1480889 3725 3744 224093 224112 TTACTGTCCATAAAATTTTC 126 2170 1480948 N/A N/A 36238 36257 GCATACACATCTATCTTTGA   3 2171 1480988 N/A N/A 85051 85070 TGCATTTCTAAATCCTGCCA  42 2172 1481104 N/A N/A 23218 23237 TCTGAAGGTACACTTCATCA  16 2173 1481114 N/A N/A 3490 3509 TATCCACCCAAACTGTATTT  81 2174 1481116 4318 4337 224686 224705 TGACCTTATTCCTTCTGTGC  18 2175 1481131 N/A N/A 102698 102717 AAAGATCTATTTCCTAACAC  85 2176 1481135 N/A N/A 124818 124837 GTCAAAATTTCCCTTCATCC  11 2177 1481149  137  156 2784 2803 GGCTCAAAACCGCTTGCCTC  79 2178 1481169 N/A N/A 131315 131334 ATGCAGATAACAATCTGGTA  72 2179 1481177 2712 2731 140821 140840 AAATCTGTATTATTTGGGAC  43 2180 1481284 N/A N/A 138266 138285 ACTGAAGATCACTTCTTGTC  55 2181 1481287 1806 1825 92578 92597 TGGGTCACCCACTTCTTTAA  49 2182 1481293 N/A N/A 72415 72434 TTCATGTTCATATTTTGGTC   5 2183 1481383 N/A N/A 19348 19367 CCAAGTCTTTACTTCCCATC  91 2184 1481400 N/A N/A 20842 20861 TATCTTCTCCAATAAGTGTA  23 2185 1481418 N/A N/A 170490 170509 GCACTATACTCACACATATA  84 2186 1481435 N/A N/A 70413 70432 ATGTATATTGATGTAGGTAT  13 2187 1481445 N/A N/A 3348 3367 AGGGCAGCTTTCTTCTAGTC  55 2188 1481464 N/A N/A 111999 112018 TTTCTACTCTTCACCCTTCA  54 2189 1481498 N/A N/A 76958 76977 GGAATCACTTACTCAGGTTT  51 2190 1481541 N/A N/A 3517 3536 TCACATCTATACCATCCTAA  79 2191 1481582 1863 1882 109565 109584 AGAACTTCCGATACAGCATC  13 2192 1481588 N/A N/A 18295 18314 CTTACCTCTGCATCTTCCCC  36 2193 1481592  744  763 18181 18200 ATGCTTTTGGACCGTTTGTT   3  433 1481599 N/A N/A 106459 106478 CTTGTCCTAGTTTCTCCACC  41 2194 1481605 N/A N/A 80723 80742 CCAGATTTTTAAACCAAGCC  11 2195 1481644 N/A N/A 221287 221306 GCAGCATAATCACTCTGACC  36 2196

Example 5: Effect of Modified Oligonucleotides on Human MSH3 RNA In Vitro, Multiple Doses

[0347] Modified oligonucleotides selected from the examples above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and MSH3 RNA levels were measured by quantitative real-time RTPCR. Human MSH3 primer probe set RTS40982 was used to measure RNA levels as described above. MSH3 levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in Tables 34-40 below as percent MSH3 RNA, relative to untreated control cells (% UTC). Each table represents results from an individual assay plate. Where possible, the half maximal inhibitory concentration (IC.sub.50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in excel.

TABLE-US-00034 TABLE 34 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479925 38 23 11 6 0.01 1479968 64 67 47 34 0.74 1480033 48 36 17 10 0.05 1480079 50 47 32 17 0.10 1480142 55 30 29 21 0.06 1480288 57 56 41 34 0.30 1480338 40 26 20 9 0.01 1480467 107 66 44 24 0.84 1480536 100 53 24 10 0.43 1480577 66 58 63 41 2.01 1480768 65 54 51 34 0.56 1480932 56 36 28 21 0.08 1480942 81 65 43 22 0.61 1481046 57 31 15 7 0.07 1481389 63 62 68 50 >4.00 1481413 89 74 57 32 1.32 1481454 65 58 45 33 0.52 1481531 55 49 39 27 0.16 1481592 68 33 14 7 0.13

TABLE-US-00035 TABLE 35 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479889 74 51 28 12 0.28 1480141 65 60 51 30 0.61 1480220 62 42 26 15 0.15 1480294 82 70 45 26 0.77 1480476 95 57 27 12 0.45 1480533 105 61 29 13 0.54 1480551 57 40 21 15 0.10 1480688 60 53 38 25 0.25 1480759 56 52 42 40 0.28 1480770 63 53 39 33 0.33 1480790 29 13 5 2 0.00 1480878 51 39 23 11 0.07 1480900 46 33 16 8 0.04 1481095 82 62 42 20 0.55 1481137 58 47 36 24 0.18 1481152 58 57 52 38 0.66 1481374 52 51 32 23 0.12 1481558 58 43 34 22 0.14 1481592 72 37 15 7 0.17

TABLE-US-00036 TABLE 36 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479847 73 58 30 16 0.34 1480122 77 68 45 35 0.88 1480428 58 57 42 26 0.30 1480472 83 51 24 11 0.32 1480487 70 52 28 14 0.26 1480495 76 69 51 36 1.09 1480501 79 61 31 15 0.40 1480665 75 62 50 32 0.80 1480848 57 39 24 13 0.10 1480903 94 69 53 28 1.03 1480925 97 68 37 24 0.72 1480955 60 41 31 16 0.15 1480989 59 47 37 20 0.18 1481055 71 67 49 38 1.04 1481304 106 100 93 90 >4.00 1481408 48 34 15 11 0.04 1481449 77 50 24 11 0.28 1481592 61 42 17 10 0.13 1481603 52 52 32 24 0.13

TABLE-US-00037 TABLE 37 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479938 59 22 23 15 0.06 1480003 89 50 31 12 0.39 1480223 55 29 15 7 0.07 1480316 55 39 25 16 0.09 1480330 64 47 28 21 0.20 1480463 95 74 43 24 0.84 1480494 34 21 12 6 0.00 1480541 67 88 70 60 >4.00 1480543 49 31 16 10 0.04 1480810 83 75 66 42 2.80 1481022 60 52 42 24 0.25 1481050 65 59 50 37 0.72 1481068 60 48 32 19 0.18 1481103 89 93 76 58 >4.00 1481156 78 55 40 19 0.43 1481176 120 96 46 33 1.42 1481193 118 89 56 32 1.57 1481470 73 58 48 24 0.54 1481592 73 41 18 10 0.19

TABLE-US-00038 TABLE 38 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479835 57 34 16 6 0.08 1479892 66 40 22 12 0.16 1479901 60 35 20 11 0.11 1480166 58 37 22 11 0.10 1480202 73 63 48 25 0.60 1480366 60 43 19 10 0.13 1480466 85 69 50 33 1.03 1480482 43 35 10 5 0.04 1480564 78 49 33 12 0.32 1480674 67 44 24 11 0.18 1480899 66 40 20 9 0.16 1480973 68 43 29 14 0.21 1481146 61 38 22 9 0.12 1481330 34 14 7 4 0.00 1481471 75 61 39 18 0.45 1481500 68 44 29 17 0.21 1481506 35 18 9 5 0.01 1481592 56 30 14 8 0.07 1481624 74 58 39 22 0.43

TABLE-US-00039 TABLE 39 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479878 100 77 52 26 1.10 1479915 93 78 60 35 1.63 1479989 77 54 35 17 0.37 1480037 96 76 52 23 0.99 1480039 46 19 13 6 0.02 1480105 97 74 40 23 0.80 1480280 87 65 36 17 0.54 1480390 58 38 18 10 0.10 1480470 93 73 51 26 1.00 1480490 78 58 38 22 0.48 1480521 63 39 28 16 0.15 1480580 82 67 51 33 1.01 1480622 49 34 19 8 0.05 1480696 69 36 18 6 0.15 1480948 80 62 35 19 0.47 1481256 45 21 9 4 0.02 1481356 63 44 24 12 0.16 1481371 73 54 39 19 0.37 1481592 55 32 15 8 0.07

TABLE-US-00040 TABLE 40 Dose-dependent reduction of human MSH3 RNA in A-431 cells by modified oligonucleotides Compound MSH3 (% UTC) IC.sub.50 Number 62.5 nM 250 nM 1000 nM 4000 nM (μM) 1479857 78 72 65 47 4.29 1479862 63 39 21 12 0.13 1479993 131 94 80 51 4.17 1479996 69 68 58 44 2.50 1480011 46 27 10 4 0.03 1480377 61 55 32 16 0.23 1480386 74 58 29 12 0.33 1480484 101 55 31 14 0.51 1480589 66 54 49 33 0.56 1481027 81 68 60 31 1.22 1481139 64 54 40 23 0.31 1481160 108 58 31 18 0.60 1481167 42 26 10 4 0.02 1481293 93 65 35 23 0.64 1481335 56 44 29 19 0.12 1481396 57 36 19 6 0.09 1481564 76 76 45 46 1.76 1481592 80 34 15 7 0.20 1481595 53 36 23 13 0.07

Example 6: Effects of 5-10-5 MOE Modified Oligonucleotides on Human MSH3 In Vitro, Single Dose

[0348] Modified oligonucleotides complementary to an MSH3 nucleic acid were synthesized and tested for their effect on MSH3 RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using the same culture conditions.

[0349] The modified oligonucleotides in Tables 41 to 66 below are 5-10-5 MOE modified oligonucleotides (i.e., they have a central gap segment of ten 2′-β-D-deoxynucleosides flanked on each side by wing segments, each wing segment consisting of five 2′-MOE modified nucleosides). The internucleoside linkage motif for the modified oligonucleotides is (from 5′ to 3′): sooosssssssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

[0350] “Start site” indicates the 5′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. “Stop site” indicates the 3′-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are complementary to either SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both.

[0351] Cultured A431 cells were treated using free uptake with 3000 nM of modified oligonucleotide. After a treatment period of approximately 48 hours, RNA was isolated from the cells and MSH3 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS40982 (described herein above) was used to measure RNA levels. MSH3 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent MSH3 RNA, relative to untreated control cells (% UTC). The values marked by the symbol “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00041 TABLE 41 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   1 1008 1566447 N/A N/A 70287 70306 CCCTATGCAGAACACTTTCT  60 2197 1566473 N/A N/A 77917 77936 CTGAGATAGCACCTATCTCC  64 2198 1566543 N/A N/A 6516 6535 GCCATTTTTAACAAGTGGCA  96 2199 1566623 N/A N/A 23145 23164 CATCTAACATTTGTTCCTCA  43 2200 1566710 N/A N/A 27340 27359 GATCTCACCTTAGTTGCCCA  15 2201 1566711 N/A N/A 29036 29055 TTACCATTTCTAGCAAGCAA  21 2202 1566712 N/A N/A 41354 41373 TGTGCATGTATATCTATATA  57 2203 41384 41403 41414 41433 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  17 2204 1566746 N/A N/A 14687 14706 CGTGCCCCCTCTGTCTACTT 102 2205 1566760 N/A N/A 26339 26358 TCATGCCAACTTGAACCTGC  86 2206 1566847 N/A N/A 80396 80415 CCACATGTTATCATTCTGTT   8 2207 1566881 N/A N/A 131679 131698 GCCCAGGTCCTCAAGACTCT  67 2208 1566884 N/A N/A 27702 27721 CTCTGCCAGACATATATCAT  45 2209 1566964 N/A N/A 118591 118610 GTAACTTATCTAACTACTCC  63 2210 1566970 N/A N/A 35925 35944 ATTCTTGCTCCTATTCCCAA  35 2211 1567032 N/A N/A 99767 99786 GTCCTTATCCCTCTACCTCA  34 2212 1567038 N/A N/A 177606 177625 CAACAATGTATAAAAAGAAA  64 2213 205267 205286 1567053 3001 3020 202237 202256 CCCTCTTCCTAGTTCATCCA  58 2214 1567058 3433 3452 223801 223820 CTCTGTCCACTTCTGCAGGT 110 2215 1567062  924  943 20295 20314 TGAGTAGGTATACTTGCTGT  12 2216 1567113 N/A N/A 187811 187830 GATTTGCTTTAGTTTCCTCC  39 2217 1567132 N/A N/A 22375 22394 TCCCAGATATAGCAAGACAA  46 2218 1567172 N/A N/A 213267 213286 GCAGGTGACTGTCATCTGTA  55 2219 1567182 N/A N/A 17345 17364 GCCACTCTGTCACTGCCAAC  30 2220 1567263 N/A N/A 102493 102512 TCCACTACTTGTATCTCTTC  44 2221 1567297 N/A N/A 106461 106480 GCCTTGTCCTAGTTTCTCCA  41 2222 1567328 N/A N/A 122661 122680 CTCCATAATCCATCCATGTT  31 2223 1567340 N/A N/A 110056 110075 AGCAGATTTTTCCATAGTTT   9 2224 1567342 N/A N/A 19313 19332 TGCTACCTCATCACTCTCTA  60 2225 1567404 N/A N/A 86570 86589 CAGTTGCCTCCTCCCTCATA  95 2226 1567444 N/A N/A 63308 63327 GCTCTGCTCACTAGGATCCA  48 2227 1567511 N/A N/A 23803 23822 GCTTAGTGTTTTATTCTGCT  33 2228 1567604 N/A N/A 149441 149460 TGGCTTTCTTAGTAAGCCCT  60 2229 1567607 N/A N/A 36200 36219 AAGCATTTATTTCAAAGGTC   1 2230 1567609 N/A N/A 39227 39246 GCATTGCTGAATTCTTATTA  25 2231 1567619 N/A N/A 36917 36936 ATGACTTCATATGAACCCAC  12 2232 1567640 N/A N/A 13710 13729 TTGCCCATCATGATTTTCCA  41 2233 1567714 N/A N/A 25072 25091 TTCTAAGTATCTCTGTTCAA  12 2234 1567746 N/A N/A 93622 93641 GTTCTCTTCACCATCACACC  56 2235 1567747 N/A N/A 90721 90740 CGGCAGGACAGATTCTCAGC  40 2236 1567761 N/A N/A 30067 30086 CGCTTAGTCCAATATGCAAA  32 2237 1567769 N/A N/A 141633 141652 TGCTATGCTTCACTTCCAAT  65 2238 1567899 N/A N/A 40547 40566 TACATGTTTATCTCTCTATA  81 2239 40575 40594 1568040 N/A N/A 84955 84974 ATGGTATATACACAGGACTC  25 2240 1568072 N/A N/A 144447 144466 TCACCATAGCAACAGTTCTA  41 2241 1568077 N/A N/A 164751 164770 CCCTATCTATCGCCAAGTCC  67 2242 1568268 N/A N/A 117342 117361 GTATCATTTCATCATCTGCA   9 2243 1568271 N/A N/A 167159 167178 GCATAACTCCACCTCTGTGC  67 2244 1568280 N/A N/A 112004 112023 GATCATTTCTACTCTTCACC  37 2245 1568288 N/A N/A 180700 180719 TTACCATTTTAGCATTTCTT  16 2246 182448 182467 1568303 N/A N/A 53398 53417 ATGCTTTCACCGTCTGGTAC  40 2247 1568341 N/A N/A 19661 19680 GCCATGGAACTCTAATTCTA  69 2248 1568405 N/A N/A 50868 50887 GCTGCTTGCCATCATGCGCA  97 2249 1568953 N/A N/A 72517 72536 TTGACTCCCTATTCTGTCCT  95 2250 1568979 N/A N/A 183298 183317 CCCCAGACAGTCTCTCAGTC  60 2251 1568985 N/A N/A 82172 82191 ATGTCTTTCAACTACCATAA  46 2252 1569014 N/A N/A 139833 139852 GTCTACCCTTTCCAACCTTC  45 2253 1569242 N/A N/A 35711 35730 ATAGGCCTTCACCCTTTCTT  48 2254 1569360 N/A N/A 26054 26073 ACTTCTGACAACAGCAAGGC  32 2255 1569377 N/A N/A 21027 21046 AAGATGCTTGTTTCCAGCCA   9 2256 1569382 N/A N/A 12035 12054 TGGATCCCTACCATGTACTA  81 2257 1569797 N/A N/A 76033 76052 CAGTTACTCTGTTCCAGCAC  44 2258 1569846 N/A N/A 161284 161303 GTGCATATTCTCCCTATTGC  51 2259 1569901 N/A N/A 44230 44249 TGCTGGCCAATACTGAGGCT  85 2260 1569929 N/A N/A 36595 36614 TTGGCACCAAAACTCTGCTA  61 2261 1569945 N/A N/A 94998 95017 CCTCATCAGTTTCCCATGTC  53 2262 1570214 N/A N/A 48815 48834 TGCTGTTTCTTCCTATTCGA  18 2263 1570232 N/A N/A 220983 221002 CTGTTCCTACTTGCCTGTTA  34 2264 1570349 N/A N/A 12569 12588 GACAACTGTCCTTCCTCCAC  54 2265 1570425 N/A N/A 107911 107930 TCTGGCTCATACTCTTGCAT  61 2266 1570451 N/A N/A 18503 18522 TCCAATAGAGACCCCTCACT 121 2267 1570496 N/A N/A 34895 34914 ACACTCCACAATTCCAAGCC  28 2268 1570632 N/A N/A 126128 126147 TGAGTATCATCTCTGCTCTC  72 2269 1570688 N/A N/A 60981 61000 AGCCGAGTAATTCATTCTCT  45 2270 1570725 N/A N/A 37519 37538 CCTAGAGCACTAAGTTTTCA  62 2271 1570855 N/A N/A 37116 37135 TCCTAACACTCCAGTCAACT  96 2272 1570912 N/A N/A 168876 168895 GTGCAAATCTCCTCTTACTC  29 2273 1570916 N/A N/A 46518 46537 CTGGCATTCATTCTTCCAGT  81 2274

TABLE-US-00042 TABLE 42 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566498 N/A N/A 143758 143777 GCCTCTCAAAGACATAGTCT  79 2275 1566538 N/A N/A 41352 41371 TGCATGTATATCTATATAAA  78 2276 41382 41401 41412 41431 1566661 N/A N/A 19312 19331 GCTACCTCATCACTCTCTAG  68 2277 1566667 N/A N/A 86566 86585 TGCCTCCTCCCTCATATGAA  97 2278 1566703 N/A N/A 50599 50618 CCCATCTCTTGCATACAGCT  44 2279 1566708 N/A N/A 45599 45618 TTGCTCCAACATGTTTCCTT  35 2280 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  22 2204 1566731 N/A N/A 39220 39239 TGAATTCTTATTACTTCTGA  52 2281 1566743 N/A N/A 202126 202145 GTCTGCAGCACCCATCCTAC  61 2282 1566754 N/A N/A 60979 60998 CCGAGTAATTCATTCTCTCC  46 2283 1566763 N/A N/A 23142 23161 CTAACATTTGTTCCTCACCT  47 2284 1566784 N/A N/A 27122 27141 ACCTAAGTTTCAGAATCGGT  45 2285 1566796 N/A N/A 177599 177618 GTATAAAAAGAAAAACAGAC  81 2286 205260 205279 1566815 N/A N/A 63023 63042 CCAAAGGCTTTATCTGTTCT  18 2287 1566818 N/A N/A 220969 220988 CTGTTAGATCCATTTATCAA  57 2288 1566891 N/A N/A 37262 37281 AGCTCCTCCCACTAGTGCCC  62 2289 1566965 N/A N/A 34866 34885 CCTTTCCTCACACAGCTTTA  33 2290 1567024 N/A N/A 48814 48833 GCTGTTTCTTCCTATTCGAC  11 2291 1567045 N/A N/A 80329 80348 GGTGGATTTTCTCACTCTTT  32 2292 1567065 N/A N/A 131671 131690 CCTCAAGACTCTAATTTGCT  65 2293 1567109 N/A N/A 12559 12578 CTTCCTCCACATCAGCAGCC  65 2294 1567111 3179 3198 212911 212930 TGCTTTCATCCTCACTGACC  73 2295 1567178 N/A N/A 161174 161193 AGCACATGTAATTTTTGGCA  47 2296 1567220 N/A N/A 30066 30085 GCTTAGTCCAATATGCAAAT  13 2297 1567223 N/A N/A 23796 23815 GTTTTATTCTGCTATCTGTA  16 2298 1567256 N/A N/A 26338 26357 CATGCCAACTTGAACCTGCT  44 2299 1567268 N/A N/A 21024 21043 ATGCTTGTTTCCAGCCACTA  24 2300 1567302 N/A N/A 36916 36935 TGACTTCATATGAACCCACA  16 2301 1567324 N/A N/A 36424 36443 GGTGGTACTATGCCTCCGCA  64 2302 1567326 N/A N/A 72470 72489 TCCCATGACTGTTATCTCTC  46 2303 1567379 N/A N/A 20070 20089 GTTCCCTGTATAGAAGCCTA  42 2304 1567382 N/A N/A 6450 6469 ACATTCCATCTCAACTGTCC  71 2305 1567417 N/A N/A 40546 40565 ACATGTTTATCTCTCTATAT  86 2306 40574 40593 1567425 N/A N/A 90496 90515 GTTCAGATGATTCTCCAGTA  20 2307 1567436 N/A N/A 70286 70305 CCTATGCAGAACACTTTCTT 110 2308 1567480 N/A N/A 167104 167123 TTCTACTCCATTCTACTGCA  24 2309 1567518 N/A N/A 82140 82159 TCATCATGTTGCAACATGTA  58 2310 1567525 N/A N/A 107909 107928 TGGCTCATACTCTTGCATGC  68 2311 1567541 N/A N/A 53359 53378 AGTCAATTCTTACAAGCAGC  11 2312 1567559 N/A N/A 76023 76042 GTTCCAGCACACAGACTACT  67 2313 1567623 N/A N/A 17087 17106 AGTGCAGTCCAGCAAACCTC  57 2314 1567697 N/A N/A 116760 116779 TCGCTTATTTTTCATAGTGT  28 2315 1567743 N/A N/A 13704 13723 ATCATGATTTTCCACGGTAA  47 2316 1567820 N/A N/A 183297 183316 CCCAGACAGTCTCTCAGTCA  49 2317 1567853 N/A N/A 122594 122613 TGTTGTGATTACATACTACA  43 2318 1567872 N/A N/A 187806 187825 GCTTTAGTTTCCTCCTACCA  51 2319 1567877 N/A N/A 94889 94908 AGTGTCCTTGTCCTCTGCCT  40 2320 1567904 N/A N/A 26043 26062 CAGCAAGGCATTATCTAGGA   1 2321 1567916 N/A N/A 24997 25016 GCTCAGGATGTCATCAGCCC  45 2322 1567935 N/A N/A 109797 109816 ATTCAGCTACTCTCGCATGC  60 2323 1568019 N/A N/A 27700 27719 CTGCCAGACATATATCATAA  14 2324 1568067 N/A N/A 180699 180718 TACCATTTTAGCATTTCTTA  10 2325 182447 182466 1568123 N/A N/A 77915 77934 GAGATAGCACCTATCTCCCC 113 2326 1568138 N/A N/A 12015 12034 GAACACAGTATTTCACCGTT  45 2327 1568191 N/A N/A 102483 102502 GTATCTCTTCCTCCTTACTA  63 2328 1568207 N/A N/A 22233 22252 GTCTGGACATATCTTTGGAC  74 2329 1568307 N/A N/A 149104 149123 GCCATGTCTGCCTCCGATCC  96 2330 1568340 N/A N/A 14685 14704 TGCCCCCTCTGTCTACTTAC  71 2331 1568386 N/A N/A 44229 44248 GCTGGCCAATACTGAGGCTT  86 2332 1568423 N/A N/A 223534 223553 GCCACTATTACCTTTGTGCC  25 2333 1568945 N/A N/A 18496 18515 GAGACCCCTCACTTTTTCCC  84 2334 1568986 N/A N/A 35702 35721 CACCCTTTCTTTCTCAATTC  68 2335 1569021 N/A N/A 168867 168886 TCCTCTTACTCAGCATCACA  69 2336 1569072 N/A N/A 35923 35942 TCTTGCTCCTATTCCCAACT  28 2337 1569177 N/A N/A 99612 99631 CAGCAAGCATACCATGTAAC  76 2338 1569409 N/A N/A 111868 111887 TAAGTCATTCTTGCACTGCA  26 2339 1569492 N/A N/A 37115 37134 CCTAACACTCCAGTCAACTC  80 2340 1569551 N/A N/A 164734 164753 TCCTGGTGATTTATTTCCCA  46 2341 1569583 N/A N/A 118584 118603 ATCTAACTACTCCAAACCTT  47 2342 1569768 N/A N/A 126050 126069 TCGAGGCTCCAGTCCTGCCA  58 2343 1569847 N/A N/A 84938 84957 CTCGACATAGAGTAATACTA  52 2344 1569890 N/A N/A 106457 106476 TGTCCTAGTTTCTCCACCTA  51 2345 1569893 N/A N/A 29027 29046 CTAGCAAGCAATCAAGAGCT  36 2346 1570042 N/A N/A 141629 141648 ATGCTTCACTTCCAATATCT  59 2347 1570118 N/A N/A 139824 139843 TTCCAACCTTCTTCTGTGCA  52 2348 1570211 N/A N/A 19534 19553 ACCTAGACAGTTTCTCTCCT  54 2349 1570565 N/A N/A 36166 36185 ACTGTGGTACCACAGGACAT 111 2350 1570739 N/A N/A 93558 93577 GGCTTGTTCCTGCTAAGGTC  31 2351

TABLE-US-00043 TABLE 43 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566448 N/A N/A 26022 26041 TGTTGAAGTATCCACACCCT  60 2352 1566483 N/A N/A 39217 39236 ATTCTTATTACTTCTGATAA 126 2353 1566511 N/A N/A 20029 20048 GTTCCAGTGACCTAACTTCA  49 2354 1566527 N/A N/A 220909 220928 GCTGTGTGCATATAGGATCT  48 2355 1566548 N/A N/A 23773 23792 TGTCCACACATATGTCTGCC   8 2356 1566550 N/A N/A 116703 116722 GTTCCAATTGTCACTAAGCA  15 2357 1566687 N/A N/A 28766 28785 TGCTCCCTAGGATTTGCTTC 137 2358 1566690 N/A N/A 183281 183300 GTCATCTTTTATCAAAGGTC  29 2359 1566892 N/A N/A 111867 111886 AAGTCATTCTTGCACTGCAT  28 2360 1566931 N/A N/A 12537 12556 CTGGAGATTTCTTCCCTGGA  89 2361 1567030 N/A N/A 37261 37280 GCTCCTCCCACTAGTGCCCA  62 2362 1567051 N/A N/A 37108 37127 CTCCAGTCAACTCGATGTTC  81 2363 1567055 N/A N/A 36161 36180 GGTACCACAGGACATTCTTC  97 2364 1567157 N/A N/A 202124 202143 CTGCAGCACCCATCCTACAA 110 2365 1567202 N/A N/A 177598 177617 TATAAAAAGAAAAACAGACC 161 2366 205259 205278 1567241 N/A N/A 36423 36442 GTGGTACTATGCCTCCGCAT  65 2367 1567253 N/A N/A 79679 79698 TGCCACTCATGAACACCACA  62 2368 1567322 N/A N/A 45596 45615 CTCCAACATGTTTCCTTAAC  20 2369 1567361 N/A N/A 180696 180715 CATTTTAGCATTTCTTAGGT  56 2370 182444 182463 1567370 N/A N/A 41351 41370 GCATGTATATCTATATAAAC  94 2371 41381 41400 41411 41430 1567407 N/A N/A 89594 89613 GCTGCCTTACTCAGAAGTTT  78 2372 1567413 N/A N/A 212289 212308 GCTGTTTTGCATAATGTCTT  68 2373 1567486 N/A N/A 19311 19330 CTACCTCATCACTCTCTAGT 106 2374 1567508 N/A N/A 102412 102431 GCCACCTTGTCACTGAGACT  70 2375 1567530 N/A N/A 125853 125872 GCGGTTGCCACTGCTGTTAA 103 2376 1567537 N/A N/A 76020 76039 CCAGCACACAGACTACTTGC  86 2377 1567585 N/A N/A 50516 50535 GCACTTGAAATGTCATGGCT  38 2378 1567646 N/A N/A 12014 12033 AACACAGTATTTCACCGTTT  17 2379 1567654 N/A N/A 14684 14703 GCCCCCTCTGTCTACTTACT 100 2380 1567680 N/A N/A 26336 26355 TGCCAACTTGAACCTGCTCC  81 2381 1567681 N/A N/A 161157 161176 GCAGCAATTTTTCAGTTATA  42 2382 1567696 N/A N/A 29816 29835 CACCAGTCAATGAATGCTGC  67 2383 1567700 N/A N/A 168858 168877 TCAGCATCACAAAGGTGCAC 113 2384 1567702 N/A N/A 13653 13672 CTGTGCTTGTATTAATTCTC  35 2385 1567729 N/A N/A 5837 5856 GCCTCCTTGCATGACCCCTC  92 2386 1567753 N/A N/A 93557 93576 GCTTGTTCCTGCTAAGGTCT  59 2387 1567767 N/A N/A 36874 36893 ATAGAACTGTAACACTGCAA  20 2388 1567824 N/A N/A 82078 82097 TATGCATATAACACATTTTA  81 2389 1567847 N/A N/A 223242 223261 GTTCCAATTACTGCTCCACC  42 2390 1567930 N/A N/A 164733 164752 CCTGGTGATTTATTTCCCAA  63 2391 1567955 N/A N/A 53358 53377 GTCAATTCTTACAAGCAGCT  15 2392 1567981 N/A N/A 40545 40564 CATGTTTATCTCTCTATATA  99 2393 40573 40592 1568064 N/A N/A 22231 22250 CTGGACATATCTTTGGACAT  45 2394 1568065 N/A N/A 167103 167122 TCTACTCCATTCTACTGCAT  60 2395 1568068 N/A N/A 99329 99348 GTCTCATGAAACTTTTCATA  68 2396 1568088 N/A N/A 122592 122611 TTGTGATTACATACTACAGC  33 2397 1568105 N/A N/A 35917 35936 TCCTATTCCCAACTATTGGC  58 2398 1568167 N/A N/A 60908 60927 ACCTGGCTTTAATATCTCCA  30 2399 1568187 N/A N/A 118581 118600 TAACTACTCCAAACCTTGGT 119 2400 1568231 N/A N/A 70283 70302 ATGCAGAACACTTTCTTGGT  49 2401 1568237 N/A N/A 27699 27718 TGCCAGACATATATCATAAC  35 2402 1568256 N/A N/A 63022 63041 CAAAGGCTTTATCTGTTCTA  30 2403 1568275 N/A N/A 109795 109814 TCAGCTACTCTCGCATGCTA  71 2404 1568285 N/A N/A 44000 44019 GGTTTCTACCTCCACCTGGC 112 2405 1568306 N/A N/A 48425 48444 GGCAAACATTTTCCTACAGC   5 2406 1568360 N/A N/A 17086 17105 GTGCAGTCCAGCAAACCTCC  99 2407 1568372 N/A N/A 19533 19552 CCTAGACAGTTTCTCTCCTT  86 2408 1568438 N/A N/A 94843 94862 CTCTCATGAGCCTCTGGCCA 130 2409 1568958 N/A N/A 187798 187817 TTCCTCCTACCATGACAGCC  84 2410 1568978 N/A N/A 24987 25006 TCATCAGCCCAAAAGTGGTT  97 2411 1569066 N/A N/A 72096 72115 GTAGCCTGCACATATCCCTC  49 2412 1569203 N/A N/A 84835 84854 CGGGCATCCAAGAATCCTCT 103 2413 1569429 N/A N/A 141581 141600 TCCCCTTCAATACCTTGGCC 103 2414 1569491 N/A N/A 107848 107867 AGCTTTGTACACACACGGGC  82 2415 1569780 N/A N/A 77872 77891 GAGCTGATGCACCCTGGATC  48 2416 1569824 N/A N/A 149092 149111 TCCGATCCATTCTTCTACCA  81 2417 1569997 N/A N/A 18495 18514 AGACCCCTCACTTTTTCCCA 124 2418 1570081 N/A N/A 106456 106475 GTCCTAGTTTCTCCACCTAT  58 2419 1570331 N/A N/A 139822 139841 CCAACCTTCTTCTGTGCATT  53 2420 1570435 N/A N/A 34862 34881 TCCTCACACAGCTTTAACAT  79 2421 1570469 N/A N/A 131413 131432 GCTTGTTTGACATCTTGGTC  47 2422 1570614 N/A N/A 35611 35630 GTGTGCCTCAGACCTCATAT  33 2423 1570674 N/A N/A 23139 23158 ACATTTGTTCCTCACCTGCA  79 2424 1570737 N/A N/A 21019 21038 TGTTTCCAGCCACTACTTCC  75 2425 1570783 N/A N/A 27121 27140 CCTAAGTTTCAGAATCGGTA  11 2426 1570852 N/A N/A 143159 143178 TGCCACACATCTCTGCCACC  63 2427 1570928 N/A N/A 86565 86584 GCCTCCTCCCTCATATGAAC  80 2428

TABLE-US-00044 TABLE 44 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   3 1008 1566446 N/A N/A 29815 29834 ACCAGTCAATGAATGCTGCT  67 2429 1566460 N/A N/A 27109 27128 AATCGGTATTATATTCCAGT  17 2430 1566615 N/A N/A 122588 122607 GATTACATACTACAGCTTCT  30 2431 1566685 N/A N/A 23772 23791 GTCCACACATATGTCTGCCA   5 2432 1566700 N/A N/A 19275 19294 TCCCAAACTATAGAATCATC  89 2433 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  22 2204 1566739 N/A N/A 111861 111880 TTCTTGCACTGCATACCGGC  66 2434 1566812 N/A N/A 77665 77684 GCTGTGTTAGCAGCTGGCCC  88 2435 1566860 N/A N/A 26021 26040 GTTGAAGTATCCACACCCTA  20 2436 1566918 N/A N/A 37257 37276 CTCCCACTAGTGCCCAGCCA  63 2437 1566920 N/A N/A 93322 93341 GTTCTAGGTCAGAATCTCCA  32 2438 1566930 N/A N/A 22151 22170 TGGGCTTCAAATAACAGACT  78 2439 1566954 N/A N/A 19530 19549 AGACAGTTTCTCTCCTTCGC  39 2440 1567063 N/A N/A 23133 23152 GTTCCTCACCTGCAAAGTAC  68 2441 1567135 N/A N/A 36422 36441 TGGTACTATGCCTCCGCATA  23 2442 1567152 N/A N/A 36160 36179 GTACCACAGGACATTCTTCC  38 2443 1567210 N/A N/A 27698 27717 GCCAGACATATATCATAACC  43 2444 1567267 N/A N/A 76012 76031 CAGACTACTTGCTATTCCTT  88 2445 1567273 N/A N/A 53087 53106 GAGCACTATGTTTCATGCAC  24 2446 1567286 N/A N/A 18494 18513 GACCCCTCACTTTTTCCCAC  73 2447 1567299 N/A N/A 20027 20046 TCCAGTGACCTAACTTCAGT  89 2448 1567339 N/A N/A 12429 12448 GCCTCTCCAGAACCCAGGAA  86 2449 1567357 N/A N/A 106354 106373 GTACCTGCTACATCATGACA  92 2450 1567368 N/A N/A 41350 41369 CATGTATATCTATATAAACA  85 2451 41380 41399 41410 41429 1567374 N/A N/A 16099 16118 TGAAGGCTCATCACTTCTCA 103 2452 1567375 N/A N/A 5530 5549 GCTCAACTGTCTATATGCAA  42 2453 1567376 N/A N/A 35905 35924 CTATTGGCATTCTCTAAGCT  68 2454 1567402 N/A N/A 60907 60926 CCTGGCTTTAATATCTCCAT  56 2455 1567449 N/A N/A 149089 149108 GATCCATTCTTCTACCACCC  70 2456 1567450 N/A N/A 35607 35626 GCCTCAGACCTCATATCATT  63 2457 1567474 N/A N/A 168795 168814 TGGAACTTTTGCTCTTTCCT 117 2458 1567550 N/A N/A 118362 118381 GTCTCCATAATAGTCTTACA  19 2459 1567567 N/A N/A 107831 107850 GGCTGGCTCTTCCATTCTCA  87 2460 1567593 N/A N/A 28759 28778 TAGGATTTGCTTCAAAGCCA  22 2461 1567659 N/A N/A 86559 86578 TCCCTCATATGAACAGGGTA 120 2462 1567663 N/A N/A 37107 37126 TCCAGTCAACTCGATGTTCC  63 2463 1567676 N/A N/A 14682 14701 CCCCTCTGTCTACTTACTTC 111 2464 1567686 N/A N/A 167047 167066 GGTTGCACCCTGATATGCCA  71 2465 1567698 N/A N/A 187786 187805 TGACAGCCACTGCTTCTGTA  82 2466 1567740 N/A N/A 219814 219833 CGTGCTTGTGTCATTCCCTC  85 2467 1567816 N/A N/A 26335 26354 GCCAACTTGAACCTGCTCCC  60 2468 1567874 N/A N/A 177597 177616 ATAAAAAGAAAAACAGACCA 103 2469 205258 205277 1567966 N/A N/A 79678 79697 GCCACTCATGAACACCACAT  42 2470 1567978 N/A N/A 180695 180714 ATTTTAGCATTTCTTAGGTA  57 2471 182443 182462 1568070 N/A N/A 94827 94846 GCCAGTGGTCTCCTTAAGCT  62 2472 1568089 N/A N/A 63017 63036 GCTTTATCTGTTCTACTACA  18 2473 1568127 N/A N/A 48363 48382 TACCAGAATTGATTTGTTCT  69 2474 1568143 N/A N/A 141580 141599 CCCCTTCAATACCTTGGCCT  58 2475 1568197 N/A N/A 34791 34810 TGCTGTTTTTACCTTTAGGT   5 2476 1568242 N/A N/A 212263 212282 TGGACTTTGCTATTTCCTCC  69 2477 1568262 N/A N/A 131320 131339 GGTCAATGCAGATAACAATC  19 2478 1568269 N/A N/A 143115 143134 ACTCTGTTACAGTCCCAGCT  68 2479 1568312 N/A N/A 164657 164676 GCTACTTACTGATCCTTTCA  65 2480 1568319 N/A N/A 109703 109722 GCTGAAGAACACTGTCAGCT 134 2481 1568332 N/A N/A 40544 40563 ATGTTTATCTCTCTATATAA 102 2482 40572 40591 1568342 N/A N/A 45592 45611 AACATGTTTCCTTAACTTCA  56 2483 1568349 N/A N/A 24967 24986 GCTGAAGTAAAGGACAGCCC 122 2484 1568401 N/A N/A 82074 82093 CATATAACACATTTTAGGTA  42 2485 1568430 N/A N/A 161102 161121 TAGACATTGGTTTACCAGCA  44 2486 1568431 1670 1689 89485 89504 TTGTCATAAATTCCATTTTA  42 2487 1569040 N/A N/A 116702 116721 TTCCAATTGTCACTAAGCAC  37 2488 1569041 N/A N/A 102020 102039 TGGCAACAGACTGCTAGGTA  15 2489 1569117 N/A N/A 201856 201875 TGATCCTGCTTTTTTCTCAC  59 2490 1569200 N/A N/A 21017 21036 TTTCCAGCCACTACTTCCCT  65 2491 1569283 N/A N/A 42735 42754 CCAGAATCCCATGCCTGGCA  99 2492 1569362 N/A N/A 182852 182871 GAGTCACCCCTACATGCCTC  78 2493 1569403 N/A N/A 70280 70299 CAGAACACTTTCTTGGTCTC  52 2494 1569449 N/A N/A 99225 99244 ATGTTGTTCTGATAGAAGCT  51 2495 1569494 N/A N/A 50476 50495 ATGCCATGCGATACCTAGCA  46 2496 1569540 N/A N/A 223231 223250 TGCTCCACCATCAAGTAGCT  93 2497 1569798 N/A N/A 72095 72114 TAGCCTGCACATATCCCTCA  83 2498 1570138 N/A N/A 13626 13645 AATCCCTCCAAGTCAAGGGC 112 2499 1570249 N/A N/A 39209 39228 TACTTCTGATAATTTGTCAC  61 2500 1570359 N/A N/A 84834 84853 GGGCATCCAAGAATCCTCTC  73 2501 1570721 N/A N/A 36872 36891 AGAACTGTAACACTGCAATC  29 2502 1570740 N/A N/A 12008 12027 GTATTTCACCGTTTAGAGCA  24 2503 1570851 N/A N/A 139521 139540 TCTCCTGGTTTTCAAGGCAT  49 2504

TABLE-US-00045 TABLE 45 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566456 N/A N/A 125788 125807 GTCTGGTCTTTTTTTGCTCC   9 2505 1566463 N/A N/A 34789 34808 CTGTTTTTACCTTTAGGTAT  45 2506 1566481 1663 1682 89478 89497 AAATTCCATTTTACTTGATA  37 2507 1566565 N/A N/A 223182 223201 GCTGGTCTCACTTTCCCCAA  99 2508 1566569 N/A N/A 168517 168536 CTGCACATCTACTTAGTACT  76 2509 1566676 N/A N/A 21012 21031 AGCCACTACTTCCCTCTTGA  37 2510 1566677 N/A N/A 14681 14700 CCCTCTGTCTACTTACTTCT  51 2511 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  16 2204 1566727 N/A N/A 36157 36176 CCACAGGACATTCTTCCACA  15 2512 1566729 N/A N/A 27696 27715 CAGACATATATCATAACCAC  18 2513 1566761 N/A N/A 40543 40562 TGTTTATCTCTCTATATAAA  79 2514 40571 40590 1566788 N/A N/A 161069 161088 TAGCATTCACCACAGCATGT 103 2515 1566791 N/A N/A 180694 180713 TTTTAGCATTTCTTAGGTAC  50 2516 182442 182461 1566831 N/A N/A 16097 16116 AAGGCTCATCACTTCTCACT  64 2517 1566833 N/A N/A 18493 18512 ACCCCTCACTTTTTCCCACC  62 2518 1566900 N/A N/A 26334 26353 CCAACTTGAACCTGCTCCCT  91 2519 1566912 N/A N/A 143110 143129 GTTACAGTCCCAGCTCGCTA  46 2520 1566940 N/A N/A 101964 101983 GCAGACATTTGCTAGCCCCC  64 2521 1567006 N/A N/A 19266 19285 ATAGAATCATCACAAGCATT  56 2522 1567026 N/A N/A 131272 131291 AAGCAATTTTATCACTATGC  30 2523 1567031 N/A N/A 50474 50493 GCCATGCGATACCTAGCACT  60 2524 1567049 N/A N/A 41349 41368 ATGTATATCTATATAAACAT  94 2525 41379 41398 41409 41428 1567069 N/A N/A 69723 69742 TCAAGCATAGTTTTTCAGTC  25 2526 1567139 N/A N/A 26924 26943 GTGGCAGGCTGCACTCCCTA   8† 2527 1567148 N/A N/A 19529 19548 GACAGTTTCTCTCCTTCGCC  63 2528 1567293 N/A N/A 45589 45608 ATGTTTCCTTAACTTCAGTC  43 2529 1567315 N/A N/A 5522 5541 GTCTATATGCAACACCACCT  63 2530 1567336 N/A N/A 93262 93281 TCTCAACTCCCTGGTCATGC  73 2531 1567388 N/A N/A 76010 76029 GACTACTTGCTATTCCTTAA  76 2532 1567409 N/A N/A 35554 35573 CCATTACCAACTCAAAGCCT  85 2533 1567416 N/A N/A 39159 39178 TCTGTGAATCATGTCAGCTT  10 2534 1567515 N/A N/A 122493 122512 CTGCAGTGCAGATATCTCCT  50 2535 1567521 N/A N/A 212262 212281 GGACTTTGCTATTTCCTCCA  48 2536 1567522 N/A N/A 107830 107849 GCTGGCTCTTCCATTCTCAG  72 2537 1567584 1934 1953 109636 109655 GTCCCCTCTCTATGTCGGGC  58 2538 1567622 1204 1223 23079 23098 TTTGTCCCTAACATTTTCCT   6 2539 1567682 N/A N/A 182389 182408 GTAGCCATCACTGCTTTCCA  30 2540 1567710 N/A N/A 36868 36887 CTGTAACACTGCAATCACGA   7 2541 1567726 N/A N/A 219811 219830 GCTTGTGTCATTCCCTCTCT  28 2542 1567727 N/A N/A 72093 72112 GCCTGCACATATCCCTCACT  89 2543 1567733 N/A N/A 11978 11997 GTTGGTGCTATTAAATGTAA  23 2544 1567744 N/A N/A 139277 139296 ATGGTCATCTTTGCTCCATA  92 2545 1567765 N/A N/A 201855 201874 GATCCTGCTTTTTTCTCACT  56 2546 1567774 N/A N/A 111860 111879 TCTTGCACTGCATACCGGCC  51 2547 1567810 N/A N/A 82073 82092 ATATAACACATTTTAGGTAT  70 2548 1567843 N/A N/A 141545 141564 TCAGTTGGTATCTCCTCCCT  56 2549 1567870 N/A N/A 167046 167065 GTTGCACCCTGATATGCCAT  76 2550 1567884 N/A N/A 177596 177615 TAAAAAGAAAAACAGACCAT  92 2551 205257 205276 1567896 N/A N/A 13625 13644 ATCCCTCCAAGTCAAGGGCT  88 2552 1567965 N/A N/A 116701 116720 TCCAATTGTCACTAAGCACT  39 2553 1568034 N/A N/A 20023 20042 GTGACCTAACTTCAGTATCA  68 2554 1568103 N/A N/A 62761 62780 GCTCCACAATGTTTTTAGAC  24 2555 1568137 N/A N/A 47857 47876 CCTAGTTATCATCAATATCA  48 2556 1568144 N/A N/A 22148 22167 GCTTCAAATAACAGACTCAA  44 2557 1568304 N/A N/A 149070 149089 CTCCACCATGTTCACTTGGT  81 2558 1568350 N/A N/A 86489 86508 GCTTCGGATTCTGAAAGCAT 119 2559 1568357 N/A N/A 29629 29648 TAATAAAATATATACTAAGT 135 2560 29649 29668 1568407 N/A N/A 94825 94844 CAGTGGTCTCCTTAAGCTCA  21 2561 1568432 N/A N/A 23755 23774 CCATTGTGTCTATCTTCAAC   7 2562 1568433 N/A N/A 79636 79655 GTACCAGTTTGATCACTATC  32 2563 1569443 N/A N/A 186959 186978 GCTAAGGCCTTGAACTTTTC  94 2564 1569577 N/A N/A 99164 99183 ACATCCTATTGAGACATGCT  38 2565 1569637 N/A N/A 52904 52923 ATTCTGTGCTCTCACTGTAT  62 2566 1569725 N/A N/A 12409 12428 GCCAGAGCACTCCTACTCCC  68 2567 1569810 N/A N/A 60832 60851 CACCACTTTCTTAGAAGACT  52 2568 1569850 N/A N/A 164519 164538 CTTCAATAGTTTACCATGGC  16 2569 1570011 N/A N/A 28650 28669 GTTCATGACACTATTCTGTA   8 2570 1570094 N/A N/A 77656 77675 GCAGCTGGCCCTTTTATCTC  74 2571 1570109 N/A N/A 24921 24940 GCTGTTTTCATTTTTCCGAG   5 2572 1570167 N/A N/A 118353 118372 ATAGTCTTACAACAGAGGTA  16 2573 1570240 N/A N/A 37098 37117 CTCGATGTTCCCAATTCCCT  26 2574 1570313 N/A N/A 37252 37271 ACTAGTGCCCAGCCAGCATC  46 2575 1570449 N/A N/A 26020 26039 TTGAAGTATCCACACCCTAT  74 2576 1570714 N/A N/A 106350 106369 CTGCTACATCATGACAACCA  82 2577 1570716 N/A N/A 35904 35923 TATTGGCATTCTCTAAGCTC  46 2578 1570802 N/A N/A 36414 36433 TGCCTCCGCATAAAGAATCA  73 2579 1570803 N/A N/A 84832 84851 GCATCCAAGAATCCTCTCCA  62 2580 1570815 N/A N/A 42237 42256 ATAGGATATCTTTTCAGATC  17 2581

TABLE-US-00046 TABLE 46 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkagesi n A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566444 N/A N/A 62632 62651 ATGGACTTGTCACTTATCCT  37 2582 1566457 N/A N/A 4299 4318 AGGTTCCTTGCCATCCACTC  92 2583 1566516 N/A N/A 122181 122200 GCTCTGCAAATAAGGTTCTC  34 2584 1566520 N/A N/A 29628 29647 AATAAAATATATACTAAGTT  93 2585 29648 29667 1566544 N/A N/A 27695 27714 AGACATATATCATAACCACA  14 2586 1566547 N/A N/A 22104 22123 ATACCAGGTTCTTACAGCCT  33 2587 1566576 N/A N/A 52816 52835 AGGAAAGGTATCATGCTCCT  56 2588 1566591 N/A N/A 69719 69738 GCATAGTTTTTCAGTCTCCC   7 2589 1566612 N/A N/A 36156 36175 CACAGGACATTCTTCCACAT  24 2590 1566626 N/A N/A 47762 47781 TGCTTCAATCAATTTACAGT  22 2591 1566627 N/A N/A 141524 141543 GGGAACATTCCTCAATGCTT  59 2592 1566654 N/A N/A 13624 13643 TCCCTCCAAGTCAAGGGCTC  74 2593 1566671 N/A N/A 131271 131290 AGCAATTTTATCACTATGCT  65 2594 1566713 N/A N/A 167043 167062 GCACCCTGATATGCCATGAT  39 2595 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  17 2204 1566720 N/A N/A 24920 24939 CTGTTTTCATTTTTCCGAGT   7 2596 1566728 N/A N/A 164518 164537 TTCAATAGTTTACCATGGCT  36 2597 1566730 N/A N/A 84794 84813 GCACTTAAATTTCCCCAGCA  87 2598 1566787 N/A N/A 60443 60462 ATGAGATCAAATCTTATTAC  84 2599 1566799 N/A N/A 94819 94838 TCTCCTTAAGCTCAAACACC 104 2600 1566823 N/A N/A 161042 161061 GCAGAATTGTAACTCTTGCA  74 2601 1566841 N/A N/A 101881 101900 GCCAATGCAAGGCCTGCCTC 106 2602 1566872 N/A N/A 21011 21030 GCCACTACTTCCCTCTTGAA  56 2603 1566921 N/A N/A 82072 82091 TATAACACATTTTAGGTATC  54 2604 1566962 N/A N/A 40541 40560 TTTATCTCTCTATATAAACA 120 2605 40569 40588 1567008 N/A N/A 36413 36432 GCCTCCGCATAAAGAATCAT  75 2606 1567017 N/A N/A 26864 26883 CCCCAGTTATGGCTATAACA  77 2607 1567076 N/A N/A 11952 11971 TGGGACTGCACACATTTATC  35 2608 1567087 N/A N/A 75986 76005 GCCAAGCACTCTCCTACTTA  53 2609 1567112 N/A N/A 77653 77672 GCTGGCCCTTTTATCTCTAA  69 2610 1567156 1900 1919 109602 109621 ATTTTCTATCTGACCAAACA  42 2611 1567192 N/A N/A 182388 182407 TAGCCATCACTGCTTTCCAT  64 2612 1567209 N/A N/A 149068 149087 CCACCATGTTCACTTGGTGC 107 2613 1567229 N/A N/A 180693 180712 TTTAGCATTTCTTAGGTACA  36 2614 182441 182460 1567254 N/A N/A 186783 186802 GCCATCACTCTAGTCCTGGC  94 2615 1567305 N/A N/A 28472 28491 GCCAAAATGTTTAACAGTCA   2 2616 1567341 N/A N/A 212256 212275 TGCTATTTCCTCCAAACATC  54 2617 1567392 N/A N/A 72089 72108 GCACATATCCCTCACTAATC  57 2618 1567418 N/A N/A 111859 111878 CTTGCACTGCATACCGGCCA  77 2619 1567435 N/A N/A 12358 12377 GGGAAATCTTACTAGCTCAA  37 2620 1567481 N/A N/A 34788 34807 TGTTTTTACCTTTAGGTATA  69 2621 1567564 1200 1219 23075 23094 TCCCTAACATTTTCCTTATT  61 2622 1567588 N/A N/A 118301 118320 AGAATTGGCACTTACACTTA  46 2623 1567589 N/A N/A 107806 107825 GTGGACTCTGTAATCCATCC 102 2624 1567603 N/A N/A 45305 45324 GCTCCAGCTGCCAACACCTT  81 2625 1567616 N/A N/A 23754 23773 CATTGTGTCTATCTTCAACC  32 2626 1567625 N/A N/A 39110 39129 AACTACTTTTCAGTTGTGCT   6 2627 1567631 N/A N/A 36860 36879 CTGCAATCACGAAATTGGTA  42 2628 1567720 N/A N/A 19528 19547 ACAGTTTCTCTCCTTCGCCT  51 2629 1567745 N/A N/A 26013 26032 ATCCACACCCTATAATTCAG  22 2630 1567773 N/A N/A 18489 18508 CTCACTTTTTCCCACCAAGT  75 2631 1567783 N/A N/A 177593 177612 AAAGAAAAACAGACCATAAC  97 2632 205254 205273 1567796 N/A N/A 16096 16115 AGGCTCATCACTTCTCACTT  52 2633 1567837 N/A N/A 106348 106367 GCTACATCATGACAACCACT  49 2634 1567854 N/A N/A 50470 50489 TGCGATACCTAGCACTCCTC  48 2635 1567857 N/A N/A 201601 201620 CAGCAGCTAATACAGGTTCC  51 2636 1568006 N/A N/A 93053 93072 CCTCTTTTGGACTCCTTGCT  81 2637 1568007 N/A N/A 20020 20039 ACCTAACTTCAGTATCAACA  70 2638 1568016 N/A N/A 14636 14655 AGTTGGTCATTCTATGTATA  36 2639 1568079 N/A N/A 35902 35921 TTGGCATTCTCTAAGCTCCT  19 2640 1568091 N/A N/A 168516 168535 TGCACATCTACTTAGTACTA  59 2641 1568193 N/A N/A 42236 42255 TAGGATATCTTTTCAGATCC  53 2642 1568195 N/A N/A 143098 143117 GCTCGCTACTACTCTGAGCT  54 2643 1568308 N/A N/A 41348 41367 TGTATATCTATATAAACATA  71 2644 41378 41397 41408 41427 1568363 N/A N/A 37097 37116 TCGATGTTCCCAATTCCCTT  30 2645 1568425 N/A N/A 96117 96136 GCATTATTTTGCTAAATCCC  47 2646 1568947 N/A N/A 35543 35562 TCAAAGCCTTCTATTCTGCA  54 2647 1568952 N/A N/A 125770 125789 CCCCAACTCTTGTAATACAC  59 2648 1569198 N/A N/A 37241 37260 GCCAGCATCCTCAATGAAAC  31 2649 1569255 N/A N/A 86475 86494 AAGCATCCCCTGTTCTACCA  46 2650 1569369 N/A N/A 223181 223200 CTGGTCTCACTTTCCCCAAC  77 2651 1569548 N/A N/A 79634 79653 ACCAGTTTGATCACTATCTT  32 2652 1569562 N/A N/A 139276 139295 TGGTCATCTTTGCTCCATAA  55 2653 1569823 N/A N/A 89368 89387 ATGCCAGCTACATTATGGCA  75 2654 1569990 N/A N/A 116503 116522 GTGCAATATGTTATAACTAC  11 2655 1570070 N/A N/A 219105 219124 GCAAATCTCAGAATCTGCCT  72 2656 1570742 N/A N/A 19260 19279 TCATCACAAGCATTCATGAC  66 2657 1570888 N/A N/A 26330 26349 CTTGAACCTGCTCCCTAACA  87 2658

TABLE-US-00047 TABLE 47 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   1 1008 1566535 N/A N/A 69370 69389 GCTTGAGAACTCTAGGCCCT  38 2659 1566558 N/A N/A 52812 52831 AAGGTATCATGCTCCTGGCC  70 2660 1566563 N/A N/A 106090 106109 TCTGAAGTACTCGCTGTGCT  92 2661 1566587 N/A N/A 36859 36878 TGCAATCACGAAATTGGTAC  49 2662 1566633 N/A N/A 109427 109446 AGGCACAAAGGAAACTCCTC 120 2663 1566653 N/A N/A 149047 149066 AGCCAGACTTGATTTCTGCT  60 2664 1566689 N/A N/A 39073 39092 TGGGCAGTATCTGATCAGTT   5 2665 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  17 2204 1566778 N/A N/A 81949 81968 CCTTGTCTTAAGTAACATCT  20 2666 1566806 N/A N/A 94812 94831 AAGCTCAAACACCATGCCGT 101 2667 1566852 N/A N/A 77549 77568 GTCCAGTTAGTATAAAGCAC  29 2668 1566869 N/A N/A 19259 19278 CATCACAAGCATTCATGACT  49 2669 1566893 N/A N/A 141523 141542 GGAACATTCCTCAATGCTTC  40 2670 1567018 N/A N/A 45303 45322 TCCAGCTGCCAACACCTTGT  23 2671 1567023 N/A N/A 37075 37094 CTCATCCTGTGACCACACTT  37 2672 1567060 N/A N/A 41347 41366 GTATATCTATATAAACATAT  68 2673 41377 41396 41407 41426 1567092 N/A N/A 107804 107823 GGACTCTGTAATCCATCCAC 139 2674 1567110 N/A N/A 11951 11970 GGGACTGCACACATTTATCA  22 2675 1567138 N/A N/A 122169 122188 AGGTTCTCTGAAATCAGCCA  31 2676 1567142 N/A N/A 211143 211162 GATGGGTCCTTCCCAGTGCA  40 2677 1567176 N/A N/A 21006 21025 TACTTCCCTCTTGAATAGCA  47 2678 1567197 N/A N/A 28446 28465 CTGGGTTACAGAATTCAACT   2 2679 1567232 N/A N/A 29627 29646 ATAAAATATATACTAAGTTA  59 2680 29647 29666 1567260 N/A N/A 186782 186801 CCATCACTCTAGTCCTGGCT  60 2681 1567284 N/A N/A 86411 86430 TCCCTATTATAATGTTGCAC  63 2682 1567287 N/A N/A 27694 27713 GACATATATCATAACCACAT   5 2683 1567348 N/A N/A 36410 36429 TCCGCATAAAGAATCATGTT  33 2684 1567410 N/A N/A 19527 19546 CAGTTTCTCTCCTTCGCCTA  37 2685 1567454 N/A N/A 26012 26031 TCCACACCCTATAATTCAGC  81 2686 1567466 N/A N/A 35901 35920 TGGCATTCTCTAAGCTCCTT   8 2687 1567490 N/A N/A 139201 139220 GTACCTTTATTTCTACATCA  39 2688 1567504 N/A N/A 217614 217633 GTATCATTATATGCTGGTCT  91 2689 1567540 N/A N/A 118298 118317 ATTGGCACTTACACTTACTT  12 2690 1567572 N/A N/A 23751 23770 TGTGTCTATCTTCAACCTTA   4 2691 1567626 N/A N/A 79478 79497 GCTGGGCTTATGCTGGATGC  62 2692 1567632 N/A N/A 42230 42249 ATCTTTTCAGATCCTGAGGT  27 2693 1567668 N/A N/A 18488 18507 TCACTTTTTCCCACCAAGTC  60 2694 1567674 N/A N/A 200958 200977 TTCAGGTTTTTCACCCAGTA  43 2695 1567675 N/A N/A 15882 15901 ACCCATCTCTTGCTTGCCAC  40 2696 1567693 N/A N/A 22099 22118 AGGTTCTTACAGCCTGATCA  22 2697 1567757 N/A N/A 14432 14451 TCAATCAATATTAGCCTGGC  67 2698 1567829 N/A N/A 95689 95708 CCTCTGTATATGCAATCCCC  29 2699 1567861 N/A N/A 60436 60455 CAAATCTTATTACCAGGAAA  57 2700 1567869 N/A N/A 47073 47092 GGCTACGGTCCCCATCACCA  63 2701 1567907 N/A N/A 180692 180711 TTAGCATTTCTTAGGTACAC  46 2702 182440 182459 1567946 N/A N/A 24918 24937 GTTTTCATTTTTCCGAGTCC   4 2703 1567982 N/A N/A 101853 101872 GCCATAAATGTATATCCTCC  13 2704 1567986 N/A N/A 111858 111877 TTGCACTGCATACCGGCCAC  36 2705 1567991 N/A N/A 35522 35541 ATGTACCAGCCTACCCCACC  90 2706 1568013 N/A N/A 50469 50488 GCGATACCTAGCACTCCTCT  30 2707 1568054 N/A N/A 71943 71962 GCAACATGGCTCTCTCTACA  54 2708 1568075 N/A N/A 26770 26789 CCTGTCTGCTTTTCAGGACT  59 2709 1568096 N/A N/A 62625 62644 TGTCACTTATCCTTGAGGCT  17 2710 1568145 N/A N/A 166967 166986 ATGCACTGATTTCATACGCA  15 2711 1568159 N/A N/A 116415 116434 GTACAAGATATCTGACACTC  18 2712 1568175 N/A N/A 26327 26346 GAACCTGCTCCCTAACATCC  48 2713 1568212 N/A N/A 36154 36173 CAGGACATTCTTCCACATGT  18 2714 1568259 N/A N/A 93047 93066 TTGGACTCCTTGCTATTACT  18 2715 1568276 N/A N/A 89143 89162 GGTCTTTTATCATTAGCCAA  42 2716 1568286 N/A N/A 84714 84733 CCCATGGTTTCTATGCCGGA  72 2717 1568324 N/A N/A 40540 40559 TTATCTCTCTATATAAACAT  56 2718 40568 40587 1568343 1197 1216 23072 23091 CTAACATTTTCCTTATTTTC  34 2719 1568392 N/A N/A 160975 160994 TTCCAGGTACACACCCCTGC 114 2720 1569027 N/A N/A 177191 177210 GGTTCAAATTTTGACCCTTC  20 2721 1569078 N/A N/A 143095 143114 CGCTACTACTCTGAGCTTTC  77 2722 1569164 N/A N/A 13402 13421 AGTACTTCAGAACCCACTAT  41 2723 1569598 N/A N/A 182099 182118 TAGCAATGCTGAATACACAC  30 2724 1569695 N/A N/A 223076 223095 GCTGCTGCAAATGACTGCTC  49 2725 1569842 N/A N/A 168140 168159 TGGCTCCATTTTAAGCCCTC 122 2726 1569999 N/A N/A 20009 20028 GTATCAACATCTGTATCTAT  41 2727 1570116 N/A N/A 12356 12375 GAAATCTTACTAGCTCAAGC  39 2728 1570356 N/A N/A 37237 37256 GCATCCTCAATGAAACAGCT  24 2729 1570398 N/A N/A 125761 125780 TTGTAATACACTGTTGCACT  15 2730 1570411 N/A N/A 4298 4317 GGTTCCTTGCCATCCACTCT  80 2731 1570599 N/A N/A 34780 34799 CCTTTAGGTATATAGCATAA  21 2732 1570618 N/A N/A 75909 75928 ATGGCTCTTTTCCTTAACTC  40 2733 1570772 N/A N/A 164501 164520 GCTCTTAGGATAAACTCCTA  50 2734 1570822 N/A N/A 131225 131244 GGCACTATGATTTAACCTCT   8 2735

TABLE-US-00048 TABLE 48 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566491 N/A N/A 36846 36865 TTGGTACCATCAAGTACCGA  63 2736 1566568 N/A N/A 95649 95668 GTGGTACATGACTAATTATA  32 2737 1566609 N/A N/A 105933 105952 TTCCATCTTCAACTCCTGTA  48 2738 1566624 N/A N/A 200956 200975 CAGGTTTTTCACCCAGTAGC  55 2739 1566642 N/A N/A 26673 26692 GCCTGGAGTTAATATACCTA  66 2740 1566656 N/A N/A 37234 37253 TCCTCAATGAAACAGCTCCA  56 2741 1566672 N/A N/A 40539 40558 TATCTCTCTATATAAACATA 101 2742 40567 40586 1566688 N/A N/A 89054 89073 GTCCTCCTTATTCTTTAGCA  45 2743 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  15 2204 1566718 N/A N/A 41345 41364 ATATCTATATAAACATATAC 112 2744 41375 41394 41405 41424 1566747 N/A N/A 13395 13414 CAGAACCCACTATTCTAGGT  30 2745 1566753 N/A N/A 22025 22044 GTTCCCTATTTATAGTATTC  22 2746 1566798 N/A N/A 19496 19515 CTACATATTTGTTCCTGCCC  66 2747 1566814 1148 1167 23023 23042 TATCAGTCATTATCTCATCA   5 2748 1566844 N/A N/A 36130 36149 TTCAAATGATATCAATGAGC  29 2749 1566864 N/A N/A 81823 81842 AGTTGTCTGCATCCCAGCCA  52 2750 1566915 N/A N/A 27692 27711 CATATATCATAACCACATCT  35 2751 1566923 N/A N/A 23750 23769 GTGTCTATCTTCAACCTTAA  19 2752 1566979 N/A N/A 24908 24927 TTCCGAGTCCCAGTTCGCAC  23 2753 1567042 N/A N/A 168138 168157 GCTCCATTTTAAGCCCTCAT  21 2754 1567074 N/A N/A 186781 186800 CATCACTCTAGTCCTGGCTT  63 2755 1567101 N/A N/A 15881 15900 CCCATCTCTTGCTTGCCACA  63 2756 1567102 N/A N/A 86396 86415 TGCACATGCCTCAAGTGAAC  27 2757 1567127 N/A N/A 4297 4316 GTTCCTTGCCATCCACTCTT  49 2758 1567128 N/A N/A 26326 26345 AACCTGCTCCCTAACATCCT  78 2759 1567355 N/A N/A 37073 37092 CATCCTGTGACCACACTTCC  48 2760 1567439 N/A N/A 71641 71660 GGTACTTTATCATAACCATA  19 2761 1567441 N/A N/A 211142 211161 ATGGGTCCTTCCCAGTGCAT  45 2762 1567456 N/A N/A 118291 118310 CTTACACTTACTTTCTCCAC  30 2763 1567463 N/A N/A 35891 35910 TAAGCTCCTTGATCTGATTC  53 2764 1567501 N/A N/A 52791 52810 CAGGTATGTTACCTTACACA  62 2765 1567524 N/A N/A 84699 84718 CCGGACTGGTCCCATAGGCA  31 2766 1567533 N/A N/A 26011 26030 CCACACCCTATAATTCAGCA  11 2767 1567701 N/A N/A 29626 29645 TAAAATATATACTAAGTTAA  61 2768 29646 29665 1567712 N/A N/A 148774 148793 TGTGTCTTCTAGTTCATCCC  29 2769 1567770 N/A N/A 182070 182089 ACTGGCTCATGAACCAGTCA  94 2770 1567781 N/A N/A 62501 62520 CCTATCTCTATTTTCCTGGA  25 2771 1567812 N/A N/A 176666 176685 GTCTTACACCTGTCCCACCA  42 2772 1567825 N/A N/A 38833 38852 TCTGGTAACTTCTACTGTAT  28 2773 1567890 N/A N/A 36409 36428 CCGCATAAAGAATCATGTTA   7 2774 1567895 N/A N/A 28445 28464 TGGGTTACAGAATTCAACTT  43 2775 1567994 N/A N/A 94810 94829 GCTCAAACACCATGCCGTCA  38 2776 1568050 N/A N/A 68813 68832 AAGCTATTTTGAACCCATGC  16 2777 1568092 N/A N/A 138860 138879 TCACCATGAATATGCAGGGC  20 2778 1568093 N/A N/A 180669 180688 TCAGTGGTATTAACATCCAC  67 2779 182417 182436 1568136 N/A N/A 79360 79379 AGCCAGTTTCCTGACCATCC  37 2780 1568227 N/A N/A 75520 75539 CCCTCCGACATATAAGCTGC 118 2781 1568273 N/A N/A 164466 164485 GCTTCACCTAGAATCTTGCT  70 2782 1568309 N/A N/A 166966 166985 TGCACTGATTTCATACGCAC  68 2783 1568371 N/A N/A 122141 122160 GTGAAGTTCTATCACACCAT  50 2784 1568376 N/A N/A 125686 125705 CCTGATGTTCTAACTCATCT 101 2785 1568398 N/A N/A 116361 116380 TGCCTGTGTTTTACCTTTCC  37 2786 1568415 N/A N/A 47069 47088 ACGGTCCCCATCACCAGCCA  86 2787 1568416 N/A N/A 111713 111732 GCCCCATGAACTGATGCTGC  50 2788 1568419 N/A N/A 19257 19276 TCACAAGCATTCATGACTTC  49 2789 1568440 N/A N/A 19999 20018 CTGTATCTATAAAAGACTCA  83 2790 1569102 N/A N/A 11950 11969 GGACTGCACACATTTATCAC  23 2791 1569126 N/A N/A 60188 60207 TGGTCCTCTTCCCTGGACTA  59 2792 1569282 N/A N/A 34491 34510 GTGAAACCCCGTATCCTGTC  62 2793 1569502 N/A N/A 21005 21024 ACTTCCCTCTTGAATAGCAC  28 2794 1569620 N/A N/A 143081 143100 GCTTTCTCTGATCTACATTC  28 2795 1569631 N/A N/A 45302 45321 CCAGCTGCCAACACCTTGTA  23 2796 1569645 N/A N/A 160973 160992 CCAGGTACACACCCCTGCTA 121 2797 1569687 N/A N/A 14431 14450 CAATCAATATTAGCCTGGCT  52 2798 1569783 N/A N/A 12281 12300 CAGAAACACCATCACTTTGC  50 2799 1569906 N/A N/A 35521 35540 TGTACCAGCCTACCCCACCT  57 2800 1569913 N/A N/A 107798 107817 TGTAATCCATCCACCACTCT  70 2801 1569933 N/A N/A 141458 141477 CTGGTCTCCTCTATCATGCC  50 2802 1570053 N/A N/A 217346 217365 ACTACTTACAAGCTATGGCC  58 2803 1570136 N/A N/A 101820 101839 TTCCACTGCTGAATATCAGT  42 2804 1570174 N/A N/A 18487 18506 CACTTTTTCCCACCAAGTCT  56 2805 1570279 N/A N/A 109408 109427 CCTTCATACTGAGATAGTCA  34 2806 1570334 N/A N/A 42186 42205 CTGAAATTTTCTGTATGGTC   7 2807 1570501 N/A N/A 131175 131194 GCAGATGAAGACACTTTGGT  17 2808 1570503 N/A N/A 50465 50484 TACCTAGCACTCCTCTGCTC  59 2809 1570514 N/A N/A 77068 77087 TTGCACCCTAGTATTCTATC  58 2810 1570575 N/A N/A 222982 223001 GCAGTTTGATTTCTTTGATC  14 2811 1570593 N/A N/A 93044 93063 GACTCCTTGCTATTACTGCT  16 2812

TABLE-US-00049 TABLE 49 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   3 1008 1566502 N/A N/A  71331  71350 GTTTTTGGATTCTCCATGCT  19 2813 1566577 N/A N/A 101816 101835 ACTGCTGAATATCAGTTCTC  89 2814 1566607 N/A N/A  36296  36315 AGTAGAGGTTATTCTTATTC   4 2815 1566649 N/A N/A 164461 164480 ACCTAGAATCTTGCTCTCCT  40 2816 1566675 1147 1166  23022  23041 ATCAGTCATTATCTCATCAA   4 2817 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  27 2204 1566803 N/A N/A 210830 210849 GCAGAGGTTTCACTTTTCCC  30 2818 1566856 N/A N/A 143051 143070 CCTACATCTCAATTCTTTCA  80 2819 1566876 N/A N/A 182069 182088 CTGGCTCATGAACCAGTCAT 122 2820 1566907 N/A N/A 111699 111718 TGCTGCCATCTTGATGCCAT  75 2821 1566928 N/A N/A  29620  29639 ATATACTAAGTTAATAAAAT 125 2822  29640  29659 1566958 N/A N/A  12275  12294 CACCATCACTTTGCCCATGA  36 2823 1566959 N/A N/A  61689  61708 TGGTAGTCTATGATTCACCT  95 2824 1567011 N/A N/A  68812  68831 AGCTATTTTGAACCCATGCC  46 2825 1567039 N/A N/A 116360 116379 GCCTGTGTTTTACCTTTCCA  26 2826 1567122 N/A N/A  81822  81841 GTTGTCTGCATCCCAGCCAA  55 2827 1567161 N/A N/A  21004  21023 CTTCCCTCTTGAATAGCACA  35 2828 1567344 N/A N/A  88257  88276 TCACACTCTCCTTATTGTCT  43 2829 1567391 N/A N/A 180668 180687 CAGTGGTATTAACATCCACA  83 2830 182416 182435 1567415 N/A N/A  41051  41070 GCATGTATATTTATCTATAT  26 2831  41085  41104  41117  41136  41151  41170  41185  41204  41219  41238  41253  41272  41287  41306  41321  41340  41445  41464 1567437 N/A N/A 122136 122155 GTTCTATCACACCATTCATT  18 2832 1567453 N/A N/A  45292  45311 ACACCTTGTATAACTCAGGC   7 2833 1567485 N/A N/A  19254  19273 CAAGCATTCATGACTTCCAA  65 2834 1567496 N/A N/A   4285   4304 CCACTCTTCAAAGAATCCTC  59 2835 1567516 N/A N/A 130771 130790 ATGATATCATAGTCACACCA  28 2836 1567528 N/A N/A  36111  36130 CTAAGGCTAGTTTTTAACCA  24 2837 1567547 N/A N/A 138701 138720 AGCAGACTCCAACTGTGGCA  70 2838 1567556 N/A N/A  37072  37091 ATCCTGTGACCACACTTCCT  34 2839 1567576 N/A N/A 105932 105951 TCCATCTTCAACTCCTGTAC  77 2840 1567637 N/A N/A  22023  22042 TCCCTATTTATAGTATTCAT  45 2841 1567652 N/A N/A 222761 222780 TTGCTCTTGCTTTATAGGCT  31 2842 1567669 N/A N/A 166918 166937 GGGATCTTATCTCTTTCTCA  44 2843 1567683 N/A N/A  60012  60031 GCTTTTCACTTACGAGCCAA  48 2844 1567737 N/A N/A  26324  26343 CCTGCTCCCTAACATCCTAA  52 2845 1567758 N/A N/A 148660 148679 CCACCATGTTTACATTTCAA  22 2846 1567808 N/A N/A  24907  24926 TCCGAGTCCCAGTTCGCACA  21 2847 1567811 N/A N/A  42119  42138 GCATCAGTTGAATAATCCCT  11 2848 1567906 N/A N/A  13391  13410 ACCCACTATTCTAGGTAACT  38 2849 1567908 N/A N/A  26672  26691 CCTGGAGTTAATATACCTAA  50 2850 1567940 N/A N/A  52790  52809 AGGTATGTTACCTTACACAA  46 2851 1567989 N/A N/A  37172  37191 CACTGAACAGCTCTTCTGCA  73 2852 1568045 N/A N/A 118235 118254 GCCACTTTTCTACTACATAT  37 2853 1568047 N/A N/A 160944 160963 GTCCAACTACAGCCCTTGGC 100 2854 1568121 N/A N/A  50462  50481 CTAGCACTCCTCTGCTCCCA  64 2855 1568139 N/A N/A  35520  35539 GTACCAGCCTACCCCACCTC  50 2856 1568161 N/A N/A  35888  35907 GCTCCTTGATCTGATTCTTT  16 2857 1568198 N/A N/A  95628  95647 AGCTGAGCCACTGACTAATC  46 2858 1568205 N/A N/A  93008  93027 GCACCTCTCCATGAACTTGC  78 2859 1568223 N/A N/A 186712 186731 TGGTTGTAGCTTCCTTGTCT  45 2860 1568238 N/A N/A  40537  40556 TCTCTCTATATAAACATATA  90 2861  40565  40584 1568251 N/A N/A  34484  34503 CCCGTATCCTGTCTCTACTA  86 2862 1568260 N/A N/A 125569 125588 TGGTGTCACTGATTTATGCC  47 2863 1568283 N/A N/A  36844  36863 GGTACCATCAAGTACCGACC  84 2864 1568289 N/A N/A  47068  47087 CGGTCCCCATCACCAGCCAT  77 2865 1568326 N/A N/A 107790 107809 ATCCACCACTCTCCACCTCT  73 2866 1568346 N/A N/A  19972  19991 ATGACAGGTCTTCTACATCC  30 2867 1568348 N/A N/A  25958  25977 CAGGCATTTGTATACGATAC  10 2868 1568395 N/A N/A  79359  79378 GCCAGTTTCCTGACCATCCT  65 2869 1568412 N/A N/A  23740  23759 TCAACCTTAAAATCTCAGGG  11 2870 1568421 N/A N/A  11949  11968 GACTGCACACATTTATCACC  29 2871 1568993 N/A N/A 168137 168156 CTCCATTTTAAGCCCTCATC  42 2872 1568995 N/A N/A 109031 109050 ATCTGGTCCTTCCATGCCTC  69 2873 1569172 N/A N/A  84694  84713 CTGGTCCCATAGGCACCATC 109 2874 1569333 N/A N/A  86388  86407 CCTCAAGTGAACCACTGAAA  88 2875 1569442 N/A N/A  38804  38823 ATGTTAGTCACAACCTACCG  28 2876 1569446 N/A N/A  94508  94527 TTGTACTACTTCTGCCTGCA  37 2877 1569457 N/A N/A  14226  14245 AATGGTTGTCAATCACAGCT  46 2878 1569512 N/A N/A  76996  77015 TGTTCATAATATAAGCTCCC  38 2879 1569653 N/A N/A  18468  18487 TGGTTCCCACCAAGTTTCTT  61 2880 1569696 N/A N/A  27686  27705 TCATAACCACATCTTCTTCC  23 2881 1569805 N/A N/A  28444  28463 GGGTTACAGAATTCAACTTA  12 2882 1569820 N/A N/A 217329 217348 GCCATTTCTTAAATGGACAT  76 2883 1569821 N/A N/A 141457 141476 TGGTCTCCTCTATCATGCCA  64 2884 1570265 N/A N/A  15282  15301 ATTCTATATTAAATGCAGGT  19 2885 1570393 N/A N/A 200950 200969 TTTCACCCAGTAGCCAGCTT  72 2886 1570573 N/A N/A 176654 176673 TCCCACCATTTATTTTGGAA  93 2887 1570779 N/A N/A  19495  19514 TACATATTTGTTCCTGCCCT  65 2888 1570808 N/A N/A  75459  75478 TCCTTATATACGACTACACT  66 2889

TABLE-US-00050 TABLE 50 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566510 N/A N/A  25916  25935 GCAGCATTCTCTGTACAACT  20 2890 1566525 N/A N/A  19968  19987 CAGGTCTTCTACATCCTTAG  37 2891 1566598 N/A N/A  68811  68830 GCTATTTTGAACCCATGCCT  69 2892 1566620 N/A N/A  23739  23758 CAACCTTAAAATCTCAGGGC  39 2893 1566640 N/A N/A 200925 200944 ATGCTGGTAACTACTTTCTC 112 2894 1566651 N/A N/A  36843  36862 GTACCATCAAGTACCGACCA  33 2895 1566699 N/A N/A  47027  47046 GGAAACTCTTTATCCAGGCC   9 2896 1566707 N/A N/A 142948 142967 TGGCTGTTTGTTATTCCCCT  53 2897 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  20 2204 1566736 N/A N/A  84684  84703 AGGCACCATCTCCCTACCAT  79 2898 1566749 N/A N/A  36108  36127 AGGCTAGTTTTTAACCAAGT   7 2899 1566774 N/A N/A  45291  45310 CACCTTGTATAACTCAGGCA  42 2900 1566867 N/A N/A  35873  35892 TCTTTTCTCTGTATCCGCTT   5 2901 1566934 N/A N/A 176230 176249 GGTTTTCTCTAGTAAGCCCC  59 2902 1567010 N/A N/A  24899  24918 CCAGTTCGCACACATGGTTA  69 2903 1567022 N/A N/A  79308  79327 GCTTCAGTTTATCAAGAGGT  33 2904 1567044 N/A N/A  41050  41069 CATGTATATTTATCTATATA  52 2905  41084  41103  41116  41135  41150  41169  41184  41203  41218  41237  41252  41271  41286  41305  41320  41339  41444  41463 1567047 N/A N/A  61686  61705 TAGTCTATGATTCACCTGCT  24 2906 1567098 N/A N/A 180667 180686 AGTGGTATTAACATCCACAA 104 2907 182415 182434 1567108 N/A N/A 148486 148505 GGCAGCACACATCAAGGGTT  53 2908 1567134 N/A N/A  50407  50426 TGGTCATGCTCCCATATGGC  44 2909 1567155 N/A N/A  26322  26341 TGCTCCCTAACATCCTAAGC  71 2910 1567252 N/A N/A 107765 107784 CACTACTATAGTCTAAGTCC  54 2911 1567274 N/A N/A 138700 138719 GCAGACTCCAACTGTGGCAT  99 2912 1567307 N/A N/A  42080  42099 GCCATCTCTGCCATATGAAC  21 2913 1567346 N/A N/A  86208  86227 GAAGGCTTACAGCCTTCATC 102 2914 1567428 N/A N/A  35509  35528 CCCCACCTCCTTCATACAGC  81 2915 1567430 N/A N/A 166917 166936 GGATCTTATCTCTTTCTCAA  27 2916 1567460 N/A N/A 125528 125547 TATCATCTAGACTTCTAGGC  45 2917 1567470 N/A N/A 116282 116301 AGGTAGCAAGTATTCCAGCT  33 2918 1567510 N/A N/A 222760 222779 TGCTCTTGCTTTATAGGCTA  50 2919 1567535 1146 1165  23021  23040 TCAGTCATTATCTCATCAAC   2 2920 1567566 N/A N/A  21000  21019 CCTCTTGAATAGCACACCTA  79 2921 1567628 N/A N/A  37053  37072 TGGAATGCCCTCTTTCTACC  61 2922 1567649 N/A N/A 105826 105845 GTAGTAACAAGACCTTCCAA  57 2923 1567650 N/A N/A  14225  14244 ATGGTTGTCAATCACAGCTA  82 2924 1567689 N/A N/A  71295  71314 TGTCTATCTCTGTATCACGA  24 2925 1567717 N/A N/A  58625  58644 GGTCAAGGCTCACCTCCTCT  87 2926 1567741 N/A N/A  27676  27695 ATCTTCTTCCTCTGTACGCA   2 2927 1567789 N/A N/A  13378  13397 GGTAACTGGATACTCATCTA  69 2928 1567792 N/A N/A  95627  95646 GCTGAGCCACTGACTAATCA  48 2929 1567817 N/A N/A  75450  75469 ACGACTACACTGTTTGACTT  82 2930 1567828 N/A N/A  38803  38822 TGTTAGTCACAACCTACCGA  33 2931 1568042 N/A N/A 160943 160962 TCCAACTACAGCCCTTGGCA  87 2932 1568046 N/A N/A  15268  15287 GCAGGTATATACTATGTAGT  25 2933 1568052 N/A N/A  18464  18483 TCCCACCAAGTTTCTTGTGT  66 2934 1568141 N/A N/A   4269   4288 CCTCTACTTTTAGCTCTGGA  55 2935 1568157 N/A N/A 182067 182086 GGCTCATGAACCAGTCATCA  88 2936 1568254 N/A N/A  88092  88111 ATCCTTTATCAGCCAGTCCT  41 2937 1568270 N/A N/A 111686 111705 ATGCCATGGACACTTTGACT  47 2938 1568296 N/A N/A 118146 118165 AGGCCAGTTTTCACTTTGCA  29 2939 1568311 N/A N/A  19466  19485 TGGTGACATTATCTCAGAGC  19 2940 1568315 N/A N/A  29618  29637 ATACTAAGTTAATAAAATAT 103 2941  29638  29657 1568318 N/A N/A 217051 217070 TGTCCATTGTTTTACCTATC  23 2942 1568329 N/A N/A  76369  76388 ATGACTTCCAATTATCTGCA  91 2943 1568393 N/A N/A  92991  93010 TGCTAACTTGATCCCACCAC  68 2944 1568441 N/A N/A  40535  40554 TCTCTATATAAACATATACA 106 2945  40563  40582 1568444 N/A N/A 141456 141475 GGTCTCCTCTATCATGCCAT  93 2946 1568962 N/A N/A 168125 168144 CCCTCATCCTTATTTATTCA  68 2947 1569123 N/A N/A  36295  36314 GTAGAGGTTATTCTTATTCC   3 2948 1569162 N/A N/A 164439 164458 AGGACCACCCTTCACTCATT  33 2949 1569400 N/A N/A  28283  28302 ACTTCACTTAATCAATCAGT  13 2950 1569414 N/A N/A 130768 130787 ATATCATAGTCACACCATCT  38 2951 1569500 N/A N/A  26671  26690 CTGGAGTTAATATACCTAAC  33 2952 1569874 N/A N/A  94285  94304 GTTCCAAATACTAGCTGCCC  39 2953 1570107 N/A N/A  52765  52784 GGGTTTGTAAACCAAACTTC  99 2954 1570150 N/A N/A  19252  19271 AGCATTCATGACTTCCAACA  50 2955 1570182 N/A N/A  12274  12293 ACCATCACTTTGCCCATGAT  59 2956 1570318 N/A N/A  34065  34084 TCGAGATTAGATCATATGTT   8 2957 1570421 N/A N/A 109016 109035 GCCTCTTATTATTATCTGAA  57 2958 1570458 N/A N/A  11724  11743 ACAGGCTTTCATTAGATCTC  68 2959 1570520 N/A N/A 101603 101622 AGCTTCCCTAACCAATGCAT 120 2960 1570579 N/A N/A  37171  37190 ACTGAACAGCTCTTCTGCAC  51 2961 1570645 N/A N/A 210828 210847 AGAGGTTTCACTTTTCCCCA  68 2962 1570686 N/A N/A 121413 121432 GTTTCAAATCTGCCACACCC  36 2963 1570788 N/A N/A 186618 186637 TGCTCACAATGATATAGCAA  90 2964 1570841 N/A N/A  81821  81840 TTGTCTGCATCCCAGCCAAC  67 2965 1570900 N/A N/A  21962  21981 GCAGATCTGTAATAAACCAT  40 2966

TABLE-US-00051 TABLE 51 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   1 1008 1566452 N/A N/A 130580 130599 ATCATGCTCAGTCATCCCTC  44 2967 1566484 N/A N/A 121078 121097 GTGGACATTTTGAACAAGGA   6 2968 1566534 N/A N/A  27675  27694 TCTTCTTCCTCTGTACGCAC   5 2969 1566552 N/A N/A  58618  58637 GCTCACCTCCTCTAAGATGC  37 2970 1566634 N/A N/A  32689  32708 TCAACATAATAGTCCTAACT 123 2971 1566637 N/A N/A 118145 118164 GGCCAGTTTTCACTTTGCAA  48 2972 1566695 N/A N/A 164435 164454 CCACCCTTCACTCATTGTCT  87 2973 1566701 N/A N/A  26590  26609 ACCAAACCAGCCTACTTCTC  29 2974 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  14 2204 1566719 N/A N/A 160872 160891 TGGCAATAGCTCCCTGGTCA 140 2975 1566757 N/A N/A  94284  94303 TTCCAAATACTAGCTGCCCT  49 2976 1566825 N/A N/A 116115 116134 GGTCTGGTACTTACTTGGCA 104 2977 1566827 N/A N/A  19967  19986 AGGTCTTCTACATCCTTAGA  25 2978 1566916 N/A N/A  13371  13390 GGATACTCATCTATAGCAGT  40 2979 1566951 N/A N/A  36840  36859 CCATCAAGTACCGACCACTT  40 2980 1566955 N/A N/A  86207  86226 AAGGCTTACAGCCTTCATCT  70 2981 1566976 N/A N/A 108991 109010 GAGCAGGTATCATACAAGGA  57 2982 1567040 N/A N/A  35868  35887 TCTCTGTATCCGCTTTTTCC  12 2983 1567086 N/A N/A  40855  40874 ATCTAAACATATACATGTGC  30 2984  40885  40904  40915  40934  40945  40964  40975  40994  41005  41024 1567143 N/A N/A  38798  38817 GTCACAACCTACCGAACTGA  19 2985 1567149 N/A N/A  29617  29636 TACTAAGTTAATAAAATATA  61 2986  29637  29656 1567198 N/A N/A  12273  12292 CCATCACTTTGCCCATGATA  38 2987 1567281 N/A N/A 168085 168104 CTGCAAGCTGTCTCATTCCT  26 2988 1567471 N/A N/A  24894  24913 TCGCACACATGGTTAACTCT  24 2989 1567482 N/A N/A  81819  81838 GTCTGCATCCCAGCCAACAC  45 2990 1567534 N/A N/A  76363  76382 TCCAATTATCTGCACTGATA  68 2991 1567558 N/A N/A  92936  92955 GCTCTGATGATATCAGCCCC  61 2992 1567563 N/A N/A 111684 111703 GCCATGGACACTTTGACTTT  37 2993 1567608 N/A N/A  84682  84701 GCACCATCTCCCTACCATGT  53 2994 1567613 N/A N/A  26321  26340 GCTCCCTAACATCCTAAGCC  83 2995 1567620 N/A N/A  21895  21914 CTCCATTCTTCCATTATCAG  38 2996 1567665 N/A N/A 105135 105154 GCCTGCAACAAATATCTCAT  48 2997 1567678 N/A N/A  87805  87824 GACTCCTTTGACTAAGGCCC  43 2998 1567711 N/A N/A  19251  19270 GCATTCATGACTTCCAACAA  33 2999 1567725 N/A N/A  27916  27935 ATGGGCTTCTCTGCCTAGTC  75 3000 1567801 N/A N/A 125402 125421 TGCATATTTCATTCATTAGC  13 3001 1567806 N/A N/A  45290  45309 ACCTTGTATAACTCAGGCAC  77 3002 1567830 N/A N/A  42076  42095 TCTCTGCCATATGAACTTCC  35 3003 1567838 N/A N/A  79222  79241 TGGTATTATTCTTATTTCGA   5 3004 1567850 N/A N/A  20992  21011 ATAGCACACCTAATCAAGGG  47 3005 1567922 N/A N/A  36294  36313 TAGAGGTTATTCTTATTCCC   3 3006 1567934 N/A N/A  52622  52641 CCACCTTATTTGCCTCACAT  18 3007 1567944 N/A N/A 141453 141472 CTCCTCTATCATGCCATGCA  64 3008 1567957 N/A N/A  68739  68758 ACCCAACTCAAATCCTGTCC  44 3009 1567993 N/A N/A  50402  50421 ATGCTCCCATATGGCCATCA  67 3010 1568171 N/A N/A  36107  36126 GGCTAGTTTTTAACCAAGTA  14 3011 1568202 N/A N/A   4268   4287 CTCTACTTTTAGCTCTGGAA  40 3012 1568247 N/A N/A  23725  23744 CAGGGCACATGGACCAAGAC  89 3013 1568263 N/A N/A  40534  40553 CTCTATATAAACATATACAT  60 3014  40562  40581 1568299 1140 1159  23015  23034 ATTATCTCATCAACATTTAC  34 3015 1568328 N/A N/A 217050 217069 GTCCATTGTTTTACCTATCA  11 3016 1568334 N/A N/A 182066 182085 GCTCATGAACCAGTCATCAA  60 3017 1568355 N/A N/A 222759 222778 GCTCTTGCTTTATAGGCTAT  18 3018 1568358 N/A N/A  18403  18422 GGTGATTGATCAAATCAGCT  77 3019 1568394 N/A N/A 200924 200943 TGCTGGTAACTACTTTCTCA  55 3020 1568402 N/A N/A  11722  11741 AGGCTTTCATTAGATCTCCT 109 3021 1568404 N/A N/A  75122  75141 ACAGAGTTTTGGCCTTCCCT  38 3022 1568949 N/A N/A  47026  47045 GAAACTCTTTATCCAGGCCC  86 3023 1568974 N/A N/A  61684  61703 GTCTATGATTCACCTGCTTT  33 3024 1568988 N/A N/A  37170  37189 CTGAACAGCTCTTCTGCACT  64 3025 1569133 N/A N/A  15003  15022 TTGTACATATTAATACCTGG  21 3026 1569270 N/A N/A 180643 180662 GTGTAGCCATCACTACTTTC  52 3027 1569390 N/A N/A  14224  14243 TGGTTGTCAATCACAGCTAC  64 3028 1569453 N/A N/A  19465  19484 GGTGACATTATCTCAGAGCC  46 3029 1569623 N/A N/A 186297 186316 GCCAGAGTCTACACTCTGCT  78 3030 1569772 N/A N/A  25695  25714 CTGGAACTAGAAGCTCCAAC 116 3031 1569830 N/A N/A 101413 101432 AAGACTCTACCTACTCACCA  94 3032 1569880 N/A N/A 210191 210210 GGACCACCTATCTCCATGGT  78 3033 1570122 N/A N/A 142928 142947 GCAGCTCTCTCATTTGGGCG  74 3034 1570175 N/A N/A 148090 148109 CTGTCTGAATAGCATCAATC  88 3035 1570230 N/A N/A  35499  35518 TTCATACAGCCTTCCTTGGC  69 3036 1570300 N/A N/A 107581 107600 TCCAGAATCTTTAATTGTCC  36 3037 1570431 N/A N/A 175852 175871 CTCCTTCATCATACCTACTA 111 3038 1570464 N/A N/A 166623 166642 ATTGCACTGTTTATCTCACT  17 3039 1570525 N/A N/A  95624  95643 GAGCCACTGACTAATCAGCA  24 3040 1570663 N/A N/A  37049  37068 ATGCCCTCTTTCTACCCAGT  27 3041 1570770 N/A N/A 138684 138703 GCATCTGCACTCTTCTTTTA  48 3042 1570859 N/A N/A  71286  71305 CTGTATCACGACCACAGTCT  53 3043

TABLE-US-00052 TABLE 52 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   1 1008 1566458 N/A N/A  35867  35886 CTCTGTATCCGCTTTTTCCT   6 3044 1566469 N/A N/A 175575 175594 GTGCTCACTTATCATGTGGA  24 3045 1566504 N/A N/A  18402  18421 GTGATTGATCAAATCAGCTT  34 3046 1566506 N/A N/A  15001  15020 GTACATATTAATACCTGGGT  77 3047 1566508 N/A N/A  26319  26338 TCCCTAACATCCTAAGCCAA 112 3048 1566605 N/A N/A  52556  52575 GCACCATAATCACTCCAGAG  35 3049 1566630 N/A N/A  37169  37188 TGAACAGCTCTTCTGCACTA  84 3050 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  17 2204 1566813 N/A N/A  21893  21912 CCATTCTTCCATTATCAGAG   6 3051 1566837 N/A N/A 115039 115058 GCATCAGTATAGAACTCCAT   7 3052 1566889 N/A N/A  19965  19984 GTCTTCTACATCCTTAGAGC  25 3053 1566953 N/A N/A  75060  75079 CTGCAGCAAGAAATACAGGC  54 3054 1566989 N/A N/A  13370  13389 GATACTCATCTATAGCAGTT 106 3055 1566999 N/A N/A  50380  50399 GAGGCATGCAAGCCCACTCA  72 3056 1567050 N/A N/A  40065  40084 TACATGTTTATCTATCTATC  76 3057  40093  40112  40121  40140  40149  40168  40249  40268  40276  40295  40327  40346 1567120 N/A N/A  92921  92940 GCCCCATGCTCAGAATCACT  65 3058 1567151 N/A N/A  45289  45308 CCTTGTATAACTCAGGCACC  35 3059 1567167 N/A N/A  61479  61498 TGGCAACCTCCCTTCTGTCC  82 3060 1567184 N/A N/A 160175 160194 GCCACACATTTCCAGTCTCC  34 3061 1567206 N/A N/A 125239 125258 TGCCTGTGCCTTCAACATCT  30 3062 1567214 N/A N/A  95622  95641 GCCACTGACTAATCAGCAGA  35 3063 1567217 N/A N/A  42073  42092 CTGCCATATGAACTTCCTAT  25 3064 1567282 N/A N/A  87288  87307 GTTCACATGAATTCATGGTC   7 3065 1567320 N/A N/A  36801  36820 GAAGCACTTCCTCTTAACCA   4 3066 1567351 N/A N/A 111680 111699 TGGACACTTTGACTTTGTGC  30 3067 1567360 N/A N/A   4149   4168 CCAAGGCTGCTACCGGTCTT  69 3068 1567395 N/A N/A 166622 166641 TTGCACTGTTTATCTCACTT  12 3069 1567434 N/A N/A  27915  27934 TGGGCTTCTCTGCCTAGTCC  97 3070 1567443 N/A N/A 209583 209602 ATTCCCCTTATGCTTCAGGC  32 3071 1567476 N/A N/A  68738  68757 CCCAACTCAAATCCTGTCCA  49 3072 1567500 N/A N/A  12263  12282 GCCCATGATATGCTTTCTGC  48 3073 1567531 N/A N/A  58267  58286 AGTCTGTATCAACTTCCAGT  45 3074 1567598 N/A N/A  23721  23740 GCACATGGACCAAGACCATC  42 3075 1567618 N/A N/A  26586  26605 AACCAGCCTACTTCTCTCAT  21 3076 1567642 N/A N/A  37048  37067 TGCCCTCTTTCTACCCAGTC  96 3077 1567648 N/A N/A  40854  40873 TCTAAACATATACATGTGCA  68 3078  40884  40903  40914  40933  40944  40963  40974  40993  41004  41023 1567662 N/A N/A  29375  29394 AAGCTCTTGATCACCATTTC  36 3079 1567721 N/A N/A  71284  71303 GTATCACGACCACAGTCTCT  58 3080 1567730 N/A N/A  27674  27693 CTTCTTCCTCTGTACGCACA  17 3081 1567762 N/A N/A 200923 200942 GCTGGTAACTACTTTCTCAG  68 3082 1567793 N/A N/A 118131 118150 TTGCAAGGTCATGACTGCAT  60 3083 1567901 N/A N/A 222213 222232 AGCAACTGTTTCTTTAGCTA  20 3084 1567902 N/A N/A 141452 141471 TCCTCTATCATGCCATGCAC  44 3085 1567915 N/A N/A 147868 147887 TAGTTCTTACAACAATGTCA  27 3086 1567929 N/A N/A  31112  31131 TTGCGAGCACCCAGGTGTCT  37 3087 1567975 N/A N/A  47000  47019 ATGCCGCTTTCTCACTCCAC  25 3088 1567983 N/A N/A  20991  21010 TAGCACACCTAATCAAGGGT  98 3089 1567999 N/A N/A  24888  24907 ACATGGTTAACTCTGGCGGT  43 3090 1568009 N/A N/A  81790  81809 TCCTAGTTATAGCCATCCTA  24 3091 1568024 N/A N/A  36293  36312 AGAGGTTATTCTTATTCCCC   4 3092 1568044 N/A N/A 108845 108864 AGCCACCTCTAGCCCTGGCC  52 3093 1568078 N/A N/A 120993 121012 GCACAATCACTACAGCGGGC  12 3094 1568087 N/A N/A 104826 104845 GCTTCACCTTTCACATACAC  37 3095 1568232 N/A N/A 142909 142928 GCTGACCTTTCTGCCACATC  42 3096 1568282 N/A N/A 138591 138610 CCCTCACTTCTGCATCATCA  46 3097 1568291 N/A N/A  76354  76373 CTGCACTGATATGGAAGGCC  83 3098 1568295 N/A N/A 186214 186233 GCTCTATAGTGACCCCAACC  43 3099 1568403 N/A N/A  19464  19483 GTGACATTATCTCAGAGCCT  24 3100 1568948 N/A N/A  94146  94165 TGGCTGAGTTTCTCATAGTA  40 3101 1569003 N/A N/A  84664  84683 GTACCAAAATTCCAGCTCCA  17 3102 1569069 N/A N/A  11648  11667 CACCTTGTTTACTATTACTC  31 3103 1569173 N/A N/A 164434 164453 CACCCTTCACTCATTGTCTA  49 3104 1569183 N/A N/A  38792  38811 ACCTACCGAACTGATTTCAT 111 3105 1569272 N/A N/A 182063 182082 CATGAACCAGTCATCAAGGC  48 3106 1569313 N/A N/A  19245  19264 ATGACTTCCAACAAAGGTGT  47 3107 1569461 N/A N/A  86204  86223 GCTTACAGCCTTCATCTACA  68 3108 1569464 N/A N/A  25694  25713 TGGAACTAGAAGCTCCAACT  79 3109 1569723 N/A N/A  14220  14239 TGTCAATCACAGCTACAGAT  28 3110 1569877 N/A N/A 178853 178872 GTAGCAATCTTTCAATTTCC  34 3111 1569888 N/A N/A  35497  35516 CATACAGCCTTCCTTGGCTA  65 3112 1570378 N/A N/A  22870  22889 AATGGTTCACAGCCAGGCGC  61 3113 1570546 N/A N/A 130577 130596 ATGCTCAGTCATCCCTCAGT  29 3114 1570625 N/A N/A 107546 107565 GCCTGTTTAGCTCTTGGGTC  80 3115 1570697 N/A N/A 167967 167986 TGTAAAGATTTGCTTCTCCA  12 3116 1570709 N/A N/A  36031  36050 ATTAGCTCACATCATTGGTT  17 3117 1570754 N/A N/A 217049 217068 TCCATTGTTTTACCTATCAC  13 3118 1570820 N/A N/A 101390 101409 ATCCTCCTAAAGTCTCCCTA  62 3119 1570893 N/A N/A  78655  78674 AGGTATCTTGTCACCCCTTT  32 3120

TABLE-US-00053 TABLE 53 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   3 1008 1566462 N/A N/A  84396  84415 GTTCTTTCAAGTTTACGCTT  18 3121 1566501 N/A N/A 200829 200848 GCACCATAATGTACCTTTCA  44 3122 1566537 N/A N/A  93998  94017 AGTGACCTTTTAAAGTTGGC  27 3123 1566584 690 709  18127  18146 TGACTTGTATTTGATGATCC   4 3124 1566610 N/A N/A  36027  36046 GCTCACATCATTGGTTATAC   9 3125 1566628 N/A N/A 108786 108805 CCCCTTTGCCAGCTAGGCAA  68 3126 1566648 N/A N/A  26318  26337 CCCTAACATCCTAAGCCAAT  56 3127 1566682 N/A N/A 216964 216983 ACGCAATGGCCTCTACCTCA  62 3128 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  16 2204 1566734 N/A N/A  36292  36311 GAGGTTATTCTTATTCCCCA  12 3129 1566735 N/A N/A  86128  86147 GCTGGTTTTTAAGTTAGCTC  62 3130 1566738 N/A N/A  35866  35885 TCTGTATCCGCTTTTTCCTT  11 3131 1566742 N/A N/A  13367  13386 ACTCATCTATAGCAGTTACA  60 3132 1566752 N/A N/A  81686  81705 TTGGTTGTTTGCATATATCC  16 3133 1566783 N/A N/A  37047  37066 GCCCTCTTTCTACCCAGTCC  48 3134 1566807 N/A N/A  87287  87306 TTCACATGAATTCATGGTCA  19 3135 1566935 N/A N/A  40064  40083 ACATGTTTATCTATCTATCT  54 3136  40092  40111  40120  40139  40148  40167  40248  40267  40275  40294  40326  40345 1567000 N/A N/A  61478  61497 GGCAACCTCCCTTCTGTCCT  58 3137 1567003 N/A N/A  12247  12266 CTGCATGTCAAAATTGTATT  42 3138 1567013 N/A N/A  27914  27933 GGGCTTCTCTGCCTAGTCCA  59 3139 1567082 N/A N/A  50374  50393 TGCAAGCCCACTCATCATGC  66 3140 1567096 N/A N/A 111679 111698 GGACACTTTGACTTTGTGCA  28 3141 1567195 N/A N/A 114780 114799 CTGCATACCCCTGCATACTA 114 3142 1567215 N/A N/A 142837 142856 GCTTTACCACTGTCTGTCCT  40 3143 1567255 N/A N/A  57929  57948 GCCACAAATTTTGCCTCCAA  13 3144 1567296 N/A N/A 166459 166478 TGACTGGTCTTTAACTCTCT  35 3145 1567353 N/A N/A 178851 178870 AGCAATCTTTCAATTTCCGT  17 3146 1567426 N/A N/A  42071  42090 GCCATATGAACTTCCTATGT  13 3147 1567438 N/A N/A  29374  29393 AGCTCTTGATCACCATTTCT  59 3148 1567517 N/A N/A 186128 186147 CTTGCTTTGAACCATCAGAC  40 3149 1567536 N/A N/A 117993 118012 GTCTGCTGAGTATAATATCT  22 3150 1567555 N/A N/A  36800  36819 AAGCACTTCCTCTTAACCAA  11 3151 1567575 N/A N/A  31094  31113 CTGTCAGCAGACAAATGGGT  56 3152 1567583 N/A N/A  11264  11283 GGCTAGTTTTACCCATTGCA  41 3153 1567590 N/A N/A 129899 129918 CTGTTAGCTCACTCTTCGCA  27 3154 1567627 N/A N/A 175573 175592 GCTCACTTATCATGTGGATT  22 3155 1567647 N/A N/A  19228  19247 TGTCATCTGCAATACTTTCC  35 3156 1567656 N/A N/A   4137   4156 CCGGTCTTGATTCAATGAGC  66 3157 1567684 N/A N/A  40853  40872 CTAAACATATACATGTGCAT  30 3158  40883  40902  40913  40932  40943  40962  40973  40992  41003  41022 1567723 N/A N/A  24861  24880 ATGGTATTTCTAAATGCACT  11 3159 1567768 N/A N/A  14820  14839 TGGCATTGCTGACCCCACCC  76 3160 1567819 N/A N/A  76338  76357 GGCCATCTATAACATGTTGC  87 3161 1567842 N/A N/A  71253  71272 GCTTGGCATCTATATCTAAA  16 3162 1567855 N/A N/A  95610  95629 TCAGCAGATTCTCTCCAGGT  16 3163 1567876 N/A N/A 104348 104367 CTGACATTGCCACCCTGTGC  75 3164 1567885 N/A N/A  20990  21009 AGCACACCTAATCAAGGGTT  44 3165 1567958 N/A N/A  35487  35506 TCCTTGGCTATGCCAGTGCT  33 3166 1567995 N/A N/A  19964  19983 TCTTCTACATCCTTAGAGCT  40 3167 1567998 N/A N/A  68030  68049 GCCACAGAGAGCTATACCCA  40 3168 1568001 N/A N/A  23717  23736 ATGGACCAAGACCATCTGGA  19 3169 1568008 N/A N/A 209582 209601 TTCCCCTTATGCTTCAGGCA 108 3170 1568106 N/A N/A  38786  38805 CGAACTGATTTCATGATCTT  30 3171 1568199 N/A N/A 107518 107537 GATCATGTGTCACTCTCTTC  18 3172 1568250 N/A N/A  78642  78661 CCCCTTTTTTTACAAAGCCC  61 3173 1568293 N/A N/A 147738 147757 GTTCATCCTCTGACATGTCT  52 3174 1568384 N/A N/A 182061 182080 TGAACCAGTCATCAAGGCTA  65 3175 1568417 N/A N/A 124711 124730 GCAACTTATTGATAACAGTA  11 3176 1568954 N/A N/A 101380 101399 AGTCTCCCTACATTCCTGAC  70 3177 1569008 N/A N/A  74957  74976 GCACTGCCACAAAGTCTGCT  59 3178 1569054 N/A N/A  22702  22721 ATGATGGTTCATTTCACACA   7 3179 1569073 N/A N/A 164391 164410 TGCACATGCTCTCTCTGAAA  23 3180 1569227 N/A N/A  25683  25702 GCTCCAACTAAAAGCAAGGA  49 3181 1569302 N/A N/A  27629  27648 AAGTGGTCTGATCTTAGATC   4 3182 1569479 N/A N/A  19448  19467 GCCTAATTTAATATCACAGA  33 3183 1569579 N/A N/A 120855 120874 CTGAGGGTCCCTTTTCCTCA  91 3184 1569734 N/A N/A  26585  26604 ACCAGCCTACTTCTCTCATA  23 3185 1569799 N/A N/A  45276  45295 AGGCACCTTTCTTATGGCAG  24 3186 1569860 N/A N/A  46999  47018 TGCCGCTTTCTCACTCCACC  25 3187 1570046 N/A N/A  52452  52471 GAAGCTTCACTCACTAAGCA  47 3188 1570162 N/A N/A  14196  14215 ATGACTGCTTTTCCTTTAGT  52 3189 1570244 N/A N/A 160092 160111 TATGGCTTTATATTGCACCT  85 3190 1570248 N/A N/A 138236 138255 AGCTGCTACACATTTTCCAC  44 3191 1570257 N/A N/A 141451 141470 CCTCTATCATGCCATGCACT  61 3192 1570329 N/A N/A 222066 222085 GATCAACAATCTGTTCATCA  38 3193 1570489 N/A N/A  92887  92906 TGGCTATCAACTCCTCAGTC  60 3194 1570853 N/A N/A 167953 167972 TCTCCATCTCCCTTACTGCA  33 3195 1570865 N/A N/A  37167  37186 AACAGCTCTTCTGCACTACA  16 3196 1570941 N/A N/A  21877  21896 AGAGAACTGATTCCACCCCC  50 3197

TABLE-US-00054 TABLE 54 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566470 N/A N/A 147663 147682 GACATGCTTTCACTCCATGT  58 3198 1566490 N/A N/A  40063  40082 CATGTTTATCTATCTATCTA  59 3199  40091  40110  40119  40138  40147  40166  40247  40266  40274  40293  40325  40344 1566560 N/A N/A  24670  24689 AGAGCTGTCTAACACCAACA  25 3200 1566570 N/A N/A  38782  38801 CTGATTTCATGATCTTAGGT   7 3201 1566578 N/A N/A 104311 104330 CTTCAGGTATTATCTTGCAT  16 3202 1566593 N/A N/A 167952 167971 CTCCATCTCCCTTACTGCAC  43 3203 1566639 N/A N/A 114771 114790 CCTGCATACTACTGTAGTTT  76 3204 1566662 N/A N/A  50373  50392 GCAAGCCCACTCATCATGCA  28 3205 1566664 N/A N/A  17935  17954 GCAAACTATCCATAGGTTAC  44 3206 1566665 N/A N/A  81683  81702 GTTGTTTGCATATATCCTTT   7 3207 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  18 2204 1566723 N/A N/A  19961  19980 TCTACATCCTTAGAGCTTTC  57 3208 1566766 N/A N/A  14195  14214 TGACTGCTTTTCCTTTAGTC  55 3209 1566768 N/A N/A 182060 182079 GAACCAGTCATCAAGGCTAC  61 3210 1566832 N/A N/A  26311  26330 ATCCTAAGCCAATAATAGCA  94 3211 1566929 N/A N/A 222046 222065 TGGTCATATGATTATCAACC  21 3212 1566937 N/A N/A 164351 164370 ACTCATCCTTCAGATAGGCA  20 3213 1566946 N/A N/A 178673 178692 GGGCAACTCATCCTCTAACA  68 3214 1566952 N/A N/A  61439  61458 AAGACAGTCATCTCGGTCTC  59 3215 1566957 N/A N/A  14818  14837 GCATTGCTGACCCCACCCTA  55 3216 1566986 N/A N/A  57909  57928 CAGCACCTTTTTCACTCCAG  18 3217 1566995 N/A N/A 111486 111505 TGGCACCCACATTGCAACTT  32 3218 1567035 N/A N/A  20989  21008 GCACACCTAATCAAGGGTTC  66 3219 1567100 N/A N/A  74918  74937 GAGCAACACATGCTCTGCTT  71 3220 1567179 N/A N/A  37166  37185 ACAGCTCTTCTGCACTACAT  34 3221 1567196 N/A N/A 174351 174370 ATGCAAATATCTCATTCTGC  32 3222 1567204 N/A N/A  71232  71251 TGGCAAGGTCCCTACCTTGC 124 3223 1567266 N/A N/A  22696  22715 GTTCATTTCACACAGTACTT  12 3224 1567288 N/A N/A  45260  45279 GCAGGGCCATTCCTCTGTCA 120 3225 1567321 N/A N/A  19416  19435 GCATCTGACTTTGAGAACGC  47 3226 1567371 N/A N/A  36679  36698 GTTGGACTTCAGTCATAACA  58 3227 1567489 N/A N/A 129897 129916 GTTAGCTCACTCTTCGCAAC  28 3228 1567611 N/A N/A  26584  26603 CCAGCCTACTTCTCTCATAA  48 3229 1567687 N/A N/A  21752  21771 CTGCATTTATAAATGACCGT  10 3230 1567688 N/A N/A  76337  76356 GCCATCTATAACATGTTGCT 107 3231 1567706 N/A N/A 215534 215553 GGGTCTTCAAAGCCAGCTCC  52 3232 1567748 N/A N/A 204930 204949 CTGCTTTTTCAACACTGTAC  27 3233 1567751 N/A N/A  12217  12236 GACCCATCTCAAATCTACCT  49 3234 1567775 N/A N/A  29373  29392 GCTCTTGATCACCATTTCTC  64 3235 1567777 N/A N/A  52403  52422 ATGCATTCCACTTTTGAGGT  15 3236 1567779 N/A N/A  87250  87269 TTTGGCTGATAGCCTGGGCT  70 3237 1567841 N/A N/A  42019  42038 GCTCCATTGCTTCATTTGCT  19 3238 1567882 N/A N/A  30361  30380 CAGCAGGTACTATTTCAGGC   1 3239 1567920 N/A N/A  27628  27647 AGTGGTCTGATCTTAGATCC  18 3240 1567962 N/A N/A  35486  35505 CCTTGGCTATGCCAGTGCTC  42 3241 1567964 N/A N/A  95609  95628 CAGCAGATTCTCTCCAGGTA  12 3242 1568010 N/A N/A  46998  47017 GCCGCTTTCTCACTCCACCG  24 3243 1568022 N/A N/A 107512 107531 GTGTCACTCTCTTCCTCCTA  46 3244 1568051 N/A N/A  36290  36309 GGTTATTCTTATTCCCCAAC   2 3245 1568076 N/A N/A 101179 101198 TCTCAAGTTCAACATGGGCT  68 3246 1568107 N/A N/A  40836  40855 CATGTATATTTATCTAAACA  97 3247  40866  40885  40896  40915  40926  40945  40956  40975  40986  41005  41016  41035 1568133 N/A N/A  78359  78378 TCCCCTGCATGTCTTCACTT 132 3248 1568151 N/A N/A  23715  23734 GGACCAAGACCATCTGGATC  28 3249 1568190 557 576  13261  13280 ATTTTGGCAGAACTGCAAAT  52 3250 1568213 N/A N/A 117619 117638 GTAGCATGCCTCAAGACCCA  43 3251 1568257 N/A N/A 108755 108774 TCATGGTAACTCCATCAGCC  62 3252 1568261 N/A N/A 159889 159908 ATGATAAAAATAAAATGAAT  68 3253 159957 159976   1568370 N/A N/A  84294  84313 GTTCTTTCACATCTAGTATC  37 3254 1568374 N/A N/A  35865  35884 CTGTATCCGCTTTTTCCTTT   5 3255 1568379 N/A N/A 142788 142807 TCCCAATCGCCATTTCTCGC  43 3256 1568424 N/A N/A 124661 124680 ACAGCTGTATATACTTCCCT  40 3257 1569178 N/A N/A  67709  67728 AGGTATAGTACCTAATGGCT  39 3258 1569189 N/A N/A  92886  92905 GGCTATCAACTCCTCAGTCT  68 3259 1569201 N/A N/A 138159 138178 ATCCTATACACATCTCCACG  52 3260 1569281 N/A N/A  11253  11272 CCCATTGCAGTCATTCACTA  87 3261 1569292 N/A N/A 141416 141435 AGCCTATCTTCTCTGCTATA 127 3262 1569498 N/A N/A  27882  27901 GTCAATATACAGTCTACTTC   7 3263 1569559 N/A N/A 200798 200817 AGTCATGGTCAAATTGCACC  57 3264 1569962 N/A N/A 120851 120870 GGGTCCCTTTTCCTCACTCA  64 3265 1570004 N/A N/A   4136   4155 CGGTCTTGATTCAATGAGCC  49 3266 1570168 N/A N/A  37028  37047 CCACCTTCCCACCTAATTTA 109 3267 1570352 N/A N/A  19223  19242 TCTGCAATACTTTCCCTAAG  51 3268 1570412 N/A N/A 165883 165902 AAGACATCATAAGTTGTCAC  73 3269 1570580 N/A N/A 186056 186075 TTGCCAGTCAACTAGTGCTA  83 3270 1570715 N/A N/A  36002  36021 GTGACAAATTATAACTACAC  19 3271 1570766 N/A N/A  93919  93938 GTGTCTTCAAGCCTATGACC  52 3272 1570769 N/A N/A  25659  25678 ATCATCTTCAAAGTCTGGAT  14 3273 1570887 N/A N/A  85686  85705 AGCACCTATTTCCATTAGAA  26 3274

TABLE-US-00055 TABLE 55 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566449 N/A N/A 171065 171084 GCTCTTTTTCACATATTGTA  55 3275 1566519 N/A N/A  37164  37183 AGCTCTTCTGCACTACATTC  32 3276 1566636 N/A N/A  11245  11264 AGTCATTCACTAATCAGAGC  14 3277 1566673 N/A N/A 147661 147680 CATGCTTTCACTCCATGTGT  93 3278 1566696 N/A N/A  24667  24686 GCTGTCTAACACCAACAGGA  41 3279 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  17 2204 1566724 N/A N/A  36678  36697 TTGGACTTCAGTCATAACAC  61 3280 1566759 N/A N/A 113802 113821 GAGGATATATACTCCACCAA  69 3281 1566924 N/A N/A  57907  57926 GCACCTTTTTCACTCCAGGG  15 3282 1566925 N/A N/A  95607  95626 GCAGATTCTCTCCAGGTATT  15 3283 1566981 N/A N/A 111484 111503 GCACCCACATTGCAACTTCA  46 3284 1566984 N/A N/A  14813  14832 GCTGACCCCACCCTAATGGT  63 3285 1567025 N/A N/A  46997  47016 CCGCTTTCTCACTCCACCGT  24 3286 1567043 N/A N/A  93781  93800 GCTCATAAAGCTCCTAGCAT  48 3287 1567072 N/A N/A  92809  92828 ATGTCTGCCAATCTGCAGGC  55 3288 1567083 N/A N/A  26581  26600 GCCTACTTCTCTCATAAGGT  40 3289 1567185 N/A N/A   4135   4154 GGTCTTGATTCAATGAGCCT  60 3290 1567187 N/A N/A  40747  40766 TATGTATATTTATCTAAACA  63 3291  40806  40825 1567275 N/A N/A  35863  35882 GTATCCGCTTTTTCCTTTAG  10 3292 1567294 N/A N/A  19395  19414 GCTTGCCTGCCACAGAGGAT  46 3293 1567334 N/A N/A 167951 167970 TCCATCTCCCTTACTGCACT  27 3294 1567364 N/A N/A 165764 165783 GGTGATACTCTAATTCTTGT  23 3295 1567387 N/A N/A  71231  71250 GGCAAGGTCCCTACCTTGCT  53 3296 1567403 N/A N/A 180924 180943 GTCCCTTCAAATCACAATCT 112 3297 1567422 N/A N/A 136517 136536 GCCTAGTCTTACTTTTTCTT  43 3298 1567487 N/A N/A 101144 101163 CATGGGTCTCATTTTCACCT  30 3299 1567639 N/A N/A  25558  25577 GGAACATCCTTAATTCTAGC  15 3300 1567742 N/A N/A  45254  45273 CCATTCCTCTGTCAACATAA  26 3301 1567749 N/A N/A 124637 124656 CCTTGTCTTTAAATGAGTCC  59 3302 1567836 N/A N/A 141415 141434 GCCTATCTTCTCTGCTATAC  58 3303 1567903 N/A N/A  19958  19977 ACATCCTTAGAGCTTTCCCT  73 3304 1567927 N/A N/A  26179  26198 CCCCAATCCACACTGTTAGC  50 3305 1567938 N/A N/A 108616 108635 ATAGCTTGCATTACCTTGGC  41 3306 1567953 N/A N/A  36289  36308 GTTATTCTTATTCCCCAACA   8 3307 1567967 N/A N/A  35481  35500 GCTATGCCAGTGCTCAGGAA   4 3308 1567968 N/A N/A  14194  14213 GACTGCTTTTCCTTTAGTCT  60 3309 1568000 N/A N/A  85646  85665 AGGGTTATATCTACCAGCAT  39 3310 1568036 N/A N/A  50370  50389 AGCCCACTCATCATGCATTC  47 3311 1568062 N/A N/A  19221  19240 TGCAATACTTTCCCTAAGTT  63 3312 1568124 N/A N/A  12216  12235 ACCCATCTCAAATCTACCTT  51 3313 1568156 N/A N/A 222045 222064 GGTCATATGATTATCAACCA  32 3314 1568194 N/A N/A  20977  20996 AAGGGTTCACCTTAATGCCT  63 3315 1568221 547 566  13251  13270 AACTGCAAATCTCTCCTGCA  31 3316 1568239 N/A N/A  30214  30233 GAGCTAGTTTTCCAACTCAA  49 3317 1568244 N/A N/A  29363  29382 ACCATTTCTCATATTACCAT  16 3318 1568327 N/A N/A 164255 164274 ACATCTTGCATATAGCCTTC  35 3319 1568368 N/A N/A  23714  23733 GACCAAGACCATCTGGATCT  57 3320 1568383 N/A N/A  40059  40078 TTTATCTATCTATCTAAACA 122 3321  40087  40106  40115  40134  40143  40162  40243  40262  40321  40340 1568408 N/A N/A  76336  76355 CCATCTATAACATGTTGCTA  49 3322 1568426 N/A N/A  38758  38777 GTCTTAGATCAACTGGATTA  27 3323 1569002 N/A N/A 186038 186057 TAGAGACTTTCTCCCCAGCT  85 3324 1569062 N/A N/A  87226  87245 GTTGGTATCTAACCAGTTAC  84 3325 1569063 N/A N/A 104309 104328 TCAGGTATTATCTTGCATTT  31 3326 1569068 N/A N/A 178672 178691 GGCAACTCATCCTCTAACAT  35 3327 1569076 N/A N/A  22688  22707 CACACAGTACTTCTGCCCTT  30 3328 1569093 N/A N/A 215473 215492 CTGCCATCCTCTGCTAAGGA  60 3329 1569118 N/A N/A 142750 142769 CCCTGTTTTCCTCTATGGCA  65 3330 1569152 N/A N/A 200731 200750 TGTGATGTCAACACATGGGC  64 3331 1569188 N/A N/A  27874  27893 ACAGTCTACTTCGCTGAAGC  25 3332 1569204 N/A N/A 158436 158455 TCCTCTTTTAAGCATCTACC  50 3333 1569357 N/A N/A  17684  17703 GGCAAAACCACTTTGAGCAA  74 3334 1569395 N/A N/A  27627  27646 GTGGTCTGATCTTAGATCCA  49 3335 1569722 N/A N/A  35988  36007 CTACACATCCCTACCTTGTC  45 3336 1569958 N/A N/A  84280  84299 AGTATCATTTTCTTAGTGTC  16 3337 1570087 N/A N/A  74860  74879 CTGGTACCACGGATAGGTCA  76 3338 1570131 N/A N/A  67675  67694 TGCAGATATATTACAACTGT  44 3339 1570197 N/A N/A 129895 129914 TAGCTCACTCTTCGCAACTC  36 3340 1570266 N/A N/A  21712  21731 TGCACATTGAAAATTCTTAC  12 3341 1570269 N/A N/A  42018  42037 CTCCATTGCTTCATTTGCTA  19 3342 1570270 N/A N/A 107501 107520 TTCCTCCTACTCTAAGTTCC  73 3343 1570379 N/A N/A  78304  78323 GAGTACGATTTCACATGTTT  12 3344 1570389 N/A N/A  61427  61446 TCGGTCTCTCAGTCATTACA  21 3345 1570571 N/A N/A  37022  37041 TCCCACCTAATTTAGGCACC  24 3346 1570662 N/A N/A 204836 204855 GTATCTGACATGACTGCCTA  34 3347 1570732 N/A N/A 117548 117567 CTGGTTCTCATTCAGACATT  16 3348 1570757 N/A N/A  81654  81673 CCTGTATGGATCATTTGTCC  47 3349 1570824 N/A N/A  52310  52329 GTTTTCTACACTTAGCCAGT  15 3350 1570871 N/A N/A 120605 120624 TAGCAACTTTTCCTGGTCTA  18 3351

TABLE-US-00056 TABLE 56 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   3 1008 1566557 N/A N/A  37163  37182 GCTCTTCTGCACTACATTCT  29 3352 1566616 N/A N/A  36288  36307 TTATTCTTATTCCCCAACAT  30 3353 1566631 N/A N/A  40058  40077 TTATCTATCTATCTAAACAT  89 3354  40086  40105  40114  40133  40142  40161  40242  40261  40320  40339 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  19 2204 1566722 N/A N/A 120526 120545 GCAATCTCTCATATTCTTCT   5 3355 1566824 N/A N/A  29243  29262 GCAGCTCTCCTTACAAGTTT   4 3356 1566840 N/A N/A  37021  37040 CCCACCTAATTTAGGCACCA  18 3357 1566862 N/A N/A 107500 107519 TCCTCCTACTCTAAGTTCCA  64 3358 1566901 N/A N/A  20976  20995 AGGGTTCACCTTAATGCCTC  51 3359 1567005 N/A N/A 117547 117566 TGGTTCTCATTCAGACATTA  11 3360 1567080 N/A N/A  40746  40765 ATGTATATTTATCTAAACAT  82 3361  40805  40824  40835  40854  40865  40884  40895  40914  40925  40944  40955  40974  40985  41004  41015  41034 1567194 N/A N/A  24656  24675 CCAACAGGAATGCTAACTCT  49 3362 1567259 N/A N/A  36677  36696 TGGACTTCAGTCATAACACA  31 3363 1567291 N/A N/A  35982  36001 ATCCCTACCTTGTCCTGGTT  39 3364 1567308 N/A N/A 164242 164261 AGCCTTCATTGACTTGTCAT  23 3365 1567331 N/A N/A  21711  21730 GCACATTGAAAATTCTTACC   5 3366 1567378 N/A N/A  85645  85664 GGGTTATATCTACCAGCATC  31 3367 1567381 N/A N/A  27624  27643 GTCTGATCTTAGATCCAGTA  33 3368 1567384 N/A N/A  71200  71219 TCTTGGCTACTCCTGGCCCT  50 3369 1567394 N/A N/A  19943  19962 TCCCTACACAAAGACTATCC  84 3370 1567399 N/A N/A  61425  61444 GGTCTCTCAGTCATTACACA  17 3371 1567406 N/A N/A  66757  66776 CAAGACTTGTTCATCACTAC  18 3372 1567440 N/A N/A  50369  50388 GCCCACTCATCATGCATTCT  53 3373 1567468 N/A N/A  95347  95366 CCAGAGATACATGATTCGGC  28 3374 1567506 N/A N/A  38752  38771 GATCAACTGGATTATCAGCT   6 3375 1567569 N/A N/A 147660 147679 ATGCTTTCACTCCATGTGTT  45 3376 1567664 N/A N/A  42003  42022 TGCTACTCTCTCCATATGCC  21 3377 1567666 N/A N/A  23704  23723 ATCTGGATCTCTCCATAGCA  24 3378 1567713 N/A N/A  92742  92761 GCCAGTCTATTGCTCAGTTC  39 3379 1567794 N/A N/A  46995  47014 GCTTTCTCACTCCACCGTTT  10 3380 1567864 N/A N/A  17675  17694 ACTTTGAGCAAAGCATGCCA  59 3381 1567866 N/A N/A 111445 111464 TTGCGACTATCAGCACAGCT  60 3382 1567921 N/A N/A  22684  22703 CAGTACTTCTGCCCTTTGCA  21 3383 1567923 N/A N/A 113108 113127 GCAGGTTGTTCTCAAGTTTC  17 3384 1567928 N/A N/A 200487 200506 TGGTTCACCCTGTCTACCAC  70 3385 1567939 N/A N/A 104127 104146 GTTCTTTAGTCCATTCAGTC  16 3386 1567973 N/A N/A  14185  14204 TCCTTTAGTCTCACCTCATC  53 3387 1567979 N/A N/A  26178  26197 CCCAATCCACACTGTTAGCC  29 3388 1568004 N/A N/A  10050  10069 TGGTCCCTCACTGACTGTCA  96 3389 1568026 N/A N/A  74214  74233 GTCTATTCACCTCACCATCC  48 3390 1568115 N/A N/A  76299  76318 GTCTGATCAATTTCATGTCT  59 3391 1568132 N/A N/A 100702 100721 GACCATGGCTACCTTCTTGA  36 3392 1568169 N/A N/A  27805  27824 CGGAGTCTTTCCAACAAGGC  20 3393 1568178 N/A N/A 215335 215354 TGTCTCTTCTTCCTTTGGAC  53 3394 1568225 N/A N/A 108615 108634 TAGCTTGCATTACCTTGGCT  50 3395 1568267 N/A N/A  57814  57833 CCTCATCTACCTCTGATGCC  37 3396 1568322 N/A N/A 171014 171033 CCAGGACCAAGTCACTGCAA  71 3397 1568353 N/A N/A 165763 165782 GTGATACTCTAATTCTTGTC  15 3398 1568354 469 488  13173  13192 TTTTTCCAGAGACTTTGAAA  27 3399 1568356 N/A N/A 129894 129913 AGCTCACTCTTCGCAACTCT  21 3400 1568365 N/A N/A  19353  19372 GTTGGCCAAGTCTTTACTTC  54 3401 1568391 N/A N/A  78258  78277 CGTGGCCTTCAGCAACTTTA  95 3402 1569026 N/A N/A  35470  35489 GCTCAGGAAGCTCTCATTTC  18 3403 1569056 N/A N/A  35823  35842 TTCAACTGTCCCATCTAGGC   9 3404 1569097 N/A N/A 185851 185870 ATGCATCTCTAGTCCTGACT  54 3405 1569124 2543 2562 135592 135611 GGTGATGCACTGCTTTACAC  23 3406 1569147 N/A N/A   3871   3890 CATAAGTCCTTCACCAGCTA  56 3407 1569275 N/A N/A  45245  45264 TGTCAACATAAGACTCTGCA  27 3408 1569310 N/A N/A  25557  25576 GAACATCCTTAATTCTAGCC  36 3409 1569349 N/A N/A 203776 203795 ACAACCTATTTGCTGCACAA  51 3410 1569352 N/A N/A  14812  14831 CTGACCCCACCCTAATGGTC  58 3411 1569439 N/A N/A 180758 180777 TGGACATACTTCAAGTGCTT  27 3412 1569495 N/A N/A  93706  93725 ATGAGGTGTTCCACCATGTC  51 3413 1569674 N/A N/A  52180  52199 ACCCACGCAGGTCACCCTCA  68 3414 1569703 N/A N/A 124533 124552 CATCAATTCATGATCTGGGT  11 3415 1569789 N/A N/A 222026 222045 AGGGTACTAATGTACCCAGC  53 3416 1569792 N/A N/A 142247 142266 CAGGATTCGCCATTCCAGCC  58 3417 1569804 N/A N/A  81629  81648 CTGAGTTATCTTTTTACCAT  11 3418 1570058 N/A N/A  26509  26528 GCACTGTACAAATAGTAGTT  17 3419 1570277 N/A N/A 141405 141424 TCTGCTATACAACAAGCTCT 102 3420 1570299 N/A N/A 178667 178686 CTCATCCTCTAACATAGCTA  37 3421 1570452 N/A N/A  83886  83905 CTGGCATGTATACATTATCT  18 3422 1570457 N/A N/A  12182  12201 CTGCTAATTTTCACAGCTTA  49 3423 1570466 N/A N/A  87190  87209 GAGTCCTTACTTCCGCTGTT  21 3424 1570479 N/A N/A 167950 167969 CCATCTCCCTTACTGCACTT  53 3425 1570532 N/A N/A  30180  30199 GAGTCCACACTGTTTGACCC  69 3426 1570617 N/A N/A 158392 158411 AGGCATGTATAAAACTGTTC  42 3427 1570668 N/A N/A  19220  19239 GCAATACTTTCCCTAAGTTT  27 3428

TABLE-US-00057 TABLE 57 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID Compound No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Number Start Site Stop Site Start Site Stop Site Sequence (5′ to 3′) (% UTC) ID No. 1480790 N/A N/A  35860  35879 TCCGCTTTTTCCTTTAGGGA   2 1008 1566466 N/A N/A  78235  78254 TTGGCTTAATATACTGTTCA  24 3429 1566494 443 462  13147  13166 TGGTCCTCAGACATTTCTTT  25 3430 1566575 N/A N/A 180750 180769 CTTCAAGTGCTTTTAAAAAT  99 3431 182494 182513 1566601 N/A N/A 164188 164207 GGTTAATGCTGATTTTCTCC   8 3432 1566602 N/A N/A  35961  35980 TCCACCTAGCTCTTTAATTC  63 3433 1566619 N/A N/A  87103  87122 CGTCGACTCTAGAACGGTGC  54 3434 1566635 N/A N/A 107497 107516 TCCTACTCTAAGTTCCAGTC  42 3435 1566641 N/A N/A 178449 178468 GCTGCATCCTTATAAACTGC  51 3436 1566655 N/A N/A 108614 108633 AGCTTGCATTACCTTGGCTA  93 3437 1566670 N/A N/A  37161  37180 TCTTCTGCACTACATTCTGT  52 3438 1566698 N/A N/A  40057  40076 TATCTATCTATCTAAACATA 116 3439  40085  40104  40113  40132  40141  40160  40241  40260  40319  40338 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC  17 2204 1566762 N/A N/A 103683 103702 GCTGCAGCAGTCAATTCACT  86 3440 1566785 N/A N/A  17669  17688 AGCAAAGCATGCCAACAGAT  34 3441 1566811 N/A N/A  27804  27823 GGAGTCTTTCCAACAAGGCA  50 3442 1566879 N/A N/A  42002  42021 GCTACTCTCTCCATATGCCA  34 3443 1566922 N/A N/A  35822  35841 TCAACTGTCCCATCTAGGCA  10 3444 1566942 N/A N/A  26495  26514 GTAGTTATCACTCAAAGTAA  46 3445 1566960 N/A N/A  35468  35487 TCAGGAAGCTCTCATTTCTT  84 3446 1566968 N/A N/A  23703  23722 TCTGGATCTCTCCATAGCAT  31 3447 1567140 N/A N/A  61421  61440 TCTCAGTCATTACACAGGGC   7 3448 1567186 N/A N/A  14184  14203 CCTTTAGTCTCACCTCATCT  63 3449 1567200 N/A N/A  92404  92423 GTCATATATACCTAGCACAA  21 3450 1567246 N/A N/A 129893 129912 GCTCACTCTTCGCAACTCTC  24 3451 1567248 N/A N/A  21616  21635 GGCTACCACTATATTTTATA  52 3452 1567290 N/A N/A  19941  19960 CCTACACAAAGACTATCCAA  67 3453 1567310 N/A N/A 134982 135001 GGTACTTTTTTCACTTATCT  19 3454 1567333 N/A N/A 200486 200505 GGTTCACCCTGTCTACCACT  86 3455 1567337 N/A N/A 142245 142264 GGATTCGCCATTCCAGCCAA  67 3456 1567377 N/A N/A  40745  40764 TGTATATTTATCTAAACATA  69 3457  40804  40823  40834  40853  40864  40883  40894  40913  40924  40943  40954  40973  40984  41003  41014  41033 1567452 N/A N/A 157636 157655 CGTGTGTCATGCCAAGGCTC  93 3458 1567494 N/A N/A 141210 141229 AAGGCATCTCTGATTCTTGC  54 3459 1567503 N/A N/A  30176  30195 CCACACTGTTTGACCCCTGC  25 3460 1567509 N/A N/A  10049  10068 GGTCCCTCACTGACTGTCAT  47 3461 1567538 N/A N/A  12181  12200 TGCTAATTTTCACAGCTTAA  64 3462 1567553 N/A N/A  85644  85663 GGTTATATCTACCAGCATCC  42 3463 1567645 N/A N/A  36286  36305 ATTCTTATTCCCCAACATTA  33 3464 1567672 N/A N/A  95309  95328 TGGTCTACTAGATTTATCTC  57 3465 1567752 N/A N/A  76297  76316 CTGATCAATTTCATGTCTCA  86 3466 1567771 N/A N/A  51974  51993 CAGGACATACTACAGCTGGC  44 3467 1567803 N/A N/A  56307  56326 GCCTCATATCATGATGCCCC  59 3468 1567805 N/A N/A 100700 100719 CCATGGCTACCTTCTTGACC  48 3469 1567844 N/A N/A  19346  19365 AAGTCTTTACTTCCCATCCA  49 3470 1567977 N/A N/A  71158  71177 GGTTCACTTACCTTCGGTCT  26 3471 1568025 N/A N/A  36650  36669 AATTTGCATAACAATTCCTC  41 3472 1568041 N/A N/A 111433 111452 GCACAGCTTCTGCTATTGCC 209 3473 1568048 N/A N/A  26155  26174 ACGGATGCTTATGAAAGCCA  26 3474 1568059 N/A N/A 170755 170774 AGGCACTGCCATTATCCCAT  70 3475 1568073 N/A N/A  38751  38770 ATCAACTGGATTATCAGCTT  15 3476 1568100 N/A N/A  83731  83750 GGACAGTTTTTCTAACTTCA  15 3477 1568185 N/A N/A  50366  50385 CACTCATCATGCATTCTTCT  27 3478 1568246 N/A N/A 124398 124417 TGTCAGGCATAGCATTCACC  29 3479 1568265 N/A N/A  65891  65910 GCAACTACCAATGTTCCATC  11 3480 1568973 N/A N/A 117545 117564 GTTCTCATTCAGACATTACT  25 3481 1569022 N/A N/A   3869   3888 TAAGTCCTTCACCAGCTACC  72 3482 1569036 N/A N/A  46980  46999 CGTTTCACTCTTGATTCTCT  22 3483 1569113 N/A N/A  25544  25563 TCTAGCCCAGAGGCTTTCTC  70 3484 1569195 N/A N/A  45231  45250 TCTGCACGATTTCTGACCTC  19 3485 1569209 N/A N/A  19217  19236 ATACTTTCCCTAAGTTTGCC  68 3486 1569215 N/A N/A  93705  93724 TGAGGTGTTCCACCATGTCA  53 3487 1569247 N/A N/A  37010  37029 TAGGCACCATGTTATTCATA  12 3488 1569339 N/A N/A 120450 120469 GCCTGTGGTATCACTGGGCT  94 3489 1569420 N/A N/A  14769  14788 CACTCAGTAGCTTTTTGCCA  29 3490 1569477 N/A N/A  29242  29261 CAGCTCTCCTTACAAGTTTA   7 3491 1569569 N/A N/A  81343  81362 AGTGTTAACTCATATCAGGT  12 3492 1569615 N/A N/A  74059  74078 CTGGTGTTTTAATTTTGGCA  26 3493 1569778 N/A N/A 165414 165433 TTGCAGTATCACCTGTACTA  44 3494 1569816 N/A N/A 222024 222043 GGTACTAATGTACCCAGCAC  60 3495 1569960 N/A N/A  24606  24625 GTCAAGTTAACACAGAGTTA  15 3496 1570237 N/A N/A 113010 113029 GTTCAGCCCTACTTCTGGCA  66 3497 1570291 N/A N/A  27623  27642 TCTGATCTTAGATCCAGTAA  67 3498 1570298 N/A N/A 147659 147678 TGCTTTCACTCCATGTGTTC  46 3499 1570399 N/A N/A 215288 215307 GCAGTCATTGTCACTAGCCT  82 3500 1570405 N/A N/A 203644 203663 TGTGCTTCCCAAACAGTGTA  68 3501 1570535 N/A N/A 167948 167967 ATCTCCCTTACTGCACTTGA  48 3502 1570728 N/A N/A 185483 185502 AGGTTCAAGCGAACTCCCAC  74 3503 1570867 N/A N/A  22656 22675 CTGCCCAGTATTCATTCTTC  33 3504 1570935 N/A N/A  20975  20994 GGGTTCACCTTAATGCCTCT  35 3505

TABLE-US-00058 TABLE 58 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 1 1008 1566471 N/A N/A 3867 3886 AGTCCTTCACCAGCTACCCT 68 3506 1566585 N/A N/A 129892 129911 CTCACTCTTCGCAACTCTCA 45 3507 1566588 N/A N/A 87102 87121 GTCGACTCTAGAACGGTGCT 72 3508 1566589 N/A N/A 71157 71176 GTTCACTTACCTTCGGTCTT 46 3509 1566597 N/A N/A 38511 38530 GTTTGACCTACACAGCGAAA 28 3510 1566603 N/A N/A 10018 10037 TGGCTGTGTTTACATTCTTA 13 3511 1566652 N/A N/A 85643 85662 GTTATATCTACCAGCATCCT 48 3512 1566659 N/A N/A 185211 185230 AGCCTAGTTTTTCCTCTCCA 59 3513 1566678 N/A N/A 25469 25488 ACCAATCTACAAACCAAGCA 44 3514 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 19 2204 1566717 N/A N/A 65745 65764 GCTCTCATTAATCATCAGGA 10 3515 1566770 N/A N/A 203643 203662 GTGCTTCCCAAACAGTGTAT 25 3516 1566820 N/A N/A 24469 24488 GGACAGAGTTCCATTTGTGC 17 3517 1566851 N/A N/A 83060 83079 TAGAATGTTTTTCTCCAGCC 35 3518 1566950 N/A N/A 100628 100647 TGGTCCTCACAACACCACAA 64 3519 1566992 N/A N/A 50356 50375 GCATTCTTCTCTAAACTTGC 16 3520 1567007 N/A N/A 164106 164125 GTTAGGTATTCACTTAGTAC 10 3521 1567016 N/A N/A 35461 35480 GCTCTCATTTCTTTGAACGC 9 3522 1567048 N/A N/A 177632 177651 TCAATAAAATATTAGCAAAA 74 3523 205293 205312 1567061 N/A N/A 22655 22674 TGCCCAGTATTCATTCTTCT 19 3524 1567067 N/A N/A 200478 200497 CTGTCTACCACTGTTTGCCT 83 3525 1567131 N/A N/A 21597 21616 AGGCATTTAACTCTGTCTTA 28 3526 1567153 N/A N/A 14768 14787 ACTCAGTAGCTTTTTGCCAT 24 3527 1567158 N/A N/A 46653 46672 TTCCAGCTTTATACACCCTT 15 3528 1567190 N/A N/A 141209 141228 AGGCATCTCTGATTCTTGCA 25 3529 1567193 N/A N/A 20973 20992 GTTCACCTTAATGCCTCTCA 19 3530 1567242 N/A N/A 19877 19896 GCATGTGCAAATGACTGACA 56 3531 1567258 N/A N/A 165235 165254 CAGCACTGTTGACCACTACT 22 3532 1567304 N/A N/A 76295 76314 GATCAATTTCATGTCTCACC 19 3533 1567309 N/A N/A 117544 117563 TTCTCATTCAGACATTACTA 46 3534 1567386 N/A N/A 170748 170767 GCCATTATCCCATTCTGTGT 72 3535 1567479 N/A N/A 17636 17655 ATGTTTTATACTTCCAAGCA 26 3536 1567493 N/A N/A 167945 167964 TCCCTTACTGCACTTGAGCT 72 3537 1567505 N/A N/A 40055 40074 TCTATCTATCTAAACATATA 86 3538 40083 40102 40111 40130 40139 40158 40239 40258 40317 40336 1567551 N/A N/A 124394 124413 AGGCATAGCATTCACCATGA 17 3539 1567557 N/A N/A 134901 134920 ATGGTCATTGCCTCAAGTCT 58 3540 1567581 N/A N/A 35960 35979 CCACCTAGCTCTTTAATTCC 63 3541 1567633 N/A N/A 41994 42013 CTCCATATGCCAATTCCATA 18 3542 1567738 N/A N/A 78198 78217 GTCATATATTAATAGCTCTA 6 3543 1567754 N/A N/A 221661 221680 GCTCTGATAGAATTTCTGGA 23 3544 1567809 N/A N/A 26467 26486 ATGGTCCTAGTAACCAGACC 57 3545 1567814 N/A N/A 40743 40762 TATATTTATCTAAACATATA 90 3546 40802 40821 40832 40851 40862 40881 40892 40911 40922 40941 40952 40971 40982 41001 41012 41031 1567834 N/A N/A 37007 37026 GCACCATGTTATTCATATCT 9 3547 1567846 N/A N/A 61341 61360 ATGTAACATGCCTCTCTGTT 22 3548 62022 62041 1567858 N/A N/A 180749 180768 TTCAAGTGCTTTTAAAAATT 59 3549 182493 182512 1567879 N/A N/A 81319 81338 GGTCCATTTTATCTTCCAAA 10 3550 1567887 N/A N/A 36277 36296 CCCCAACATTAAGATTTCAA 32 3551 1567950 N/A N/A 27803 27822 GAGTCTTTCCAACAAGGCAC 73 3552 1567984 N/A N/A 103576 103595 TGTTATGCTTGATCCAGCAT 79 3553 1567990 N/A N/A 14181 14200 TTAGTCTCACCTCATCTGCA 40 3554 1568142 N/A N/A 36647 36666 TTGCATAACAATTCCTCTGA 7 3555 1568155 N/A N/A 215122 215141 GTTCCTTGCAATCACATGCT 24 3556 1568184 N/A N/A 26126 26145 GTTACAGGCTGCATTAGCTA 26 3557 1568226 N/A N/A 27585 27604 GCCATGAATTGAAACTTGCA 19 3558 1568279 N/A N/A 35810 35829 TCTAGGCAGTACACTCATCT 56 3559 1568316 N/A N/A 45208 45227 GCTCTCTGAATCCACTTGGT 9 3560 1568347 N/A N/A 37158 37177 TCTGCACTACATTCTGTTGC 33 3561 1568364 N/A N/A 19324 19343 AAGCACAGACATGCTACCTC 101 3562 1568435 N/A N/A 19173 19192 CAACCTTCTTGACTAGGGCC 51 3563 1568442 N/A N/A 120098 120117 TTCCACATTTCATTCAAGGT 7 3564 1568951 N/A N/A 141856 141875 AGCTCCATTTAGCTTTGACA 53 3565 1569019 N/A N/A 51858 51877 GCCCACTCTCTGCACTTAGA 39 3566 1569032 N/A N/A 93704 93723 GAGGTGTTCCACCATGTCAA 53 3567 1569042 N/A N/A 29240 29259 GCTCTCCTTACAAGTTTACT 19 3568 1569196 N/A N/A 95307 95326 GTCTACTAGATTTATCTCAA 22 3569 1569212 N/A N/A 157256 157275 TTCCATTTCTGGCTTAGCCA 46 3570 1569388 N/A N/A 111246 111265 CCTCAAGTATTCTTAGAAGC 38 3571 1569588 N/A N/A 112874 112893 GGCTTATTCCTGCTTAGCTA 50 3572 1569644 N/A N/A 107480 107499 GTCAGACTGCATATCTTTCA 43 3573 1569698 N/A N/A 30175 30194 CACACTGTTTGACCCCTGCT 22 3574 1569739 N/A N/A 73916 73935 CCACTCTGATGAATATGTCA 81 3575 1569873 N/A N/A 23702 23721 CTGGATCTCTCCATAGCATA 15 3576 1569894 N/A N/A 92232 92251 GCTTTATCTAAGCATCTTTA 106 3577 1570253 N/A N/A 56104 56123 TTCCAAGGTCATAATCAGGA 9 3578 1570303 N/A N/A 108613 108632 GCTTGCATTACCTTGGCTAA 42 3579 1570612 N/A N/A 12147 12166 TCTCTGTGTTCCTCTAACAA 44 3580 1570844 N/A N/A 147617 147636 TGGACAGTCATAATATCCCT 62 3581 1570856 N/A N/A 13081 13100 GGTCTCATTATGTCAATTCA 87 3582

TABLE-US-00059 TABLE 59 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 2 1008 1566461 N/A N/A 129884 129903 TCGCAACTCTCAATTACAGC 18 3583 1566509 N/A N/A 214757 214776 AAGCAATATTTAGCATGGCA 43 3584 1566524 N/A N/A 117450 117469 TAACTGTAGTTTTTCACTCT 63 3585 1566546 N/A N/A 100281 100300 GCTTGTCCTATACAAAGACA 108 3586 1566573 N/A N/A 24468 24487 GACAGAGTTCCATTTGTGCT 7 3587 1566586 N/A N/A 163879 163898 ACTGATTCCACACCCTGTGA 82 3588 1566611 N/A N/A 82737 82756 GAAGGGTCACCTCAACTCTT 85 3589 1566650 N/A N/A 73893 73912 CCATCAACTTACTAGCTGGT 67 3590 1566684 N/A N/A 13072 13091 ATGTCAATTCATAACCAGCA 53 3591 1566704 N/A N/A 26093 26112 TCACCAATCCCTATGTTCAT 35 3592 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 12 2204 1566748 N/A N/A 39816 39835 TTTATCTATATAAACATACA 78 3593 39866 39885 41108 41127 1566751 N/A N/A 221424 221443 AGAGCTGTTTTCACTTCATC 18 3594 1566758 N/A N/A 108424 108443 TGCGGGATTTTACCAACGGC 65 3595 1566782 N/A N/A 95129 95148 CCACAATGCTGCATCCCTTA 81 3596 1566792 N/A N/A 61339 61358 GTAACATGCCTCTCTGTTGC 62 3597 62020 62039 1566816 N/A N/A 21588 21607 ACTCTGTCTTAATTCTGACT 41 3598 1566834 N/A N/A 71029 71048 GCAGCATCATCGACCTCCCA 36 3599 1566846 N/A N/A 40742 40761 ATATTTATCTAAACATATAC 91 3600 40801 40820 40831 40850 40861 40880 40891 40910 40921 40940 40951 40970 40981 41000 41011 41030 1566882 N/A N/A 199638 199657 GTGGCTTTACATATATGTCA 87 3601 1566887 N/A N/A 78143 78162 GCATGAATATAGCACAAGGA 4 3602 1566894 N/A N/A 20971 20990 TCACCTTAATGCCTCTCAGC 48 3603 1566908 N/A N/A 36643 36662 ATAACAATTCCTCTGATAAT 80 3604 1566982 N/A N/A 92202 92221 GCATACTTTCCTACCTTGGG 21 3605 1567114 N/A N/A 65542 65561 ATAGACCTACTAGCTGGGCA 50 3606 1567124 N/A N/A 35459 35478 TCTCATTTCTTTGAACGCAA 1 3607 1567133 N/A N/A 180748 180767 TCAAGTGCTTTTAAAAATTA 84 3608 182492 182511 1567164 N/A N/A 103563 103582 CCAGCATATCTAGTTATTTC 42 3609 1567165 N/A N/A 30090 30109 AATGCAGATTTAACTTTTGA 38 3610 1567243 N/A N/A 19323 19342 AGCACAGACATGCTACCTCA 64 3611 1567251 N/A N/A 25409 25428 TCAGTCAGCCAAATTCCCTT 13 3612 1567295 N/A N/A 17634 17653 GTTTTATACTTCCAAGCACA 31 3613 1567303 N/A N/A 203609 203628 GCACAAGTTCTGCCGCTCAC 26 3614 1567390 N/A N/A 55117 55136 ATGCACTGTACTGACTCCAC 38 3615 1567424 N/A N/A 156350 156369 ATCCACATTTTCCTGGAGGT 73 3616 1567447 N/A N/A 22619 22638 AGTTGCATGCCTTATCTTTC 16 3617 1567560 N/A N/A 93662 93681 TGGGAGTGACTCACTCAGCT 72 3618 1567690 N/A N/A 3866 3885 GTCCTTCACCAGCTACCCTT 103 3619 1567756 N/A N/A 141208 141227 GGCATCTCTGATTCTTGCAT 45 3620 1567763 N/A N/A 177626 177645 AAATATTAGCAAAATGAATC 97 3621 205287 205306 1567782 N/A N/A 165234 165253 AGCACTGTTGACCACTACTT 39 3622 1567862 N/A N/A 51626 51645 GCTTCTCTCCTTCTTCAAGC 60 3623 1567888 N/A N/A 76277 76296 CCACAAACACTGCAACAGCT 91 3624 1567951 N/A N/A 35787 35806 CCCTTCTATCATGCCATTCC 37 3625 1567956 N/A N/A 87080 87099 GCTGGCATCTTTGTTTATTT 83 3626 1567972 N/A N/A 170199 170218 GCACAGTACTTCTCTCAGGG 10 3627 1568002 N/A N/A 111231 111250 GAAGCAGTACTTATCATTCT 41 3628 1568038 N/A N/A 46652 46671 TCCAGCTTTATACACCCTTT 10 3629 1568061 N/A N/A 45183 45202 GGTTCCTTCAAATACTTTTA 16 3630 1568110 N/A N/A 9996 10015 GTTACTAATGTCTACTGTCT 46 3631 1568129 N/A N/A 35959 35978 CACCTAGCTCTTTAATTCCT 72 3632 1568149 N/A N/A 134900 134919 TGGTCATTGCCTCAAGTCTC 47 3633 1568166 N/A N/A 37006 37025 CACCATGTTATTCATATCTA 11 3634 1568172 N/A N/A 185061 185080 AGCATGGTTTTCAAGACCCT 59 3635 1568243 N/A N/A 37157 37176 CTGCACTACATTCTGTTGCA 85 3636 1568255 N/A N/A 81318 81337 GTCCATTTTATCTTCCAAAC 14 3637 1568314 N/A N/A 41987 42006 TGCCAATTCCATACTAACTT 54 3638 1568333 N/A N/A 14178 14197 GTCTCACCTCATCTGCAGGC 66 3639 1568335 N/A N/A 14762 14781 TAGCTTTTTGCCATTCATCC 17 3640 1568409 N/A N/A 119829 119848 GCTTTAGTATTCTAATGAGT 21 3641 1568411 N/A N/A 107459 107478 TGACTTAGTTACTCCAAGCT 67 3642 1568998 N/A N/A 38252 38271 GGGCAAACCACTTAAGTCAT 94 3643 1569280 N/A N/A 23696 23715 CTCTCCATAGCATAGAGTAT 63 3644 1569359 N/A N/A 12136 12155 CTCTAACAAGATCACATCTC 85 3645 1569431 N/A N/A 27583 27602 CATGAATTGAAACTTGCAGC 5 3646 1569509 N/A N/A 141798 141817 ACCCAGCTTCTATCACTCTC 65 3647 1569643 N/A N/A 26466 26485 TGGTCCTAGTAACCAGACCA 78 3648 1569679 N/A N/A 29089 29108 GCAAAGGTTCAAAGAACCCT 91 3649 1569784 N/A N/A 85638 85657 ATCTACCAGCATCCTAAGGT 78 3650 1570226 N/A N/A 167944 167963 CCCTTACTGCACTTGAGCTC 99 3651 1570312 N/A N/A 146731 146750 CCTTCTCTATCCATTGTTTC 75 3652 1570337 N/A N/A 19853 19872 GAAGACACTACAGAGTATGC 66 3653 1570342 N/A N/A 124342 124361 AGGTTCCTCAACTTTTCTTC 36 3654 1570345 N/A N/A 36276 36295 CCCAACATTAAGATTTCAAT 20 3655 1570576 N/A N/A 112816 112835 CCTCAACATTTGCTAAGTGC 27 3656 1570582 N/A N/A 18821 18840 GCACAATCCCAATTTAGACT 44 3657 1570634 N/A N/A 27802 27821 AGTCTTTCCAACAAGGCACC 74 3658 1570724 N/A N/A 50296 50315 GTGTGTTCAGGATTCATGTC 44 3659

TABLE-US-00060 TABLE 60 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 2 1008 1566477 N/A N/A 39695 39714 GGGCAAATAGCTCTAAGTCT 53 3660 1566500 N/A N/A 14177 14196 TCTCACCTCATCTGCAGGCT 57 3661 1566608 N/A N/A 146477 146496 GCACAAATTGTCAACAGCTT 27 3662 1566663 N/A N/A 111228 111247 GCAGTACTTATCATTCTAGT 22 3663 1566767 N/A N/A 3682 3701 CCAGTCTTCAATGCCCTTCC 69 3664 1566794 N/A N/A 103560 103579 GCATATCTAGTTATTTCACA 30 3665 1566809 N/A N/A 37143 37162 GTTGCAGGCTACTCTTGACC 12 3666 1566826 N/A N/A 117447 117466 CTGTAGTTTTTCACTCTAGA 18 3667 1566836 N/A N/A 14761 14780 AGCTTTTTGCCATTCATCCA 33 3668 1566854 N/A N/A 19322 19341 GCACAGACATGCTACCTCAT 66 3669 1566883 N/A N/A 35425 35444 TGTGATGTTCACCTGATTCA 5 3670 1566886 N/A N/A 134242 134261 GTGCAATTTTACAGACTCCT 8 3671 1566888 N/A N/A 129877 129896 TCTCAATTACAGCCTAGGGA 8 3672 1566926 N/A N/A 40740 40759 ATTTATCTAAACATATACAT 65 3673 40799 40818 40829 40848 40859 40878 40889 40908 40919 40938 40949 40968 40979 40998 41009 41028 1566933 N/A N/A 19834 19853 CAGAAATGATGAACCCATCC 62 3674 1567002 N/A N/A 63977 63996 TTGCACTTGCCCTCTGACTC 63 3675 1567009 N/A N/A 18719 18738 CTTCCATTGAGACTTAACTT 55 3676 1567019 N/A N/A 73892 73911 CATCAACTTACTAGCTGGTC 52 3677 1567078 N/A N/A 22618 22637 GTTGCATGCCTTATCTTTCC 11 3678 1567106 N/A N/A 177622 177641 ATTAGCAAAATGAATCCAAC 70 3679 205283 205302 1567174 N/A N/A 123408 123427 GATGGCTTTTTCATTAACCA 21 3680 1567269 N/A N/A 163765 163784 TTTTCCTTGCAACTATGGCC 57 3681 1567312 N/A N/A 35958 35977 ACCTAGCTCTTTAATTCCTC 64 3682 1567327 N/A N/A 119579 119598 GGGTTTTCCACCCTGCCTCC 73 3683 1567349 N/A N/A 78064 78083 ACTCTGTTCTAGTACCACAC 19 3684 1567365 N/A N/A 180747 180766 CAAGTGCTTTTAAAAATTAT 74 3685 182491 182510 1567383 N/A N/A 26092 26111 CACCAATCCCTATGTTCATA 6 3686 1567400 N/A N/A 92089 92108 GCTGGAGATAGACATGAACT 27 3687 1567446 N/A N/A 27570 27589 TTGCAGCACAGACAAAGCAT 57 3688 1567465 N/A N/A 185060 185079 GCATGGTTTTCAAGACCCTC 68 3689 1567467 N/A N/A 13071 13090 TGTCAATTCATAACCAGCAT 93 3690 1567477 N/A N/A 108423 108442 GCGGGATTTTACCAACGGCT 52 3691 1567484 N/A N/A 49278 49297 AAGCCATGAACAATGTGTCT 30 3692 1567519 N/A N/A 214630 214649 GGTCCATCAATAATGTGTCA 27 3693 1567520 N/A N/A 141207 141226 GCATCTCTGATTCTTGCATA 57 3694 1567529 N/A N/A 46650 46669 CAGCTTTATACACCCTTTCT 22 3695 1567545 N/A N/A 81258 81277 GCACAGACAGTTATCTTGGC 25 3696 1567552 N/A N/A 29085 29104 AGGTTCAAAGAACCCTCCTA 83 3697 1567578 N/A N/A 55115 55134 GCACTGTACTGACTCCACTT 12 3698 1567596 N/A N/A 26465 26484 GGTCCTAGTAACCAGACCAC 74 3699 1567599 N/A N/A 36995 37014 TCATATCTATATGCTACCCA 49 3700 1567612 N/A N/A 30089 30108 ATGCAGATTTAACTTTTGAC 11 3701 1567621 N/A N/A 35786 35805 CCTTCTATCATGCCATTCCT 28 3702 1567643 N/A N/A 76266 76285 GCAACAGCTTTCCATCTGGT 45 3703 1567653 N/A N/A 17619 17638 GCACACTGTAAAAGACAGCA 39 3704 1567731 N/A N/A 221423 221442 GAGCTGTTTTCACTTCATCA 18 3705 1567867 N/A N/A 27772 27791 GCACTTAATACATCATGCCT 27 3706 1567932 N/A N/A 41986 42005 GCCAATTCCATACTAACTTA 11 3707 1567988 N/A N/A 9950 9969 GTGTGCTACTGCTACTATGC 35 3708 1568005 N/A N/A 21583 21602 GTCTTAATTCTGACTTCAGC 18 3709 1568032 N/A N/A 51619 51638 TCCTTCTTCAAGCAGACTTC 49 3710 1568120 N/A N/A 36640 36659 ACAATTCCTCTGATAATTAT 65 3711 1568150 N/A N/A 70641 70660 TGGTTGTGCTCACTCTTAGA 6 3712 1568153 N/A N/A 86944 86963 GCTCAGTCCCCATAGATGGC 73 3713 1568181 N/A N/A 93636 93655 GCCAACACATAGCGGTTCTC 37 3714 1568201 N/A N/A 20970 20989 CACCTTAATGCCTCTCAGCT 59 3715 1568305 N/A N/A 107458 107477 GACTTAGTTACTCCAAGCTC 38 3716 1568313 N/A N/A 85633 85652 CCAGCATCCTAAGGTATCCA 27 3717 1568375 N/A N/A 95123 95142 TGCTGCATCCCTTACACTGT 69 3718 1568390 N/A N/A 24459 24478 CCATTTGTGCTTAACTTACA 15 3719 1569037 N/A N/A 141797 141816 CCCAGCTTCTATCACTCTCT 46 3720 1569060 N/A N/A 203515 203534 GCTGCCCCATGATCTCCATC 33 3721 1569131 N/A N/A 165204 165223 AGCACTCTTTCCCCTCGCTC 80 3722 1569136 N/A N/A 169828 169847 GTGCATACAACAAGGGAAGC 45 3723 1569146 N/A N/A 199636 199655 GGCTTTACATATATGTCATC 65 3724 1569258 N/A N/A 112783 112802 ATGTATTCACCAACCTCGGC 39 3725 1569584 N/A N/A 36256 36275 GTTTTCTTTAAATCTGCAGC 3 3726 1569852 N/A N/A 37793 37812 TGACACTTTTATTCTGTACC 5 3727 1569881 N/A N/A 100225 100244 AGCTCTTCTCCCATTCCACC 51 3728 1569889 N/A N/A 23558 23577 CTCATGACAGTTCTCACAAT 30 3729 1569966 N/A N/A 82734 82753 GGGTCACCTCAACTCTTGGC 64 3730 1570264 N/A N/A 167943 167962 CCTTACTGCACTTGAGCTCC 96 3731 1570324 N/A N/A 61325 61344 TGTTGCCTACCATATTGCTT 34 3732 1570478 N/A N/A 155470 155489 CCCACCATCACTATGACCTC 71 3733 1570488 N/A N/A 25408 25427 CAGTCAGCCAAATTCCCTTT 18 3734 1570670 N/A N/A 12134 12153 CTAACAAGATCACATCTCCC 72 3735 1570750 N/A N/A 44678 44697 TGTTTCCCCACTCCTACTCT 71 3736

TABLE-US-00061 TABLE 61 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 2 1008 1566474 N/A N/A 146302 146321 GAGCACCCATTCCATACCAC 56 3737 1566487 N/A N/A 40736 40755 ATCTAAACATATACATGTGT 58 3738 40795 40814 40825 40844 1566493 N/A N/A 167913 167932 GGGCTTTCTTGGCATACTCA 35 3739 169711 169730 1566495 N/A N/A 49248 49267 TGGGACTCAATCTTTCCCTT 348 3740 1566592 N/A N/A 221340 221359 ACGCTCCTCTCTTTCTTGGA 43 3741 1566674 N/A N/A 19721 19740 CACCATGTGATTCCCTGATT 64 3742 1566709 N/A N/A 153293 153312 GCTTGCCTGATCACTATGTT 115 3743 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 15 2204 1566740 N/A N/A 92070 92089 TTGCACTGCACTCTAGGTAT 35 3744 1566781 N/A N/A 35785 35804 CTTCTATCATGCCATTCCTT 55 3745 1566810 N/A N/A 27771 27790 CACTTAATACATCATGCCTT 67 3746 1566835 N/A N/A 37651 37670 ACAGTTTATTTTTAGCAGCA 4 3747 1566857 N/A N/A 202901 202920 CCTTGTTTTTCCCTCGAGGA 71 3748 1566877 N/A N/A 17517 17536 GCACAAGGCCACATTTTCAA 112 3749 1566897 N/A N/A 14176 14195 CTCACCTCATCTGCAGGCTA 73 3750 1566909 N/A N/A 141794 141813 AGCTTCTATCACTCTCTTGC 78 3751 1566993 N/A N/A 95122 95141 GCTGCATCCCTTACACTGTT 100 3752 1567081 N/A N/A 37142 37161 TTGCAGGCTACTCTTGACCC 22 3753 1567115 N/A N/A 81165 81184 ATAAGTTTATTTCCAGACTC 73 3754 1567116 N/A N/A 123406 123425 TGGCTTTTTCATTAACCACC 20 3755 1567163 N/A N/A 41527 41546 GCATATATATTTATATAAAC 101 3756 41557 41576 1567181 N/A N/A 85522 85541 ACTCACCAACAACATCTGGC 230 3757 1567188 N/A N/A 39668 39687 CTGTCTTACTTATTATTGGC 3 3758 1567235 N/A N/A 73891 73910 ATCAACTTACTAGCTGGTCA 70 3759 1567240 N/A N/A 36993 37012 ATATCTATATGCTACCCACT 65 3760 1567245 N/A N/A 18708 18727 ACTTAACTTTGTTCCTGGCT 69 3761 1567354 N/A N/A 23305 23324 GCTACAAGTACCAAGTAGCC 94 3762 1567366 N/A N/A 198886 198905 ACTCGAGTAATGTTCCAGTC 91 3763 1567369 N/A N/A 29073 29092 CCCTCCTAGACTATACTGGT 74 3764 1567401 N/A N/A 177621 177640 TTAGCAAAATGAATCCAACA 176 3765 205282 205301 1567433 N/A N/A 21234 21253 CCTGGCTTCAATAAGTTACT 112 3766 1567459 N/A N/A 82733 82752 GGTCACCTCAACTCTTGGCC 131 3767 1567498 N/A N/A 26464 26483 GTCCTAGTAACCAGACCACC 118 3768 1567543 N/A N/A 35957 35976 CCTAGCTCTTTAATTCCTCC 150 3769 1567571 N/A N/A 19320 19339 ACAGACATGCTACCTCATCA 92 3770 1567694 N/A N/A 25336 25355 CTGTGTGATATGTATCACAC 120 3771 1567708 N/A N/A 61127 61146 AGCTTACCAATTGCATGATC 34 3772 1567739 N/A N/A 14737 14756 TATCCATGCCATCAAACAGC 102 3773 1567755 N/A N/A 93629 93648 CATAGCGGTTCTCTTCACCA 39 3774 1567826 N/A N/A 46603 46622 GTTGCCTGCTCATGCTGGCA 98 3775 1567873 N/A N/A 112328 112347 GCTCACTTGAGATCCTCTAT 63 3776 1567900 N/A N/A 100187 100206 TCGAATCTCAGATTCAGACC 118 3777 1567933 N/A N/A 3611 3630 CTTGGGCTTTTCCTGTGGCA 99 3778 1567954 N/A N/A 110482 110501 GAGCATCATCATATTAGCCA 37 3779 1567980 N/A N/A 107457 107476 ACTTAGTTACTCCAAGCTCT 71 3780 1568014 N/A N/A 169810 169829 GCAAGCTTCCTCTTTAAGGG 127 3781 1568030 N/A N/A 163764 163783 TTTCCTTGCAACTATGGCCA 83 3782 1568082 N/A N/A 119532 119551 ATGGAGTCTGTTCCTAGTCC 46 3783 1568094 N/A N/A 27565 27584 GCACAGACAAAGCATCTCCA 7 3784 1568158 N/A N/A 51446 51465 AGGCTGCTCCCACTGTTCTC 55 3785 1568272 N/A N/A 180745 180764 AGTGCTTTTAAAAATTATGA 132 3786 182489 182508 1568320 N/A N/A 63975 63994 GCACTTGCCCTCTGACTCCT 47 3787 1568321 N/A N/A 77997 78016 GCCTTTCTTTGACTCTCTCC 87 3788 1568325 N/A N/A 9948 9967 GTGCTACTGCTACTATGCAC 126 3789 1568362 N/A N/A 128379 128398 TGGGTATGATACTTAGCCTT 75 3790 1568420 N/A N/A 30088 30107 TGCAGATTTAACTTTTGACT 10 3791 1568436 N/A N/A 12133 12152 TAACAAGATCACATCTCCCT 108 3792 1568989 N/A N/A 103310 103329 CTAGAGCTCACTGAAGGTCC 76 3793 1569044 N/A N/A 70617 70636 TACACATACCTCTCTCTGGT 112 3794 1569139 N/A N/A 184389 184408 AGCTGTCCCTGATTCCCCTC 69 3795 1569154 N/A N/A 22612 22631 TGCCTTATCTTTCCTAAGAT 68 3796 1569211 N/A N/A 214037 214056 TAGCGGCACTGACTCCTCTT 81 3797 1569422 N/A N/A 117446 117465 TGTAGTTTTTCACTCTAGAC 25 3798 1569425 N/A N/A 86735 86754 TCCAGGCCATAACAGTTGGC 104 3799 1569638 N/A N/A 26091 26110 ACCAATCCCTATGTTCATAT 7 3800 1569837 N/A N/A 76265 76284 CAACAGCTTTCCATCTGGTC 99 3801 1569849 N/A N/A 20969 20988 ACCTTAATGCCTCTCAGCTC 62 3802 1569891 N/A N/A 36245 36264 ATCTGCAGCATACACATCTA 47 3803 1570145 N/A N/A 165148 165167 TCTCTGGCTACACCTCCTTT 84 3804 1570164 N/A N/A 36632 36651 TCTGATAATTATATAGTCTC 65 3805 1570204 N/A N/A 140240 140259 GCTGGGCTTTATTCTTCATT 76 3806 1570260 N/A N/A 54511 54530 GAGGTATTTTTTCAATAGCA 3 3807 1570341 N/A N/A 44672 44691 CCCACTCCTACTCTAAGTAC 144 3808 1570483 N/A N/A 13070 13089 GTCAATTCATAACCAGCATA 99 3809 1570613 N/A N/A 108305 108324 CCACACTAGGTATAATGACC 77 3810 1570658 N/A N/A 35419 35438 GTTCACCTGATTCACCTGAA 3 3811 1570679 N/A N/A 24425 24444 TCTGATTGTTCTGAAGGGCC 48 3812 1570775 N/A N/A 133253 133272 GTAGCTCAGATATTCTGTAC 44 3813

TABLE-US-00062 TABLE 62 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 3 1008 1566566 N/A N/A 13973 13992 AGGGAAGGTTCTTAATGGCA 23 3814 1566582 N/A N/A 81162 81181 AGTTTATTTCCAGACTCTGA 30 3815 1566604 N/A N/A 36985 37004 ATGCTACCCACTGTTTGGTA 29 3816 1566625 N/A N/A 39665 39684 TCTTACTTATTATTGGCCCT 24 3817 1566658 N/A N/A 146298 146317 ACCCATTCCATACCACATGC 66 3818 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 17 2204 1566808 N/A N/A 36243 36262 CTGCAGCATACACATCTATC 44 3819 1566839 N/A N/A 19716 19735 TGTGATTCCCTGATTTCCTC 68 3820 1566849 N/A N/A 49175 49194 CGTACTGTTTCCCTTTGCCT 15 3821 1566855 N/A N/A 202688 202707 TAGCATTCTAATGATCACTT 21 3822 1566859 N/A N/A 214034 214053 CGGCACTGACTCCTCTTCTT 49 3823 1566875 N/A N/A 139983 140002 GAATCATTTTTTGACCTTGA 27 3824 1566878 N/A N/A 54241 54260 GCTCAGGTCTGCCTTAGCCT 76 3825 1566938 N/A N/A 117440 117459 TTTTCACTCTAGACTTGTTT 38 3826 1566949 N/A N/A 35956 35975 CTAGCTCTTTAATTCCTCCC 58 3827 1566983 N/A N/A 95120 95139 TGCATCCCTTACACTGTTGT 86 3828 1567027 N/A N/A 23212 23231 GGTACACTTCATCAGATATC 26 3829 1567036 N/A N/A 41486 41505 TAAACATATACATGTGCATA 64 3830 41512 41531 1567054 N/A N/A 40735 40754 TCTAAACATATACATGTGTA 62 3831 40794 40813 40824 40843 1567094 N/A N/A 100078 100097 GCATACATACCTTCACCTGG 45 3832 1567105 N/A N/A 12942 12961 ACACAGATGCAATTTCACTC 37 3833 1567154 N/A N/A 107429 107448 GAGGCTTTCTCATTTGCTGC 64 3834 1567189 N/A N/A 169760 169779 CTGCAAGCACAACTTTGACA 72 3835 1567211 N/A N/A 70616 70635 ACACATACCTCTCTCTGGTC 81 3836 1567221 N/A N/A 30086 30105 CAGATTTAACTTTTGACTTC 20 3837 1567285 N/A N/A 177617 177636 CAAAATGAATCCAACAATGT 92 3838 205278 205297 1567329 N/A N/A 23943 23962 TGGTATTTTATATCAGCCAA 91 3839 1567373 N/A N/A 9947 9966 TGCTACTGCTACTATGCACC 74 3840 1567393 N/A N/A 141793 141812 GCTTCTATCACTCTCTTGCT 72 3841 1567398 N/A N/A 14736 14755 ATCCATGCCATCAAACAGCT 68 3842 1567414 N/A N/A 128112 128131 TGCCAATATGAACACATGAC 54 3843 1567448 N/A N/A 77977 77996 AGCAACCTTGAACCAGCACC 95 3844 1567513 N/A N/A 153153 153172 CTCAGTGCTTTGCTTTGGCA 54 3845 1567539 N/A N/A 18588 18607 GGTTTATTCACTAATTGACT 33 3846 1567568 N/A N/A 184388 184407 GCTGTCCCTGATTCCCCTCC 97 3847 1567638 N/A N/A 35748 35767 GCCTTCTACAGGAATCCATA 47 3848 1567644 N/A N/A 26463 26482 TCCTAGTAACCAGACCACCA 68 3849 1567788 N/A N/A 76170 76189 AGATCATTAGACTATTTTGC 75 3850 1567798 N/A N/A 221339 221358 CGCTCCTCTCTTTCTTGGAC 60 3851 1567865 N/A N/A 123405 123424 GGCTTTTTCATTAACCACCT 16 3852 1567891 N/A N/A 198706 198725 GCCACATCTTTTCTTGTAGC 105 3853 1567924 N/A N/A 19319 19338 CAGACATGCTACCTCATCAC 115 3854 1567969 N/A N/A 133250 133269 GCTCAGATATTCTGTACGAC 16 3855 1567976 N/A N/A 180744 180763 GTGCTTTTAAAAATTATGAT 81 3856 182488 182507 1568011 N/A N/A 167911 167930 GCTTTCTTGGCATACTCAGT 31 3857 169709 169728 1568033 N/A N/A 82424 82443 ATGCAATTCACCCACTTGGA 54 3858 1568037 N/A N/A 37141 37160 TGCAGGCTACTCTTGACCCA 32 3859 1568043 N/A N/A 17448 17467 TCCAATTCACAGCTTAGGGA 18 3860 1568053 N/A N/A 93627 93646 TAGCGGTTCTCTTCACCATC 45 3861 1568102 N/A N/A 108137 108156 AGCCACTGAATAAACTTGGT 108 3862 1568147 N/A N/A 36631 36650 CTGATAATTATATAGTCTCA 30 3863 1568214 N/A N/A 26086 26105 TCCCTATGTTCATATACTAC 85 3864 1568249 N/A N/A 61126 61145 GCTTACCAATTGCATGATCT 36 3865 1568277 N/A N/A 37570 37589 TTTAATCTCAAATTTTGCTT 73 3866 1568382 N/A N/A 44671 44690 CCACTCCTACTCTAAGTACC 93 3867 1568406 N/A N/A 25252 25271 GCAGTGATACTACAACAGCA 62 3868 1569043 N/A N/A 35359 35378 TCGCTTTCTAAAGCTTTCCT 59 3869 1569100 N/A N/A 102701 102720 GTCAAAGATCTATTTCCTAA 49 3870 1569150 N/A N/A 12128 12147 AGATCACATCTCCCTGTGGC 69 3871 1569217 N/A N/A 27763 27782 ACATCATGCCTTTAAGTCCA 21 3872 1569286 N/A N/A 46588 46607 TGGCAGAGTAACCCAGCCAA 115 3873 1569524 N/A N/A 2493 2512 TCGGAGGTCCTCCCGCTGCT 97 3874 1569567 N/A N/A 51187 51206 GCCCAATGTTTCAGTCAGAA 12 3875 1569733 N/A N/A 110309 110328 GTATGTGAATGACTTCTGCA 21 3876 1569974 N/A N/A 119521 119540 TCCTAGTCCTTTAAGTACCT 34 3877 1569975 N/A N/A 29072 29091 CCTCCTAGACTATACTGGTA 82 3878 1570009 N/A N/A 73749 73768 AGGCGATCCTCCCCTACCTC 98 3879 1570055 N/A N/A 91872 91891 TGGCTGTTTCCACTTGAGTT 62 3880 1570078 N/A N/A 162852 162871 ACTCATATTCCTAACACGGC 26 3881 1570135 N/A N/A 21233 21252 CTGGCTTCAATAAGTTACTT 77 3882 1570165 N/A N/A 63924 63943 AGTGCTTCCATATATGATAT 40 3883 1570171 N/A N/A 27430 27449 AACCTCTTCAAAAAGACTGC 62 3884 1570485 N/A N/A 20964 20983 AATGCCTCTCAGCTCATCTA 75 3885 1570560 N/A N/A 112286 112305 ATTGGTACATATTCCAGGGC 25 3886 1570624 N/A N/A 85509 85528 ATCTGGCTAGAATTCATGCT 64 3887 1570713 N/A N/A 22611 22630 GCCTTATCTTTCCTAAGATA 53 3888 1570838 N/A N/A 165142 165161 GCTACACCTCCTTTGTTGGT 56 3889 1570925 N/A N/A 86699 86718 AACCACAATCTAGCAGCCTT 44 3890

TABLE-US-00063 TABLE 63 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 2 1008 1566459 N/A N/A 41479 41498 ATACATGTGCATATTTATAT 86 3891 41505 41524 1566468 N/A N/A 37566 37585 ATCTCAAATTTTGCTTGGAC 3 3892 1566507 N/A N/A 29047 29066 ATAAATTGATATTACCATTT 84 3893 1566531 N/A N/A 14735 14754 TCCATGCCATCAAACAGCTT 52 3894 1566556 N/A N/A 183620 183639 CCCGGTCTCATATTTTCTTC 58 3895 1566622 N/A N/A 19715 19734 GTGATTCCCTGATTTCCTCT 42 3896 1566647 N/A N/A 20954 20973 AGCTCATCTAAAAAGTTCCC 72 3897 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 22 2204 1566775 N/A N/A 180743 180762 TGCTTTTAAAAATTATGATA 62 3898 182487 182506 1566802 N/A N/A 36242 36261 TGCAGCATACACATCTATCT 19 3899 1566845 N/A N/A 93626 93645 AGCGGTTCTCTTCACCATCA 20 3900 1566863 N/A N/A 26085 26104 CCCTATGTTCATATACTACT 50 3901 1566913 N/A N/A 61117 61136 TTGCATGATCTATACCGACT 9 3902 1566972 N/A N/A 132356 132375 GCCACATGTTGCATTGACCT 28 3903 1566974 N/A N/A 39382 39401 TTAAGACCTTATTTTCTTTT 76 3904 1567089 N/A N/A 12941 12960 CACAGATGCAATTTCACTCA 32 3905 1567090 N/A N/A 198704 198723 CACATCTTTTCTTGTAGCTC 83 3906 1567104 N/A N/A 76056 76075 AGCTCACCTAATGTTCTCCC 52 3907 1567117 N/A N/A 12112 12131 TGGCACTCATCACAGTCTGC 50 3908 1567162 N/A N/A 213791 213810 GGTCCATCCCTATTACTTTT 40 3909 1567203 N/A N/A 177616 177635 AAAATGAATCCAACAATGTA 82 3910 205277 205296 1567233 N/A N/A 164927 164946 TGCCTACTATATGATAGCTC 75 3911 1567283 N/A N/A 119343 119362 GGAGCATAGACACATTCCAC 58 3912 1567301 N/A N/A 167909 167928 TTTCTTGGCATACTCAGTAA 44 3913 169707 169726 1567306 N/A N/A 27760 27779 TCATGCCTTTAAGTCCAGTT 1 3914 1567316 N/A N/A 86667 86686 CTCAGCTCACTGCCTTTATC 79 3915 1567319 N/A N/A 17373 17392 GTTGGCTAAATCCAACTTCT 93 3916 1567335 N/A N/A 9946 9965 GCTACTGCTACTATGCACCC 89 3917 1567367 N/A N/A 202686 202705 GCATTCTAATGATCACTTGC 26 3918 1567451 N/A N/A 40734 40753 CTAAACATATACATGTGTAT 48 3919 40793 40812 40823 40842 1567492 N/A N/A 82179 82198 GTGACTGATGTCTTTCAACT 38 3920 1567495 N/A N/A 146292 146311 TCCATACCACATGCGGAGCT 65 3921 1567586 N/A N/A 128111 128130 GCCAATATGAACACATGACT 36 3922 1567760 N/A N/A 162750 162769 ATGATCTTGGTCCAATGCCT 28 3923 1567800 N/A N/A 13926 13945 TCCAATGTAAAGCTAAGGTT 33 3924 1567804 N/A N/A 95118 95137 CATCCCTTACACTGTTGTCC 39 3925 1567823 N/A N/A 139901 139920 AAGCACCTCTGAGCCCTGCC 63 3926 1567848 N/A N/A 44667 44686 TCCTACTCTAAGTACCACTC 86 3927 1567863 N/A N/A 23882 23901 ATAATACCATAGTCATTCAT 41 3928 1567868 N/A N/A 70615 70634 CACATACCTCTCTCTGGTCT 62 3929 1567892 N/A N/A 49169 49188 GTTTCCCTTTGCCTTCACCT 17 3930 1567945 N/A N/A 2466 2485 TTGGTTCGCTAAACTGCATC 63 3931 1567974 N/A N/A 153152 153171 TCAGTGCTTTGCTTTGGCAT 56 3932 1568017 N/A N/A 36984 37003 TGCTACCCACTGTTTGGTAT 106 3933 1568023 N/A N/A 19318 19337 AGACATGCTACCTCATCACT 79 3934 1568028 N/A N/A 221338 221357 GCTCCTCTCTTTCTTGGACA 124 3935 1568098 N/A N/A 107321 107340 AGGCCTTTCTAGATTCACTA 115 3936 1568125 N/A N/A 123404 123423 GCTTTTTCATTAACCACCTC 33 3937 1568162 N/A N/A 30084 30103 GATTTAACTTTTGACTTCGC 12 3938 1568188 N/A N/A 112247 112266 AGCCTATGCTAACCACTTCC 58 3939 1568208 N/A N/A 110176 110195 GACTCATTTTTGCTATGACT 20 3940 1568209 N/A N/A 37140 37159 GCAGGCTACTCTTGACCCAT 38 3941 1568222 N/A N/A 25231 25250 AGCCCTTTGAATTTCAGACT 18 3942 1568248 N/A N/A 27428 27447 CCTCTTCAAAAAGACTGCCT 48 3943 1568258 N/A N/A 85346 85365 CTCCATATTACTCTAACCCT 95 3944 1568302 N/A N/A 36620 36639 ATAGTCTCACAGTTATCACT 16 3945 1568352 N/A N/A 35955 35974 TAGCTCTTTAATTCCTCCCC 49 3946 1568400 N/A N/A 77976 77995 GCAACCTTGAACCAGCACCA 34 3947 1568434 N/A N/A 99953 99972 GGTTATTTACAACCTCACAT 34 3948 1568437 N/A N/A 22518 22537 GCCCAAATATCAACCCACTT 61 3949 1569083 N/A N/A 63921 63940 GCTTCCATATATGATATGGT 20 3950 1569090 N/A N/A 73748 73767 GGCGATCCTCCCCTACCTCA 76 3951 1569444 N/A N/A 26461 26480 CTAGTAACCAGACCACCAGT 111 3952 1569611 N/A N/A 51186 51205 CCCAATGTTTCAGTCAGAAC 13 3953 1569614 N/A N/A 21058 21077 GATGAACTTGCCTTCTACTA 56 3954 1569716 N/A N/A 23211 23230 GTACACTTCATCAGATATCC 24 3955 1569863 N/A N/A 54017 54036 ACTGTGCAACTACCACAGGC 73 3956 1569904 N/A N/A 141674 141693 TCCAACCTTACTCATCATCT 48 3957 1569909 N/A N/A 117415 117434 AGCAGCTATACTCTTAACTT 22 3958 1570031 N/A N/A 81137 81156 ATCACATTGATCACATGTCT 68 3959 1570099 N/A N/A 169359 169378 AGTAGCTGTACTTACTGCCA 50 3960 1570126 N/A N/A 18580 18599 CACTAATTGACTCATCCAAT 56 3961 1570195 N/A N/A 102621 102640 GCCTAATTTCCTAAAGCAGT 49 3962 1570255 N/A N/A 108120 108139 GGTGTCTCTCAAAATTCTGT 35 3963 1570499 N/A N/A 91110 91129 TGTTCTTGCTGACACCCAAC 92 3964 1570500 N/A N/A 35747 35766 CCTTCTACAGGAATCCATAC 50 3965 1570557 N/A N/A 35358 35377 CGCTTTCTAAAGCTTTCCTC 56 3966 1570877 N/A N/A 46573 46592 GCCAAACTAGTTTCTGCTTC 20 3967

TABLE-US-00064 TABLE 64 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 1 1008 1566455 N/A N/A 18507 18526 ACATTCCAATAGAGACCCCT 45 3968 1566482 N/A N/A 44647 44666 CCTGCATATTACATGTCAAA 73 3969 1566517 N/A N/A 82176 82195 ACTGATGTCTTTCAACTACC 29 3970 1566530 N/A N/A 36617 36636 GTCTCACAGTTATCACTTCA 10 3971 1566644 N/A N/A 202376 202395 TGGCACAATTATGACTGTCA 63 3972 1566692 N/A N/A 19704 19723 ATTTCCTCTAGAAAGCACCA 86 3973 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 17 2204 1566721 N/A N/A 22510 22529 ATCAACCCACTTCATCACTT 41 3974 1566744 N/A N/A 180705 180724 AAAATTTACCATTTTAGCAT 53 3975 182453 182472 1566769 N/A N/A 139886 139905 CTGCCCTACTCTCAGCTCTC 57 3976 1566880 N/A N/A 118910 118929 GCTGTACTTTTTAAACCTCA 11 3977 1566903 N/A N/A 37555 37574 TGCTTGGACTTTATTCCTGT 3 3978 1566904 1438 1457 73470 73489 ATCCATCCTTTCGACTCGAA 9 3979 1566943 N/A N/A 26079 26098 GTTCATATACTACTGATGGA 14 3980 1566977 N/A N/A 198703 198722 ACATCTTTTCTTGTAGCTCC 49 3981 1566997 N/A N/A 107263 107282 CCGTCTTTTCCCTTCTCATA 32 3982 1567015 N/A N/A 14734 14753 CCATGCCATCAAACAGCTTA 101 3983 1567020 N/A N/A 19317 19336 GACATGCTACCTCATCACTC 91 3984 1567034 N/A N/A 37139 37158 CAGGCTACTCTTGACCCATA 34 3985 1567066 N/A N/A 164926 164945 GCCTACTATATGATAGCTCC 62 3986 1567079 N/A N/A 40689 40708 CATGTGTATGTATATTTATC 10 3987 40723 40742 40753 40772 40782 40801 40812 40831 1567125 N/A N/A 91003 91022 ATGTTAATCTCAGCTTCGGC 32 3988 1567177 N/A N/A 23209 23228 ACACTTCATCAGATATCCTT 38 3989 1567199 N/A N/A 183619 183638 CCGGTCTCATATTTTCTTCT 37 3990 1567230 N/A N/A 112246 112265 GCCTATGCTAACCACTTCCC 51 3991 1567238 N/A N/A 93625 93644 GCGGTTCTCTTCACCATCAC 21 3992 1567270 N/A N/A 81117 81136 GTGCTTATGCCAATTCCACA 28 3993 1567292 N/A N/A 13858 13877 GTTAAATTCCCTGATTCTGC 30 3994 1567311 N/A N/A 27413 27432 TGCCTTCTAAAGTTCTACAT 57 3995 1567338 N/A N/A 54014 54033 GTGCAACTACCACAGGCACA 64 3996 1567442 N/A N/A 169358 169377 GTAGCTGTACTTACTGCCAT 57 3997 1567455 N/A N/A 141650 141669 GTTCCTCGAATTCCTCCTGC 36 3998 1567561 N/A N/A 146291 146310 CCATACCACATGCGGAGCTA 35 3999 1567617 N/A N/A 29044 29063 AATTGATATTACCATTTCTA 49 4000 1567851 N/A N/A 177615 177634 AAATGAATCCAACAATGTAT 60 4001 205276 205295 1567881 N/A N/A 2467 2486 GTTGGTTCGCTAAACTGCAT 68 4002 1567914 N/A N/A 30082 30101 TTTAACTTTTGACTTCGCTT 4 4003 1567918 N/A N/A 36235 36254 TACACATCTATCTTTGAGGA 26 4004 1567971 N/A N/A 122886 122905 CCATGTTATCAATACTAGGT 10 4005 1567997 N/A N/A 167906 167925 CTTGGCATACTCAGTAAGAA 17 4006 169704 169723 1568018 N/A N/A 86590 86609 GGCTGTCCAGAAATACTGCC 80 4007 1568020 N/A N/A 102574 102593 AGGTATTACTCATTTGCTCT 15 4008 1568027 N/A N/A 41478 41497 TACATGTGCATATTTATATA 59 4009 41504 41523 1568049 N/A N/A 108119 108138 GTGTCTCTCAAAATTCTGTT 22 4010 1568109 N/A N/A 23879 23898 ATACCATAGTCATTCATGTT 25 4011 1568111 N/A N/A 48900 48919 TCCAAACTTTCTGTTCAAGC 2 4012 1568113 N/A N/A 110175 110194 ACTCATTTTTGCTATGACTC 22 4013 1568117 N/A N/A 63920 63939 CTTCCATATATGATATGGTT 43 4014 1568146 N/A N/A 99773 99792 GCTGAAGTCCTTATCCCTCT 19 4015 1568148 N/A N/A 35723 35742 TTGCTGGATTTCATAGGCCT 46 4016 1568154 N/A N/A 76055 76074 GCTCACCTAATGTTCTCCCC 54 4017 1568160 N/A N/A 12939 12958 CAGATGCAATTTCACTCATT 35 4018 1568164 N/A N/A 39250 39269 ATAAACTGATCTTATATTTA 57 4019 1568174 N/A N/A 36972 36991 TTTGGTATGCCATTCCACAT 10 4020 1568186 N/A N/A 26397 26416 TGTATACTTTATCAAACTCT 10 4021 1568192 N/A N/A 70614 70633 ACATACCTCTCTCTGGTCTT 44 4022 1568245 2773 2792 161621 161640 GGAGCTCTTTCCACCCATGT 25 4023 1568381 1057 1076 20808 20827 GGCAGTCAATTTCCGGGAAA 3 4024 1568445 N/A N/A 213790 213809 GTCCATCCCTATTACTTTTC 15 4025 1569007 N/A N/A 132349 132368 GTTGCATTGACCTAACTGCC 49 4026 1569417 N/A N/A 84989 85008 GAGTCTACAAGACCACTGCC 79 4027 1569487 N/A N/A 8550 8569 TACCTTGTTTACCATGACTT 47 4028 1569514 N/A N/A 25217 25236 CAGACTAATTACCAATACTC 29 4029 1569530 N/A N/A 17348 17367 ATTGCCACTCTGTCACTGCC 46 4030 1569566 N/A N/A 12086 12105 GCAGTTTTTCATAAACAAGC 41 4031 1569656 N/A N/A 27740 27759 AGGTATGCACACATCTGACT 11 4032 1569917 N/A N/A 46558 46577 GCTTCCTAAGAAAAGCACGC 50 4033 1569948 N/A N/A 51154 51173 GTACATTCCTAAACCTGTCA 30 4034 1570119 N/A N/A 35349 35368 AAGCTTTCCTCTCAACCATT 43 4035 1570207 N/A N/A 61116 61135 TGCATGATCTATACCGACTT 6 4036 1570302 N/A N/A 127313 127332 GGTCATCTTAACTTTCAGTA 20 4037 1570383 N/A N/A 35929 35948 TTGTATTCTTGCTCCTATTC 24 4038 1570453 N/A N/A 117384 117403 CCCACCGTTTAATCACTGTA 52 4039 1570474 N/A N/A 95097 95116 CAGAAAGCCATCTTGTCTGC 71 4040 1570528 N/A N/A 152868 152887 TCATTCACTATTGCCAGGCA 32 4041 1570600 N/A N/A 221337 221356 CTCCTCTCTTTCTTGGACAA 44 4042 1570639 N/A N/A 77961 77980 CACCACCTCCTTGTTTCCTA 37 4043 1570773 N/A N/A 21053 21072 ACTTGCCTTCTACTATGACA 31 4044

TABLE-US-00065 TABLE 65 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 2 1008 1566522 N/A N/A 29040 29059 GATATTACCATTTCTAGCAA 5 4045 1566533 N/A N/A 50994 51013 GCTGTTGCTTGTCTCGCTCT 50 4046 1566540 N/A N/A 8545 8564 TGTTTACCATGACTTCCTTT 29 4047 1566551 N/A N/A 141635 141654 CCTGCTATGCTTCACTTCCA 99 4048 1566555 N/A N/A 39244 39263 TGATCTTATATTTAATGGCA 11 4049 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 17 2204 1566745 N/A N/A 37554 37573 GCTTGGACTTTATTCCTGTT 5 4050 1566777 N/A N/A 36971 36990 TTGGTATGCCATTCCACATT 12 4051 1566789 N/A N/A 177614 177633 AATGAATCCAACAATGTATA 53 4052 205275 205294 1566804 N/A N/A 30069 30088 TTCGCTTAGTCCAATATGCA 28 4053 1566902 N/A N/A 122666 122685 ATGACCTCCATAATCCATCC 31 4054 1567021 N/A N/A 213721 213740 GCAGCATACCAATTGCGCAA 50 4055 1567028 N/A N/A 86589 86608 GCTGTCCAGAAATACTGCCC 62 4056 1567088 N/A N/A 26370 26389 GCCCAAGTAGACAGTCTATC 25 4057 1567093 N/A N/A 180704 180723 AAATTTACCATTTTAGCATT 50 4058 182452 182471 1567126 N/A N/A 107971 107990 GCCTTTTCATAATACAGAGC 25 4059 1567175 N/A N/A 169355 169374 GCTGTACTTACTGCCATCCT 49 4060 1567180 N/A N/A 36616 36635 TCTCACAGTTATCACTTCAT 25 4061 1567257 N/A N/A 102496 102515 GCTTCCACTACTTGTATCTC 31 4062 1567280 N/A N/A 22480 22499 GAGACTTGAATCCTTAACAA 27 4063 1567419 N/A N/A 13788 13807 AGCCCATGTTCATTTGGCTT 78 4064 1567462 N/A N/A 117364 117383 TGAGCCAATCAACACAGGCT 62 4065 1567497 N/A N/A 35721 35740 GCTGGATTTCATAGGCCTTC 33 4066 1567523 N/A N/A 80652 80671 CCTGATTCCATGTACTTATA 16 4067 1567544 N/A N/A 35927 35946 GTATTCTTGCTCCTATTCCC 10 4068 1567591 N/A N/A 25187 25206 TCCCAGGTACTGACCAGGCA 33 4069 1567602 N/A N/A 82175 82194 CTGATGTCTTTCAACTACCA 45 4070 1567606 N/A N/A 107228 107247 GTATTTCTTCTTCAATGGGA 26 4071 1567615 N/A N/A 17347 17366 TTGCCACTCTGTCACTGCCA 46 4072 1567657 N/A N/A 40688 40707 ATGTGTATGTATATTTATCT 18 4073 40722 40741 40752 40771 40811 40830 1567660 N/A N/A 2441 2460 TGTGTCCCAGAACATGGGCA 56 4074 1567677 N/A N/A 41477 41496 ACATGTGCATATTTATATAA 38 4075 41503 41522 1567695 N/A N/A 53901 53920 CCTCAGTATATAATGTGACT 38 4076 1567718 N/A N/A 37138 37157 AGGCTACTCTTGACCCATAT 31 4077 1567764 N/A N/A 167170 167189 GCCTTCTTATTGCATAACTC 21 4078 1567784 N/A N/A 118797 118816 AGGACCGTCTTTCCAAGACT 53 4079 1567813 N/A N/A 145272 145291 TCTTCATGCTTACAGTCCAC 86 4080 1567822 N/A N/A 61110 61129 ATCTATACCGACTTTAGAAA 42 4081 1567827 N/A N/A 26058 26077 AGCCACTTCTGACAACAGCA 21 4082 1567889 N/A N/A 63366 63385 GGTCTCCATTCAAGTCATCA 45 4083 1567897 N/A N/A 72683 72702 ATCTGTTTCTATCACAGTCT 57 4084 1567936 N/A N/A 183322 183341 GCCTCTGATGATCTTTGCAT 50 4085 1567952 N/A N/A 77956 77975 CCTCCTTGTTTCCTAGTTAA 44 4086 1568012 N/A N/A 19315 19334 CATGCTACCTCATCACTCTC 127 4087 1568015 N/A N/A 139840 139859 GCTTGGTGTCTACCCTTTCC 72 4088 1568029 N/A N/A 93624 93643 CGGTTCTCTTCACCATCACA 18 4089 1568095 N/A N/A 190455 190474 TGCTATCTCCCACATCAAGC 60 4090 1568126 1027 1046 20778 20797 TCTGTTGTCTCCAATGGCCT 52 4091 1568177 N/A N/A 152803 152822 GCTGACTGTAGACCCTAGGA 82 4092 1568182 N/A N/A 164925 164944 CCTACTATATGATAGCTCCC 40 4093 1568189 N/A N/A 126187 126206 TGTGCAGATTCACAGTGGCT 68 4094 1568323 N/A N/A 23872 23891 AGTCATTCATGTTTAATTTC 13 4095 1568361 N/A N/A 161319 161338 TGGCTTTCTCATTAAGCATT 65 4096 1568964 N/A N/A 44267 44286 GTGTCAGCCATACAGTAGCA 7 4097 1569013 N/A N/A 48899 48918 CCAAACTTTCTGTTCAAGCA 5 4098 1569364 N/A N/A 19687 19706 CCATGGCTTAGATATTGCCC 70 4099 1569413 N/A N/A 14733 14752 CATGCCATCAAACAGCTTAT 43 4100 1569506 N/A N/A 23208 23227 CACTTCATCAGATATCCTTA 36 4101 1569545 N/A N/A 84988 85007 AGTCTACAAGACCACTGCCA 49 4102 1569755 N/A N/A 202374 202393 GCACAATTATGACTGTCATT 18 4103 1569756 N/A N/A 221335 221354 CCTCTCTTTCTTGGACAACT 29 4104 1569835 N/A N/A 95066 95085 AAGGTCTGCTTATTTCATTA 12 4105 1569854 N/A N/A 12037 12056 TCTGGATCCCTACCATGTAC 52 4106 1569941 N/A N/A 99772 99791 CTGAAGTCCTTATCCCTCTA 42 4107 1570030 N/A N/A 90988 91007 TCGGCTTCTAAAATGGTGCA 30 4108 1570038 N/A N/A 70402 70421 TGTAGGTATATCTAATGATC 29 4109 1570043 N/A N/A 131887 131906 CCACTTGTTGCCCTCTTGCA 67 4110 1570198 N/A N/A 35347 35366 GCTTTCCTCTCAACCATTTC 14 4111 1570256 N/A N/A 27738 27757 GTATGCACACATCTGACTCT 19 4112 1570271 N/A N/A 76044 76063 GTTCTCCCCATCAGTTACTC 63 4113 1570289 N/A N/A 12681 12700 CAGGAATTAGAGTACCAGTA 22 4114 1570311 N/A N/A 27405 27424 AAAGTTCTACATTAAGGTGA 42 4115 1570406 N/A N/A 46545 46564 AGCACGCTCTCTCACACCTC 32 4116 1570605 N/A N/A 110113 110132 CTCACCTTCAATATCCAAGC 40 4117 1570729 N/A N/A 36234 36253 ACACATCTATCTTTGAGGAA 31 4118 1570735 N/A N/A 112013 112032 TTGTTACCAGATCATTTCTA 36 4119 1570799 N/A N/A 18505 18524 ATTCCAATAGAGACCCCTCA 50 4120 1570904 N/A N/A 21052 21071 CTTGCCTTCTACTATGACAT 85 4121

TABLE-US-00066 TABLE 66 Reduction of MSH3 RNA by 5-10-5 MOE modified oligonucleotides with mixed PO/PS internucleoside linkages in A431 cells SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 MSH3 SEQ Compound Start Stop Start Stop (% ID Number Site Site Site Site Sequence (5′ to 3′) UTC) No. 1480790 N/A N/A 35860 35879 TCCGCTTTTTCCTTTAGGGA 2 1008 1566485 N/A N/A 53403 53422 TACCAATGCTTTCACCGTCT 9 4122 1566514 N/A N/A 131856 131875 GCTGTCTTTGTTCTAATTAC 34 4123 1566529 N/A N/A 26057 26076 GCCACTTCTGACAACAGCAA 57 4124 1566554 N/A N/A 77918 77937 GCTGAGATAGCACCTATCTC 58 4125 1566614 N/A N/A 14732 14751 ATGCCATCAAACAGCTTATC 67 4126 1566621 N/A N/A 70292 70311 TGGCTCCCTATGCAGAACAC 55 4127 1566714 N/A N/A 112007 112026 CCAGATCATTTCTACTCTTC 54 4128 1566715 N/A N/A 125789 125808 TGTCTGGTCTTTTTTTGCTC 22 2204 1566750 N/A N/A 8056 8075 ATGGACTATGCATCTCTTAC 24 4129 1566793 N/A N/A 149443 149462 GGTGGCTTTCTTAGTAAGCC 75 4130 1566797 N/A N/A 19314 19333 ATGCTACCTCATCACTCTCT 50 4131 1566800 N/A N/A 22475 22494 TTGAATCCTTAACAATCCCA 37 4132 1566819 N/A N/A 2442 2461 CTGTGTCCCAGAACATGGGC 66 4133 1566848 N/A N/A 213448 213467 GCTCATTTTAGCCCCCATCT 30 4134 1566853 N/A N/A 80446 80465 AGTAGCTTATATATTAAGCT 71 4135 1566858 N/A N/A 30068 30087 TCGCTTAGTCCAATATGCAA 47 4136 1566870 N/A N/A 161290 161309 GCCTATGTGCATATTCTCCC 74 4137 1566890 N/A N/A 12593 12612 CCCCTACCATACTCCAAGCT 60 4138 1566910 3002 3021 202238 202257 TCCCTCTTCCTAGTTCATCC 69 4139 1566914 N/A N/A 167169 167188 CCTTCTTATTGCATAACTCC 37 4140 1566945 N/A N/A 63310 63329 TGGCTCTGCTCACTAGGATC 26 4141 1566963 N/A N/A 41476 41495 CATGTGCATATTTATATAAA 53 4142 41502 41521 1566969 N/A N/A 144453 144472 TGCACTTCACCATAGCAACA 56 4143 1566985 N/A N/A 86577 86596 TACTGCCCAGTTGCCTCCTC 111 4144 1566996 N/A N/A 76037 76056 CCATCAGTTACTCTGTTCCA 60 4145 1567070 N/A N/A 35926 35945 TATTCTTGCTCCTATTCCCA 52 4146 1567119 N/A N/A 177613 177632 ATGAATCCAACAATGTATAA 73 4147 205274 205293 1567207 N/A N/A 180702 180721 ATTTACCATTTTAGCATTTC 25 4148 182450 182469 1567224 N/A N/A 21028 21047 AAAGATGCTTGTTTCCAGCC 44 4149 1567262 N/A N/A 61104 61123 ACCGACTTTAGAAACTCATA 31 4150 1567277 N/A N/A 37551 37570 TGGACTTTATTCCTGTTAAA 5 4151 1567359 N/A N/A 107157 107176 GGGTCATTTCTTATCCCTAC 64 4152 1567372 N/A N/A 93623 93642 GGTTCTCTTCACCATCACAC 19 4153 1567475 N/A N/A 164776 164795 ACTCCATTTATCTCAGCTGC 31 4154 1567491 N/A N/A 183314 183333 TGATCTTTGCATCAAACCCC 53 4155 1567527 N/A N/A 169023 169042 TCATGATTATCCCATCTTGC 74 4156 1567562 N/A N/A 72681 72700 CTGTTTCTATCACAGTCTCC 33 4157 1567595 N/A N/A 40687 40706 TGTGTATGTATATTTATCTA 9 4158 40721 40740 40751 40770 40810 40829 1567600 N/A N/A 27736 27755 ATGCACACATCTGACTCTCA 12 4159 1567641 N/A N/A 18504 18523 TTCCAATAGAGACCCCTCAC 117 4160 1567716 N/A N/A 39243 39262 GATCTTATATTTAATGGCAT 18 4161 1567722 N/A N/A 139837 139856 TGGTGTCTACCCTTTCCAAC 110 4162 1567776 N/A N/A 36970 36989 TGGTATGCCATTCCACATTT 6 4163 1567875 N/A N/A 84957 84976 TCATGGTATATACACAGGAC 12 4164 1567883 3259 3278 221164 221183 CCTTGCTGCAATTCCTCTAG 64 4165 1567917 N/A N/A 36607 36626 TATCACTTCATTTTGGCACC 4 4166 1567919 N/A N/A 117348 117367 GGCTTTGTATCATTTCATCA 11 4167 1567947 N/A N/A 12036 12055 CTGGATCCCTACCATGTACT 60 4168 1567959 N/A N/A 13740 13759 GCTTTCAACTGAAACCTCAA 55 4169 1567985 N/A N/A 126131 126150 GCTTGAGTATCATCTCTGCT 51 4170 1568108 N/A N/A 29037 29056 ATTACCATTTCTAGCAAGCA 10 4171 1568170 N/A N/A 26350 26369 CAGTAGAATAATCATGCCAA 45 4172 1568200 N/A N/A 44241 44260 AGGTTCATCCTTGCTGGCCA 45 4173 1568206 N/A N/A 110091 110110 GTTTGCATACTAACTACCAC 31 4174 1568215 N/A N/A 107912 107931 CTCTGGCTCATACTCTTGCA 57 4175 1568233 N/A N/A 118796 118815 GGACCGTCTTTCCAAGACTT 38 4176 1568274 N/A N/A 95007 95026 TCTTCTTTACCTCATCAGTT 53 4177 1568338  994 1013 20745 20764 TTCAGTTTGCTTCACAACTC 44 4178 1568359 N/A N/A 50869 50888 AGCTGCTTGCCATCATGCGC 63 4179 1568443 N/A N/A 23207 23226 ACTTCATCAGATATCCTTAT 31 4180 1569039 N/A N/A 36220 36239 GAGGAAGCACTTATGTGTTC 21 4181 1569231 N/A N/A 141634 141653 CTGCTATGCTTCACTTCCAA 40 4182 1569238 N/A N/A 82174 82193 TGATGTCTTTCAACTACCAT 90 4183 1569316 N/A N/A 35301 35320 AAGCAACCTTAACTGCAATT 62 4184 1569345 N/A N/A 19686 19705 CATGGCTTAGATATTGCCCA 57 4185 1569525 N/A N/A 122665 122684 TGACCTCCATAATCCATCCA 35 4186 1569601 N/A N/A 27342 27361 GAGATCTCACCTTAGTTGCC 36 4187 1569719 N/A N/A 187914 187933 TCAGGGACCACTCAGTGGTT 126 4188 1569758 N/A N/A 35714 35733 TTCATAGGCCTTCACCCTTT 52 4189 1569996 N/A N/A 25186 25205 CCCAGGTACTGACCAGGCAA 58 4190 1570112 N/A N/A 37117 37136 TTCCTAACACTCCAGTCAAC 79 4191 1570193 N/A N/A 99768 99787 AGTCCTTATCCCTCTACCTC 41 4192 1570538 N/A N/A 23829 23848 AACACTTTGCCACCATGCTT 72 4193 1570569 N/A N/A 90932 90951 GATTCCAGATGATTTCTGCC 41 4194 1570604 N/A N/A 48842 48861 GAAGATCTTTTCTCCACACT 39 4195 1570699 N/A N/A 46544 46563 GCACGCTCTCTCACACCTCC 49 4196 1570717 N/A N/A 102494 102513 TTCCACTACTTGTATCTCTT 39 4197 1570814 N/A N/A 17346 17365 TGCCACTCTGTCACTGCCAA 72 4198