Strain producing allose from fructose and method for producing allose using same

Abstract

The present invention relates to a recombinant strain for producing an allose from a fructose, a composition for producing an allose which produces an allose from a fructose-containing raw material comprising the strain, and a method for preparing an allose using the same.

Claims

1. An enzyme for producing an allose from a fructose comprising a fusion protein in which a psicose epimerase and an allose isomerase are connected by a linker peptide, wherein the psicose epimerase comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 3, and the allose isomerase comprises the amino acid sequence of SEQ ID NO: 4.

2. The enzyme for producing an allose from a fructose of claim 1, wherein the linker peptide consists of 1 to 6 amino acid sequence.

3. The enzyme for producing an allose from a fructose of claim 1, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 23 or 25.

4. The enzyme of claim 1, wherein the enzyme is characterized by producing an allose from a fructose with a conversion rate of 12 to 15%.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows a cleavage map of recombinant vector in which CDPE or TDPE and RPI genes are introduced into pACYCDuet-1 vector according to one example of the present invention.

(2) FIG. 2 shows a cleavage map of recombinant vector in which EDPE and RPI genes are introduced into pACYCDuet-1 vector according to one example of the present invention.

(3) FIG. 3 shows a cleavage map of recombinant vector in which CDPE or TDPE and RPI genes are introduced into RSFDuet-1 vector according to one example of the present invention.

(4) FIG. 4 shows a cleavage map of recombinant vector in which EDPE and RPI genes are introduced into RSFDuet-1 vector according to one example of the present invention.

(5) FIG. 5 is a graph showing the result of cell reaction activity analysis by temperature of RSF_CDPE_RPI strain according to one example of the present invention.

(6) FIG. 6 is a graph showing the result of cell reaction activity analysis by temperature of RSF_TDPE_RPI strain according to one example of the present invention.

(7) FIG. 7 is a graph showing the result of cell reaction activity analysis by temperature of RSF_EDPE_RPI strain according to one example of the present invention.

(8) FIG. 8 is a graph showing the result of cell reaction activity analysis by pH of RSF_CDPE_RPI strain according to one example of the present invention.

(9) FIG. 9 is a graph showing the result of cell reaction activity analysis by pH of RSF_TDPE_RPI strain according to one example of the present invention.

(10) FIG. 10 is a graph showing the result of cell reaction activity analysis by pH of RSF_EDPE_RPI strain according to one example of the present invention.

(11) FIG. 11 is a graph showing the result of analysis of metal ion requirement of enzyme in RSF_CDPE_RPI strain according to one example of the present invention.

(12) FIG. 12 is a graph showing the result of analysis of metal ion requirement of enzyme in RSF_TDPE_RPI strain according to one example of the present invention.

(13) FIG. 13 is a graph showing the result of analysis of metal ion requirement of enzyme in RSF_EDPE_RPI strain according to one example of the present invention.

(14) FIG. 14 is a graph showing the result of analysis of cell reaction thermal stability of RSF_CDPE_RPI strain according to one example of the present invention.

(15) FIG. 15 is a graph showing the result of analysis of cell reaction thermal stability of RSF_TDPE_RPI strain according to one example of the present invention.

(16) FIG. 16 is a graph showing the result of analysis of cell reaction thermal stability of RSF_EDPE_RPI strain according to one example of the present invention.

(17) FIG. 17 is a graph showing the result of allose production from 15% fructose according to one example of the present invention.

(18) FIG. 18 is a graph showing the result of allose production from 50% fructose according to one example of the present invention.

(19) FIG. 19 is a cleavage map of recombinant vector in which CDPE or TDPE and RPI genes are fused into pACYCDuet-1 vector according to one example of the present invention.

(20) FIG. 20 is a photograph confirming the expression of fusion enzyme according to one example of the present invention through SDS-PAGE.

(21) FIG. 21 is a graph showing the result of measuring the allose conversion rate of fusion enzyme according to one example of the present invention.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(22) Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Preparation of Duet Plasmid and Transformation

(23) Plasmids for expressing enzyme for producing a psicose from a fructose, CDPE, EDPE, or TDPE each, in one strain, with RPI enzyme for producing an allose from a psicose was constructed through gene recombination.

(24) Specifically, in order to prepare a vector introducing a sequence encoding RPI, a recombinant vector was prepared by inserting the polynucleotide encoding the amino acid sequence of SEQ ID NO: 4 which was a RPI protein (SEQ ID NO; 11) into a same restriction enzyme site of pACYC (NOVAGEN) or RSF (NOVAGEN) which was an expression vector using NdeI and XhoI(NEB).

(25) Then, to prepare a vector introducing a sequence encoding the psicose epimerase, a sequence encoding psicose epimerase was prepared first.

(26) Specifically, as the polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 derived from Clostridiuim scindens (Gene bank: EDS06411.1), polynucleotide encoding the amino acid sequence of SEQ ID NO: 2 derived from Ensifer adhaerens or polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 derived from Treponema primitia (Gene bank: WP_010256447), to be optimized for E. coli to be used as an expression strain, original nucleotide sequences of encoding polynucleotides (SEQ ID NOs: 5, 7 and 8, respectively) and polynucleotides modified thereof were synthesized by requesting to Bioneer. Co (Korea).

(27) Then, by using restriction enzymes NdeI and XhoI(NEB), the synthesized polynucleotides encoding each psicose epimerase was inserted into same restriction site of pACYC(NOVAGEN) or RSF(NOVAGEN) which was an expressing vector in which RPI gene was inserted, and TDPE, CDPE, EDPE were respectively inserted into the prepared recombinant vector comprising RPI, to make two genes (RPI enzyme gene and psicose epimerase gene) be inserted into one vector. The restriction enzymes were shown in the following Table 6.

(28) TABLE-US-00006 TABLE6 SEQ Nucleotide Restriciton IDNO PrimerName Sequence(5.fwdarw.3) Enzyme 11 CDPE_F_BamHI(Duet) CGATCGGATCCGATGAAACACG BamHI GTATCTACTAC 12 CDPE_R_HindIII(Duet) GCGACCAAGCTTTTATTTCCATT HindIII CCAGCATG 13 EDPE_F_BamHI(Duet) CGATCGGATCCGATGCAGGGTTT BamHI TGGCGTC 14 EDPE_R_NotI(Duet) GCGACCGCGGCCGCTTAGATCA NotI ATCCGTATTGCCG 15 TDPE_F_BamHI(Duet) CGATCGGATCCGATGCAGTACG BamHI GTATCTAC 16 TDPE_R_HindIII(Duet) GCGACCAAGCTTTTACAGAACA HindIII GAGGTAGAACC 17 RPI_F_NdeI(Duet) GCGTTGCATATGAAAATCTCTAT NdeI CGGTTCTG 18 RPI_R_XhoI(Duet) GGCAGGCTCGAGTTACAGGTTG XhoI ATTTTTTCGATG 19 CDPE_F_NcoI(Duet) CGCAAGCCATGGGCATGAAACA NcoI CGGTATCTACTAC 20 EDPE_F_NcoI(Duet) CGCAAGCCATGGGCATGCAGGG NcoI TTTTGGCGTC 21 TDPE_F_NcoI(Duet) CGCAAGCCATGGGCATGCAGTA NcoI CGGTATCTAC

(29) Then, a recombinant E. coli strain was prepared by transforming E. coli BL21(DE3) (invitrogen) with the constructed each recombinant vector by the heat shock method (Sambrook and Russell: Molecular Cloning.).

(30) After inoculating the prepared recombinant E. coli strain into 5 ml LB-ampicilline medium (Difco), it was shaking cultured at 37 C., 200 rpm until the absorbance (OD) at 600 nm reached 1.5, and after inoculating it into 500 ml LB-ampicilline medium again, it was seed cultured in a shaking incubator of 37 C. Then, when the absorbance at 600 nm of culture solution was 0.5, 1 mM of IPTG (isopropyl-1-thio--D-galactopyranoside) was added, to induce overexpression of target enzyme. The culture condition was converted to 16 C. and 150 rpm from the overexpression induction time and maintained for 16 hours.

Example 2. Establishment of Reaction Condition of Allose Producing Strain

(31) 2-1. Analysis of Cell Reaction Activity by Temperature

(32) To confirm the optimum temperature for producing an allose, reaction was done for 2 hours under 60 C., in 5 mg/ml_DCW range of microbial cell concentration of strain isolated in Example 2, in a 10% (v/v) fructose 1 ml, 50 mM PIPES buffer (pH 7.0) solution, and after finishing (stopping) the reaction by heating to stop the substrate reaction, the temperature showing the maximum activity was measured. Then, the allose conversion rate from a fructose for 2 hours was measured, thereby showing the relative value of allose conversion rate at each temperature (RA (%) that is Y axis value of figure) when the allose conversion rate at the optimum temperature was taken as 100%. The result was shown in the following Table 7 and FIGS. 5 to 7.
Conversion rate (%)=(production/amount of substrate added)*100
Amount of substrate added=residual fructose+amount of psicose remained+allose production[Formula]

(33) TABLE-US-00007 TABLE 7 Classi- fication Conversion rate (%) Temperature RSF_CDPE_RPI RSF_TDPE_RPI RSF_EDPE_RPI ( C.) (his tag X) (his tag X) (his tag X) 40 5.46 6.39 6.84 45 8.50 7.27 7.32 50 8.51 8.12 7.81 55 8.17 8.57 7.28 60 7.90 3.99 4.94 70 8.04 2.68 3.71

(34) As shown in the Table 7 and FIGS. 5 to 7, it could be confirmed that RSF_TDPE_RPI (FIG. 5) exhibited the optimum activity at 55 C. and RSF_CDPE_RPI (FIG. 6) and RSF_EDPE_RPI (FIG. 7) exhibited the optimum activity at 50 C.

(35) 2-2. Analysis of Cell Reaction Activity by pH

(36) To confirm the cell reaction activity by pH, reaction was done for 2 hours at 50 C. under each pH condition using 5 mg/ml_DCW of microbial cell concentration of strain isolated in Example 1 and fructose concentration 10% (v/v) buffer solution, 50 mM sodium citrate (pH 4 to 5), 50 mM sodium phosphate (pH 6 to 8), 50 mM glycine NaOH (pH 9 to 10), respectively, and after finishing (stopping) the reaction by heating to stop the substrate reaction, the pH showing the maximum activity was measured. Then, the allose conversion rate from a fructose for 2 hours was measured, thereby showing the relative value of allose conversion rate at each pH (RA (%) that is Y axis value of figure) when the allose conversion rate at the optimum pH was taken as 100%. The result was shown in the following Table 8 and FIGS. 8 to 10.
Conversion rate (%)=(Production/amount of substrate added)*100
Amount of substrate added=residual fructose+amount of psicose remained+allose production[Formula]

(37) TABLE-US-00008 TABLE 8 Converstion rate (%) Classification RSF_CDPE_RPI RSF_TDPE_RPI RSF_EDPE_RPI Buffer pH (his tag X) (his tag X) (his tag X) Sodium citrate 5 0.4 0 0 6 6.5 8.8 8.3 Sodium 6 4.1 5.9 6.8 Phosphate 7 6.6 10.0 9.1 8 7.4 8.9 9.6 Glycine- 9 4.4 5.2 6.5 NaOH 10 2.8 1.3 2.7

(38) As shown in the Table 8 and FIGS. 8 to 10, RSF_TDPE_RPI exhibited the optimum activity at pH 7.0 (FIG. 8), and RSF_CDPE_RPI (FIG. 9) and RSF_EDPE_RPI (FIG. 10) exhibited the optimum activity at pH 8.0.

(39) 2-3. Analysis of Metal Ion Requirement of Enzyme

(40) To confirm the metal ion requirement, reaction was done for 2 hours using 1 mM metal ion (CuCl.sub.2, MnCl.sub.2, FeSO.sub.4, ZnSO.sub.4, NiSO.sub.4, or CoCl.sub.2) solution dissolved in 50 mM PIPES buffer solution (pH 7.0 or 8.0, performing at the optimum pH of each enzyme), at 5 mg/ml_DCW of microbial cell concentration of strain isolated in Example 2 and 50 C., respectively, and after finishing (stopping) the reaction by heating for 5 minutes to stop the substrate reaction, the allose production was measured through HPLC analysis by the same method as the Example 3-1. That was treated with no metal ion was used as a control group (Non).

(41) The result was shown in the following Table 9 and FIGS. 11 to 13.

(42) TABLE-US-00009 TABLE 9 RSF_CDPE_RPI RSF_TDPE_RPI RSF_EDPE_RPI (his tag X) (his tag X) (his tag X) Conversion Conversion RA Conversion RA rate (%) RA (%) rate (%) (%) rate (%) (%) Cu 0 0 1.5 18 1.7 18 Mn 4.7 72 6.8 81 8.2 90 Ni 4.3 66 7.1 85 7.5 83 Fe 6.5 100 8.1 97 9.1 100 Co 4.9 76 8.3 98 7.6 84 Zn 0 0 1.9 22 1.2 14 Non 5.8 90 8.4 100 8.6 95

(43) As shown in the Table 9 and FIGS. 11 to 13, it was confirmed that in case of CDPE_RPI, the activity was slightly increased by Fe ion (FIG. 11), but all three enzymes did not exhibit the result considerably depending on the metal ion (FIGS. 11 to 13).

(44) In other words, it was confirmed that the activity, conversion rate, thermal stability, etc. were significantly degraded when conventional CDPE, TDPE, EDPE were expressed alone without a metal, but when two enzymes were expressed in one vector at the same time, the conversion reaction was occurred without a metal ion different from conventional each enzyme.

(45) 2-4. Analysis of Thermal Stability of Cell Reaction

(46) To confirm the thermal stability of cell reaction, after adding heat to the enzyme at 40 to 50 C. for 24 hours, the strain to which the thermal shock was applied was used for reaction.

(47) Specifically, reaction was done for 2 hours using 50 mM PIPES buffer solution (pH 7.0 or 8.0, performing at the optimum pH of each enzyme), at 5 mg/ml_DCW of microbial cell concentration of strain to which the thermal shock was added and 50 C., respectively, and after finishing (stopping) the reaction by heating for 5 minutes to stop the substrate reaction. The allose conversion rate was measured by the following formula. The result was shown in the following Table 10 (40 C.) and Table 11 (50 C.), and the conversion rate converted into a log value was shown in FIGS. 14 to 16.
Conversion rate (%)=(Production/amount of substrate added)*100
Amount of substrate added=residual fructose+amount of psicose remained+allose production[Formula]

(48) TABLE-US-00010 TABLE 10 Conversion rate (%) 40 C. RSF_CDPE_RPI RSF_TDPE_RPI RSF_EDPE_RPI Time (h) (his tag X) (his tag X) (his tag X) 0 5.4 5.4 5.7 2 5.8 6.4 6.0 4 5.2 4.4 5.7 6 5.3 3.9 6.2 20 5.5 5.5 5.6

(49) TABLE-US-00011 TABLE 11 Conversion rate (%) 50 C. RSF_CDPE_RPI RSF_TDPE_RPI RSF_EDPE_RPI Time (h) (his tag X) (his tag X) (his tag X) 0 5.4 5.4 4.7 2 6.1 5.0 4.0 4 4.4 2.8 3.5 6 4.0 2.3 3.0 8 2.0 1.0 1.5 20 0 0 0

(50) As shown in the Tables 10 to 11 and FIGS. 14 to 16, it was confirmed that the enzyme bore a certain degree of heat for 20 hours or more at 40 C., but when compared to the half-life at each temperature, the activity was decreased by half when heat shock was applied for 3 hours at 50 C.

Example 3. Allose Production

(51) 3-1. Allose Production Reaction from 15% (v/v) Fructose

(52) To confirm the allose production from a fructose, the allose conversion rate was measured through the following formula by sampling by time as reacting for 0 to 20 hours at 50 C. temperature in 5 mg/ml_DCW range of microbial cell concentration of strais isolated from Example 2, in 15% (v/v) fructose 1 ml as a substrate and 50 mM PIPES buffer solution (pH 7.0 or 8.0, performing at the optimum pH of each enzyme). The result was shown in Table 12 and FIG. 17.
Conversion rate (%)=(Production/amount of substrate added)*100
Amount of substrate added=residual fructose+amount of psicose remained+allose production[Formula]

(53) TABLE-US-00012 TABLE 12 Allose conversion Psicose conversion Enzyme rate (%) Rate (%) RSF_CDPE_RPI (Histag x) 11.3 24.9 RSF_TDPE_RPI (Histag x) 12.0 25.3 RSF_EDPE_RPI (Histag x) 12.6 25.3 RSF_CDPE_RPI (Histag ) 13.0 24.8 RSF_TDPE_RPI (Histag ) 11.5 25.3 RSF_EDPE_RPI (Histag ) 12.9 24.9 ACYC_CDPE_RPI (Histag x) 11.8 25.9 ACYC_TDPE_RPI (Histag x) 12.8 25.7 ACYC_TDPE_RPI (Histag x) 13.6 25.9 ACYC_CDPE_RPI (Histag ) 13.4 24.7 ACYC_TDPE_RPI (Histag ) 13.1 25.9 ACYC_EDPE_RPI (Histag ) 12.8 26.0

(54) As shown in the Table 12, as the result of analysis of 12 enzymes reaction conversion, it could be confirmed that the allose was produced from the fructose averagely with approximately 13% of conversion rate, even though there was slight difference between enzymes.

(55) 3-2. Allose Production Reaction from 50% (v/v) Fructose

(56) To confirm the allose production from a fructose, the allose conversion rate was measured by sampling by time as reacting for 0 to 20 hours at 50 C. in 5 mg/ml_DCW range of microbial cell concentration of strais isolated from Example 2, in 50% (v/v) fructose 1 ml as a substrate and 50 mM PIPES buffer solution (pH 7.0 or 8.0, performing at the optimum pH of each enzyme). The result was shown in Table 13 and FIG. 18.

(57) TABLE-US-00013 TABLE 13 Allose conversion Psicose conversion Enzyme rate (%) rate (%) RSF_TDPE_RPI (Histag x) 10.3 25.6 RSF_CDPE_RPI (Histag ) 13.1 25.1 RSF_EDPE_RPI (Histag ) 11.4 25.4 ACYC_CDPE_RPI (Histag x) 13.3 26.5 ACYC_TDPE_RPI (Histag x) 13.0 25.3 ACYC_TDPE_RPI (Histag x) 13.9 25.6 ACYC_CDPE_RPI (Histag ) 12.7 25.6 ACYC_TDPE_RPI (Histag ) 11.8 26.0 ACYC_EDPE_RPI (Histag ) 13.2 26.0

(58) As can be seen in the Table 13, as the result of analysis of 12 enzymes reaction conversion, it could be confirmed that the allose was produced from the fructose averagely with approximately 13% of conversion rate, even though there was slight difference between enzymes.

Example 4. Preparation of Fusion Enzyme Plasmid and Transformation

(59) The encoding gene of psicose epimerase derived from Ensifer adhaerens was synthesized as a form of polynucleotide modified by optimizing for E. coli (SEQ ID NO: 6) and designated as EDPE. The encoding genes of PRI secured in gDNA of Persephonella marina EX-H1, the polynucleotide optimized for E. coli (SEQ ID NO: 10) were secured as each template through PCR, and they were linked as one template by an overlap PCR method (SEQ ID NO: 22).

(60) A recombinant vector was prepared by inserting the polynucleotide linked as one template into the same restriction site of pET21a which was an expression vector using restriction enzymes NdeI and XhoI. The cleavage map of prepared recombinant vector was described in FIG. 19.

(61) Then, a recombinant strain was prepared by transforming E. coli BL21(DE3) (invitrogen) with the constructed each recombinant vector by the heat shock method (Sambrook and Russell: Molecular Cloning.).

(62) After inoculating the prepared recombinant strain into 5 ml LB-ampicilline medium (Difco), it was shaking cultured at 37 C., 200 rpm until the absorbance (OD) at 600 nm reached 1.5, and after inoculating it into 500 ml LB-ampicilline medium again, it was seed cultured in a shaking incubator of 37 C. Then, when the absorbance at 600 nm of culture solution was 0.5, 1 mM of IPTG (isopropyl-1-thio--D-galactopyranoside) was added, to induce overexpression of target enzyme. The culture condition was converted to 16 C. and 150 rpm from the overexpression induction time and maintained for 16 hours. After that, only microbial cells were recovered by centrifugation at 8000 rpm for 20 minutes, and washed twice with 0.85% (w/v) NaCl, and then used for allose production and enzyme purification.

Example 5. Allose Production Reaction Using Fusion Enzyme (Enzyme Reaction)

(63) 5-1: Purification of Fusion Enzyme

(64) After suspending the microbial cells recovered in the Example 4 into a lysis buffer (50 mM Tris-HCl, pH 7.0 300 mM NaCl), they were lysated at 4 C. for 20 minutes using a ultrasonic processor (ColepParmer). The lysated solution was centrifuged at 13,000 rpm and 4 C. for 20 minutes to recover the supernatant, and applied for Ni-NTA column equilibrated with a lysis buffer in advance (Ni-NTA Superflow, Qiagen), and then a buffer solution in which 20 mM imidazol and 250 mM imidazol were contained in 50 mM Tris-HCl 300 mM NaCl, pH 7.0 was flowed sequentially. The eluted target protein was converted with a buffer solution for measuring the enzyme activity (50 mM Tris-HCl, pH7.0) and used for the next experiment. The partially purified enzyme could be obtained by the method, and it was confirmed that the size of monomer was about 47 kDa by SDS-PAGE (FIG. 20).

(65) 5-2: Allose Production from Fructose

(66) To confirm the allose production from a fructose, the allose conversion rate was measured by sampling by time as reacting for 24 hours at 50 C. in 1.0 mg/ml range of concentration of enzyme purified in Example 6, in 50% (v/v) fructose 1 ml as a substrate and 50 mM PIPES buffer (pH 7.0 or 8.0, performing at the optimum pH of each enzyme). The result was shown in Table 14 and FIG. 21.

(67) TABLE-US-00014 TABLE 14 Hours EDPE_RPI (%) CDPE_RPI (%) 3 7.2 7.8 8 11.7 11.3 24 13.4 13.1

(68) As can be seen in the Table 14 and FIG. 20, as the result of analysis of reaction of two enzymes, it was confirmed that the allose was produced with about 13.4% in case of EDPE_RPI_FUSION and with about 13.1% in case of CDPE_RPI_FUSION. In other words, it was confirmed that the expression rate of fusion enzyme was decreased, but the conversion rate reached a similar equilibrium value of 13%, when two enzymes were expressed respectively and reacted.