DNA METHYLATION EDITING KIT AND DNA METHYLATION EDITING METHOD
20200190543 ยท 2020-06-18
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
C07K2319/01
CHEMISTRY; METALLURGY
C07K16/44
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
C07K16/44
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
Abstract
A DNA methylation editing kit comprises: (1) a fusion protein of inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and a tag peptide array in which plural tag peptides are linked by linkers, or an RNA or DNA coding therefor; (2) a fusion protein(s) of a tag peptide-binding portion and a methylase or demethylase, or an RNA(s) or DNA(s) coding therefor; and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb of a desired site of methylation or demethylation, or a DNA(s) expressing the gRNA(s).
Claims
1-19. (canceled)
20. A DNA methylation editing method comprising transfecting a cell with the following (1) to (3): (1) a first fusion protein comprising (i) inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and (ii) a tag peptide array comprising a plurality of tag peptides and peptide linkers which consist of 15 to 50 amino acids and link said tag peptides, or an RNA or DNA coding the first fusion protein, wherein the tag peptides are peptide epitopes, and the tag peptide-binding portion is an anti-peptide-epitope antibody and wherein the peptide epitopes are general control non-derepressible 4 (GCN4) peptide epitopes, and the anti-peptide-epitope antibody is an anti-GCN4 peptide epitope antibody; (2) a second fusion protein(s) comprising a tag peptide-binding portion and a methylase or demethylase, or an RNA(s) or DNA(s) coding the second fusion protein, wherein the demethylase is a catalytic domain often-eleven translocation 1 (TET1CD) and the methylase is DNA methyltransferase 3 beta (DNMT3B); and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb of a desired site of methylation or demethylation, or a DNA(s) expressing the gRNA(s).
21. The DNA methylation editing method according to claim 20, wherein the fusion proteins of the (1) and/or (2) further comprise a selection marker.
22. The DNA methylation editing method according to claim 21, further comprising selecting and collecting a cell expressing the selection marker as a part of the fusion protein.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DESCRIPTION OF EMBODIMENTS
[0045] Embodiments of the present invention will be described in detail below.
[0046] In CRISPR/Cas, Cas9, which is a DNA-cleaving enzyme, forms a complex with a short RNA (guide RNA (gRNA)) comprising an about-20-bp sequence complementary to a target, and cleaves DNA as a target (Non Patent Literature 2). In such a case, when a mutant enzyme having no DNA cleavage activity, referred to as dCas9, is used, only binding to a target can be achieved without cleaving the target. Thus, recruitment of factors that perform methylation and demethylation by linking various components to dCas9 enables the methylation of a particular gene to be regulated. When a system where dCas9 linked with a tag peptide array comprising plural tag peptides, and a tag peptide-binding portion such as a single-chain antibody (scFv) for a tag peptide fused with a factor performing methylation and demethylation are used, and plural methylation factors or demethylation factors can be recruited for one molecule of dCas9, and an ability to perform the methylation or demethylation can be enhanced (
[0047] In the present invention, first, a sequence (target sequence) complementary to a DNA sequence within 1 kb from a desired site of methylation or demethylation is produced, and a gRNA comprising the target sequence is produced. The gRNA has a property of forming a complex, with dCas9 having no nuclease activity.
[0048] When a fusion protein of dCas9 and a tag peptide array is produced, the gRNA forms a complex with the fusion protein, through dCas9, and therefore, a gRNA-dCas9-tag peptide array complex is formed. The gRNA is bound to a sequence complementary to a target sequence included in the gRNA, and therefore, the gRNA-dCas9-tag peptide array complex is bound to a DNA sequence within 1 kb from a desired site of methylation or demethylation. A fusion protein of a tag peptide-binding portion and a methylase or demethylase is recruited within 1 kb from the desired site of methylation or demethylation by binding of the tag peptide-binding portion to the tag peptide array. The recruited methylase or demethylase methylates or demethylates a site within 1 kb from its recruited portion (
[0049] (DNA Methylation Editing Kit and DNA Methylation Editing Method)
[0050] The present invention relates to a DNA methylation editing kit comprising: (1) a fusion protein of inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and a tag peptide array in which plural tag peptides such as GCN4 are linked by linkers, or an RNA or DNA coding therefor; (2) a fusion protein(s) of a tag peptide-binding portion such as an anti-tag peptide antibody and a methylase or demethylase, or an RNA(s) or DNA(s) coding therefor; and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb from a desired site of demethylation, or a DNA(s) expressing the gRNA(s). In addition, the present invention relates to a DNA methylation editing method comprising transfecting a cell with the (1) to (3) described above.
[0051] The DNA methylation editing includes both of the methylation of a DNA unmethylated site and the demethylation of a DNA methylated site.
[0052] (Inactivated Cas9 Having No Nuclease Activity)
[0053] CRISPR-associated endonuclease Cas9 (Cas9) includes two lobes of a REC lobe (REC: recognition) and a NUC lobe (NUC: nuclease), in which the NUC lobe is a site responsible for nuclease activity (Non Patent Literature 2). Thus, inactivated Cas9 (dCas9) having no nuclease activity in the present invention can be produced by introducing a mutation into the NUC lobe of Cas9. As a result, the nuclease activity of Cas9 can be inactivated while maintaining the capacity of binding to a target site. A site in which the mutation is introduced into the NUC lobe is not limited as long as only the nuclease activity can be inactivated. For example, mutation of Asp10 to alanine (D10A), mutation of His840 to alanine (H840A), and mutation of Asn863 to alanine (N863A) in Cas9 (UniProtKB/Swiss-Prot: Q99ZW2) are preferred. Such mutations may be one kind or a combination of two or more kinds thereof.
[0054] DNAs encoding dCas9 can be produced by introducing mutations into DNAs encoding Cas9 that can be obtained from GenBank and the like. Alternatively, plasmids comprising commercially available dCas9 may be obtained from Addgene and the like and used, DNAs encoding dCas9 may be obtained by PCR with the plasmids as templates or may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and methods of obtaining the DNAs are not limited. RNAs encoding dCas9 may be obtained by known molecular biological techniques, of which any may be used. For example, such an RNA may be obtained by using a DNA encoding the dCas9 as a template and triggering an RNA polymerase.
[0055] (Tag Peptide Array)
[0056] The tag peptide array in the present invention refers to a tag peptide array in which plural tag peptides are linked by linkers.
[0057] The tag peptides can be optionally selected in combination with a tag peptide-binding portion described later. Examples of the combination of the tag peptides and the tag peptide-binding portion include a combination of a peptide epitope and an antibody recognizing the peptide epitope, and a combination of the small fragment and large fragment of a split protein.
[0058] Examples of the combination of a peptide epitope and an antibody recognizing the peptide epitope include: GCN4 and an anti-GCN4 antibody; a His tag and an anti-His tag antibody; an EE hexapeptide and an anti-EE hexapeptide antibody; a c-Myc tag and an anti-c-Myc tag antibody; an HA tag and an anti-HA tag antibody; an S tag and an anti-S tag antibody; and a FLAG tag and an anti-FLAG tag antibody (Protein Engineering, Design & Selection vol. 24 no. 5 pp. 419-428, 2011). Among them, a peptide included in GCN4 is preferably used, the amino acid sequence of GCN4 can be obtained from, for example, PDB, and the DNA sequence of GCN4 can be obtained from GenBank or the like. Those skilled in the art can also obtain an RNA sequence corresponding to the DNA sequence on the basis of information on the DNA sequence by using nucleotide sequence conversion software and the like. The GCN4 peptide epitope can be used without limitation as long as being an epitope in GCN4, and an amino acid sequence represented by SEQ ID NO: 1 is preferred. Information on the amino acid sequences of the other tag peptides and the nucleotide sequences encoding the amino acid sequences can be obtained from known databases and the like.
[0059] The split protein refers to a pair of proteins in which, in the case of dividing a certain protein into two portions, the two portions of the protein are reassociated, thereby enabling formation of the same structure as that of the original protein. Particularly in the case of dividing the original protein into the two portions, one portion as a short peptide (small fragment) may be used with a tag peptide, and the other longer portion (large fragment) may be used as a tag peptide-binding portion (Current Opinion in Chemical Biology 2011, 15: 789-797). A known split protein can be used as the split protein which can be used for such a purpose, and examples thereof include GFP (green fluorescent protein).
[0060] Further, binding of a peptide and a protein domain is compiled into a database, and a combination of a tag peptide and a tag peptide-binding portion can be found with reference to, for example, Peptide Binding Proteins Database (http://pepbind.bicpu.edu.in/home.php). For example, since PDZAIpha-Syntrophin PDZ protein interaction domain can be bound to GVKESLV (SEQ ID NO: 44), GVKESLV can be used with a tag peptide, and the PDZ domain can be used as a tag peptide-binding portion.
[0061] Further, the binding strength of a pair of a peptide and a peptide binding portion can be increased by connecting another unrelated domain with a linker and performing domain interface evolution. Methylation can be further efficiently regulated by using such a pair (Proc. Natl. Acad. Sci. USA, 2008, vol. 105 no. 18, 6578-6583).
[0062] Linkers interposed in a tag peptide array comprising such plural tag peptides as described above include any sequence as long as the linkers do not inhibit binding of the peptides and peptide-binding portions or the desired effect of the present invention. Examples of the linkers include a repeating sequence of glycine and serine. The length of such a linker can be set as appropriate according to the kind of a methylase or demethylase and the like, and is preferably 5 to 100 amino acids, more preferably 5 to 50 amino acids, and still more preferably 10 to 50 amino acids. In the case of TET and DNMT described later, the length is more preferably 15 to 40 amino acids, still more preferably 17 to 30 amino acids, and most preferably 22 amino acids. When the length of the linker is 10 amino acids in the case of the repeating sequence of glycine (G) and serine (S), for example, the linker sequence may be GSGSG (SEQ ID NO: 45), GSGSGGSGSGSGGSGSGGSGSG (SEQ ID NO: 46), or GSGSGGSGSGGSGSGGSGSGGSGGSGSGGSGSGGSGSGGSGSG (SEQ ID NO: 47).
[0063] The tag peptide array in the present invention refers to a tag peptide array in which assuming that a combination of a tag peptide and a linker is one unit, one or plural units are repeatedly linked. The plural units mean two or more units. The number of repeated units can be increased or decreased as appropriate depending on the distance between a target site and a methylated or demethylated site, the kind of a methylase or demethylase, and the like, and may be, for example, 3 to 5.
[0064] DNA encoding a tag peptide array can be produced by adding a DNA sequence encoding a desired linker to DNA encoding a tag peptide that can be obtained from GenBank or the like. A method of obtaining the DNA by a molecular biological technique based on information on a DNA sequence is known. For example, the DNA can be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and the method of obtaining the DNA is not limited. Those skilled in the art can also obtain an RNA sequence corresponding to the DNA sequence on the basis of information on the DNA sequence by using nucleotide sequence conversion software and the like.
[0065] (Fusion Protein of dCas9 and Tag Peptide Array, or RNA or DNA Coding Therefor)
[0066] DNA encoding a fusion protein of dCas9 and a tag peptide array can be produced by binding of DNA encoding the dCas9 defined above and DNA encoding the tag peptide array by using an optional method including a well-known gene manipulation method, and is not particularly limited. A DNA sequence encoding a selection marker may also be inserted into the DNA encoding the fusion protein. The selection marker enables cells into which the DNA encoding the fusion protein is introduced to be selected by cell sorting or the like. Examples of the selection marker include, but are not limited to, genes encoding fluorescent proteins such as GFP, Ds-Red, and mCherry, and drug resistance genes such as puromycin resistance genes and neomycin resistance genes. The fusion protein or RNA encoding the fusion protein can be obtained by a known molecular biological technique using DNA encoding the fusion protein, and can be obtained by, for example, inserting DNA encoding the fusion protein into an appropriate expression vector and expressing the protein or the RNA.
[0067] (Tag Peptide-Binding Portion)
[0068] As the tag peptide-binding portion, an anti-tag peptide (peptide epitope) antibody, the large fragment of a split protein, or the like can be used depending on the kind of a tag peptide, as described above. The anti-tag peptide antibody means an antibody that specifically recognizes a tag peptide. The anti-tag peptide antibody includes polyclonal antibodies and monoclonal antibodies. The monoclonal antibodies include monoclonal antibodies, the fragments of monoclonal antibodies, F(ab).sub.2 antibodies, F(ab) antibodies, short-chain antibodies (scFv), diabodies, and minibodies. DNA encoding the anti-tag peptide antibody can be obtained by a known molecular biological technique, can be obtained by amplifying, for example, a commercially available plasmid such as Addgene plasmid 60904 by PCR, or may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and a method of obtaining the DNA is not limited. The anti-tag peptide antibody or RNA encoding the anti-tag peptide antibody can be obtained by inserting the DNA encoding the anti-tag peptide antibody into an appropriate expression vector and expressing the protein or the RNA.
[0069] (Methylase and Demethylase)
[0070] The methylase in the present invention can be used without limitation as long as being an enzyme that catalyzes the methylation of an unmethylated site, and includes a methylase which is an enzyme that methylates a particular base on a DNA nucleotide sequence, and a methyltransferase which is an enzyme transferring a methyl group to a particular base, and more specific examples thereof include DNA methyltransferase 3 beta (DNMT3B), DNA methyltransferase 3 alpha (DNMT3A), and DNA methyltransferase 1 (DNMT1). The demethylase in the present invention can be used without limitation as long as being an enzyme catalyzing a series of reaction leading to the demethylation of a methylation site, and includes ten-eleven translocation 1 (TET1), ten-eleven translocation 2 (TET2), ten-eleven translocation 3 (TET3), and thymine-DNA glycosylase (TDG). These enzymes may be a portion or the whole of an enzyme protein. Preferred examples of the portion of the enzyme protein include a catalytic domain of an enzyme. Information on the sequence of DNAs encoding the enzymes can be obtained from GenBank and the like, and the DNAs can be produced from the cDNAs of target animals such as human by PCR. Alternatively, the DNAs encoding the enzymes may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and methods of obtaining the DNAs are not limited. The enzymes or RNAs encoding the enzymes can be obtained by inserting the DNAs into an appropriate expression vector and expressing the proteins or RNAs.
[0071] (Fusion Protein of Tag Peptide-Binding Portion and Methylase or Demethylase, or RNA or DNA Encoding Fusion Protein)
[0072] DNA encoding a fusion protein of a tag peptide-binding portion such as an anti-peptide-epitope antibody and a methylase or demethylase can be produced by linking DNA encoding the tag peptide-binding portion defined above with DNA encoding a methylase or demethylase by using an optional method including a well-known gene manipulation method, and is not particularly limited. A DNA sequence encoding a selection marker may also be inserted into DNA encoding the fusion protein. The selection marker enables cells into which the DNA encoding the fusion protein is introduced to be selected by cell sorting or the like. Examples of the selection marker include, but are not limited to, genes encoding fluorescent proteins such as GFP, Ds-Red, and mCherry, and drug resistance genes such as puromycin resistance genes and neomycin resistance genes. When a DNA sequence encoding a selection marker is inserted into the DNA encoding the fusion protein of the dCas9 and the tag peptide array, a selection marker different from the selection marker may be inserted into DNA encoding a fusion protein of a tag peptide-binding portion and a methylase or demethylase. The fusion protein or RNA encoding the fusion protein can be obtained by a known molecular biological technique using DNA encoding the fusion protein, and can be obtained by, for example, inserting DNA encoding the fusion protein into an appropriate expression vector and expressing the protein or the RNA.
[0073] (Guide RNA (gRNA) or DNA Expressing Guide RNA)
[0074] The guide RNA (gRNA) in the present invention is a guide RNA in which a tracrRNA and a crRNA are artificially linked in a CRISPER/Cas method. By a known technique based on an RNA sequence described in Non Patent Literature 2 (p. 1698), DNA corresponding to the RNA sequence can be obtained as DNA expressing tracrRNA. For example, the DNA may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and a method of obtaining the DNA is not limited. Alternatively, a plasmid that enables a desired gRNA to be expressed by inserting a DNA sequence corresponding to an arbitrary crRNA is commercially available (Addgene plasmid 41824 or the like) and may be therefore used. A sequence complementary to a DNA sequence within 1 kb from a desired site of methylation or demethylation is used as the crRNA. One kind of the gRNA is acceptable, or plural gRNAs each comprising different crRNAs may be used.
[0075] (All-in-One Vector)
[0076] The DNAs encoding the two fusion proteins described above may be further linked, resulting in DNA encoding a fusion protein of dCas9, a tag peptide array, a tag peptide-binding portion, and a methylase or demethylase, which may be incorporated into a vector and may be used. The vector comprising the DNA is referred to as an all-in-one vector. A linker may be inserted as appropriate into the DNA encoding the fusion protein. For example, when a 2A peptide derived from a virus is inserted as a linker between a fusion protein (regarded as a component 1) of dCas9 and a tag peptide array and a fusion protein (regarded as a component 2) of a tag peptide-binding portion and a methylase or demethylase, the 2A peptide is cleaved by the 2A peptidase in a cell, and therefore, the components 1 and 2 are prevented from being linked and expressed as two separated proteins. The all-in-one vector may also include a gRNA.
[0077] Examples of vectors comprising desired genes in the present invention include a vector that can be replicated in a eukaryotic cell, a vector which maintaining an episome, and a vector incorporated into a host cell genome, and viral vectors are preferred, and adenovirus vectors, lentiviral vectors, and adeno-associated virus vectors are more preferred. Such a vector may include a selection marker. Selection marker refers to a genetic element which provides a selectable phenotype to a cell into which the selection marker is introduced, and is commonly a gene of which a gene product imparts resistance to an agent that inhibits cell proliferation or kills or wounds a cell. Specific examples thereof include Neo gene, Hyg gene, hisD gene, Gpt gene, and Ble gene. Examples of a drug useful for selecting the presence of the selection marker include G418 for Neo, hygromycin for Hyg, histidinol for hisD, xanthine for Gpt, and bleomycin for Ble.
[0078] (Transfection into Cell)
[0079] Transfection of DNA, RNA, and a protein into a cell can be performed by using known optional means or may be performed using a commercially available reagent for transfection. For example, electroporation, Lipofectamine 2000 (Invitrogen), jetPRIME Kit (Polyplus-transfection), DreamFect (OZ Biosciences), GenePorter3000 (OZ Biosciences), Calcium Phosphate Transfection Kit (OZ Biosciences), and the like can be used for transfection of DNA. Electroporation, Lipofectamine 3000 (Invitrogen), RNAi Max (Invitrogen), MessengerMAX (Invitrogen), and the like can be used for transfection of RNA. Electroporation, Lipofectamine CRISPRMAX (Invitrogen), PULSin (Polyplus-transfection), Pro-DeliverlN (OZ Biosciences), BioPORTER Protein Delivery Reagent (Genlantis), and the like can be used for transfection of a protein. Transfection into a cell may also performed by forming a complex of a gRNA and a fusion protein of dCas9 and a tag peptide array, in advance, and transfecting the complex into the cell. DNA, RNA, or a protein can also be introduced into a fertilized egg by microinjection or electroporation.
EXAMPLES
[0080] The present invention will be further described below with reference to non-limiting examples. In the present examples, GCN4 was used as a tag peptide. However, the GCN4 can be replaced with another tag peptide.
Example 1. Demethylation of Target Using TET1CD
[0081] <Plasmid Construction for Target Demethylation>
[0082] A dCas9-TET1 catalytic domain (CD) fusion protein expression vector (pCAG-dCas9TET1CD) was produced by fusing cDNA encoding codon-optimized S. pyogenes Cas9 (dCas9) as a catalytically inactive nuclease to a catalytic domain in the N-terminus of human TET1CD (System 1). A dCas9 fragment was amplified from Addgene plasmid 48240 by PCR. A TET1CD fragment was amplified from human cDNA by PCR.
[0083] The dCas9 fragments of Systems 1 to 4 in
[0084] <Construction of gRNA>
[0085] A gRNA vector for Gfap or H19 was produced by inserting a target sequence into Addgene plasmid 41824. Cloning was performed by Gibson assembly system via the linearization of an AflII site and the insertion of a gRNA fragment.
[0086] Target sequences are set forth in Table 1.
TABLE-US-00001 TABLE1 TargetSequence Target Methylation- Name TargetSequence SensitiveSitearoundTarget Gfap_1 ATAGACATAATGGTCAGGGGTGG GfapSTAT3-bindingsite Gfap_2 GGAFGCCAGGATGTCAGCCCCGG GfapSTAT3-bindingsite Gfap_3 ATATGGCAAGGGCAGCCCCGTGG GfapSTAT3-bindingsite H19DMR_1 GTGGGGGGGCTCTTTAGGTTTGG H19DMRCTCF-bindingsite1 H19DMR_2 ACCCTGGTCTTTACACACAAAGG H19DMRCTCF-bindingsite2 H19DMR_3 GAAGCTGTTATGTGCAACAAGGG H19DMRCTCF-bindingsite3 H19DMR_4 CAGATTTGGCTATAGCTAAATGG H19DMRCTCF-bindingsite4
[0087] The underlines show PAM sequences.
[0088] Unrelated gRNA Sequence
TABLE-US-00002 Target Name gRNASequence UR_1 CCATTATTGCATTAATCTGA UR_2 TAATGCAGCCAGAAAATGAC UR_3 TCAGGGATCAAATTCTGAGC
[0089] <Cell Culture>
[0090] Embryonic stem cells (ESCs) were cultured in Dulbecco's modified Eagle's medium-high-concentration glucose (D6429-500ML, Sigma) to which 1% FBS, 17.5% KSR100 (10828028, Gibco), 0.2% of 2-mercaptoethanol (21985-023, Gibco), and 110.sup.3 unit/mL (ESGI 107, Millipore) of ESGRO mLIF were added under 37 C. and 5% CO.sub.2. The ESCs were transfected using Lipofectamine 2000 (Invitrogen) according to an attached protocol, and the cells were collected 48 hours after the transfection and directly used for an assay and a sort by FACSAriaII (BD Biosciences).
[0091] <DNA Methylation Analysis>
[0092] Genomic DNA was treated using Epitect Plus DNA Bisulfite Kit (QIAGEN) according to an attached instruction. The modified DNA was amplified using the following PCR primers in Table 2.
TABLE-US-00003 TABLE2 PCRPrimerSequenceforBisulfiteSequence Methylation-SensitiveSite PrimerName PrimerSequence aroundTarget GfapSTAT3-B3 TTGGTTAGTTTTTAGGATTTTTTTT GfapSTAT3-bindingsite(ES) GfapSTAT3-B4 AAAACTTCAAACCCATCTATCTCTTC H19DMR-B1 AAGGAGATTATGTTTTATTTTTGGA H19DMRCTCF-bindingsite1 H19DMR-B2 AAAAAAACTCAATCAATTACAATCC Gfap_O1B1 TTGTAAAGGTAGGATTAATAAGGGAATT Gfapoff-targetsite1 Gfap_O1B2 AAAAAAAACCCTTCAAAAAAAATCTA Gfap_O2B1 TTATTATTTATATTTGGAGGGAGGG Gfapoff-targetsite2 Gfap_O2B2 ATTACACCAAAAAAATTTTAAAAAC Gfap_O3B1 TTTAAATTTTTTTATGTGAATATGG Gfapoff-targetsite3 Gfap_O3B2 AAACATTTAATTCATTAATACACAC
[0093] The percentages of the demethylation of the STAT3 site of Gfap and the m1 to m4 sites of H19 were determined by Combined Bisulfite Restriction Analysis (COBRA). The fragments amplified using the primers in Table 3 were cleaved with restriction enzymes having recognition sites in the sites and set forth in in Table 3 below and subjected to polyacrylamide gel electrophoresis.
TABLE-US-00004 TABLE3 COBRAPrimerSequence Restriction methylationsensitivesite primername primersequence enzyme nearthetargets GfapSTAT3-B1 GTTGAAGATTTGGTAGTGTTGAGTT Hpy188III GfapSTAT3-bindingsite GfapSTAT3-B2 TAAAACATATAACAAAAACAACCCC H19DMR-B1 AAGGAGATTATGTTTTATTTTTGGA BstUI H19DMRCTCF-bindingsite1 H19DMR-B2 AAAAAAACTCAATCAATTACAATCC H19DMR-B1 AAGGAGATTATGTTTTATTTTTGGA RsaI H19DMRCTCF-bindingsite2 H19DMR-B2 AAAAAAACTCAATCAATTACAATCC H19DMR-B3 GGGTTTTTTTGGTTATTGAATTTTAA BstUI H19DMRCTCF-bindingsite3 H19DMR-B4 AATACACACATCTTACCACCCCTATA H19DMR-B5 TTTTTGGGTAGTTTTTTTAGTTTTG BstUI H19DMRCTCF-bindingsite4 H19DMR-B6 ACACAAATACCTAATCCCTTTATTAAAC
[0094] The methylation was calculated as the ratio of cleaved DNA by densitometry analysis of a gel stained with ethidium bromide. In each assay, the methylation of cells transfected with a control vector (empty gRNA vector) was defined as 100% methylation (0% demethylation), and the demethylation of each sample was standardized by the control using the following Numerical Formula 1.
Demethylation of sample (%)=(methylation of control-methylation of sample)/methylation of control100Numerical Formula 1
[0095] Bisulfite sequencing was carried out for the methylation analysis and off-target analysis of a peripheral region. The amplified fragment was ligated into a TOPO vector (Invitrogen), and sequencing of at least 14 clones was carried out. The sequencing was analyzed by a methylation analysis tool referred to as QUantification tool for Methylation Analysis (QUMA). Statistical significance between two groups of all sets in CpG sites was evaluated using Mann-Whitney U test (also referred to as Wilcoxon matched pairs signed ranks test is called) used for a test of nonparametric statistical significance.
[0096] <Results>
[0097] First, a simple design which was a direct fusion protein of inactivated Cas9 nuclease (dCas9) and TET1 was produced for methylation treatment. TET1 has a catalytic domain preserved in a C-terminus, and this domain has higher catalytic activity than that of a full-length protein. Therefore, the TET1 catalytic domain (TET1CD) was fused to dCas9 having inactive catalytic action (System 1 in
[0098] A cytosine residue in a STAT3-binding site located upstream of a gene encoding glial fibrillary acidic protein (GFAP) which is an astrocyte-specific marker was used as a target. The site is methylated in many cell types excluding astrocytes, and the demethylation of the site plays an important role in differentiation of neural precursor cells (NPCs) into astrocytes. Three targets around the STAT3-binding site were designed (
[0099] In the STAT3 site, the three gRNAs, Gfap1, Gfap2 and Gfap3, showed demethylations of 3%, 14%, and 9%, respectively (
[0100] Then, an attempt to amplify a demethylation ability was made using dCas9 fused in a repeating peptide sequence in order to recruit plural copies of the antibody fused TET1 hydroxylase catalytic domain (
[0101] The length of a linker by which the sequence of a GCN4 peptide epitope comprising 19 amino acids was separated was examined in order to investigate the reason why System 2 failed to improve the degree of the demethylation. If the length of the linker is too short, it is considered that for the antibody-TET1CD fusion protein, a space for approaching and binding to the GCN4 peptide sequence is too narrow, and therefore, demethylation activity becomes insufficient. If the length of the linker is too long, it is considered that the antibody-TET1CD fusion protein is incapable of approaching a target methylated site (
[0102] An antibody-TET1CD fusion protein having a linker of which the length was 22 amino acids (System 3 in
[0103] These results suggested that the length of a linker by which each GCN4 peptide unit sequence fused with dCas9 is separated is more important for demethylation activity than the number of copies of GCN4. The demethylation activity was prominently improved by increasing the length of the linker from 5 amino acids to 22 amino acids. This is considered to be because the 22 amino acids have a width enough for the antibody-TET1CD fusion protein to approach a peptide sequence. In contrast, the linker of which the length was 43 amino acids was considered to be long for the antibody-TET1CD fusion protein to approach a methylated site which was a target.
[0104] Cells into which a GFP expression vector was introduced were selected using fluorescence activated cell sorting (FACS) for the purpose of further improving demethylation efficiency. For this purpose, an all-in-one vector comprising a gRNA, dCas9 comprising the GCN4 sequence of System 3, and an antibody-sfGFP-TET1CD fusion protein was produced (
[0105] The ESCs in to which System 3 was introduced and which was sorted by GFP also unexpectedly showed roughly complete demethylation (
[0106] Then, the range of the demethylation of a used sorted sample from a target site was investigated by bisulfite sequencing. The demethylation occurred even at a site located at least 100 bp or more apart from the target site (
[0107] Then, a similar experiment was conducted using a differential methylation region (DMR) of H19 as a paternal methylated imprinting gene. The DMR of H19 includes four methylation-sensitive CTCF binding sites (m1 to m4), which are important for adjusting H19 imprinting (
[0108] As a result, noticeable improvement in methylation in System 3 was observed in comparison with dCas9-TET1CD. Complete demethylation was observed at the m2 site in the cells sorted by GFP (
Example 2. Methylation of Target Using Dnmt3b
[0109] The m2 site of H19 was methylated using System 3 (linker 22aa) in order to introduce methylation into a target. Experiments were conducted using (1) Dnmt3b, (2) Dnmt3bNLS, and (3) Dnmt3bNLS_N662R instead of TET1CD (
TABLE-US-00005 (1)Dnmt3b: (SEQIDNO:41) pCAG-scFvGCN4sfGFPDnmt3bF (2)Dnmt3bNLS: (SEQIDNO:42) pCAG-scFvGCN4sfGFPDnmt3bFNLS (3)Dnmt3bNLS_N662R: (SEQIDNO:43) pCAG-scFvGCN4sfGFPDnmt3bS1
[0110] Only cells into which genes were introduced and which emitted fluorescence were isolated based on fluorescence of GFP by a cell sorter 2 days after introduction of these systems of (1) to (3) into ES cells, and the methylation of the m2 of H19 was examined in a manner similar to that in the demethylation. The methylation was calculated as a methylation (%) standardized by a control, as shown in Numerical Formula 2. As a result, the methylations of the targets were (1) 540%, (2) 74%, and (3) 84%, revealing that methylation efficiency in the case of adding NLS was higher than that in the case of only Dnmt3b, and methylation efficiency in the case of the amino acid substitution of N662R was further higher (
Methylation (%)standardized by control=(methylation of sample-methylation of control)/methylation of control100Numerical Formula 2
REFERENCES
[0111] Shen L, Gao G Zhang Y, Zhang H, Ye Z, Huang S, Huang J, Kang J. A single amino acid substitution confers enhanced methylation activity of mammalian Dnmt3b on chromatin DNA. Nucleic Acids Res. 38:6054-6064, 2010. doi: 10.1093/nar/gkq456. [0112] SEQ ID NO: 1: GCN4 [0113] SEQ ID NO: 2: linker 5 [0114] SEQ ID NO: 32 linker 22 [0115] SEQ ID NO: 4: linker 43 [0116] SEQ ID NO: 5: 2A peptide [0117] SEQ ID NO: 6: pCAG-dCas9TET1CD [0118] SEQ ID NO: 7: pCAG-dCas9-10GCN4_v4 [0119] SEQ ID NO: 8: pCAG-scFvGCN4sfGFPTET1CD [0120] SEQ ID NO: 9: pCAG-dCas9-5Plat2AflD [0121] SEQ ID NO: 10: pCAG-dCas9-3.5Super [0122] SEQ ID NO: 11: pPlatTET-gRNA2 [0123] SEQ ID NO: 12: Gfap_1 [0124] SEQ ID NO: 13: Gfap_2 [0125] SEQ ID NO: 14: Gfap_3 [0126] SEQ ID NO: 15: H19DMR_1 [0127] SEQ ID NO: 16: H19DMR_2 [0128] SEQ ID NO: 17: H19DMR_3 [0129] SEQ ID NO: 18: H19DMR_4 [0130] SEQ ID NO: 19: UR_1 [0131] SEQ ID NO: 20: UR_2 [0132] SEQ ID NO: 21: UR_3 [0133] SEQ ID NO: 22: GfapSTAT3-B3 [0134] SEQ ID NO: 23: GfapSTAT3-B4 [0135] SEQ ID NO: 24: H19DMR-B1 [0136] SEQ ID NO: 25: H19DMR-B2 [0137] SEQ ID NO: 26: Gfap_O1B1 [0138] SEQ ID NO: 27: Gfap_O1B2 [0139] SEQ ID NO: 28: Gfap_O2B1 [0140] SEQ ID NO: 29: Gfap_O2B2 [0141] SEQ ID NO: 30: Gfap_O3B1 [0142] SEQ ID NO: 31: Gfap_O3B2 [0143] SEQ ID NO: 32: GfapSTAT3-B1 [0144] SEQ ID NO: 33: GfapSTAT3-B2 [0145] SEQ ID NO: 34: H19DMR-B3 [0146] SEQ ID NO: 35: H19DMR-B4 [0147] SEQ ID NO: 36: H19DMR-B5 [0148] SEQ ID NO: 37: H19DMR-B6 [0149] SEQ ID NO: 38: off target 1 [0150] SEQ ID NO: 39: off target 2 [0151] SEQ ID NO: 40: off target 3 [0152] SEQ ID NO: 41: pCAG-scFvGCN4sfGFPDnmt3bF [0153] SEQ ID NO: 42: pCAG-scFvGCN4sfGFPDnmt3bFNLS [0154] SEQ ID NO: 43: pCAG-scFvGCN4sfGFPDnmt3bS1 [0155] SEQ ID NO: 44: tag peptide GVKESLV [0156] SEQ ID NO: 45: GS linker [0157] SEQ ID NO: 46: GS linker [0158] SEQ ID NO: 47: GS linker
INDUSTRIAL APPLICABILITY
[0159] The methylation of a particular gene can be controlled according to the present invention. As a result, model cells and animals with diseases (epigenome diseases) occurring due to DNA methylation abnormality, such as cancers and imprinting diseases, can be produced. In addition, virus vectors and other delivery systems can be used for treatment of the diseases. In production of iPS cells, the iPS cells can be effectively produced by demethylating and activating a pluripotent gene such as Oct-4 according to the present invention.