Targeted transposition for use in epigenetic studies
10689643 ยท 2020-06-23
Assignee
Inventors
- Mary Anne JELINEK (Carlsbad, CA, US)
- Brian Stanley EGAN (Carlsbad, CA, US)
- Joseph Fernandez (Carlsbad, CA)
Cpc classification
C12Q2522/101
CHEMISTRY; METALLURGY
C12N15/1065
CHEMISTRY; METALLURGY
C12N15/1006
CHEMISTRY; METALLURGY
C12N15/1034
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12N15/1065
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12Q2522/101
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C07H21/00
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are compositions, methods and kits useful for epigenetic analysis based on the use of transposons that are targeted to specific regions of chromatin based on DNA-DNA interactions, protein-protein interactions, RNA-RNA interactions, and nucleic acid-protein interactions.
Claims
1. A method of making a nucleic acid sequence library comprising: a. extracting chromatin from cells to provide a sample containing chromatin; b. adding to said sample containing chromatin at least one assembled conjugate comprising a targeting protein covalently conjugated to a stable transposase:transposon complex containing a transposase complexed with a transposon cassette, wherein: (i) the targeting protein binds a target protein or a target DNA-binding site; and (ii) the transposon cassette comprises: (1) transposase recognition sequences required for catalysis of a DNA integration reaction; (2) one or more oligonucleotide bar code sequences to uniquely identify the conjugated protein; and (3) primer sites for DNA amplification; c. allowing said at least one conjugate to locate at its/their target proteins and/or target DNA-binding sites in said chromatin; d. tagging nucleic acid in said chromatin with said conjugate by inducing an intermolecular reaction between said transposase recognition sequences and said nucleic acid; and e. performing PCR amplification of the tagged nucleic acid using the primer sites.
2. The method of claim 1, wherein (a) comprises cross-linking said chromatin.
3. The method of claim 2 further comprising removing the cross-links after said tagging.
4. The method of claim 1, wherein the chromatin in said provided sample is fragmented.
5. The method of claim 1, wherein (a) comprises cross-linking and fragmenting said chromatin.
6. The method of claim 1, wherein the targeting protein binds a target protein.
7. The method of claim 1, wherein the targeting protein binds a target DNA-binding site.
8. The method of claim 1, wherein the targeting protein comprises a domain selected from bZIP domain, DNA-binding domain, helix-loop-helix, helix-turn-helix, MG-box, leucine zipper, lexitropsin, nucleic acid simulations, zinc finger, histone methylases, recruitment proteins, Swi6, chromodomain, chromoshadow domain, bromodomain, a methyl binding domain and PHD-finger.
9. The method of claim 1, wherein the targeting protein comprises an antibody.
10. The method of claim 9, wherein the targeting protein is an antibody and the target protein is a histone or a polymerase.
11. The method of claim 1, wherein the transposon recognition sequences comprise Tn5 transposase DNA recognition sequences.
12. The method of claim 1, wherein the oligonucleotide bar code sequences are fewer than 20 bases.
13. The method of claim 1, wherein the transposon cassette further comprises platform-specific tags required for next generation sequencing (NGS).
14. The method of claim 1, wherein the transposon cassette comprises an Epicentre EZ-Tn5 Transposome.
15. The method of claim 1, wherein the transposase:transposon complex further comprises an extraction moiety.
16. The method of claim 15 wherein the extraction moiety is biotin, avidin or streptavidin.
17. The method of claim 1, wherein the intermolecular reaction is activated by the addition of a cofactor.
18. The method of claim 17, wherein the cofactor is Mg2+.
19. The method of claim 1, further comprising: f. sequencing said amplified DNA.
20. The method of claim 1, comprising adding to said provided sample containing chromatin a plurality of the complexes, wherein each complex comprises a targeting protein that targets a different target protein or target DNA binding site and each complex comprises a different bar code sequence to uniquely identify the targeting protein of the complex.
21. The method of claim 20, further comprising: f. sequencing said amplified DNA; and g. using the bar code sequences for the identification of the covalently conjugated targeting protein.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(43) The disclosure herein provides methods of tagging and isolating DNA or other nucleic acids that are associated with a protein or proteins of interest. Generally the methods comprise first preparing complexes of oligonucleotide tag(s) or barcode(s) with antibody(ies) that recognize protein(s) of interest in chromatin or that are otherwise associated with nucleic acids. The tagged oligonucleotide complexes may further comprise an extraction moiety, such as a biotin molecule (or other member of a high affinity binding pair), that can be used to extract or isolate the tagged nucleic acid. A binding partner or member of a high affinity binding pair (i.e., a pair of molecules wherein one of the molecules binds to the second molecule with high affinity (e.g., biotin and avidin (or streptavidin), carbohydrates and lectins, effector and receptor molecules, cofactors and enzymes, enzyme inhibitors and enzymes, and the like).
(44) Next, when the complexes are added to the nucleic acids, the antibody(ies) recognize or bind to the protein(s) of interest that are associated with the nucleic acids. Using a variety of intermolecular reactions, the nucleic acid proximate those proteins is tagged with the complex. Thus, the proximate nucleic acid is tagged with one or more oligonucleotide bar code(s) and, optionally, a moiety that allows for purification or isolation.
(45) One embodiment of the invention, termed Transposase-Assisted Multi-analyte Chromatin ImmunoPrecipitation or TAM-ChIP, is a unique method that significantly improves ChIP, the principle technique currently used to study how histone post-translational modifications and the proteins which they recruit regulate gene expression. Traditional ChIP is a cumbersome multiday, multistep procedure that requires large numbers of cells, ultra-high affinity antibodies for the immunocapture of large protein-chromatin complexes, and is limited to the analysis of a single protein species per sample.
(46) Briefly, conventional ChIP methods involve the crosslinking of DNA and protein in live cells, isolation of crosslinked material, shearing of DNA (still bound, through crosslinking, to protein), immunoprecipitation of the crosslinked DNA-protein complexes via antibody-binding of the protein of interest (still bound to DNA), reverse-crosslinking of DNA and proteins, and the detection or sequencing of DNA molecules that were crosslinked to the immunoprecipitated DNA-protein complexes, allowing the generation of specific, DNA sequence context data (
(47) In contrast, TAM-ChIP (
(48) TABLE-US-00001 TABLE 1 ChIP-Seq TAM CHIP-Seq Reagents Reagents Steps needed Time Steps needed Time Cell fixation 4 2 30 4 2 30 Chromatin 5 2 30 1 1 5 preparation Shearing 6 0 20 0 0 0 ChIP reaction 40 20 48 hours 6 6 6 hours Libraries 12 19 8 hours 3 3 1 hour 67 43 3-4 14 12 1 steps reagents work days steps reagents work day
(49) TAM-ChIP enables rapid (<24 hour elapsed time) and streamlined analysis of one or several protein-chromatin interactions for analysis of a single gene all the way through to genome-wide interrogation. To achieve this, proteins, such antibodies specific for the protein(s) of interest, transcription factors, or chromodomains, such as in HP1 and Polycomb proteins are first conjugated to a transposase:transposon complex (Transposome) charged with synthetic oligonucleotide(s) that comprise a transposon cassette containing the following features: Transposase recognition sequences required by the for catalysis of the DNA integration reaction; a biotin (or other) molecule conjugated to an oligonucleotide, preferably at one end, to facilitate purification of targeted DNA with streptavidin magnetic beads (or other suitable support conjugated to the other member of the selected high affinity binding pair); unique bar code sequences (i.e., short nucleotide sequences, i.e., from 1-1,000 bases, preferably 1-50 bases, preferably fewer than 20, even more preferably fewer than 10 bases) that uniquely label an oligonucleotide species so that it can be distinguished from other oligonucleotide species in the reaction, and which correspond to a particular antibody) for antibody identification in multi-analyte applications in which multiple antibodies are used simultaneously with the same sample material; for whole genome sequencing applications, platform-specific tags required for next generation sequencing (NGS).
(50) In some aspects, rather than using a protein conjugated to a Transposome, the synthetic oligonucleotide described above will also contain sequences that are able to bind to non-coding RNA, such sequences may include locked nucleic acids (LNA).
(51) In still other aspects, rather than using a protein conjugated to a Transposome, the Transposome with synthetic oligonucleotide will be conjugated to a molecule that recognizes G-quadruplex structures, such as small molecules and/or peptide nucleic acids (PNA). DNA-PNA chimeric oligomers can be synthesized using techniques known in the art [42].
(52) The antibody-transposase conjugates are incubated with chromatin fragments extracted from isolated cells, tissue, or whole organs (or other cell-containing biological samples) to allow specific antibody-protein binding. The transposase is subsequently activated by addition of a cofactor, e.g., Mg.sup.2+, after sample dilution to prevent inter-molecular events. Transposase activation results in insertion of the two transposase-associated oligonucleotides into the chromatin in proximity to the region where the antibody-associated DNA fragment bound, thereby producing analysis-ready templates following a deproteination step and capture of biotin-tagged DNA fragments using streptavidin-coated magnetic beads.
(53) Leveraging Tn5 Transposase for Improving ChIP
(54) Transposable elements are discrete DNA segments that can repeatedly insert into a few or many sites in a host genome. Transposition occurs without need for extensive DNA sequence homology or host gene functions required in classical homologous recombination [15]. Consequently, transposable elements have proven to be superb tools for molecular genetics and have been used extensively in vivo to link sequence information to gene function. More recently, in vitro applications have also been developed, specifically for Tn5, a class II cut and paste transposable element isolated from gram negative bacteria [16]. Catalysis involves nicking of DNA to generate nucleophilic 3 OH groups on both strands at the ends of the 19 bp Tn5 transposase DNA recognition sequence. The 5 ends are also cleaved within the synaptic complex, releasing the transposable element from the donor DNA (
(55) Transposases are not conventional enzymes in the classical sense, in that there is no turn-over. Spontaneous product release is not required and consequently the transposase is required in stoichiometric quantities [15].
(56) Tn5-mediated transposition is random, causing a small 9 bp duplication of the target sequence immediately adjacent to the insertion site (
(57) As described above and depicted in
(58) As described herein, the transposon is loaded with oligonucleotides containing both the transpose recognition sequences and sequences for sequencing on the Illumina platform. This enzyme-DNA complex (
(59) Applicants investigated two forms of the Tn5 enzyme for testing in TAM-ChIP. One form of the enzyme was the same as that sold in the Nextera kit (Tn5) while the second (TS-Tn5) was a temperature stable variant under development by Illumina. Applicants initially determined the compatibility of chromatin extraction buffers with the transposase enzymes and established that chromatin was recognized as a Tn5 transposase substrate.
(60) Also disclosed herein is the surprising discovery that sheering of chromatin by sonication to achieve smaller, soluble fragments is not necessary in TAM-ChIP. This unexpected result will further reduce technical barriers and equipment needs required for ChIP and other related techniques using the assisted transposon technology described herein.
(61) The direct insertion of the oligonucleotide duplex in the transposon cassette by the transposase eliminates the need for immunoprecipitation, thereby reducing the input DNA requirement. It can also eliminate the need for ultra-high affinity antibodies, thereby expanding the application of the ChIP technique to a broader range of cellular targets which were previously excluded due to the lack of suitable antibodies. The inclusion of barcode sequences in the oligonucleotides allows for the identification of the corresponding immunoprecipitating antibody, and is the basis of the multi-analyte potential of TAM-ChIP, which for the first time enables simultaneous use of multiple antibodies in the same sample and experiment. This innovation also has the benefits of further reducing sample size requirements and enables elucidation of protein co-association in sequence-specific contexts throughout the genome.
(62) The construction of a functional antibody-transposome complex can be based on a primary conjugation scheme or secondary conjugation scheme as depicted in
(63) The functionality of this conjugate was tested in ChIP to confirm that the addition of oligonucleotides did not interfere with its ability to interact with rabbit primary antibodies. A two to three fold reduction was observed with the conjugate but was deemed not significant.
(64) The ability of the antibody-tethered oligonucleotides to form a functional transposome was also determined. Activity was first tested at 55 C. for 30 min, the standard temperature for the Tn5 transposase, and also for longer durations at 37 C. (
(65) Data disclosed herein shows that the antibody-transposome construct could be directed to chromatin in a specific manner through a primary antibody that binds trimethyl-lysine at residue 4 of Histone H3 (H3K4me3), a post translation modification found in the promoter regions of transcriptionally active genes.
(66) Next generation sequencing data from normal ChIP and from TAM-ChIP was found to be nearly identical as shown in
(67) As stated above, transposon targeting can be achieved utilizing not only antibody-transposon targeting, but also targeting via protein-protein and/or protein-DNA interactions in which the transposon is conjugated to a protein that would target a protein-binding partner or protein-binding domain on the chromosome. Examples of such proteins include, without limitation, methyl-binding proteins, proteins containing the following domains: bZIP domain, DNA-binding domain, helix-loop-helix, helix-turn-helix, MG-box, leucine zipper, lexitropsin, nucleic acid simulations, zinc finger, histone methylases, recruitment proteins, Swi6. For example, conjugating a transposon onto MBD2, a protein that binds to the methyl group in DNA, would enable tagging chromatin DNA with the specific DNA code of the transposon where MBD2 binds-all methylated CpG binding sites (see Example 14). Similarly, binding domains, such as chromodomains [41], can be cloned into vectors and expressed in the appropriate cells to create GST-fusions proteins, which after purification can be conjugated to the Transposome using the methods described herein or known in the art. These complexes could then be isolated using a GST-binding resin. For example, using chromodomains from MPP8, CBX2, CBX7, ADD from ATRX and PWWP domain from DNMT3a would enable binding to H3K9me3, H3k27me3, H3K27me3, H3K9me3, and H3K36me3, respectively.
(68) Transposon targeting can also be based on RNA-protein interactions, RNA-DNA interactions. For example, the TAM-CHIP methods described herein can be modified to work with Chirp and CHART. Given the similarities to ChIP it is possible to modify the TAM-ChIP protocol to work in Chirp and CHART procedures. The advantage of this approach would be in the simplification of the Chirp and CHART protocol since library generation occurs automatically using the transposase-targeted approach. A basic outline of how this would be achieved is listed below. 1. A series of modified (biotin, streptavidin or other attachment chemistry) oligonucleotides are designed to hybridize to the ncRNA of interest. 2. Formaldehyde fixed chromatin is prepared (similar to what is done for ChIP). 3. Oligonucleotides are hybridized to the native target within the chromatin prep. 4. Transposase enzymes preloaded with a sequencing library compatible transposon (similar to TAM-ChIP approach) and modified with a complimentary attachment chemistry are added to the material generated from Step 3 (above). These enzymes will bind to the complimentary chemistry on the hybridized oligos resulting in the intended targeting of the transposon to the sites of interest. 5. Following washing, magnesium is added to activate the transposase resulting in the integration of library adaptors to the sites of interest. 6. PCR amplification results in sequence-ready libraries 7. DNA is sequenced using Next-Gen sequencing platforms such as Illumina resulting in the genome-wide identification ncRNA interaction sites. 8. As an alternative to steps 3 and 4, the biotinylated or otherwise chemically modified oligos could be preincubated with the streptavidin or otherwise chemically modified transposase complex. This entire complex could then be hybridized to the chromatin sample.
Methods and Representative Examples
(69) Preferred methods, materials, and conditions for carrying out some preferred, non-limiting, representative embodiments of the invention are described below. Those of ordinary skill in the art will readily appreciate that the invention can be practiced in a number of additional embodiments using equivalent alternate techniques and materials.
Example 1
TAM-ChIP
Preliminary Data
(70) In order to improve the turnaround-time of conventional ChIP-Seq services, Epicentre's Nextera DNA Sample Prep kit, which uses the EZ-Tn5 Transposome and suppression PCR to generate NGS compatible libraries, was evaluated for suitability for use with ChIP-enriched DNA. ChIP was performed in duplicate using p53 antibodies and 30 g chromatin extracted from estrogen stimulated MCF-7 cells (a human breast cancer cell line) following established protocols, and isolated DNA was then purified. Quantitative PCR was performed on known p53 binding sites to validate the specificity of the anti-p53 ChIP reactions (
(71) The Nextera transposition reaction was performed using two quantities of ChIP DNA (
(72) These data demonstrate the suitability of EZ-Tn5 for use with fragmented DNA substrates, and that the p53 binding sites detected in traditional ChIP are preserved and quantifiable in Nextera-generated libraries. Interestingly, a higher amount of DNA was generated in the Nextera reaction with the smaller amount of DNA isolated by ChIP, suggesting that the transposition efficiency was higher and that less input chromatin may be required for ChIP experiments when EZ-Tn5 is incorporated into the methodology.
(73) For the methods described below, the EZ-Tn5 transposome is purchased from Epicentre Biotechnology (Madison, Wis., USA) and ChIP-IT Express reagents and protocols are used (Active Motif, Carlsbad, Calif., USA) as the ChIP reagents throughout this example. The end result is an optimized method for the ChIP-validated antibody-transposome conjugates.
(74) The methods below are performed in human Hela cell lines, which are easily cultured in vitro to produce the necessary quantities of genomic DNA (gDNA) or chromatin required for the experiments described below. While many epigenetic research tools and consumables target researchers using vertebrate animal model systems, largely because this segment is the largest in the epigenetic research tools market, the principle epigenetic mechanisms are conserved throughout vertebrates (including the primary amino acid sequence of histones and the repertoire of post-translational modifications), although those skilled in the art will be able to adapt the reagents and methods of this invention for use with other organisms. Another compelling reason for the use of mammalian cells for the TAM-ChIP technology stems from the complexity of the genome. ChIP is far more challenging in mammalian cells, where genes represent only 1-1.5% of the genome, than in lower eukaryotes where genes represent a much large fraction of the total genome (compare with 70% in S. Cerevisiae).
(75) TABLE-US-00002 TABLE 2 Candidate HeLA genomic loci for qPCR analysis of transposition efficiency Transcriptionally Active GAPDH HOX10 EEF1A1 TUB1C LDHA RASSF 1A ACTB PPIB PABPC1 RPS18 Transcriptionally Repressed PTGER3 HOXD13 HBB Untr12 NGB CFDP1 Sat2A MyoD PAX2 MYT1
Analytic Methods
(76) The majority of the experiments described below require determination of transposition efficiency, and evaluation of the distribution (both abundance and range) of DNA fragments generated as a consequence of transposition. Transposition efficiency can be determined using any suitable technique, for example, by quantitative real-time PCR using a StepOnePlus RT-PCR thermocycler (Applied Biosystems) and primers complimentary to a panel of genomic loci known to be either transcriptionally active or repressed in Hela cells (Table 2, above) [25]. Transposition results in the insertion the biotin-tagged transposon oligonucleotide into the target DNA, enabling isolation of transposon-tagged DNA fragments with streptavidin-coated magnetic beads and subsequent quantitation in triplicate by real time PCR. A five-fold dilution series of fragmented Hela genomic DNA can be used as standards to generate a quantitation curve. Identical locus-specific PCR primer sets are used for both samples and standards, and transposition efficiency will be calculated as the median of the DNA recovered for all loci. The generation of tagged fragments less than about 200 bp is particularly preferred to achieve the necessary resolution of sequence reads in NGS applications. Evaluation of the abundance and range of transposon tagged-DNA fragment sizes produced by transposition events requires, for example, an Agilent 2100 Bioanalyzer, which employs a microfluidics system for electrophoretic determination of size and quantity of DNA fragments in sample volumes of 1-4 l.
Example 2
Antibody-Transposase Conjugates
(77) TAM-ChIP requires that the enzymatic activity of the transposase preferably be unaltered, with regards to catalytic rate and randomness of integration sites, when coupled to another protein. Conjugations with various chemistries and crosslinkers of varying length are compared using ChIP validated antibodies. This example generates functional antibody-transposome conjugates.
(78) An extensive number of ChIP-validated antibodies are commercially available or can be developed using conventional antibody production techniques. Here, antibodies to a chromatin associated protein (RNA polymerase II) and a structural chromatin protein, a histone (anti-histone H3 trimethyl-lysine 4 (H3K4tm) mark associated with transcriptionally active chromatin), are conjugated to the EZ-Tn5 transposome using any suitable approach, two of which are described below.
(79) Antibodies can be chemically crosslinked either to the transposase (protein-protein) or to the transposon (protein-DNA) using Hydralink Chemistry (Solulink, San Diego, Calif., USA), which is stoichiometrically more efficient than traditional EDC/NHS chemistries and has been used in the development of PCR-based proximity ligation assays, recognized as the most sensitive assay for protein detection[26-28]. The chemistry involves formation of reaction between an aromatic hydrazine (hydrazinonicotinamide-HyNic) and an aromatic aldehyde (4-formylbenzamide-4FB), yielding a stable bis-arylhydrazone that is UV-traceable, absorbing at 350 nm Conjugation reaction kinetics can be augmented 10-100 fold in the presence of aniline, leading to conjugation yields of >95%[26].
(80) Conjugations are performed following the manufacturer's established protocols in quantities sufficient for their functional characterization described below and for their subsequent use in the methods described. Both antibody-transposase and antibody-transposon, the transposase-associated oligonucleotide (
Example 3
TAM-ChIP Optimization
(81) Examples 1 and 2 above provides the basis for performing TAM-ChIP and demonstrating its benefits relative to traditional ChIP methods. The optimized chromatin extraction and fragmentation procedure above is combined with the antibody-transposome conjugate to perform the TAM-ChIP procedure. A method of comparing the genomic representation of the sequencing libraries produced by TAM-ChIP and traditional ChIP-Seq is also provided. This is done using two steps. The first step involves optimizing sets of conditions with regards to chromatin and antibody-transposase concentrations, optimization of incubation times using transposition the analytic methods describe above as the readout. The second step is a direct comparison of the genomic representation of the DNA libraries produced by TAM-ChIP with that of conventional ChIP-Seq methods.
(82) An optimal protocol can be determined using the steps depicted in
(83) Triplicate samples of 50, 150, and 450 ng of Hela cell chromatin (quantitated by A260) are incubated with the antibody-transposase conjugate in 100 IJI for two hours at 4 c. (
(84) Biotin-tagged DNA fragments are captured using streptavidin magnetic beads and transposition efficiency and fragment size profiles are determined as described above. Transposition efficiency is significantly higher at the transcriptionally active genomic targets listed in Table 1 than at the transcriptionally silent regions that are analyzed by qPCR. Consequently, for these experiments transposition efficiency is calculated as a relative ratio of transposition into transcriptionally active and inactive regions, thereby providing a means for comparison of the specificity and efficacy of the antibody-transposome complexes. The range of input chromatin is expanded in subsequent experiments if transposition efficiencies are too low or tagged-DNA fragments too small, the latter a consequence of too little DNA. This set of experiments identifies the antibody-transposome conjugates with optimal activity for chromatin substrates and which chemistry is optimal for the generation of additional antibody-transposase conjugates, such as a non-immune IgG-transposase negative control required for the TAM-ChIP protocol described below.
(85) The optimal conjugate for each of the two antibodies (RNA polyermase II and H3K4tm) is used in the following subsequent experiments (
Example 4
Validation of NGS Libraries Generated by TAM-ChIP
(86) The DNA libraries produced by the optimized method in developed in the preceding experiments with IgG, RNA polymerase II, and H3K4tm antibody-transposome conjugates are compared with the libraries produced via traditional ChIP-Seq performed with the same unconjugated antibodies. For traditional ChIP-Seq, Hela chromatin extracts generated for the above set of experiments are incubated with 5 g antibody for 16 hours at 4 C. 1 g are left unprocessed and serve as the input control. Antibody-chromatin complexes are captured using protein A coated magnetic beads, washed, eluted, and DNA purified following established procedures. ChIP with 5 g of non-immune rabbit IgG is performed in parallel as an antibody specificity control. The ChIP-enriched and the untreated sonicated gDNA are processed according standard protocols for library preparation for sequencing in the Illumina Genome Analyzer GAll. This consists of end-repair, adaptor ligation, size-selection and PCR amplification, and all these steps are done and sequencing performed according to standard methods. The generated data from both TAM-ChIP and traditional ChIP from two independent experiments is analyzed. Reads mapped to the human genome (alignments) are analyzed to find genomic regions with significant enrichments (peaks) over alignments obtained from either
(87) Input or IgG control DNA. Dozens of H3K4tm and RNA Polymerase II ChIP-Seq assays are performed and analyzed, and very similar results are obtained with the peak calling algorithms MACS [32], SICER [33], or CCAT [34]. In addition, software is used to extend the read alignments to the actual length of the DNA fragments (200-250 bp), and to generate a signal map showing alignment (tag) densities in 32-bp bins across the genome and reproducibility between replicates is typically 80%. Peaks and signal maps are entered into gene annotation and sample comparison software, returning concise Excel tables showing peak metrics and location of peaks relative to genes. These are used to compare the representation of genomic sequences in the DNA libraries prepared by two methods and show concordance of genomic coverage.
Example 5
Additional TAM ChIP Embodiments
(88) The methods established above will be recognized by those of ordinary skill in the art to be readily carried out in other embodiments, e.g., (a) those comprising antibodies from different animal hosts (rabbit, mouse, rat and goat) specific for proteins associated with either transcriptionally active euchromatin or transcriptionally silenced heterochromatin (i.e. HP1 proteins, and heterochromatin-associated histone marks), (b) TAM-ChIPs wherein antibody-transposase conjugates are be used singly or simultaneously, and with different degrees of complexity (two-plex, three-plex, etc.), including versions with each conjugate bearing a unique bar-code sequence for antibody identification, (c) those where the antibody-oligonucleotide conjugates prepared above are used in a multiple proximity ligation method (see, e.g., Example 6, below). Antibody-oligo conjugates bound to chromatin are diluted, followed by proximity ligation of the antibody-associated oligonucleotide with the associated chromatin fragment end and nicks sealed. Ligation of oligonucleotides to chromatin has been used to map chromatin higher order structures [35], where co-associating chromatin ends in isolated complexes containing higher-order structures are tagged via ligation with primers and then ligated to each other via their proximity, supporting the feasibility of this approach. Use of a reversible antibody-oligonucleotide crosslinking chemistry or the inclusion of a rare restriction endonuclease cleavage site allows liberation of the antibody from the DNA now tagged with the bar-code containing oligonucleotide which is then directly amplified for NGS using an appropriate PCR amplification strategy.
Example 6
Antibody-Oligonucleotide Conjugates and Proximity Ligation
(89) These methods use cross-linked and sonicated (or restriction digested) chromatin as a starting material. Instead of conjugation to transposase, this approach uses conjugation of an antibody to short double-stranded DNA oligonucleotides of known sequence. The conjugate is incubated with cross-linked chromatin that has been either restriction enzyme digested or sonicated, resulting in antibody binding at the intended target. Proximity-mediated ligation is performed, resulting in ligation of the antibody delivered oligos to the target-associated free genomic DNA ends (
(90) Oligonucleotide Embodiments.
(91) Several features can be designed into the oligonucleotide(s) that are conjugated to the antibody(ies). These features are listed below and depicted in
(92) 1. The oligonucleotide is double-stranded and the 5 end of one of the strands is linked to biotin (or a member of different high affinity binding pair). The biotin is used for conjugation to the antibody.
(93) 2. There is a restriction site (e.g., Not 1, a freeing restriction enzyme in the context of the invention) encoded in each oligonucleotide to allow the oligonucleotide to be separated from the antibody, if needed.
(94) 3. There is a region of sequence included that functions only for the purpose of varying the oligonucleotide length. The ligation of the oligonucleotide to the free genomic ends of the captured DNA may be dependent on the length of the oligonucleotides. The entire oligonucleotide is typically about 80 nucleotides in length, although longer or shorter lengths may be optimal in a given application.
4. A region is included that is complementary to Illumina (or other suitable) primers. This region facilitates amplification of oligonucleotide-ligated genomic DNA, preferably to be compatible with sequencing on the intended (e.g., Illumina) platform.
5. There is a 4-base pair (or shorter or longer) barcode. Several different oligonucleotides can be synthesized, each having a different bar code. Oligos with different bar codes can be conjugated to different antibodies, thus allowing multiple antibodies to be used in the same reaction.
6. There is a restriction-site-compatible overhang that allows the oligonucleotide to be ligated to restriction-digested genomic DNA. The overhang may preferably be a 4 nucleotide overhang (e.g., GATC, which is compatible with Dpn II, Mbo I, and Sau3A I, digestions). In such cases, the genomic DNA is cut with a restriction enzyme that having a 4 bp recognition site, which should on average cleave the DNA every 256 bases. Alternatively, a combination of restriction enzymes having 6 bp recognition sites can be used. Alternatively, TA cloning can be used. In such embodiments, sonicated DNA is used which has gone through end repair and A overhang addition. The oligonucleotides are designed to have T overhangs.
Example 7
Alternate Antibody/Oligonucleotide Conjugation Embodiments
(95) Any suitable chemistry can be used to achieve the antibody/oligonucleotide conjugations used in this invention. One such approach is described below.
(96) 1) The biotinylated forward strand oligonucleotide is annealed to the unbiotinylated reverse strand using standard procedures.
(97) 2) The antibody can be biotinylated using a number of available kits, for example, the Solulink Chromalink One-Shot biotinylation kit, which allows for quantitation of the number of biotins per antibody and thus allows for optimization of the number of biotins conjugated to the antibody.
3) Self-assembly of the conjugate can be achieved by mixing appropriate ratios of the biotinylated oligo, biotinylated antibody, and free streptavidin, a tetra mer with four biotin binding sites all of which can be simultaneously occupied.
4) Unconjugated antibody and oligo can be removed using streptavidin magnetic beads.
(98) This approach has been used and validated using a ratio of 2:1:2 (oligo: free streptavidin:antibody). An anti-Goat IgG antibody was coupled to a 100 bp oligo by mixing in the presence of free streptavidin. A goat antibody serves as the antigen and was absorbed to maxisorp 96-well plates at different concentrations. The antibody/oligionucleotide conjugate was allowed to bind the antigen and excess antibody was washed away. After washing, signal was detected using PCR with primers that anneal within the conjugated oligonucleotide (
Additional Examples
Example 8
Compatibility of Chromatin Extraction Buffers with the Transposase Enzyme and Determination of Whether Chromatin is Recognized as a Tn5 Transposase Substrate
(99) For this analysis two forms of the Tn5 enzyme were used. One form of the enzyme was the same as that sold in the Nextera kit (Tn5) while the second (TS-Tn5) was a temperature stable variant under development by Illumina.
Example 9
Identify the Minimum Dilution Factor with which the Antibody-Chromatin Complex Must be Diluted Such that Transposase Efficiency is Unaffected
(100) The lysis buffer used to extract chromatin from cells for the ChIP method contains harsh detergents such as SDS (for efficient extraction) and EDTA (to inhibit nuclease activity). In TAM-ChIP, antibody-transposase complexes are directly added to chromatin in lysis buffer. Initial experiments were aimed at determining the minimum dilution factor of the chromatin in lysis buffer required to preserve full transposase activity is retained. A mock-ChIP experiment using Active Motif's ChIP lysis buffer was performed to reproduce the buffer composition present at the chromatin immunocapture step. This buffer was sequentially diluted two fold (ranging from undiluted to a 1:20 dilution) into sterile water. Transposase was added to each buffer dilution with either 50 ng of unmethylated lambda phage DNA (48.5 kb, Promega) or 1 g of genomic HeLa DNA.
Example 10
Confirm Activity of Custom-Order Tn5 and TS-Tn5 Transposome Complexes
(101) Applicant manufactures all buffers, and reagents as part of its development process. To confirm that the efficiency of the transposase tagmentation reaction was equivalent with the use of Applicant's components compared to those provided in the Illumina Nextera kits. A-METS and B-METS oligonucleotides corresponding to the Illumina sequences were ordered (IDT, Inc.) and were annealed to p-MENTS (
(102)
(103) It was noted that unintegrated oligonucleotides were visible in the agarose gels in
(104) The Illumina sequencing platform requires the addition of index primers containing bar-code sequences as well as other platform-specific features to the tagmentation reaction products. These bar-codes allow for of up to 96 distinct samples to be sequenced simultaneously. These primers are added followed by a limited-cycle four-primer PCR reaction, the result of which are fragments that serve as input material for bridge PCR which generates the sequencing ready DNA library (
(105) TABLE-US-00003 TABLE3 AdapterandPrimersequencesforlimited-cyclePCR Name Sequence Adapter1a 5-AATGATACGGCGACCACCGAGATCTTAAGGCG SEQIDNO:1 ATCGTCGGCAGCGTC-3 Adapter2A 5-CAAGCAGAAGACGGCATACGAGATCGGTCTGT SEQIDNO:2 CTCGTGGGCTCGG-3 Adapter1b 5-AATGATACGGCGACCACCGAGATCTACACTCG SEQIDNO:3 TCGGCAGCGTC-3 Adapter2b 5-CAAGCAGAAGACGGCATACGATAGATCGCGTC SEQIDNO:4 TCGTGGGCTCGG-3 Primer1 5-AATGATACGGCGACCACCGA-3 SEQIDNO:5 Primer2 5-CAAGCAGAAGACGGCATACGA-3 SEQIDNO:6
(106) To test the compatibility of the in house designed oligonucleotides assembled into transposomes with the Illumina Associated Nextera Index kit, 100 ng of genomic DNA was tagmented by the in house assembled Tn5 and TS-Tn5 transposome complexes, and subjected to limited-cycle PCR using the four primers provided in the Illumina kit.
(107) Since the primers listed in Table 3 were based on sequences deduced form the literature and not provided by Illumina, the next experiment was performed to validate this set of in house primers. Two different versions of adapters 1 and 2 (called a and b) were synthesized (IDT, Inc). Different combinations of the primers and adapters provided by Illumina and the primers and adapters made by Applicant were used in PCR amplification of 100 ng tagmented genomic HeLa DNA. As depicted in
Example 11
Confirm Activity of Tn5 and TS-Tn5 Transposome Complexes on Chromatin
(108) With Tn5 and TS-Tn5 activity on naked genomic DNA confirmed, the next set of experiments were aimed at verifying the activity of the Tn5 and TS-Tn5 transposases on chromatin. Formaldehyde crosslinked HeLa chromatin was mechanically sheared with Applicant's EpiShear Probe Sonicator with a cooled platform to generate chromatin fragments of less than 1 kb as per traditional ChIP protocols. 10 g of chromatin was incubated with different amounts of Tn5 and TS-Tn5 transposome complexes. Initial experiments were performed with transposome concentrations ranging between 5 and 20 units, amounts of enzyme sufficient to tagment purified genomic DNA (data not shown). However, no or very low levels of tagmentation was detected with these amounts of enzyme when the reaction products were analyzed by agarose gel electrophoresis. These results suggested that the efficiency of the transposase on crosslinked chromatin is significantly lower, so higher enzyme amounts were used in subsequent experiments. Up to 100 units were utilized, and reaction products amplified by limited cycle PCR prior to agarose gel electrophoresis. In order to detect any tagmentation of chromatin, the number of limited cycle PCR cycles was increased from 5 to 25, and half of the PCR reaction resolved on the agarose gel (
(109) The above data establish that the transposase enzyme retains function in the buffers that are used to extract chromatin from the nuclei of mammalian cells and that both naked DNA and formaldehyde-crosslinked chromatin do indeed serve as substrates, albeit the latter with significantly reduced efficiency. In addition, in house generated tagmentation buffer, assembled transposomes and PCR primers for downstream library amplification appear functionally as robust as reagents provided in the Illumina products.
(110) Relative to pure DNA, tagmentation of chromatin does require more enzyme; however, the end productthe range of DNA fragment size generatedare essentially identical (compare
(111) DNA fragments of less than 200 bp in length are typically used in the traditional method of NGS library preparation where DNA fragments of 100-200 bp in length are excised from an agarose gel. In all of the data shown above, whether chromatin or purified genome DNA was used a substrate, the majority of the fragments produced were larger, in the 200-300 bp range. This product range was also observed in positive control samples where only Nextera kit reagents were used. This fragment size may represent threshold for Tn5 when presented with larger DNA (1 kb or larger) substrates. The fragment sizes produced through tagmentation are still very suitable for use in NGS sequencing. While the larger fragment size could impact resolution of the sequencing reads, this could be compensated for by the randomness of the Tn5 mediated insertion events, and could result in adequate genomic coverage.
Example 12
Development of Antibody-Transposome Conjugates
(112) Development of TAM-ChIP requires that the enzymatic activity of the transposase is retained, with regards to catalytic rate and randomness of integration sites, when coupled to an anti-rabbit secondary antibody (Jackson ImmunoResearch Laboratories Inc), as the conjugation partner (
(113) Optimal Ratio of Primary to Secondary Antibodies.
(114) In many applications secondary antibodies are used in excess of the primary and multiple secondary antibody molecules can bind a single primary antibody molecule, thereby providing signal amplification. However, these conditions may or may not be ideal for TAM-ChIP. Initial experiments were focused on establishing the optimal ratio of primary to secondary antibodies using quantitative PCR of captured DNA as the analytical method. Chromatin was prepared essentially as described herein and Applicant's ChIP validated rabbit polyclonal specific for trimethyllysine at residue 4 of histone H3 (H3K4me3, Catalog No. 39915) was used in ChIP with varying amounts of secondary IgG (Jackson ImmunoResearch Laboratories Inc). Following enrichment, qPCR was performed using primers against untranslated region 12 (Untr12) and GAPDH. Untr12, a gene desert on chromosome 12, shows no or low H3K4me3 enrichment, while GAPDH, an actively transcribed gene that is associated with the presence of H3K4me3, shows varying enrichment depending on amount of secondary antibody. The optimal ratio of primary H3K4me3 antibody to secondary IgG is 1:1 with half the amount of primary relative to secondary (2:1) also giving a high signal (
(115) ChIP data is expressed as binding events detected per 1,000 cells which represents the average of the raw data triplicates adjusted for the amount of chromatin in the reaction, the resuspension volume and the primer efficiency. Applicant's custom ChIP service has performed and analyzed hundreds of ChIP assays with a broad range of primary antibodies and this calculation provides consistency in data analysis and allows direct comparison across samples and experiments. This scale can be converted to enrichment over input (used in some figure below) by dividing binding event values by 1,000. Antibody-Oligonucleotide Conjugation.
(116) The secondary antibody was conjugated to single-stranded oligonucleotides (A and B, Table 4) with appended ends containing at the 5 end two iterations of an 18-carbon long hexaethyleneglycol spacer (Sp18) and a 5 Thiol Modifier C6 S-S (ThiolC6) via thiol-maleimide/thiol exchange chemistry which targets introduced maleimide/thiol exchange residues on the antibody. The objective was to introduce a cleavable (disulfide) bond between the antibody and oligonucleotide to facilitate separation and isolation of tagmented DNA fragments in downstream steps.
(117) TABLE-US-00004 TABLE4 SequencesofsinglestrandedoligonucleotideA andBconjugatedtoa18-carbonspacer OligonucleotideA ThiolC6//Sp18//Sp18/TCGTCGGCAG SEQIDNO:7 CGTCAGATGTGTATAAGAGACAG OligonucleotideB ThiolC6/Sp18//Sp18/GTCTCGTGGGC SEQIDNO:8 TCGGAGATGTGTATAAGAGACAG
(118) Conjugations were performed using a 6-fold molar excess of single-stranded oligonucleotides to achieve antibodies containing a minimum of 2 oligos/antibody. In the initial approach, an equimolar mixture of A and B oligo was used in the conjugation reaction. Consequent, reaction products will contain a mixture of conjugation products (A:A, A:B and B:B). To create a cleavable link between the secondary antibody and the conjugated oligonucleotides, a disulfide bond was introduced. To achieve this, the antibody had to be modified prior to forming the disulfide bond with the oligonucleotides. In a first attempt, the commercial reagent SPDP (cat #21857; Pierce) failed to give satisfactory results. However, by following another approach and synthesizing nitro-SPDP, we were able to modify the antibody. Mercaptopropionic acid in acetonitrile was treated with 2,2-dithiobis(5-nitropyridine) in the presence of triethylamine. Citric acid solution was added and the resulting 3-([5-nitro-2-pyridyl]dithio) propionic acid was extracted with dichloromethane. The product was purified by silica gel flash chromatography. To prepare an active form, 3-([5-nitro-2-pyridyl]dithio) propionic acid and N-hydroxysuccinimide were dissolved in acetonitrile and N,N-dicyclohexylcarbodiimide was added. Once the reaction was complete, crude nitro-SPDP was purified by preparative thin layer chromatography (
(119) During antibody activation, nitro-SPDP precipitated out of solution and subsequent successful activations were performed in the presence of DMSO. Use of DMSO may not be suitable with primary antibodies.
(120) The Nitro-SPDP activated antibody was subsequently desalted and mixed with the A-METS and B-METS oligonucleotide at a 6-fold excess to perform the conjugation reaction involving the disulfide bond formation between nitro-SPDP residues and thiol groups of the oligonucleotides. The reaction efficiency was verified on a 10% native polyacrylamide gel (
(121) Several purification and separation approaches were tested. However, both Protein A/G Spin Kit (cat #89980 from Pierce; manufacturer protocol was used) and Thiophilic Adsorbtion Kit (cat #44916 from Pierce; manufacturer protocol was used) failed to achieve the desired separation of free oligonucleotide from antibody-oligo conjugate. Only size exclusion chromatography, using a HiLoad 16/600 Superdex 75 g column, was able to purify the antibody-oligonucleotide conjugate and remove free oligos. The antibody-oligonucleotides reaction mixture was diluted with running buffer (50 mM Tris, 200 mM NaCl pH 8 and loaded onto the HiLoad 16/600 Superdex 75 g column. The running buffer was pumped through the column at 1 ml/min till the chromatography was completed. UV absorbance at three wavelengths was used as a detection method.
(122) Functionality of Antibody-Oligonucleotide Conjugate in ChIP
(123) A portion of the generated conjugate was tested by conventional ChIP to confirm that the addition of the oligonucleotides did not impair primary antibody binding. Chromatin was prepared as described above and Applicant's H3K4me3 antibody was used as the primary antibody with two different ratios of secondary antibody-conjugate. Following enrichment, qPCR was performed using primers against untranslated region 12 (Untr12) and GAPDH. As illustrated in
(124) Functionality of Antibody-DNA Conjugate in Transposomes
(125) A series of experiments were performed to test whether oligonucleotides now tethered to an antibody would still associate with the transposome to form a functional transposome and to determine the optimal conditions for tagmentation with the antibody/transposome complex. First, since the antibody-conjugate was constructed using single-stranded oligonucleotides, the complementing p-MENTS sequence oligonucleotides were added (
(126) The ability of the antibody-tethered oligonucleotides to form a functional transposome was also determined. Activity was first tested at 55 C. for 30 min, the standard temperature for the Tn5 transposase, and also for longer durations at 37 C. (
(127) The assembled transposome was incubated with genomic MCF7 DNA at various concentrations ranging from 5 to 25 units and extending the incubation at 55 C. to 10 and 30 minutes.
(128) Since TAM-ChIP requires the antibody to still be bound to its target during the tagmentation reaction, transposase activation at 55 C. could potentially adversely affect antibody to remain bound to its target protein. Therefore, the tagmentation at a lower temperature was assessed. Twenty-five units of the assembled Tn5 transposome was incubated with genomic DNA at 37 C. and room temperature for varying times to identify optimal conditions for tagmentation at lower temperatures. In the initial experiment the three hour incubation at 37 C. resulted in a strong increase in tagmentation; however, when this reaction was repeated, the same significant effect was not observed. The initial result was either an artifact of unequal sample loading on the gel (
(129) In the next experiment, twenty-five units of either the Tn5 and TS-Tn5 transposome-conjugates were added to 1 g of genomic MCF7 DNA and incubated at either 37 C. for one or three hours or 55 C. for one hour (
(130) The reason for reduced activity of the antibody/transposome complex is not clear. The incomplete tagmentation reactions with the transposome-conjugates could be due to reduced transposase activity, incomplete or incorrect assembly of the transposome complex or due to steric hindrance from being antibody-tethered. However, the residual activity may nonetheless be sufficient for TAM-ChIP. Primary antibody targeting of the transposome-antibody conjugate to chromatin could potentially overcome the decrease in random transposition activity through primary antibody mediated stabilization of the transposome/antibody/chromatin complex, which would effectively drive the reaction forward.
SUMMARY OF RESULTS
(131) The data in this example demonstrate the development of a conjugation strategy which was successful in the generation of an antibody-DNA conjugate. The data also demonstrate functionality of the conjugate in both ChIP and transposase functions, albeit at attenuated levels. In ChIP experiments, the same primary to secondary antibody ratio requirement was retained post-conjugation. When assembled into a transposome, tagmentation of genomic DNA was demonstrable, indicating that the antibody-transposome complex was formed and functioned.
Example 13
TAM-ChIP Validation
(132) To test the above hypothesis that antibody localization of transposase to chromatin would overcome the attenuation of transposase activity the following prototypic TAM-ChIP experiments were performed.
(133) Functionality of Tn5 and TS-Tn5 Transposomes Assembled with Antibody-Oligonucleotide Conjugate in ChIP
(134) A portion of the antibody-transposome complexes generated as described were used in a set of preliminary ChIP experiments. The H3K4me3 primary antibody used above was incubated with 10 g of chromatin overnight. The transposome-antibody conjugate, either Tn5 or TS-Tn5, was added at a ratio of 1:1 of primary antibody to secondary-transposome conjugate, and incubated at 4 C. for four hours to allow binding of the secondary antibody-transposome to the primary antibody. The reaction was diluted first with four volumes of the buffer used in the immunoprecipitation step of traditional ChIP and one volume of Mg.sup.2+ containing tagmentation buffer to activate the transposase during a three hour incubation at 37 C. Antibody bound chromatin tagmented by the transposome was captured using Protein G agarose beads (Invitrogen) and eluted following established ChIP procedures in the presence of TCEP (Tris(2-Carboxyethyl)phosphine) to reduce the disulfide bonding linking oligonucleotide with antibody. After Proteinase K treatment and reversal of formaldehyde crosslinks, achieved with a two hour incubation at 80 C., half of the eluted DNA was subjected to 25 cycles of the four primer PCR reaction shown in
(135) Following dilution, qPCR was performed on 10 ng of DNA using primers against the negative control regions Untr12 and Untr20 as well as positive control regions for H3K4me3 GAPDH and Zc3h13.
(136) In the above procedure, protein G agarose beads were used in lieu of the streptavidin-beads to avoid complications stemming from biotin-streptavidin interactions. Thus the oligonucleotides designed and used in this example lacked a biotin moiety.
(137)
(138) One possible interpretation of these results is that the observed enrichment (
(139) Thus, the results depicted in
(140) To confirm the results achieved above and further optimize TAM-ChIP performance, several variables were next introduced. These included varying amounts of chromatin (10 and 1 g), antibody-transposase concentrations (1:1 and 2:1 ratios of secondary/transposase conjugate relative to primary antibody) and incubation times of the TS-Tn5/secondary complex (2 and 4 hours) with primary antibody:chromatin complexes before transposase activation. Antibody-bound DNA was isolated as described above followed by four primer PCR. qPCR of amplified DNA was performed using primers against Untr12 and GAPDH. This experiment was performed twice with inconsistent results indicating that optimization will be required to achieve reproducibility (
(141) Both experiments showed specific association of the H3K4me3 with the GAPDH region and not with Untr12, the condition which produced the highest capture of a H3K4me3-associated genomic regions was with 10 g chromatin in both, but for
(142) The experiments preformed in
(143) Sequencing and 50-nt reads were generated on a HiSeq sequencer and aligned to the human genome (hg19). Only uniquely aligning reads were kept and duplicate reads were removed, resulting in 545,182 alignments for the TAM-ChIP sample. A control standard ChIP-Seq data set (traditional ChIP-seq on MCF7 chromatin using the H3K4me3 antibody) was down-sampled to the same number of alignments and analyzed in parallel. Signal maps were generated and the fragment densities in 32-nt bins along the genome was determined. The resulting histograms were visualized in the Integrated Genome Browser (IGB). Peak calling was performed using SICER (Zang et al., Bioinformatics 25, 1952-1958, 2009) at a standard cutoff of E-value=1. SICER identified 10,897 peaks for TAM-ChIP and 12,526 peaks for traditional ChIP, which are within expectations for this histone mark if compared to numerous previous assays and 91.5% of the TAM-ChIP peaks overlapped with the traditional ChIP peaks (
(144) When annotated with genes, it was found that 83.6% of the TAM-ChIP peaks and 84.2% of the traditional ChIP peaks were located in promoters (defined as 7500 to +2500 relative to TSS). In conclusion, the correlation between the TAM-ChIP and traditional ChIP data is extremely high. In both assay, highest signals were seen at the transcriptional start site (TSS), as shown in the promoter profile (5000 to +5000) generated by seqMINER in
(145) These results indicate that the TS-Tn5 transposase can be directed in a specific manner to chromatin via an antibody specific for a chromatin associated proteinin this case, a post-translational histone modification that is associated with transcriptionally active regions of the genome. Together the results presented herein clearly establish proof of concept.
Example 14
Enrich for DNA Methylated Genomic Regions Using Transpososome-Antibody/Oligonucleotide Complex
(146) Approach:
(147) A recombinant tagged methyl-binding protein (in this case a His tagged MBD2 and/or MBD3 protein(s)) binds to methylated DNA and an anti-His antibody that has been conjugated with the same oligonucleotides containing the NGS adaptor and transposase sequences that bind to the methyl binding protein such that upon transposase activation the oligonucleotide sequence is integrated into region of DNA methylation.
(148) Uniqueness Relative to TAM-ChIP:
(149) 1) Uses genomic DNA as a substrate as opposed to chromatin 2) Uses DNA binding proteins instead of a primary antibody 3) An antibody that recognizes the tag on a protein delivers the oligonucleotide sequence to the DNA 4) Can be combined with other DNA modification marks, including hydroxymethylcytosine, carboxylcytosine and formylcytosine in addition to methylcytosine
(150) Here data is present utilizing the antibody directed insertion of barcodes/sequences using the transposase to determine DNA methylation levels in genomic DNA will allow this method to crossover into the field of DNA methylation, which is also analyzed at genome-wide levels and will also facilitate an emerging trend of studies that examine how distinct epigenetic regulatory mechanisms overlap or are co-integrated.
(151) This approach enables the multianalyte capabilities of this assay as 5-mC, 5-hmC, 5-caC and 5-fC and can be performed on unfragmented DNA which would likely reduce input DNA amounts compared to over methylation enrichment technologies (e.g. MeDIP). Using this approach the library preparation step will be eliminated and it is possible that the immunoprecipitation step may also be removed.
(152) The method described herein is based on Applicant's MethylCollector assay, which enriches CpG-methylated DNA from limited amounts of cell or tissue samples (
(153) The first step to determine the feasibility of adapting the described MethylCollector protocol for use with the transposome/antibody conjugate was to confirm that MBD2b binding was retained in conditions required for the tagmentation (i.e. low magnesium and 37). The modified MethylCollector protocol included the necessary steps for binding of the anti-His antibody and tagmentation of the DNA by the transposome (
(154) The experiment was performed in duplicate with either 4 ug of MBD2b alone or together with MBD3L on 100 ng of fragmented human genomic DNA following either the original MethylCollector protocol (
(155) Based on these results an antibody conjugate directed against the His tagged MBD2 was developed. The transposase recognition sequences (A- and B-METS) was conjugated to an anti-His antibody (Pierce 6His epitope tag antibody (MA1-21315)) using the same conjugation strategy as described previously. The retained activity of the conjugated antibody was confirmed by dotblot against 0-1000 ng of His-tagged recombinant MBD2b (data not shown).
(156) After confirming the retained activity of the anti-His antibody, we further confirmed the functionality of the assembled conjugated antibody-transposome complex. Unfragmented genomic DNA was incubated with 25 units of the assembled transposome complex and incubated at 50 for five minutes, or at 37 for either 1 or 3 hours. All reactions showed the same level of tagmentation and fragmentation of the genomic DNA compared to control reactions using an unconjugated transposome complex (data not shown)
(157) The next step was to determine the feasibility of utilizing this antibody conjugate in the MethylCollector assay and generating specific tagmentation by the transposome of only those regions containing DNA methylation. Applicant incubated the His-tagged MBD2b and the anti-His antibody conjugate/transposome at a 1:1 ratio (4 ug of MBD2b and 4 ug of the anti-His antibody) with 100 ng unfragmented human genomic DNA (
(158)
(159) As one of the main advantages of the TAM-MIRA methodology (as disclosed herein) is its putative multianalyte capability, Applicant has initiated studies to show that this approach can be applied to determine 5-hmC levels in genomic unfragmented DNA. The advantages in studying 5-hmC compared to 5-mC enrichment is that one can utilize an antibody such as the Active Motif 5-Hydroxymethylcytosine antibody that recognizes and binds both single- and double-stranded DNA. (An alternative approach is to use tagged hmc-binding proteins followed by transpososome complexes containing an antibody to the tag).
(160) Thus in this approach, Applicant incubated 100 ng of unfragmented mouse genomic DNA from brain and embryonic stem cells (ESC) with 2 ug of the primary 5-hmC antibody followed by 2 ug of the secondary antibody conjugate/transposome complex utilized in TAM-ChIP. After binding, dilution and tagmentation of the genomic DNA, the bound regions were captured using either Protein G Agarose or Magnetic beads, followed by washes and elution. The purified DNA was subjected to 25 cycles of PCR amplification using the same adapters and primers utilized in TAM-ChIP. All libraries were purified using standard methods and diluted to 2 ng/ul. Quantitative PCR was performed using primers targeting the regions known to be negative (Control 1) or positive (Slc22a4) for DNA hydroxymethylation.
(161) All together the results in this Example indicate that the methodology of antibody directed tagmentation of unfragmented genomic DNA, in addition to chromatin, by the TS-Tn5 transposase can be utilized to specifically detect 5-mC and 5-hmC levels. These data also support this approach for detecting formyl and carboxylcytosine.
(162) Those of skill in the art will recognize that many equivalent antibody/oligonucleotide conjugation strategies could be substituted for use in the invention. For example, direct via a chemical crosslinker, indirect via other proteins/biomolecules that have strong interactions, including a streptavidin-protein A fusion protein (or protein G). Protein A binds the antibody in a manner that is known not to interfere with antibody function. A single protein A/G immunoglobulin binding domain could be also used, and expressed as a fusion protein. This would then bind with biotinylated oligonucleotides. There are also biotin-binding peptides that are much smaller than the streptavidin protein. Further, as indicated herein other transposon-targeted constructs are possible including those described herein based on protein-protein interactions, RNA-protein interactions, and DNA-DNA-interactions.
REFERENCES CITED
(163) 1. Allis, et al., Overview and Concepts, in Epigenetics, Allis, et al., Eds. 2006, Cold Spring Harbor Laboratory Press: New York. p. 23-62. 2. Luger, et al., Nature, 1997. 389(6648): p. 251-60. 3. Strahl and Allis, Nature, 2000. 403(6765): p. 41-5. 4. Grewal and D. Moazed, Science, 2003. 301(5634): p. 798-802. 5. Jenuwein and Allis, Science, 2001. 293(5532): p. 1074-80. 6. Suganuma and Workman, Cell, 2008. 135(4): p. 604-7. 7. Grewal, S. l., Current Opinions in Genetics & Development, 2010. 20(2): p. 134-41. 8. Vire, et al., Nature, 2006. 439(7078): p. 871-4. 9. Jones, et al., Nature Genetics, 1998. 19(2): p. 187-91. 10. Felsenfeld, G., A Brief History of Epigenetics, in Epigenetics, Allis, et al., Eds. 2006, above, p. 15-22. 11. Braunstein, et al., Genes & Development, 1993. 7(4): p. 592-604. 12. Alberts, et al., Cell, 1998. 92(4): p. 475-87. 13. Rister and Desplan, Bioessays, 2010. 32(5): p. 381-4. 14. Active Motif, l., ChIP-IT Express Magnetic Chromatin Immunoprecipitation Kit. 2011, Active Motif, Carlsbad, Calif., USA. 15. Mizuucki and Baker, Chemical Mechanisms for Mobilizing DNA, in Mobile DNA II, Craig, et al., Eds. 2002, ASM Press: Washington, p. 12-23. 16. Goryshin and Reznikoff, Journal of Biological Chemistry, 1998. 273(13): p. 7367-74. 17. Davies, et al., Science, 2000. 289(5476): p. 77-85. 18. Goryshin, et al., PNAS USA, 1998. 95(18): p. 10716-21. 19. Goryshin, et al., Nature Biotechnology, 2000. 18(1): p. 97-100. 20. Gallagher, et al., PNAS USA, 2007. 104(3): p. 1009-14. 21. Vidal, et al., PLoS One, 2009. 4(7): p. e6232. 22. Bertram, et al., Nucleic Acids Research, 2005. 33(18): p. e153. 23. Shi, et al., Moleucular and Biochemical Parasitology, 2002. 121(1): p. 141-4. 24. Suganuma, et al., Biology of Reproduction, 2005. 73(6): p. 1157-63. 25. Steger, et al., Molecular and Cellular Biology, 2008. 28(8): p. 2825-39. 26. Dirksen and Dawson, Bioconjugate Chemistry, 2008. 19(12): p. 2543-8. 27. Fredriksson, et al., Clinical Chemistry, 2008. 54(3): p. 582-9. 28. Jarvius, et al., Molecular and Cellular Proteomics, 2007. 6(9): p. 1500-9. 29. Solulink, Protein-Protein Conjugation Kit Solulink Inc.: San Diego. 30. Mahnke Braam and Reznikoff, Journal of Biological Chemistry, 1998. 273(18): p. 10908-13. 31. Mahnke Braam, et al., Journal of Biological Chemistry, 1999. 274(1): p. 86-92. 32. Zhang, et al., Genome Bioi, 2008. 9(9): p. R137. 33. Zang, et al., Bioinformatics, 2009. 25(15): p. 1952-8. 34. Xu, et al., Bioinformatics, 2010. 26(9): p. 1199-204. 35. Li, et al., Genome Biology, 2010. 11(2): p. R22. 36. Life Science Tools and Reagents: Global Markets 2011. 2011, BCC Research, Inc., Wellesley, MAm USA. 37. Epigenetics Market Trends 2011. 2011, Select BioSciences, Ltd, Sudbury, UK. 38. Chu et al., Molecular Cell, 2011. 44: 667-678. 39. Simon et al., Proc. Nat. Acad. Sci. 2011. 108(51):20497-20502 40. Guttman & Rinn Nature 2012 482:339-345 41. Jones et al, BioEssays 2000. 22:124-137 42. Finn et al., Nucleic Acid Research 1996. 24(17):3357-3363. 43. Akst, The Scientist 2012 Epigenetics Armed German E. coli. 44. Fang et al., Nature Biotechnology 2012. 30:1232-1239 45. Bruscella, et al., 2008. J. Bacter. 190(20):6817-6828 46. Yandell, 2013. The Scientist Decoding Bacterial Methylomes