BACTERIAL VACCINE COMPONENTS AND USES THEREOF
20200188501 ยท 2020-06-18
Inventors
- Francois Malouin (Eastman, CA)
- Marianne Allard (Sherbrooke, CA)
- Christian Lebeau Jacob (Sherbrooke, CA)
- Brian Geoffrey Talbot (Sherbrooke, CA)
- Daniel Scholl (Mont Saint-Hilaire, CA)
- Pierre Lacasse (Sherbrooke, CA)
- Moussa S. Diarra (Agassiz, CA)
- Celine Ster (Sherbrooke, CA)
Cpc classification
A61K39/00
HUMAN NECESSITIES
International classification
Abstract
Agents, compositions, methods and kits useful for the treatment and diagnosis of Staphylococcal intramammary infection are disclosed. The agents, compositions, methods and kits are derived from genes expressed during Staphylococcal intramammary infection, and more particularly genes SACOL0442, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome.
Claims
1. A method for immunizing a mammal against a Staphylococcal intramammary infection (IMI), said method comprising administrating to said mammal an effective amount of a composition comprising an oil and at least one polypeptide, wherein said polypeptide is: (a) a polypeptide encoded by a gene, wherein said gene is SACOL0442, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide comprising an amino acid at least 60% identical overall to the polypeptide of (a); (c) a polypeptide comprising an immunogenic fragment of (a) or (b); (d) a polypeptide comprising an immunogenic variant of any one of (a) to (c); or (e) any combination of (a) to (d).
2. The method of claim 1, wherein the polypeptide (a) is a polypeptide comprising residues 36 to 203 of the amino acid sequence of SEQ ID NO: 37 or SEQ ID NO: 48.
3. The method of claim 1, comprising administrating to said mammal an effective amount of a combination of polypeptides.
4. The method of claim 1, wherein said immunogenic fragment comprises one or more of the following amino acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17), KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19).
5. The method of claim 1, wherein said immunogenic fragment comprises one or more of the following amino acid sequences: KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19).
6. The method of claim 1, wherein said Staphylococcal intramammary infection is caused by one or more Staphylococcus aureus strains.
7. The method of claim 1, further comprising administering to said mammal an effective amount of an adjuvant.
8. The method of clam 7, wherein said adjuvant comprises alum, oil, cyclic-diguanosine-5-monophosphate (c-di-GMP), polyphosphasine or pathogen associated molecular patterns (PAMPS).
9. The method of claim 8, wherein said PAMPS is unmethylated dinucleotides (CpG) or microbial polysaccharides.
10. The method of claim 7, wherein said (i) polypeptide, (ii) adjuvant, or both (i) and (ii) are comprised in a pharmaceutical composition.
11. The method of claim 10, wherein said pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients.
12. The method of claim 1, wherein said mammal is a cow.
13. The method of claim 12, wherein said IMI is associated with bovine mastitis.
14. A pharmaceutical composition comprising: (i) at least one polypeptide, wherein said polypeptide is: (a) a polypeptide encoded by a gene, wherein said gene is SACOL0442, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide comprising an amino acid at least 60% identical overall to the polypeptide of (a); (c) a polypeptide comprising an immunogenic fragment of (a) or (b); (d) a polypeptide comprising an immunogenic variant of any one of (a) to (c); or (e) any combination of (a) to (d); and (ii) a pharmaceutically acceptable excipient.
15. The pharmaceutical composition of claim 14, wherein the polypeptide (a) is a polypeptide comprising the amino acid sequence of SEQ ID NO: 37 or SEQ ID NO: 48.
16. The pharmaceutical composition of claim 14, comprising a combination of polypeptides.
17. The pharmaceutical composition of claim 14, wherein said immunogenic fragment comprises one or more of the following amino acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17), KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19).
18. The pharmaceutical composition of claim 14, wherein said immunogenic fragment comprises one a more of the following amino acid sequences: KDTINGKSNKSRNW(SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19).
19. The pharmaceutical composition of claim 14, further comprising an adjuvant.
20. The pharmaceutical composition of claim 19, wherein said adjuvant comprises alum, oil, cyclic-diguanosine-5-monophosphate (c-di-GMP), polyphosphasine or pathogen-associated molecular patterns (PAMPS).
21. The pharmaceutical composition of claim 20, wherein said PAMPS is unmethylated dinucleotides (CpG) or microbial polysaccharides.
22. A kit for the prevention and/or treatment of Staphylococcal IMI, comprising (i) at least one agent, wherein said agent is: (a) a polypeptide encoded by a gene, wherein said gene is SACOL0442, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide comprising an amino acid at least 60% identical overall to the polypeptide of (a); (c) a polypeptide comprising an immunogenic fragment of (a) or (b); (d) a polypeptide comprising an immunogenic variant of any one of (a) to (c); or (e) any combination of (a) to (d); and (ii) instructions to use the kit for the prevention and/or treatment of Staphylococcal IMI.
23. The kit of claim 22, wherein the polypeptide (a) is a polypeptide comprising the amino acid sequence of SEQ ID NO: 37 or SEQ ID NO: 48.
24. The kit of claim 22, comprising a combination of polypeptides.
25. The kit of claim 22, wherein said immunogenic fragment comprises one or more of the following amino acid sequences: TFGIYPKADASTQN (SEQ ID NO: 17), KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19).
26. The kit of claim 22, wherein said immunogenic fragment comprises one or more of the following amino acid sequences: KDTINGKSNKSRNW (SEQ ID NO: 18) or KDGGKYTLESHKELQ (SEQ ID NO: 19).
27. The kit of claim 22, further comprising an adjuvant.
28. The kit of claim 27, wherein said adjuvant comprises alum, oil, cyclic-diguanosine-5-monophosphate (c-di-GMP), polyphoshasine or pathogen-associated molecular patterns (PAMPS).
29. The kit of claim 28, wherein said PAMPS is unmethylated dinucleotides (CpG) or microbial polysaccharides.
30. The kit of claim 27, wherein said (i) agent, (ii) adjuvant, or both (i) and (ii), are comprised in a pharmaceutical composition.
31. The kit of claim 30, wherein said pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0107] In the appended drawings:
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0126] In a first aspect, the present invention provides a method for preventing and/or treating Staphylococcal intramammary infection (IMI) in a mammal, said method comprising administrating to said mammal an effective amount of an agent, wherein said agent is (a) a polypeptide encoded by a gene, wherein said gene is SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene from a same operon as one of the genes of (a); (c) an immunogenic fragment of (a) or (b); (d) an immunogenic variant of any one of (a) to (c); (e) a nucleic acid encoding the polypeptide of any one of (a) to (d); or (f) any combination of (a) to (e).
[0127] In another aspect, the present invention provides a use of an agent, wherein said agent is (a) a polypeptide encoded by a gene, herein said gene is SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene from a same operon as one of the genes of (a), (c) an immunogenic fragment of (a) or (b); (d) an immunogenic variant of any of (a) to (c); (e) a nucleic acid encoding the polypeptide of any one of (a) to (d); or (f) any combination of (a) to (e), for preventing and/or treating a Staphylococcal intramammary infection (IMI) in a mammal.
[0128] In another aspect, the present invention provides a use of an agent, wherein said agent is: (a) a polypeptide encoded by a gene, wherein said agent is SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene from a same operon as one of the genes of (a); (c) an immunogenic fragment of (a) or (b); (d) an immunogenic variant of any one of (a) to (c); (e) a nucleic acid encoding the polypeptide of any one of (a) to (d); or (f) any combination of (a) to (e); for the preparation of a medicament for preventing and/or treating Staphylococcal intramammary infection (IMI) in a mammal.
[0129] In another aspect the present invention provides a pharmaceutical composition (e.g., a vaccine) for preventing and/or treating Staphylococcal intramammary infection (IMI) in a mammal, said composition comprising an agent, wherein said agent is: (a) a polypeptide encoded by a gene, wherein said gene is SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on the gone nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2; (b) a polypeptide encoded by a gene from a same operon as one of the genes of (a); (c) an immunogenic fragment of (a) or (b); (d) an immunogenic variant of any one of (a) to (c); (e) a nucleic acid encoding the polypeptide of any one of (a) to (d); or (f) any combination of (a) to (e), and optionally one or more pharmaceutically acceptable excipients/carriers.
[0130] The Genbank accession numbers for the above mentioned S. aureus genes and encoded polypeptides are depicted in Table I below:
TABLE-US-00001 TABLE I Genbank accession numbers for the IMI-associated S. aureus genes and encoded polypeptides described herein. Gene name GenBank Gene ID No. GenBank protein No. SACOL0029 3236748 (SEQ ID NO: 77) YP_184940.1 (SEQ ID NO: 78) SACOL0100 3236858 YP_185004.1 SACOL0101 3236840 YP_185005.1 SACOL0105 3236844 YP_185009.1 SACOL0148 3236734 YP_185048.1 SACOL0154 3238707 YP_185054.1 SACOL0204 3236774 YP_185103.1 SACOL0205 3236775 YP_185104.1 SACOL0264 3236683 (SEQ ID NO: 79) YP_185159.1 (SEQ ID NO: 80) SACOL0442 3236485 (SEQ ID NO: 81) YP_185332.1 (SEQ ID NO: 37) SACOL0461 3236475 YP_185351.1 SACOL0608 3236353 YP_185493.1 SACOL0660 3238251 YP_185544.1 SACOL0688 3236721 YP_185570.1 SACOL0690 3236723 YP_185572.1 SACOL0704 3236241 YP_185586.1 SACOL0718 3236599 (SEQ ID NO: 82) YP_185600.1 (SEQ ID NO: 83) SACOL0720 3236600 (SEQ ID NO: 84) YP_185601.1 (SEQ ID NO: 62) SACOL0829 3238649 YP_185703.1 SACOL1054 3236163 YP_185919.1 SACOL1142 3236098 YP_186005.1 SACOL1145 3237661 YP_186008.1 SACOL1320 3236394 YP_186175.1 SACOL1353 3236077 (SEQ ID NO: 85) YP_186206.1 (SEQ ID NO: 86) SACOL1416 3236563 (SEQ ID NO: 87) YP_186268.1 (SEQ ID NO: 88) SACOL1611 3236575 (SEQ ID NO: 89) YP_186451.1 (SEQ ID NO: 90) SACOL1637 3238018 YP_186477.1 SACOL1680 3238476 YP_186520.1 SACOL1781 3236594 YP_186614.1 SACOL1812 3238705 YP_186645.1 SACOL1867 3236101 (SEQ ID NO: 99) YP_186695.1 (SEQ ID NO: 100) SACOL1912 3236086 YP_186737.1 SACOL1944 3237515 (SEQ ID NO: 91) YP_186769.1 (SEQ ID NO: 92) SACOL2092 3238693 YP_186907.1 SACOL2144 3237436 (SEQ ID NO: 93) YP_186957.1 (SEQ ID NO: 94) SACOL2169 3237416 YP_186981.1 SACOL2171 3237418 YP_186983.1 SACOL2321 3238070 YP_187128.1 SACOL2325 3238483 YP_187132.1 SACOL2342 3235997 YP_187148.1 SACOL2365 3238203 (SEQ ID NO: 95) YP_187170.1 (SEQ ID NO: 96) SACOL2379 3237628 YP_187183.1 SACOL2385 3238646 YP_187189.1 SACOL2599 3237186 (SEQ ID NO: 97) YP_187390.1 (SEQ ID NO: 98)
[0131] In an embodiment, the above-mentioned gene is SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599.
[0132] As used herein, the term vaccine refers to any compound/agent (vaccine component), or combinations thereof, capable of inducing/eliciting an immune response in a host and which permits to treat and/or prevent an infection and/or a disease. Therefore, non-limiting examples of such agent include proteins, polypeptides, protein/polypeptide fragments, immunogens, antigens, peptide epitopes, epitopes, mixtures of proteins, peptides or epitopes as well as nucleic acids, genes or portions of genes (encoding a polypeptide or protein of interest or a fragment thereof) added separately or in a contiguous sequence such as in nucleic acid vaccines, and the like.
[0133] An immunogenic fragment of a protein/polypeptide is defined as a part of a protein/polypeptide which is capable of inducing/eliciting an immune response in a host. In an embodiment, the immunogenic fragment is capable of eliciting the same immune response in kind, albeit not necessarily in amount, as the protein/polypeptide. An immunogenic fragment of a protein/polypeptide preferably comprises one or more epitopes of said protein/polypeptide. An epitope of a protein/polypeptide is defined as a fragment of said protein/polypeptide of at least about 4 or 5 amino acids in length, capable of eliciting a specific antibody and/or an immune cell (e.g., a T cell or B cell) bearing a receptor capable of specifically binding said epitope. Two different kinds of epitopes exist linear epitopes and conformational epitopes. A linear epitope comprises a stretch of consecutive amino acids. A conformational epitope is typically formed by several stretches of consecutive amino acids that are folded in position and together form an epitope in a properly folded protein. An immunogenic fragment as used herein refers to other one, or both, of said types of epitopes. In an embodiment, the immunogenic fragment of a protein/polypeptide comprises at least 4 or 5 amino acid residues. In a further embodiment, the immunogenic fragment comprises at least 6, 7, 8, 9, 10, 13, 14, 15, 20, 25, 30, 50 or 100 consecutive amino acids of the native protein/polypeptide.
[0134] As will be understood by the person of ordinary skill, agents (proteins/polypeptides, fragments thereof) having non-naturally occurring modifications (e.g., immunogenic variants) and which are capable of inducing an immune response specific for the unmodified agent (e.g., capable of inducing the production of antibodies capable of recognizing the unmodified agent) are also within the scope of the term vaccine component. For example, the vaccine components of the present invention can be modified to enhance their activity, stability, and/or bioavailability, and/or to reduce their toxicity. Conservative amino acid substitutions may be made, like for example replacement of an amino acid comprising an acidic side chain by another amino acid comprising an acidic side chain, replacement of a bulky amino acid by another bulky amino acid, replacement of an amino acid comprising a basic side chain by another amino acid comprising a basic side chain, and the like. A person skilled in the art is well able to generate variants of a protein/polypeptide. This is for instance done through screening of a peptide library or by peptide changing programs. An immunogenic variant according to the invention has essentially the same immunogenic properties of said protein in kind, not necessarily in amount. An immunogenic variant of a protein/polypeptide of the invention may for instance comprise a fusion protein and/or chimeric protein. For example, the biological of protein SACOL0442 identified herein is predicted to be an exotoxin, enterotoxin or superantigen and it could potentially interfere will the mammalian immune system and antibody production, and/or show some toxicity in the host. Although such interference was not observed when the SACOL0442 polypeptide was used in combination with for example SACOL0720 during immunization (
[0135] In an embodiment, the above-mentioned polypeptide is a polypeptide normally secreted or expressed at the surface of the bacteria (e.g., Staphylococcus aureus).
[0136] In another embodiment, the above-mentioned polypeptide or a polypeptide substantially identical to said polypeptide, is expressed in at least two different strains of Staphylococcus aureus. Substantially identical as used herein refers to polypeptides having at least 60% of similarity, in embodiments at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of similarity in their amino acid sequences. In further embodments, the polypeptides have at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of identity in their amino acid sequences.
[0137] In an embodment, the above mentioned immunogenic fragment comprises a sequence that is conserved (i.e. identical) in at least two different strains of Staphylococcus aureus. In further embodiments, the above mentioned immunogenic fragment comprises a sequence that is conserved (i.e., identical) in at least 3, 4, 5, 6, 7, 8, 9 or 10 different strains of Staphylococcus aureus. In another embodiment, the above-mentioned strains of Staphylococcus aureus are COL, RF122, NCTC 8325, JH1, JH9, Newman, Mu3, Mu50, USA300-FPR3757, N315, MW2 or MSSA476. In an embodiment, the above mentioned strains of Staphylococcus aureus are associated with bovine mastitis (e.g., RF122).
[0138] The similarity and identity between amino acid or nucleotides sequences can be determined by comparing each position in the aligned sequences. Optimal alignment of sequences for comparisons of similarity and/or identity may be conducted using a variety of algorithms, for example using a multiple sequence alignment program/software well known in the art such as ClustalW, SAGA, UGENE or T-coffee. Examples of multiple sequence alignments are described in the examples below and depicted in
[0139] Also within the context of the present invention is the in vivo administration of a nucleic acid of the invention to a mammal so that one or more proteins/polypeptides (or a fragment thereof) of interest is/are expressed in the mammal (e.g., nucleic acid vaccine, DNA or RNA vaccine).
[0140] The nucleic acid of the present invention preferably comprises a nucleotide sequence that encodes one or more proteins/polypeptides noted above (or fragments thereof) operably linked to regulatory elements needed for gene expression, such as a promoter, an initiation codon, a stop codon, enhancers, and a polyadenylation signal. Regulatory elements are preferably selected that are operable in the species to which they are to be administered.
[0141] The nucleic acid of the present vaccine can be naked DNA or can be operably incorporated in a vector. Nudeic acids may be delivered to cells in vivo using methods well known in the art such as direct infection of DNA, receptor-mediated DNA uptake, viral-mediated transfection or non-viral transfection and lipid-based transfection, all of which may involve the use of vectors. Direct injection has been used to introduce naked DNA into cells in vivo (see e.g., Acsadi et al. (1991) Nature 332:815-818; Wolff et al. (1990) Science 247:1465-1468). A delivery apparatus (e.g., a gene gun) for injecting DNA into cells in vivo may be used. Such an apparatus may be commeraally available (e.g., from BioRad). Naked DNA may also be introduced into cells by complexing the DNA to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G and Wu, C. H. (1988) J. Biol. Chem. 263: 14621; Wilson et al. (1992) J. Biol. Chem. 267: 963-967, and U.S. Pat. No. 5,166,320). Binding of the DNA ligand complex to the receptor may facilitate uptake of the DNA by receptor-mediated endocytosis. A DNA ligand complex linked to adenovirus capsids which disrupt endosomes, thereby releasing material into the cytoplasm, may be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al. (1991) Proc. Natl. Acad. Sci. USA 88: 8850; Cristriano et al. (1993) Proc. Natl. Acad. Sci. USA 90: 2122-2126).
[0142] Useful delivery vectors include biodegradable micocapsules immuno-stimulating complexes (ISCOMs) or liposomes, and genetically engineered attenuated live vectors such as viruses or bacteria. Examples of suitable attenuated live bacterial vectors include Salmonella typhimurium, Salmonella typhi, Shigella, Bacillus, Lactobacillus, Bacille Calmette-Guerin (BCG), Escherichia coli, Vibrio cholerae, Campylobacter, or any other suitable bacterial vector, as is known in the art. Methods of transforming live bacterial vectors with an exogenous DNA construct are well described in the art. See, for example, Joseph Sambrook and David W. Russell, Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
[0143] Preferred viral vectors include Bacteriophages, Herpes virus, Adenovirus, Polio virus, Vaccinia virus, defective retroviruses, adeno-associated virus (AAV) and Avipox. Methods of transforming viral vector will an exogenous DNA construct are also well described in the art. See Sambrook and Russell, above.
[0144] Liposome vectors are unilamellar or multilamellar vesicles, having a membrane portion formed of lipophilic material and an interior aqueous portion. The aqueous portion is used is the present invention to contain the polynucleotide material to be delivered to the target cell. It is generally preferred that the liposome forming materials have a cationic group, such as a quaternary ammonium group, and one or more lipophilic groups, such as saturated or unsaturated alkyl groups having about 6 to about 30 carbon atoms. One group of suitable materials is described in European Patent Publication No. 0187702, and further discussed in U.S. Pat. No. 6,228,844 to Wolff et al., the pertinent disclosures of which are incorporated by reference. Many other suitable liposome-forming cationic lipid compounds are described in the literature. See, e.g., L. Stamatatos, et al., Biochemistry 27:3917 3925 (1988); and H. Eibl, et al., Biophysical Chemistry 10:261 271 (1979). Alternatively, a microsphere such as a polylactide-coglycolide biodegradable microsphere can be utilized. A nucleic acid construct is encapsulated or otherwise complexed will the liposome or microsphere for delivery of the nucleic acid to a tissue, as is known in the art.
[0145] Alternatively, the nucleic acid (e.g., DNA or RNA) may be incorporated in a cell in vitro or ex vivo by transfection or transformation and the transfected or transformed cell (e.g., an immune cell such as a dendritic cell), which expresses the protein or polypeptide of interest (or a fragment thereof), may be administered to the host. Following administration, the cell will express the protein or polypeptide of interest (or a fragment thereof) in the host which will in turn lead to the induction of an immune response directed against the protein, polypeptide or fragment thereof.
[0146] Also encompassed by the methods, uses, pharmaceutical compositions and kits of the present invention is passive immunization, which is the injection of antibodies or antiserum, previously generated against the pathogen, in order to protect or cure a recipient animal of an election or future infection. Protection fades over the course of a few weeks during which time the active immunization with protein and/or DNA (as described above) will have time to generate a lasting protective response. Serum for passive immunization can be generated by immunization of donor animals using the S. aureus antigens (proteins, polypeptides or nucleic acids), as described above. This serum, which contains antibodies against the antigens, can be used immediately or stored under appropriate conditions. It can be used to combat acute infections (IMI) or as a prophylactic (Tuchscherr et al., 2008). Use of antibodies or serums in a passive immunization can be combined with other agents such as an antibiotic to increase the cure rate of an infection currently in progress or to increase protection against an imminent infection.
[0147] Also encompassed by the methods, uses, pharmaceutical compositions and kits of the present invention is immunization with the Staphylococcus aureus bacteria in attenuated live or inactivated form (e.g., S. aureus having at least one of the genes of the present invention mutated (e.g., 442a, 442b and 720 of SACOL442 and SACOL720, as described in Example 6). Mutation as used herein includes a substitution, a deletion and/or an insertion of one or more nucleotides that prevents expression of the polypeptide encoded by a gene of the present invention or that prevents expression of a functional polypeptide. In a preferred embodiment, the mutation prevents expression of the polypeptide (e.g., 442a, 442b and 720 of SACOL442 and SACOL720, as described in Example 6). In another specific embodiment, the mutation is a deletion or an insertion. It is expected that a mutated strain of S. aureus having a mutation at any position of one of the genes of the present invention that prevents expression of the polypeptide can be used as an attenuated live vaccine in accordance will the present invention. Attenuated live vaccines, i.e. vaccines comprising the bacterium according to the invention in a live attenuated form, have the advantage over inactivated vaccines that they best mimic the natural way of infection. In addition, their replicating abilities allow vaccination with low amounts of bacteria; their number will automatically increase until it reaches the trigger level of the immune system. From that moment on, the immune system will be triggered and will finally eliminate the bacteria. A minor disadvantage of the use of live attenuated bacteria however might be that inherently there is a certain level of virulence left. This need not be a real disadvantage as long as the level of virulence is acceptable, i.e. as long as the vaccine at least decreases the mammal IMI symptoms. Of course, the lower the rest virulence of the live attenuated vaccine is, the less influence the vaccination has on weight gain during/after vaccination.
[0148] The components identified in accordance with the teachings of the present invention have a prophylactic and/or therapeutic value such as they can be used to raise an immune response to prevent and/or combat diseases or conditions, and more particularly diseases or conditions related to microbial infections.
[0149] The terms treat/treating/treatment and prevent/preventing/prevention as used herein, refers to eliciting the desired biological response, i.e., a therapeutic and prophylactic effect, respectively. In accordance with the subject invention, the therapeutic effect comprises one or more of a decrease/reduction in the severity of the disease (e.g., a reduction or inhibition of infection), a decrease/reduction in symptoms and disease related effects, an amelioration of symptoms and disease-related effects, and an increased survival time of the affected host animal, following administration of the at least one agent (or of a composition comprising the agent). In accordance with the invention, a prophylactic effect may comprise a complete or partial avoidance/inhibition or a delay of infection, and an increased survival time of the affected host animal, following administration of the at least one agent (or of a composition comprising the agent).
[0150] As used herein, the term pharmaceutically acceptable refers to vaccine components (e.g., excipients, carriers) and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a subject. Preferably, as used herein, the term pharmaceutically acceptable means approved by regulatory agency of the federal or state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and in humans. The term excipient refers to a diluent, carrier, or vehicle with which the vaccine components of the present invention may be administered. Sterile water or aqueous saline solutions and aqueous dextrose and glycerol solutions may be employed as carriers, particularly for injectable solutions.
[0151] In an embodiment, the agent of the present invention is administered in combination with an adjuvant or immunostimulant. Suitable adjuvant or immunostimulant that may improve the efficacy of components to raise an immune response include but is not limited to oils (e.g., mineral oils, emulsified oil such as EMULSIGEN-D), metallic salts (e.g., alum, aluminum hydroxide or aluminum phosphate), natural and artificial microbial components (e.g., bacterial liposaccharides. Freund's aduvants, muramyl dipeptide (MDP), cyclic-diguanosine-5-monophosphate (c-di-GMP), pathogen associated molecular patterns (PAMPS)), plant components (e.g., Quil A), and/or one or more substances that have a carrier effect (e.g., bentonite, latex particles, liposomes, ISCOM and polyphosphazine (PCPP) copolymers). Immunization will synthetic nanoparticles (such as those made from a biodegradable synthetic polymer like poly(D,L-lacticco-glycolic acid)) containing antigens plus ligands that signal through TLR to stimulate proinflammatory cytokines is also possible (Kasturi et al, 2011).
[0152] Vaccine components of the invention may be administered in a pharmaceutical composition. Pharmaceutical compositions may be administered in unit dosage form. Any appropriate route of administration may be employed, for example, parenteral, subcutaneous, intramuscular, intramammary, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraarticular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol or oral administration. Examples of specific routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, intramammary, oral (e.g., inhalation) transdermal (topical), transmucosal, and rectal administration.
[0153] Conventional pharmaceutical practice may be employed to provide suitable formulations a compositions to administer such vaccine components with a without adjuvants to subjects. Methods well known in the art for making pharmaceutical compositions and formulations are found in, for example, Remington: The Science and Practice of Pharmacy, (20.sup.th ed.) ed. A. R. Gennaro A. R. 2000, Lippincott: Philadelphia. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, miglyol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for compounds of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation or intramammary injection may contain excipients, or example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, miglyol, glycocholate and deoxycholate, or may be oily solutions (e.g., paraffin oil) for administration in the form of nasal drops, or as a gel.
[0154] Therapeutic formulations may be in the form of liquid sections or suspension, for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols. Solutions or suspensions used for parenteral, intradermal, intramammary or subcutaneous application can include the following components a sterile diluent such as water for injection, saline solution, fixed oils (e.g., paraffin oil), polyethylene glycols, glycerine, propylene glycol, miglyol or other synthetic solvents, antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; reducing agents such dithiothreitol, buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0155] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous or intramammary administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
[0156] Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets or feed. For the purpose of oral vaccine administration, the active components can be incorporated with excipients and used in the form of tablets, troches, capsules or in feed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth a gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0157] For administration by inhalation, the vaccine components are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
[0158] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0159] Liposomal suspensions (including liposomes targeted to specific cell types) can also be used as pharmaceutically acceptable carriers.
[0160] The pharmaceutical compositions may also contain preserving agents, solubilising agents, stabilising agents, wetting agents, emulsifiers, sweeteners, colorants, odorants, salts for the variation of osmotic pressure, buffers, coating agents or antioxidants. They may also contain other therapeutically valuable agents.
[0161] Intravenous, intramuscular, intramammary or oral administration is a preferred form of use. The dosages in which the components of the present invention are administered in effective amounts depend on the nature of the specific active ingredient, the host and the requirements of the subject and the mode of application. In general, an amount of about 0.01 mg-500 mg per dose, come into consideration.
[0162] Toxicity or efficacy of vaccine components to elicit an immune response can be determined by standard procedures in cell cultures or experimental animals. The dose ratio between toxic and immune stimulatory effects can be measured. Components that exhibit large ratios are preferred. While components that exhibit toxic side effects may be used, care should be taken to design a delivery system in order to minimize potential damage to cells and, thereby, reduce side effects.
[0163] Data obtained from cell culture assays and laboratory animal studies can be used in formulating a range of dosage for use in large animals and humans. The dosage of such components lies preferably within a range of administered concentrations that include efficacy with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
[0164] The skilled artisan will appreciate that certain factors may influence the dosage required to effectively raise an immune response in a subject. Moreover, the therapeutically effective amount of a component of the present invention may require a series of doses.
[0165] The present invention also encompasses kits comprising the components of the present invention. For example, the kit can comprise one or more components. The components can be packaged in a suitable container and device for administration. The kit can further comprise instructions for using the kit.
[0166] The present invention also provides a method of diagnosing Staphylococcal IMI in a mammal, said method comprising determining a level of expression of at least one gene, wherein said gene is SACOL0029, SACOL0100, SACOL0101, SACOL0105, SACOL0148, SACOL0154, SACOL0204, SACOL0205, SACOL0264, SACOL0442, SACOL0461, SACOL0608, SACOL0660, SACOL0688, SACOL0690, SACOL0704, SACOL0718, SACOL0720, SACOL0829, SACOL1054, SACOL1142, SACOL1145, SACOL1320, SACOL1353, SACOL1416, SACOL1611, SACOL1637, SACOL1680, SACOL1781, SACOL1812, SACOL1867, SACOL1912, SACOL1944, SACOL2092, SACOL2144, SACOL2169, SACOL2171, SACOL2321, SACOL2325, SACOL2342, SACOL2365, SACOL2379, SACOL2385 or SACOL2599, based on the gene nomenclature from the Staphylococcus aureus COL (SACOL) genome set forth in NCBI Reference Sequence NC_002951.2, or the level of activity of a polypeptide encoded by said one or more genes (at least one gene), in a biological sample from said mammal, and comparing said level of expression or activity to a reference level of expression or activity, wherein a higher expression or activity in said biological sample relative to said reference expression or activity is indicative that said mammal has staphylococcal IMI.
[0167] In an embodiment, the above-mentioned reference expression or activity is a level of expression or activity determined in a corresponding biological sample from a mammal known to not having staphylococcal IMI. Such reference expression or activity may be an expression or activity corresponding to an average or median expression or activity calculated based on measurements made in several subjects not suffering from the condition (e.g., known to not having staphylococcal IMI). The reference expression or activity may be adjusted or normalized for age, gender, race, or other parameters.
[0168] In an embodiment, the above mentioned at least one gene is SACOL0029, SACOL0264, SACOL0442, SACOL0718, SACOL0720, SACOL1353, SACOL1416, SACOL1611, SACOL1944, SACOL2144, SACOL2365 or SACOL2599.
[0169] Sample or biological sample refers to any solid or liquid sample isolated from a live being. In a particular embodiment, it refers to any solid (e.g., tissue sample) or liquid sample isolated from a mammal, such as milk, a biopsy material (e.g., solid tissue sample), blood (e.g., plasma, serum or whole blood), saliva, synovial fluid, urine, amniotic fluid and cerebrospinal fluid. Such sample may be, for example, fresh, fixed (e.g., formalin-, alcohol- or acetone-fixed), paraffin-embedded or frozen prior to analysis of the infectious agents expression level.
[0170] In an embodiment, the above-mentioned biological sample is milk.
[0171] In an embodiment, the above mentioned mammal is a cow.
[0172] In an embodiment, the above-mentioned level of expression is determined by measuring the level of expression of a polypeptide/protein encoded by said one or more genes. Methods to measure the amount/level of selected polypeptides/proteins of this invention (one or more of the polypeptides noted above) are well known in the art. Protein/polypeptide levels may be detected either directly using affinity reagents, such as an antibody or a fragment thereof (for methods, see for example Harlow, E. and Lane, D (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), or a ligand (natural or synthetic) which binds the protein.
[0173] Protein/polypeptide levels may be detected based on other properties, for example by measurement of the protein's activity, which may entail enzymatic activity to produce a detectable product (e.g., with altered spectroscopic properties) or a detectable phenotype (e.g., alterations in cell growth/function).
[0174] Examples of methods to measure the amount/level of selected proteins/polypeptides include, but are not limited to: Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry microcytometry, microarray, microscopy, flow cytometry, and assays based on a property of the protein including but not limited to DNA binding, ligand binding, interaction with other protein partners or enzymatic activity.
[0175] In an embodiment, the amount of the polypeptide/protein within the methods of the present invention is detected using antibodies that are directed specifically against the polypeptide/protein. The term antibody as used herein encompasses monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired biological activity or specificity. Antibody fragments comprise a portion of a full-length antibody, generally the antigen binding or variable region thereof. Interactions between antibodies and a target polypeptide are detected by radiometric, colorimetric, or fluorometric means. Detection of antigen-antibody complexes may be accomplished by addition of a secondary antibody that is coupled to a detectable tag, such as for example an enzyme, fluorophore, or chromophore.
[0176] Methods for making antibodies are well known in the art. Polyclonal antibodies can be prepared by immunizing a suitable subject (e.g., rabbit, goat, mouse, or other mammal) with the polypeptide/protein of interest or a fragment thereof as an immunogen. A polypeptide/protein fragment portion or segment is a stretch of amino acid residues of at least about 5, 7, 10, 14, 15, 20, 21 or more amino acids of the polypeptide noted above. The antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized exosomal marker polypeptide or a fragment hereof. At an appropriate time after immunization, e.g., when the antibody titers are highest, antibody-producing cells can be obtained from the animal usually a mouse, and can be used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256: 495-497, the human B cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4: 72), the EBV-hybridoma technique (Cole et al. (1985) in Monoclonal Antibodies and Cancer Therapy, ed. Reisfeld and Sell (Alan R. Liss, Inc., New York, N.Y.), pp. 77-96) or trioma techniques. The technology for producing hybridomas is well known (see generally Coligan et al., eds. (1994) Current Protocols in Immunology, John Wiley & Sons, Inc., New York, N.Y.).
[0177] Alternatively to preparing monoclonal antibody-secreting hybridomas, a monoclonal antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with a polypeptide or a fragment thereof to thereby isolate immunoglobulin library members that bind the polypeptide. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01, and the Stratagene SurfZAP Phage Display Kit, Catalog No. 240612).
[0178] Furthermore, antibodies directed against one or more of the polypeptides/proteins described herein may be obtained from commercial sources.
[0179] The use of immobilized antibodies specific for the polypeptides/proteins is also contemplated by the present invention and is well known by one of ordinary skill in the art. The antibodies could be immobilized onto a variety of solid supports, such as magnetic or chromatographic matrix particles, the surface of an assay place (such as microtiter wells), pieces of a solid substrate material (such as plastic, nylon, paper), and the like. An assay strip could be prepared by coating the antibody or a plurality of antibodies in an array on solid support. This strip could then be dipped into the test sample and then processed quickly through washes and detection steps to generate a measurable signal, such as a colored spot.
[0180] The analysis of a plurality (2 or more) of polypeptides/proteins may be carried out separately or simultaneously with one test sample. Several polypeptides/proteins may be combined into one test for efficient processing of a multiple of samples.
[0181] The analysis of polypeptides/proteins could be carried out in a variety of physical formats as well. For example, the use of microtiter plates or automation could be used to facilitate the processing of large numbers of test samples. Alternatively, single sample formats could be developed to facilitate immediate treatment and diagnosis in a timely fashion. Particularly useful physical formats comprise surfaces having a plurality of discrete, addressable locations for the detection of a plurality of different analytes. Such formats include protein microarrays, or protein chips (see, e.g., Ng and Ilag, J. Cell Mol. Med. 6: 329-340, 2002) and capillary devices.
[0182] In an embodiment, the above mentioned level of expression is determined by measuring the level of expression of a mRNA transcribed from said one or more genes.
[0183] Methods to determine nucleic acid (mRNA) levels are known in the art, and include for example polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), SAGE, quantitative PCR (q-PCR). Southern blot, Northern blot, sequence analysis, microarray analysis, detection of a reporter gene, or other DNA/RNA hybridization platforms. For RNA expression, preferred methods include, but are not limited to: extraction of cellular mRNA and Northern blotting using labeled probes that hybridize to transcripts encoding all or part of one or more of the nucleic acids encoding the protein/polypeptide of this invention, amplification of mRNA expressed from one or more of the nucleic adds encoding the proteins/polypeptides of this invention using specific primers, polymerase chain reaction (PCR), quantitative PCR (q-PCR), and reverse transcriptase polymerase chain reaction (RT-PCR), followed by quantitative detection of the product by any of a variety of means; extraction of total RNA from the biological sample, which is then labeled and used to probe cDNAs or oligonucleotides encoding all or part of the nucleic acids encoding the proteins/polypeptides of this invention, arrayed on any of a variety of surfaces.
[0184] The present invention also provides a kit or package comprising reagents useful for determining the amount/level of one or more proteins/polypeptides of the present invention, for example a ligand that specifically bind to proteins/polypeptides, such as a specific antibody, or to a nucleic acid encoding a protein/polypeptide, such as an oligonucleotide (e.g., primer or probe). Such kit may further comprise, for example, instructions for the diagnosis of Staphylococcal IMI, control samples (e.g., samples to which the test sample may be compared to establish the diagnostic), containers, reagents useful for performing the methods (e.g., buffers, enzymes, immunodetection reagents, etc). The kit may further include where necessary agents for reducing background interference in a test, agents for increasing signal, software and algorithms for combining and interpolating marker values to produce a prediction of clinical outcome of interest, apparatus for conducting a test, calibration curves and charts, standardization curves and charts, and the like. The present invention also provides a kit or package comprising one or more agents of the present invention for treating and/or preventing Staphylococcal IMI. Such kit may further comprise, for example, instructions for the prevention and/or treatment of IMI in a mammal.
[0185] The use of the word a or an when used in conjunction with the term comprising in the claims and/or the specification may mean one but it is also consistent with the meaning of one or more, at least one, and one or more than one.
[0186] As used in this specification and claim(s), the words comprising (and any form of comprising, such as comprise and comprises), having (and any form of having, such as have and has), including (and any form of including, such as includes and include) or containing (and any form of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional, un-recited elements or method steps.
MODE(S) FOR CARRYING OUT THE INVENTION
[0187] The present invention is illustrated in further details by the following non-limiting examples.
EXAMPLE 1
Materials and Methods
[0188] Staphylococcus aureus strains. Two types of Staphylococcus aureus isolates from cows were used in this study: chronic and systematically isolated strains (i.e. strains isolated from bovine mastitis with clinical signs (high somatic cell counts (SCC) in milk or signs of inflammation). Chronic isolates were from cows shedding a genetically identical S. aureus strain >56 days apart, between dry off and calving as illustrated in
TABLE-US-00002 TABLE II Staphylococcus aureus mastitis isolates used in the studies described herein Interval Isolate Type Date (days) Herd Cow Quarter 3 Chr 20 Oct. 2005 3 37 1 151 Chr 4 Jan. 2006 77 3 37 1 54 Chr 18 Nov. 2005 2 147 4 353 Chr 10 Feb. 2006 85 2 147 4 140 Chr 1 Jan. 2006 8 46 3 552 Chr 3 Apr. 2006 93 8 46 3 205 Chr 31 Jan. 2006 8 40 4 996 Chr 20 May. 2007 110 8 40 4 557 Chr 3 Apr. 2006 3 16 1 1429 Chr 29 Jun. 2006 88 3 16 1 2099 Chr 25 Aug. 2006 2 96 3 3992 Chr 17 Nov. 2006 85 2 96 3 1290 Chr 16 Jul. 2006 1 83 4 2483 Chr 8 Sep. 2006 55 1 83 4 2484 Chr 15 Sep. 2006 4 39 1 4210 Chr 8 Dec. 2006 85 4 39 1 3237 Chr 29 Sep. 2006 4 36 4 4334 Chr 22 Dec. 2006 85 4 36 4 G3 R 15 Mar. 2006 12 19 C G6 R 16 Mar. 2006 11 249 C G7 R 16 Mar. 2006 11 156 C G11 R 22 Mar. 2006 5 28 C G17 R 3 Apr. 2006 10 106 C G18 R 24 Mar. 2006 7 15 C G23 R NA NA NA NA G26 R 6 Apr. 2006 6 135 C G28 R 13 Apr. 2006 5 32 C G51 R 16 Nov. 2005 5 13 C 275 R NA NA NA NA SHY97-3906 R From mastitis; Diarra, MS et al., 2002; Allard et al., 2006 NA Newbould R From mastitis; Prasad and Newbould, 1968 (ATCC 29740) NA ATCC 49775 Reference strain from human ATCC 51811 Reference strain from human MRSA COL Reference MRSA strain from human N315 Reference MRSA strain from human Chr, chronic; R, random; C, mix of all quarters; NA, not available
[0189] Comparative genomic hybridization of S. aureus isolates. The genetic relatedness of S. aureus isolates was determined by comparative genomic DNA hybridization data obtained for 530 genes printed on arrays as described previously (Atalla et al., 2008) and is shown in
[0190] Production of biofilms by S. aureus isolates Biofilm formation was evaluated by spectrophotometry in microplates using crystal violet staining, as previously described with a few modifications (Brouillette et al., 2005). Briefly, strains were cultured from frozen stocks onto BHI agar plates and mediated overnight at 35 C. Three colonies were then inoculated into 7 ml of BHI containing 0.25% of supplemental glucose and incubated at 35 C. for 18 h with shaking at 225 rpm. This culture was then diluted to 0.5 McFarland in BHI 0.25% glucose and transferred into wells of a flat-bottom polystyrene microtiter plate half full of the same medium. The plates were then incubated at 35 C. for 24 or 48 h. The supernatant was then discarded and the wells were delicately washed three times with 200 l of PBS. The plates were dried, stained for 30 min with crystal violet, washed twice with 200 l of water and allowed to dry again. A volume of 200 l of 95% ethanol was added to each well and plates were incubated at room temperature for 1 h with frequent agitation. The absorbance of each well was then measured at 560 nm using a plate reader (Bio-Tek Instruments). The results were collected from at least three independent experiments in which the biofilm formation of each culture tested was evaluated in four replicates.
[0191] In vitro culture conditions. For bacterial growth in low and high iron concentrations, bacteria were first grown in Mueller-Hinton broth (MHB, Becton Dickinson Sparks, Md., USA) in an orbital shaker (225 RPM) at 35 C. At an A.sub.600 nm of 0.6 (approx 110.sup.6 CFU/ml), the culture was divided in two pre-warmed sterile flasks. Iron limitation was induced by addition of 2,2-dipyridyl (Sigma Chemicals, St-Louis, Mo.) at 600 M to one culture, whereas FeCl.sub.3 was added to the other culture at 10 M. The growth rate of S. aureus in the presence of supplemental 2,2-dipyridyl or FeCl.sub.3 was equivalent in both test conditions and these supplements did not affect the exponential growth during the one-hour treatment period. After 1 h, the cultures reached an A.sub.500 nm of 1.0 (approx. 10.sup.9 CFU/ml) and 5 ml of each culture were treated with RNAprotect (QIAgen, Mississauga, ON, Canada) for 10 min before harvesting the cells by centrifugation. For bacterial growth in freshly collected non-mastitic milk, S. aureus SHY97-3906, #3, #557 and #1290 were first grown overnight in MHB in an orbital shaker (225 RPM) at 35 C. In the morning, 250 ml of fresh milk was inoculated with bacteria from the overnight culture to obtain a bacterial concentration of approximately 10.sup.4 CFU/ml. Bacterial growth was allowed for 7 h in an orbital shaker (225 RPM) at 35 C. before isolating the bacteria from milk as described below. For bacterial growth destined to the qPCR amplification of icaC and hld genes, S. aureus was grown in brain heart infusion (BHI) broth (BD, ON, Canada) until the cultures reached an A.sub.600 nm of 0.6.
[0192] Animals. All animal experiments were approved by local institutional animal care committees and conducted in accordance with the guidelines of the Canadian Council on Animal Care. Animals were kept in a level 2 confinement barn for the entire duration of each trial. Eight Multiparous Holstein cows in mid lactation were housed at the Dairy and Swine Research and Development Centre of Agriculture and Agri-Food Canada in Sherbrooke, QC, Canada. Cows were selected as not infected before the experiment by bacterial analysis of aseptic milk samples and somatic cell count (SCC) determination.
[0193] Experimental infections. Before the animal trials, the relation between the absorbance of bacterial cultures (A.sub.600 nm) and CFU was determined as previously described (Petitclerc et al., 2007). The morning of the challenge, a volume of the overnight culture of S. aureus in MHB was transferred to 200 ml of fresh MHB to obtain an A.sub.600 nm of 0.1 and grown at 35 C. without shaking until the A.sub.600 nm reached a value corresponding to 10.sup.8 CFU/ml in the exponential phase of growth. Bacteria were then diluted in sterile physiological saline (Baxter Healthcare Corporation, Deerfield, Ill.) to obtain 50 CFU in 3 ml. Intramammary (IM) infusions were performed the same day immediately after the late evening milking. Each individual mammary gland quarter was infused with 3 ml of a bacterial suspension. Each of the 8 cows was infused with the four different S. aureus strains and the position of each strain in the four quarters alternated between the animals. Infusion of mammary quarters with bacteria was performed according to the procedure described by Nickerson et al. (1999) with few modifications. All infusions were performed after milking. Before inoculation, the teat end of each quarter was thoroughly wiped to remove gross contamination and dipped in a solution of iodine. After a minimum of 30 second contact time, teats were wiped dry and subsequently scrubbed with gauzes soaked in 70% ethanol. Teats were allowed to air-dry. Foremilk was then discarded and the IM infusion was performed. Immediately afterwards, all quarters were thoroughly massaged and teats dipped again with an iodine solution. Disposable gloves were worn throughout the procedure and changed before proceeding to the next animal.
[0194] Milk samples. Milk samples were always aseptically collected before milking the experimentally infected cows using the procedure suggested by the National Mastitis Council (1996). After foremilk was discarded, a 10 ml milk sample was collected for each individual quarter in a 50 ml sterile vial. Milk samples were serially diluted and 200 l plated on TSA and on mannitol salt agar plates (MSA; Becton Dickinson Sparks, Md., USA) for S. aureus identification. Plates were then incubated for 24 h at 35 C. before colony counting. The dilution that showed between 30 and 300 colonies was the one considered for the calculation of bacterial concentration. Considering the wide range of dilutions plated and the great number of samples to be tested, only one plate per sample was considered. Samples that showed 0 colonies for the undiluted milk was considered to have a concentration of 5 CPU/ml. The concentration of lactose, protein, fat and SCC in milk which indicates the presence of leukocytes in response to an infection were determined in a commercial laboratory (Valacta Inc., Ste-Anne-de-Bellevue, QC, Canada). This was done every two days over the 18 day period of experimental infections.
[0195] Milk collection for bacterial isolation. Milk was collected from each quarter of each cow every 2-4 days in the morning for a total of 18 days. Milk was harvested using individual quarter milking units. Prior to milking, the four reservoirs were disinfected with 70% ethanol. A maximum of one litre of milk was collected for centrifugation and isolation of bacteria.
[0196] Bacterial isolation from milk. Mastitic milk from experimentally infected cows or freshly collected milk from non-infected cows used for bacterial growth in vitro was treated with 200 g/ml of protease from bovine pancreas (Sigma) for 10 min in an orbital shaker (100 RPM) at 35 C. After the treatment, the milk was centrifuged 15 minutes at 4000 g. The supernatant was discarded and the pellet was washed with PBS and centrifuged. The supernatant was discarded and the bacterial cell pellet was suspended in 1 ml PBS and treated with RNAprotect for 10 min before harvesting the cells by centrifugation. The cell pellet was then stored frozen at 86 C.
[0197] RNA extraction and purification. Bacterial pellets from in vitro and in vivo growth conditions were suspended in 200 l of TE buffer containing 200 g/ml lysostaphin (Sigma). Cell lysis was allowed for 1 h at room temperature before RNA extraction with the TRIzol Max bacterial RNA isolation Kit (Invitrogen, Carlsbad, Calif., USA) followed by a DNase treatment with TURBO DNase (Ambion, Austin, Tex., USA) RNA from bacteria isolated from the milk of infected cows underwent an additional purification step using the MICROBEnrich Kit from Ambion followed by a second round of DNase treatment with TURBO DNase (Ambion). The RNA concentration in samples was determined by an A.sub.260 nm reading and the samples were stored at 86 C. until used.
[0198] cDNA probe synthesis. Fluorescent probes for hybridization to DNA arrays were generated through an aminoallyl cDNA labelling procedure. Briefly, 2.5-5 g of total RNA was mixed with 5 g of random hexamers (Amersham Biosciences, Piscataway, N.J., USA). This mixture was denatured at 70 C. for 10 min. Reverse transcription was carried out in the presence of RT buffer (Invitrogen), 10 mM DDT, dNTP mix (final concentration: 500 M dATP, dCTP, dGTP, 300 M dTTP and 200 M 5-[3-Aminoallyl]-2-dUTP (Sigma)) and 400 U of Superscript II RT was added to the RNA preparation and the reaction was allowed to occur for 2 h at 42 C. The RNA was hydrolyzed after transcription with 200 mM NaOH and 100 mM EDTA at 65 C. for 15 min. The reaction was neutralized with 333 M HEPES pH 7.5. The cDNAs were purified before fluorescent labeling through three passages on a Microcon YM30 (Millipore) the resulting aadUTP-cDNA was coupled with NHS-Cy5 (Fluorolink Cy5 monoreactive pack, Amersham Biosciences) in the presence of 100 M NaHCO.sub.3, pH 9.0 for 1 h at room temperature. The reactions were quenched with 125 M hydroxylamine for 15 min at room temperature. The fluorescent cDNAs were purified by using a QIAquick PCR purification kit (QIAgen), inducing three washing steps will buffer PE, before eluting in water.
[0199] DNA arrays. Arrays were previously described (Allard et al., 2006, Moisan et al., 2006) and contained a selection of 530 known or putative genes implicated in iron/cation-transport and acquisition systems, virulence (biofilm genes, adhesins, toxins and homologs of such genes), secretion, general stress responses, sensory/regulator systems, antibiotic resistance and various biosynthesis and metabolism genes. Genes were first amplified by PCR using Sigma Genosys (Oakville, ON, Canada) primers based on the published genome sequence of the S. aureus COL genome as well as other primers that were designed using the Primer3 software (primer3_www.cgi v 0.2). PCR products were then purified using the QIAquick PCR purification kit, precipitated, suspended at a concentration of 150 ng/l in 50% DMSO and printed in triplicate on Coming GAPS II sides (Corning, Corning, N.Y., USA) with the help of the Microarray printing platform of the Biotechnology Research Institute of Montreal (Montreal, QC, Canada). Control spots were from the Lucidea Universal Scorecard (Amersham, Piscataway, N.J.).
[0200] Hybridization to DNA arrays and analysts. The probes were suspended in 16.5 l of hybridization buffer (5SSC, 0.1% SDS, 25% formamide). The prehybridization, hybridization and washing steps were done as prescribed for Corning Gaps II Slides. Hybridization signals for each spot were quantified with the ScanArrayExpress Microarray Scanner and the ScanArrayExpress software V 2.2.0.0022 (Perkin Elmer, Wellesley, Mass., USA). A mean intensity value was calculated as the: (intensity of every spots)/number of genes on array=100%. Only genes with a Cy5 signal intensity of 100%, i.e., greater or equal to the mean Cy5 intensity of the entire array were analyzed. Thus, this report identifies only genes that were strongly expressed in vivo during mastitis because their signal intensities on arrays were higher than average.
[0201] Quantitative PCR (qPCR). Additional RNA preparations ware obtained for qPCR analyses. Bacteria were collected from broth cultures (low-iron and iron-rich) as well as from milk (in vitro and in vivo) as described above. Also, RNA was extracted as mentioned earlier. Total RNA (2-5 g) was reversed transcribed with 0.5 mM dNTP, 50 ng random hexamers and 200 U of Invitrogen Superscript II Reverse Transcriptase according to the manufacturer recommendations. RNA was denatured and the cDNAs were purified with QIAquick PCR purification kit. One l of cDNA was amplified on the Stratagene MX3000P Real-Time PCR (Sratagene, LaJolla, Calif. USA) with a master mix composed of 6 mM Tris-HCl pH 8.3, 25 mM KCl, 4 mM MgCl2, 75 mM trehalose, 0.1% (v/v) Tween 20, 0.1 mg/ml nonacetylated BSA, 0.07 SYBR green (Invitrogen), 125 nM dNTPs and 0.5 U JumpStart Taq DNA Polymerase (Sigma), and 100 nM of the primers listed in Table III below. Reaction mixtures were denatured for 10 min at 95 C., followed by 40 cycles of 1 min at 60 C., 1 min at 72 C. and finished with a dissociation ramp from 55 C. to 95 C. The level of expression of each gene was calculated by using the Ct of the in vitro experiments as the calibrator (expression fold=2.sup.Ct, where Ct represents the difference between the Ct of the in vitro and in vivo conditions). The fold expression of genes from each experiment was then normalized with their respective gyrB expression level. The gyrB gene was found to be constitutively expressed during growth up to the early stationary phase (Goerke et al., 2000), which is well within the boundaries of the growth experiments described herein. Also, it was found that the expression of gyrB in the in vitro as well as in the in vivo conditions was not significantly modulated.
TABLE-US-00003 TABLEIII SequenceofprimersusedforquantitativePCR(qPCR). ORF Gene Description Forwardsequence Reversesequence SACOL0005 gyrB DNAgyrase,B GGTGCTGGGCAAATACAAGT TCCCACACTAAATGGTGCAA subuni (SEQIDNO:1) (SEQIDNO:2) SACOL0148 cap Capsular AGGTCCTAGACCAGCGCTTT TCTCTCCCATCACTTGAGC M polysaccharide (SEQIDNO:3) (SEQIDNO:4) biosynthesis SACOL0442 Exotoxin, CATACACAGTTGCTGGCAGAG CAAGCCATAGGAAATATGAGCA putative (SEQIDNO:5) (SEQIDNO:6) SACOL0718 ABC GCACAAGAAGTGTTGCGAGA GTCGTTTTCCCAGATCCAGA transporter, (SEQIDNO:7) (SEQIDNO:8) unknown function SACOL2022 hld Delta- TAATTAAGGAAGGAGTGATTTCA TTTTTAGTGAATTTGTTCACTGTGT hemolysin, ATG C RNAIII (SEQIDNO:9) (SEQIDNO:10) SACOL2171 Unknown CAATGCATCGCGAAAACTTA GCTTAGCTTGTGGGAACTGG function, (SEQIDNO:11) (SEQIDNO:12) possibly iron-related SACOL2325 Transcriptional CATCTCGGCTTAGGTTACGC TTTTTCGGCCTAAGTTTGGA regulator,LysR (SEQIDNO:13) (SEQIDNO:14) family SACOL269 icaA Biosynthesisof TTGCGTTAGCAAATGGAGAC AATGCGTGCAAATACCCAAG polysaccharides, (SEQIDNO:15) (SEQIDNO:16) biofilms
[0202] Sequence alignments. Nucleic acid and amino acid sequences of S. aureus genes (including SACOL0442 and SACOL0720, as well as other genes) and encoded proteins from Staphylococcus aureus strains COL, RF122, NCTC 8325, JH1, JH9, Newman, Mu3, Mu50, USA300-FPR3757, N315, MW2 or MSSA476 were obtained from the Comprehensive Microbial Resource (CMR) of the J. Craig Venter Institute at http://cmr.jcvi.org/ligr-scripts/CMR/CmrHomePage.cgi (Peterson, J. D., et al., Nucleic Acids Res. 2001 29(1): 123-5). The sequences were submitted to a multiple sequence alignment program for DNA or proteins, ClustalW2, available online for free from the European Bioinformatics Institute (www.ebi.ac.uk; Larkin M. A. et al., 2007 Bioinformatics 23(21): 2947-2948).
[0203] Purification of proteins encoded by S. aureus genes expressed during IMI. Genes or part of the genes were cloned into the vector pQE-30 (Qiagen) downstream to a polyhistidine signal to allow protein expression in Escherichia coli and purification of the expressed his-tagged polypeptides using a nickel affinity column (Qiagen Ni-NTA 1018244). Expression of the recombinant proteins and their purification was performed according to the manufacturer's recommendations (Qiagen).
[0204] Immunization mammalian species and measurement of antibody titers. Mice were immunized with the antigens (purified recombinant proteins, polypeptides or epitopes of interest, alone or in combination). For example, each animal group composed of ten mice received a different antigen (100 g per injection), a combination of antigens (100 g of each per injection) or saline (i.e. the control non-immunized group). Mice were immunized twice 3 weeks apart. The antigens or saline was combined with the adjuvant Emulsigen-D (MVP Technologies, Omaha, USA). Injections were performed subcutaneously in 400 l on the back of the mice. Blood samples were performed in the mandibular vein before each injection and, 3 weeks after the second injection, mice were euthanized and maximum blood was sampled. The levels of specific antibodies against the immunizing antigens were determined. Levels of antibodies were evaluated using standard ELISA methodology (Loiselle et al., 2009). Briefly 96-well plates were coated with individual purified antigen and then saturated with non-specific protein. After incubation with serial dilutions of the serums and washes, a secondary antibody conjugated to an enzyme (HRP) was added and the presence of antibodies was detected with a colorimeter reaction.
[0205] Immunization in cows. Each animal group composed of 5 cows receives a different antigen (300 g per injection), a combination of antigens (300 g of each per injection) or saline (i.e. the control non-immunized group). The antigens or saline is combined with the adjuvant Emulsigen-D. After blood samplings for the determination of pro-immune levels of antibodies, a final volume of 3 ml per dose of antigens or saline is injected subcutaneously in the neck of the cows. Blood samplings is performed every 2 weeks. Ten weeks after the first injection, the second injection is performed subcutaneously in the neck on the other side of the animals. The levels of the specific antibodies is determined as described for the mice immunization.
[0206] Evaluation of antibody binding on bacterial surface. Bacteria were incubated at 4 C., under gentle agitation, with a solution of PBS-2% BSA containing a 1/500 dilution of rabbit serum to block staphylococcal protein A, which can bind non specifically the Fc fragment of immunoglobulins. After 2 washes with PBS-2% BSA-0.02% tween20, bacteria were incubated at 4 C., under gentle agitation, in PBS-2% PBS containing 10 l of bovine pre immune or immune serum against the antigen of interest. After 2 washes with PBS-2% BSA-0.02% tween20, bacteria were incubated for one hour at 4 C., under gentle agitation, in PBS-2% PBS containing a 1/1000 dilution of FITC-conjugated goat anti-bovine IgG. After 3 washes with PBS-2% BSA-0.02% tween20, bacteria were suspended in PBS with 1% formaldehyde. Surface labeling was then analyzed by flow cytometry using a BD FACSCalibur instrument and the CellQuest Pro software.
[0207] Identification of B cell epitopes. With a combination of prediction software including BCPred Predictions (EL-Manzalawy et al., 2008a). AAP Predictions (Chen J et al., 2007). FBCPred Prediction (EL-Manzalawy et al., 2008b) and ABCPred (Saha, S and Raghava G. P. S., 2006), available at http://bioinfo.bgu.ac.il/bsu/immunology/epitope_pred/index.htm, http://ailab.cs.iastate.edu/bcpreds/index.html and elsewhere, B cell epitopes, i.e., short amino acid sequences that will be recognized by B cells, thus inducing the production of antibodies by B cells, were determined for several vaccine components.
[0208] Identification of T cell epitopes. Computer driven algorithms can also be used to facilitate identification of T cell epitopes i.e., short amino acid sequences that will bind MHC molecules (MHC class I and/or II) and be recognized by T cells, thus inducing a cellular immune response. The antigens may be subjected to analysis by the Epimatrix System (http://www.epivax.com/platform/) to identify putative T cell epitopes. This in-silico technique divides the total sequence of the antigen into fragments of 9 amino acids overlapping by 8 amino acids. This pool of 9-mer peptides is then screened for predicted affinity against a group of known MHC class I and class II alleles. The resulting scores can be used to rate putative epitopes on a common scale which can then be tested in vitro. The technique is applicable to any animal for which a sufficient knowledge of MHC sequences is available (De Groot et al., 2008).
EXAMPLE 2
Validation of Chronic S. aureus Strains
[0209] Comparative genomic hybridization data for the members of chronic isolate pairs collected from cows >55 days apart between dry-off and calving (
[0210]
EXAMPLE 3
Efficient Isolation of Bacteria from the Milk of Experimentally Infected Cows
[0211] The method used for isolating bacteria from mastitis milk samples is illustrated in
EXAMPLE 4
Experimental Infection Profiles in Cows
[0212] Experimental infection profiles for strain SHY97-3906 and the 3 chronic strains (#3, 557, 1290) in 3 different cows are reported in
EXAMPLE 5
S. aureus Genes Expressed During IMI in Cows
[0213] The transcriptional profile of S. aureus strains infecting the mammary glands of cows was determined by DNA microarray experiments. The relative levels of expression of the differentially expressed genes and the 20 genes expressed by both of the two groups of isolates (i.e., from chronic or acute mastitis) are reported in Table IV below.
[0214]
[0215] Several genes shown in
[0216] It was observed (i) that the expression of capM was reduced in cows and in milk compared to that seen in vitro, (ii) that gene SACOL2171 was up regulated by iron restriction either in cows, in milk or in iron-restricted broth in vitro, (iii) that the expression of SACOL0718 and SACOL2325 were specifically induced by the milk environment (i.e. up-regulated in cows compared to any broth in vitro but equivalent to that seen in fresh milk) and (iv) that gene SACOL0442 was exclusively expressed during infection in the cow, i.e., more expressed in cows compared to any other environment. The summary of the expression profile determined by DNA array and qPCR analyses for genes SACOL0442 and SACOL0718 in different strains, cows and time points during infection is reported in Table V below. As seen, SACOL442 and SACOL0718 are representative examples of S. aureus genes that exhibit sustained expression during IMI and this independently of individual S. aureus strains Table VI below lists 11 genes (i.e. SACOL442, SACOL0718 and 9 other genes) for which expression had never been reported before, when S. aureus was grown in other mammalian environments (i.e. different from the bovine mammary gland environment, as used herein) (Allard et al., 2006, Burtak et al., 2007; Goerke et al., 2000; Garzoni et al., 2007) or in surrogate cultivation media such as in human neutrophils in vitro (Voyich et al., 2005), an iron-restricted medium in vitro (Allard et al., 2006 Maresso et al., 2006), in milk in vitro (Lammers et al., 2000) or when S. aureus mastitis isolates were grown in vitro (Taverna et al., 2007). The genes depicted in Table VI thus represent excellent targets for prevention and/or treatment of S. aureus IMI, for example as components for a vaccine composition aimed at preventing S. aureus IMI. Also, reports of S. aureus genes expressed in surrogate media or in mammalian environment other than the mammary gland can actually lead away from what is reported here for S. aureus genes expressed during bovine IMI. For example, the gene capM (SACOL0148) was reported to be expressed in a mastitis isolate grown on a blood agar plate in vitro (Taverna et al., 2007) but is shown here to be less expressed during bovine IMI than that measured after growth in vitro (
[0217] Gene SACOL0718 identified in Tables III and V is part of an operon comprising genes SACOL0718 SACOL0720 as illustrated in
[0218] Table IV. S. aureus genes (43 genes) with significant levels of expression (intensity >100%) during bovine IMI as determined in microarray experiments. Genes are listed by name (if attributed) as well as by open reading frame (ORF) numbers for three different S. aureus strains for which the genome is sequenced (MRSA COL, N315 and the mastitis isolate RF122). Such genes are also reported in the Venn diagrams of
TABLE-US-00004 TABLE IV S. aureus genes (43 genes) with sigificant levels of expression (intensity >100%) during bovine IMI as determined in microarray experiments. Genes are listed by name (if attributed) as well as by open reading frame (ORF) numbers for three different S. aureus strains for which the genome is sequenced (MRSA COL, N315 and the mastitis isolate RF122). Such genes are also reported in the Venn diagrams of FIGS. 6 and 7. The 20 genes expressed by both chronic strains as well as by strain SHY97-3906 (common) are indicated by a plus (+) sign. Cow 307, Cow 307, ORF ORF ORF Day 8 Day 10 Gene COL RF122 N315 Description Common SHY97 #3 #557 #1290 SHY97 0029 35 Biosynthesis of cofactors + 106.6 sbnA 0100 55 112 Staphylobactin biosynthesis 440.5 sbnB 0101 56 113 Staphylobactin biosynthesis 559.4 sbnF 0105 60 117 Staphylobactin biosynthesis 395.7 capM 0148 102 156 Capsular polysaccharide biosynthesis + 1187.2 291.6 592.3 568.2 177.9 0154 108 162 Aldehyde dehydrogenase pflB 0204 164 218 Formate acetyltransferase + pflA 0205 165 219 Formate-lyase activating enzyme + 0264 216c 266 ABC transporter, unknown function 0442 321 357 Exotoxin, putative + 383.8 115.3 201.3 123.5 guaA 0461 341 376 GMP synthase + 396.3 213.0 720.5 555.2 331.7 sdrC 0608 513 519 Virulence adhesin + 132.3 adh 0660 557 562 Alcool deshydrogenase, Zn containing + 110.5 mntC 0688 581c 587 Manganese ABC transporter mntA 0690 583c 589 Manganese ABC transporter fhuA 0704 596 602 Ferrichrome transport ATP-binding protein 0718 610 616 ABC transporter, unknown function + 116.8 171.5 108.7 trxB 0829 717 719 Thioredoxin reductase menB 1054 912 898 Enoyl-CoA hydratase/isomerase family + 132.2 115.0 isdD 1142 996 979 Iron transport from heme + srtB 1145 999 982 Sortase B + 107.4 glpK 1320 1161 1141 Glycerol kinase 1353 1157 ABC transporter, unknown function 115.5 1416 1236c 1213 ABC transporter, unknown function 103.9 1611 1426c 1383 Transcription regulator homolog 118.0 dnaK 1637 1452c 1409 Chaperone protein csb8 1680 1452 Conserved protein 120.9 isdH 1781 1590c 1552 Iron transport from heme + 120.1 rot 1812 1622c 1583 Regulator of toxin, Rot 116.2 splC 1867 1671c 1629 Serine protease csb33 1912 1788c 1671 Glucosamine-6-phosphate isomerase + 110.8 186.8 1944 1818c 1702 Hypothetical protein + murA 2092 1984c 1902 UDP-NAcGlc-1-carboxyvinyltransferase + 104.2 2144 2033c 1958 ABC transporter, unknown function 377.6 2169 2060c 1981 Siderophore biosynthesis, putative + 2171 2062 1983 Siderophore biosynthesis, putative + 100.4 114.0 144.0 csb28 2321 2205c 2119 Oxidoreductase dehydrogenase/reductase 2325 2209 2123 Transcriptional regulator, LysR family + corA 2342 2226c 2137 Magnesium and cobalt transport protein 106.9 2365 2248c 2158 Hypothetical protein + 106.9 csb19 2379 2261 2170 Conserved protein 116.2 2385 2266 2175 HSP20 family protein 123.7 2599 2457c 2369 Homolog to FeoB, Fe2+ transport protein Proportion of genes (%) with significant level of expression (intensity >100%) on arrays 6.6 5.4 7.5 5.9 16.7 Cow 307, Cow 5325, ORF ORF ORF Day 10 Day 10 Gene COL RF122 N315 Description #3 #557 #1290 SHY97 #3 0029 35 Biosynthesis of cofactors 195.4 356.4 sbnA 0100 55 112 Staphylobactin biosynthesis sbnB 0101 56 113 Staphylobactin biosynthesis sbnF 0105 60 117 Staphylobactin biosynthesis capM 0148 102 156 Capsular polysaccharide biosynthesis 347.7 181.0 208.7 351.9 0154 108 162 Aldehyde dehydrogenase 136.8 pflB 0204 164 218 Formate acetyltransferase 1825.5 465.6 pflA 0205 165 219 Formate-lyase activating enzyme 1300.8 231.8 0264 216c 266 ABC transporter, unknown function 111.8 0442 321 357 Exotoxin, putative 227.2 145.1 115.8 guaA 0461 341 376 GMP synthase 335.6 135.6 156.5 209.8 sdrC 0608 513 519 Virulence adhesin 173.6 312.1 adh 0660 557 562 Alcool deshydrogenase, Zn containing 2228.3 168.2 mntC 0688 581c 587 Manganese ABC transporter 273.8 mntA 0690 583c 589 Manganese ABC transporter 168.8 fhuA 0704 596 602 Ferrichrome transport ATP-binding protein 162.1 0718 610 616 ABC transporter, unknown function 110.6 trxB 0829 717 719 Thioredoxin reductase 258.3 menB 1054 912 898 Enoyl-CoA hydratase/isomerase family 112.8 222.6 isdD 1142 996 979 Iron transport from heme 142.5 200.0 srtB 1145 999 982 Sortase B 109.3 125.2 434.1 672.1 glpK 1320 1161 1141 Glycerol kinase 163.2 1353 1157 ABC transporter, unknown function 1416 1236c 1213 ABC transporter, unknown function 117.1 1611 1426c 1383 Transcription regulator homolog dnaK 1637 1452c 1409 Chaperone protein 264.1 csb8 1680 1452 Conserved protein isdH 1781 1590c 1552 Iron transport from heme 117.2 rot 1812 1622c 1583 Regulator of toxin, Rot splC 1867 1671c 1629 Serine protease 111.0 csb33 1912 1788c 1671 Glucosamine-6-phosphate isomerase 176.5 158.2 220.9 1944 1818c 1702 Hypothetical protein 138.0 277.4 murA 2092 1984c 1902 UDP-NAcGlc-1-carboxyvinyltransferase 116.4 2144 2033c 1958 ABC transporter, unknown function 2169 2060c 1981 Siderophore biosynthesis, putative 112.8 177.3 2171 2062 1983 Siderophore biosynthesis, putative 128.4 csb28 2321 2205c 2119 Oxidoreductase dehydrogenase/reductase 129.9 2325 2209 2123 Transcriptional regulator, LysR family 242.1 364.9 corA 2342 2226c 2137 Magnesium and cobalt transport protein 2365 2248c 2158 Hypothetical protein 124.7 198.0 csb19 2379 2261 2170 Conserved protein 2385 2266 2175 HSP20 family protein 2599 2457c 2369 Homolog to FeoB, Fe2+ transport protein 101.8 Proportion of genes (%) with significant level of expression (intensity >100%) on arrays 16.7 16.1 15.4 7.6 8.3
TABLE-US-00005 TABLE V Mastitic milk samples in which the expression of SACOL0442 (upper panel) or SACOL0718 (lower panel) was detected on DNA array or by qPCR for 4 different S. aureus strains at 3 different time points in two cows. S. aureus strains Cow Day of infection SHY97-3609 3 557 1290 Gene SACOL0442 307 8 .circle-solid. .circle-solid. .circle-solid. .circle-solid. 307 10 .circle-solid. ND .circle-solid. .circle-solid. 307 14 .circle-solid. .circle-solid. .circle-solid. .circle-solid. 5325 10 .circle-solid. .circle-solid. .circle-solid. .circle-solid. Gene SACOL0718 307 8 .circle-solid. .circle-solid. .circle-solid. .circle-solid. 307 10 .circle-solid. .circle-solid. ND ND 307 14 .circle-solid. .circle-solid. .circle-solid. .circle-solid. 5325 10 .circle-solid. .circle-solid. .circle-solid. .circle-solid. ND, not detected.
TABLE-US-00006 TABLE VI Names and annotations for a selection of 11 genes or operons taken from the 43 genes found to be strongly expressed in microarray experiments (Table III above) and for which expression had never been reported when S. aureus was grown in a different mammalian environment or in surrogate cultivation media such as in human neutrophils in vitro, in iron-restricted media or in milk in vitro or when S. aureus mastitis isolates were grown in vitro. Annotations are compared for representatives of the S. aureus sequenced genomes (MRSA COL, N315, RF122 [a mastitis isolate], USA300, MSSA476). Gene SACOL COL N315 RF122 USA300 MSSA476 0442 enterotoxin, similar to hypothetical enterotoxin, putative putative exotoxin 2 protein putative exported protein 0718- ABC ABC ABC ABC putative ABC 0720 transporter, transporter, transporter, transporter, transporter ATP-binding ATP-binding ATP-binding ATP-binding protein and protein and protein and protein and protein and permease permease permease permease permease 2365 lipoprotein, hypothetical lipoprotein, lipoprotein, lipoprotein, putative protein, similar putative putative putative to TpgX protein 0029 HMG-CoA probable conserved synthase, HMG-CoA hypothetical truncation synthase protein 1416 peptide ABC oligopeptide probable peptide ABC putative transporter, transporter oligopeptide transporter, oligopeptide permease membrane membrane permease transport system protein, permease permease protein permease putative domain (opp2c) 1944 conserved conserved conserved conserved putative hypothetical hypothetical hypothetical hypothetical membrane protein protein protein protein protein 1611 transcriptional ferric uptake zinc-specific ferric uptake zinc-specific regulator, Fur regulator metalloregulator regulation metalloregulatory family homolog (zur) protein (fur) protein 2599 conserved hypothetical probable transporter putative domain protein protein, similar membrane gate domain membrane to ferrous iron protein protein protein transporter 2144 ABC ABC ABC ABC ABC transporter, transporter, transporter, transporter, transporter, ATP-binding ATP-binding ATP-binding ATP-binding ATP-binding protein protein protein protein protein 1353 ABC hypothetical ABC putative transporter, protein, similar transporter, membrane permease to ABC permease protein protein, transporter protein putative integral 0264 ABC conserved probable ABC ABC putative ABC transporter, hypothetical transporter ATP transporter, transporter ATP- ATP-binding protein binding protein ATP-binding binding protein protein protein
[0219] Mutants for genes SACOL0442 and SACOL0720 were produced by gene replacement for mutant 442a, (Mitchell et al., 2008) and by intron insertion for mutants 442b and 720 (TargeTron Gene Knockout System, Sigma Aldrich (Chen et al., 2007)). The mutants were carried out in the S. aureus parental strain ATCC 29213 that could be easily transformed by electroporation. For creating mutant 442a, a 223-pb fragment of gene SACOL0442 in strain ATCC 29213 was deleted and replaced by insertion of the 1300-bp erythromycin resistance gene ermA between positions 188 and 411 of the nucleotide sequence of SACOL0442. For creating mutants 442b and 720, the Group II intron (fragment size of approx. 2 Kb) from the TargeTron Gene Knockout System inserted itself into the target chromosomal gene between nucleotide positions 45 and 46 for gene SACOL0442 and between positions 803 and 804 for gene SACOL0720, respectively. Prior to experimental IMI with the mutants, their growth, compared to the parental strain, was evaluated in vitro in freshly collected milk (
EXAMPLE 7
Relatedness of Some S. aureus Genes and Proteins
[0220]
[0221] Similarly, Table VII below shows the percentage of similarity and identity of the amino acid sequences corresponding to some of the S. aureus genes expressed in vivo during bovine IMI (Table VI above) for some representatives of the sequenced S. aureus genomes. Again, a high degree of similarity and identity was observed (>92.7%), confirming that these genes and encoded proteins represent good target or protection against multiple S. aureus strains. There is also about 40% identity and about 60% similarity between the amino acid sequence of SACOL0442 and that of other putative exotoxins such as SACOL0469, SACOL0470, SACOL0472 and SACOL0473 (also known as SA0383 exotoxin 7 [set7], SA0384 exotoxin 8 [set8], SA0385 exotoxin 9 [set9] and SA0389 exotoxin 13 [set13] in strain N315, respectively) (www.jcvi.org). Although these components are not the same genes or proteins, it is possible to find common protein regions, fragments or epitopes for use in vaccines with broader applications and thus aim at the prevention and control of many types of S. aureus infections in addition to IMI. Some genetically related bacterial species or genus such as Staphylococcus epidermidis, Streptococcus, Listeria and others may also have homologs of these genes or proteins. Thus, it may also be possible to find common protein regions, fragments or epitopes for use in vaccines with broader applications aimed at the prevention and control of many types of bacterial infections. For example, the S. aureus gene SACOL1416 shows about 30% sequence homology to Streptococcus agalactiae gene SAJ1496 and Listeria gene LWE0119 and the S. aureus gene SACOL0718 shows about 40-50% sequence homologies to Streptococcus agalactiae gene SAJ1013 and Listeria gene LWE 1764 (www.jcvi.org). Noteworthy, Streptococcus agalactiae is also a pathogen involved in IMI and Listeria is a pathogen often contaminating milk products (Bradley, 2002; Jayarao et al., 2001).
TABLE-US-00007 TABLE VII Percentage similarity (% sim) and identity (% ide) of the amino acid sequences corresponding to some of the S. aureus genes expressed in vivo during bovine IMI (Table IV above) for some representatives of the sequenced Staphylococcus aureus genomes (strains N315, RF122, USA300-FPR3757 and MSSA476 compared to the MRSA COL strain). Gene COL N315 RF122 USA300 MSSA476 SACOL % ide % sim % ide % sim % ide % sim % ide % sim % ide % sim 0442 100 100 99.5 99.5 94.6 98 100 100 95.6 98.0 0718 100 100 99.6 100 99.6 100 99.6 100 99.6 100 0720 100 100 99.4 99.7 99.4 100 100 100 99.4 99.7 2365 100 100 98.5 98.5 97.1 98.1 100 100 99.0 99.0 0029 100 100 100 100 100 100 1416 100 100 99.6 100 98.2 99.6 100 100 100 100 1944 100 100 100 100 99.6 99.6 100 100 100 100 1611 100 100 100 100 100 100 100 100 100 100 2599 100 100 99.8 100 99.1 99.8 100 100 99.8 99.8 2144 100 100 94.6 98.5 92.7 96.2 99.6 99.6 96.2 99.2 1353 100 100 99.6 99.6 100 100 99.6 100 0264 100 100 99.5 99.5 99.1 99.5 100 100 99.1 99.1
EXAMPLE 8
Preparation of Vaccines
[0222] Bioinformatic software provided sequence and structural information on proteins SACOL0718, SACOL0720 and SACOL0442 that were useful for preparing such proteins in vaccine compositions (
[0223] For vaccine preparation, most of the SACOL0442 protein was used (polypeptide comprising amino acids 44 to 159 in the sequence depicted at
EXAMPLE 9
Immunogenicity of Vaccine of the Present Invention in Mice
[0224] Each of the purified polypeptides derived from SACOL0442, SACOL0720 and SACOL1781, independently or all together in combination, were tested for antibody production in mice. Antibody titers in sera of mice vaccinated with SACOL0442, SACOL0720 and SACOL1781 (in the presence of the adjuvant Emulsigen-D) are shown in
EXAMPLE 10
Immunogenicity of Vaccine of the Present Invention in Cows
[0225] Immunizations were also performed in dairy cows. Antibody titers in sera of cows vaccinated with the polypeptide fragments of SACOL0442, SACOL0720 described in Example 8 (in the presence of the adjuvant Emulsigen-D) are shown in
EXAMPLE 11
Epitopes of Interest
[0226] As an alternative of using the entire proteins or a long region of the polypeptides of interest for vaccination, it is also possible to specifically used small peptide regions predicted to be recognized by the B or T cells from the mammalian immune system. Identification of the B cell epitopes (that is to say short amino acid sequences that will be recognized by the immune system and able to induce the production of antibodies by the B cells) among some of the proteins of interest such as SACOL0442 and SACOL0720 are shown in Table VIII below. For each protein, the predicted B cell epitopes are presented with their position in the protein sequence. The score was obtained from 4 distinct programs: BCPred Predictions, AAP Predictions, FBCPred Predictions and ABCPred.
[0227] Similarly, computer driven algorithms can also be used to facilitate the identification of T cell epitopes (that is to say short amino acid sequences that will be recognized by the immune system and able to induce a cellular response by T cells) for use as vaccines against Staphylococcus aureus infection. The proteins of interest can be subjected to analysis by the Epimatrix system to identify putative T cell epitopes. This in-silico technique divides the total sequence of the antigen into fragments of 9 amino acids overlapping by 8 amino acids. This pool of 9-mer is screened for predicted affinity against a group of known MHC class I and class II alleles. The resulting scores can be used to rate putative epitopes on a common scale which can then be tested in vitro. The technique is applicable to any animal for which a sufficient knowledge of MHC sequences is available. (De Groot et al., 2008)
[0228] The B or T cell epitopes can therefore the used in vaccine compositions alone or in combination with an assemblage of proteins, peptides or other epitopes. In addition, any B or T cell epitopes as well as any other epitopes can be presented in a contiguous sequence (such as in a protein fusion approach) by using genetic and protein engineering methods.
TABLE-US-00008 TABLEVIII IdentificationofBcellepitopesamongsomeof theproteinsofinterest(A)SACOL0442and(B) SACOL0720.Foreachprotein,thepredictedB cellepitopesarepresentedwiththeirposition intheproteinsequenceandthepredictionscore theyobtainedusing4distinctsoftwares:BCPred Predictions,AAPPredictions,FBCPredPredictions andABCPred. Position PotentialB intothe cellepitope sequence score SACOL0442 TFGIYPKADASTQN 26 0.840 (SEQIDNO:17) KDTINGKSNKSRNW 72 0.848 (SEQIDNO:18) KDGGKYTLESHKELQ 159 1.000 (SEQIDNO:19) (B)SACOL0720 QFGFDLKHKKDALA 468 0.981 (SEQIDNO:20) TIKDQQKANQLAS 325 0.898 (SEQIDNO:21) KDINKIYFMTDVDL 428 0.890 (SEQIDNO:22) DVDLGGPTFVLND 436 0.993 (SEQIDNO:23)
EXAMPLE 12
Use of S. aureus Genes Expressed During IMI as Diagnostic Tools
[0229] The diagnosis of S. aureus IMI is difficult and requires time. Traditionally, milk samples are taken and shipped to a microbiology laboratory where cultivation of S. aureus is achieved using various artificial growth media. Following growth and if growth occur (usually 24 h after sample arrival), the microorganism need to be identified as S. aureus among other possible pathogens by a variety of biochemical tests which could take up an additional 24 h. For milk producers, this delay represents a serious economic loss as cows suspected to have acquired an IMI need to be removed from the milk production herd while cows not tested for S. aureus but that have subclinical IMI may continue to contaminate the bulk milk tank. It would thus be highly desirable to develop a novel tool for rapid detection of S. aureus in milk to permit a rapid intervention by milk producers or veterinarians.
[0230] As an alternative of using traditional microbial cultures to identity S. aureus in milk samples of cows with or without clinical signs of IMI and mastitis, the products of the S. aureus genes identified as expressed during IMI (either the messenger RNA, the protein or the metabolic product subsequent to the protein activity) may be used as diagnostic tools. Indeed, the detection of such specific products, for example in milk, blood or biopsies, would indicate the presence of S. aureus. Since such products are strongly expressed during IMI, their detection would also strongly correlate with this specific type of infection.
[0231] For example, detection of the putative exotoxin SACOL0442 that is secreted in the extracellular milieu, i.e., in milk during mastitis, would be a strong indication that the cow is infected by S. aureus since the gene is only expressed during IMI. The detection of the putative exotoxin SACOL0442 can be easily achieved by the use of a specific antibody and an ELISA technique or a dip stick approach or the like and the signal of detection can be easily amplified by a variety of signal amplification techniques. Such techniques could rapidly be performed by the microbiology laboratory or even on-farm by the milk producer himself, hence gaining valuable time. Alternatively, detection of messenger RNA (mRNA) from the genes expressed during IMI would also indicate the presence of S. aureus in milk. Detection of mRNA is possible after its release from bacteria by a cell lysis step, copying mRNA into complementary DNA by reverse transcription and by PCR amplification
REFERENCES
[0232] Allard, M., H. Moisan, E. Brouillette, A. L. Gervais, M. Jacques, P. Lacasse, M. S. Diarra, and F. Malouin. 2006. Transcriptional modulation of some Staphylococcus aureus iron-regulated genes during growth in vitro and in a tissue cage model in vivo. Microbes Infect. 7:1679-1690.
[0233] Allard, M., C. Ster, L. St James, P. Lacasse, M. S. Diarra, C. L. Jacob, and F. Malouin. 2008. Transcriptional Analysis of In Vivo-Expressed Genes in Staphylococcus aureus During Bovine Mastitis American Society for Microbiology General Meeting Boston, USA. Jun. 1-5, 2008 (Poster)
[0234] Atalla, H., C. Gyles, C. L. Jacob, H. Moisan, F. Malouin, and B. Mallard. 2008. Characterization of a Staphylococcus aureus small colony variant (SCV) associated with persistent bovine mastitis. Foodborne Pathog 5:785-799.
[0235] Barkema, H. W., Y. H. Schukken, and R. N. Zadoks. 2006. Invited Review. The role of cow, pathogen, and treatment regimen in the therapeutic success of bovine Staphylococcus aureus mastitis. J. Dairy Sci. 89:1877-1895.
[0236] Bradley, A. 2002. Bovine mastitis: an evolving disease. Vet. J. 164:116-128.
[0237] Barrio, M. B., P. Rainard, F. B. Gilbert, B. Poutrel. 2003 Assessment of the opsonic activity of purified bovine sIgA following intramammary immunization of cows with Staphylococcus aureus J. Dairy Sci. 86: 2884-2894.
[0238] Brouillette, E., M. Hyodo, Y. Hayakawa, D. K. Karaolis, and F. Malouin. 2005. 3,5-cyclic diguanylic acid reduces the virulence of biofilm-forming Staphylococcus aureus strains in a mouse model of mastitis infection. Antimicrob. Agents Chemother. 49:3109-3113.
[0239] Burtak, C., C. H. Hammer, M. A. Robinson, A. R. Whitney, M. J. McGavin, B. N. Kreiswirth, and F. R. Deleo. 2007 Global analysis of community-associated methicillin-resistant Staphylococcus aureus exoproteins reveals molecules produced in vitro and during infection. Cell Microbiol 9:1172-1190
[0240] Chang, B. S., J. S. Moon, H. M. Kang, Y. I. Kim, H. K. Lee, J. D. Kim, B. S. Lee, H. C. Koo, Y. H. Park. 2008. Protective effects of recombinant staphylococcal enterotoxin type C mutant vaccine against experimental bovine infection by a strain of Staphylococcus aureus isolated from subclinical mastitis in dairy cattle. Vaccine: 26:2081-2091.
[0241] Chen J., H. Liu, J. Yang, K. Chou. 2007. Prediction of linear B-cell epitopes using amino acid pair antigenicity scale. Amino Acids 33:423-428
[0242] Chen Y. L., Caruso, B. McClane, D. Fisher, P. Gupta. 2007. Disruption of a toxin by introduction of a foreign gene into the chromosome of Clostridium perfringens using targetron induced mutagenesis. Plasmid. 58:182-189.
[0243] De Groot, A. S., J. McMurry, and L. Moise. 2008. Prediction of immunogenicity: in silico paradigms, ex vivo and in vivo correlates. Curr Opinion in Pharmacol. 8:620-626.
[0244] Dehal P S, Joachimiak M P, Price M N, Bates J T, Baumohl J K, Chivian D, Friedland G D, Huang K H, Keller K, Novichkov P S, Dubchak I L, Alm E J, Arkin A P. MicrobesOnline: an integrated portal for comparative and functional genomics. Nucleic Acids Res. 2010 January; 38(Database issue): D396-400 Epub 2009 Nov. 11.
[0245] Diarra, M. S., D. Petitclerc, and P. Lacasse. 2002. Response of Staphylococcus aureus isolates from bovine mastitis to exogenous iron sources. J. Dairy Sci. 85:2141-2148.
[0246] EL-Manzalawy Y, Dobbs D, Honavar V. 2008a. Predicting linear B-cell epitopes using string kernels. J Mol Recognit 21 243-255.
[0247] EL-Manzalawy Y, Dobbs D, Honavar V. 2008b. Predicting flexible length linear. B-cell epitopes. 7.sup.th International Conference on Computational Systems Bioinformatics, Stanford, Calif. pp. 121-131
[0248] Eng. N. F., S. Garlapati, V. Gerdts, A. Potter, L. A. Babiuk, and G. K. Mutwiri. 2010. The Potential of Polyphosphazenes for Delivery of Vaccine Antigens and Immunotherapeutic Agents. Curr Drug Deliv. 7(1):13-30.
[0249] Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M. Ester and F. S. L. Brinkman. 2005. PSORTb v.2.0: Expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis Bioinformatics 21(5):617-623; doi:10.1093/bioinformatics/bti057
[0250] Garzoni, C., P. Francois, A. Huyghe, S. Couzinet, C. Tapparel, Y. Charbonnier, A. Renzoni, S. Lucchini, D. P. Lew, P. Vaudaux, W. L. Kelley, and J. Schrenzel. 2007. A global view of Staphylococcus aureus whole genome expression upon internalization in human epithelial cells. BMC Genomics: 8:171.
[0251] Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins M. R., Appel R. D., Bairoch A. Protein Identification and Analysis Tools on the ExPASy Server; (In) John M. Walker (ed): The Proteomics Protocols Handbook, Humana Press (2005), pp. 571-607
[0252] Goerke, C. S., Campana, M. G. Bayer, G. Dring, K. Botzenhart, and C. Wolz. 2000. Direct quantitative transcript analysis of the agr regulon of Staphylococcus aureus during human infection in comparison to the expression profile in vitro. Infect Immun. 68:1304-1311.
[0253] Guidry, A. J., L. M. Berning, C. N. Hambleton. 1993. Opsonization of Staphylococcus aureus by bovine immunoglobulin isotypes. J. of Dairy Sci. 76:1285-1289.
[0254] Haveri, M., A. Roslf, L. Rantala, and S. Pyrl. 2007. Virulence genes of bovine Staphylococcus aureus from persistent and nonpersistent intramammary infections with different clinical characteristics. J. Appl. Microbiol. 103:993-1000.
[0255] Hogarth, C. J., J. L. Fitzpatrick, A. M. Nolan, F. J. Young, A. Pitt, and P. D. Eckersall. 2004. Differential protein composition of bovine whey: a comparison of whey from healthy animals and from those with clinical mastitis. Proteomics. 4:2094-2100.
[0256] Jayarao, B. M., D. R. Henning. 2001. Prevalence of foodborne pathogens in bulk tank milk. J Dairy Sci. 84:2157-2162.
[0257] Karaolis, D. K., T. K. Means, D. Yang, M. Takahashi, T. Yoshimura, E. Muraille, D. Philpott, J. T. Schroeder, M. Hyodo, Y. Hayakawa, B. G. Talbot, E. Brouillette, and F. Malouin. 2007. Bacterial c-di-GMP is an immunostimulatory molecule. J Immunol. 178:2171-2181.
[0258] Kaslun, S. P. et al. 2011. Programming the magnitude and persistence of antibody responses with innate immunity. Nature 470:543-547.
[0259] Lammers, A. E., Kruijt, K. C. van de, P. J. Nuijten, and H. E. Smith. 2000. Identification of Staphylococcus aureus genes expressed during growth in milk: a useful model for selection of genes important in bovine mastitis? Microbiology. 146:981-987.
[0260] Larkin M. A., Blackshields G., Brown N. P., Chenna R., McGettigan P. A., McWilliam H.*, Valentin F.*, Wallace I. M., Wilm A., Lopez R., Thompson J. D., Gibson T. J. and Higgins D. G. 2007. ClustalW and ClustalX version 2. Bioinformatics 2007 23(21): 2947-2948.
[0261] Linghua, Z. T. Xingshan, Z. Fengzhen. 2006. The efficacy of CpG oligodinucleotides, in combination with conventional adjuvants, as immunological adjuvants to swine streptococcic septicemia vaccine in piglets in vivo. Int Immunopharmacol. 6:1267-76.
[0262] Loiselle, M. C., C. Ster, B. G. Talbol, X. Zhao, G. F. Wagner, Y. R. Boisclair, and P. Lacasse. 2009. Impact of postpartum milking frequency on the immune system and the blood metabolite concentration of dairy cows. J Dairy Sci. 92:1900-1912.
[0263] Lowe, A. M., D. T. Beattie, and R. L. Deresiewicz. 1998. Identification of novel staphylococcal virulence genes by in vivo expression technology. Mol Microbiol. 27:967-976.
[0264] Maresso, A. W., and O. Schneewind. 2006. Iron acquisition and transport in Staphylococcus aureus. Biometals. 19:193-203.
[0265] Mayer, S. J., A. E. Waterman, P. M. Keen, N. Craven, and F. J. Bourne. 1988. Oxygen concentration In milk of healthy and mastitic cows and implications of low oxygen tension for the killing of Staphylococcus aureus by bovine neutrophils. J Dairy Res 55:513-519.
[0266] Melchior, M. B., M. H. vanOsch, R. M. Graat, E. van Duijkeren, D. J. Mevius, N. Nielen, W. Gaastra, J. Fink-Gremmels. 2009. Biofilm formation and genotyping of Staphylococcus aureus bovine mastitis isolates: evidence for lack of penicillin-resistance in Agr-type II strains. Vet. Microbiol. 137:83-89.
[0267] Middleton, J. R. 2008. Staphylococcus aureus antigens and challenges in vaccine development. Expert Rev. Vaccines. 7:805-815.
[0268] Moisan, H., E. Brouillette, C. L. Jacob, P. Langlois-Bgin, S. Michaud, and F. Malouin. 2006. Transcription of virulence factors in Staphylococcus aureus small-colony variants isolated from cystic fibrosis patients is influenced by SigB. J Bacteriol. 188:64-76.
[0269] Mitchell, G., C. A. Lamontagne, E. Brouillette, G. Grondin, B. G. Talbot, M. Grandbois, F. Malouin. 2008. Staphylococcus aureus SigB activity promotes a strong fibronectin-bacterium interaction which may sustain host tissue colonization by small-colony variants isolated from cystic fibrosis patients. Mol Microbiol 70:1540-1555.
[0270] Myllys, V., J. Ridell, J. Bjorkroth, I. Biese, and S. Pyorala. 1997. Persistence in bovine mastitis of Staphylococcus aureus clones as assessed by random amplified polymorphic DNA analysis, ribotyping and biotyping. Vet Microbiol. 57:245-251.
[0271] National Mastitis Council. 1996. Current Concept of Bovine Mastitis. 4 ed. National Mastitis Council, Madison, Wis.
[0272] Nickerson, S. C., W. E. Owens, L. K. Fox, C. C. Scheilinger, T. R. Shryock, and T. E. Spike: 1999. Comparison of tilmicosin and cephapirin as therapeutics for Staphylococcus aureus mastitis at dry-off. J Dairy Sci. 82:696-703.
[0273] Owens, W. E., C. H. Ray, J. L. Watts, and R. J. Yancey. 1997. Comparison of success of antibiotic therapy during lactation and results of antimicrobial susceptibility tests for bovine mastitis. J Dairy Sci. 80:313-317.
[0274] Park, Y. K., H. C. Koo, S. H. Kim, S. Y. Hwang, W. K. Jung, J. Kim, S. Shin, R. Kim, and Y. Park. 2007. The analysis of milk components and pathogenic bacteria isolated from bovine raw milk in Korea. J Dairy Sci. 90:5405-5414.
[0275] Petes, F., M. Wagner, L. Varga, I. Hein, P. Rieck, K. Gutser, P. Keresztri, G. Kardos, I. Turcsnyi, B. Bri, and A. Szab. 2007. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. Int J Food Microbiol. 118:186-93.
[0276] Peterson, J. D., Umayam, L. A., Dickinson, T., Hickey, E. K., White, O. 2001. The Comprehensive Microbial Resource Nucleic Acids Res. 29(1): 123-5.
[0277] Petitclerc, D., K. Lauzon, A. Cochu, C. Ster, M. S. Diarra, and P. Lacasse. 2007. Efficacy of a lactoferrin-penicillin combination to treat {beta}-lactam-resistant Staphylococcus aureus mastitis. J Dairy Sci. 90:2778-2787.
[0278] Pragman, A. A., and P. M. Schlievert. 2004. Virulence regulation in Staphylococcus aureus the need for in vivo analysis of virulence factor regulation. FEMS Immunol Med Microbiol. 42:147-154.
[0279] Saha, S and Raghava G. P. S. BcePred Prediction of Continuous B-Cell Epitopes in Antigenic Sequences Using Physico-chemical Properties In G. Nicosia, V. Cutello, P. J. Bentley and J. Timis (Eds.) ICARIS 2004, LNCS 3239, 197-204, Springer, 2004.
[0280] Saha, S and Raghava G. P. S., (2006) Prediction of Continuous B-cell Epitopes in an Antigen Using Recurrent Neural Network. Proteins, 65(1), 40-48.
[0281] Sandholm, M., L. Kaartinen, and S. Pyorala. 1990. Bovine mastitiswhy does antibiotic therapy not always work? An overview. J Vet Pharmacol Therap. 13:248-260.
[0282] Schaffer, A. C., and J. C. Lee. 2009. Staphylococcal vaccines and immunotherapies. Infect Dis Clin North Am. 23:153-171.
[0283] Sears, P. M. and McCarthy, K. K. 2003. Management and treatment of staphylococcal mastitis. Vet Clin North Am Food Anim Pract 19:171-185.
[0284] Sibbald, M. J., A. K. Ziebandt, S. Engelmann, M. Hecker, A. de Jong, H. J. Harmsen, G. C. Raangs, I. Stokroos, J. P. Arends, J. Y. Dubois, and J. M. van Dijl. 2006. Mapping the pathways to staphylococcal pathogenesis by comparative secretomics. Microbiol Mol Biol Rev. 70:755-788.
[0285] Silanikove, N., F. Shapiro, and G. Leitner. 2007. Posttranslational ruling of xanthine oxidase activity in bovine milk by its substrates. Biochem Biophys Res Commun. 363:561-565.
[0286] Somerville, G. A., and R. A. Proctor. 2009. At the crossroads of bacterial metabolism and virulence factor synthesis in Staphylococci. Microbiol Mol Biol Rev. 73:233-248.
[0287] Sprickler A. R. and J. A. Roth. Adjuvants in veterinary vaccines: mode of action and adverse effects. 2003. 17:273-281.
[0288] Srinivasan, V., A. A. Sawant, B. E. Gillespie, S. J. Headrick, L. Ceasaris, and S. P. Oliver. 2006. Prevalence of enterotoxin and toxic shock syndrome toxin genes in Staphylococcus aureus isolated from milk of cows with mastitis. Foodborne Pathog Dis. 3:274-83.
[0289] Srivastava S, Singh V, Kumar V, Verma P C, Srivastava R, Basu V, Gupta V, Rawat A K. Identification of regulatory elements in 16S rRNA gene of Acinetobacter species isolated from water sample. Bioinformation. 2008; 3(4): 173-6. Epub 2008 Dec. 6.
[0290] Taverna, F., A. Negri, R. Piccinini, A. Zecconi, S. Nonnis, S. Ronchi, and G. Tedeschi. 2007. Characterization of cell wall associated proteins of a Staphylococcus aureus isolated from bovine mastitis case by a proteomic approach. Vet Microbiol. 119:240-247.
[0291] Tollesrud, T., A. H. Kampen, and K. Kenny. 2006. Staphylococcus aureus enterotoxin D is secreted in milk and simulates specific antibody responses in cows in the course of experimental intramammary infection. Infect Immun. 74:3507-3512.
[0292] Tuchscherr, L. P., F. R. Buzzola, L. P. Alvarez, J. C. Lee, and D. O. Sordelli. 2006. Antibodies to capsula polysaccharide and clumping factor A prevent mastitis and the emergence of unencapsulated and small colony variants of Staphylococcus aureus in mice. Infect Immun. 76:5738-5744.
[0293] Tusndy, G. E. and Simon, I. 2001. The HMMTOP transmembrane topology prediction server Bioinformatics 17:849-850.
[0294] Voyich, J. M., K. R. Braughton, D. E. Sturdevant, A. R. Whitney, B. Said-Salim, S. F. Porcella, R. D. Long, D. W. Dorward, D. J. Gardner, B. N. Kreiswirth, J. M. Musser, and F. R. DeLeo. 2005. Insists into mechanisms used by Staphylococcus aureus to avoid destruction by human neutrophils. J Immunol. 175:3907-3919.
[0295] WO/2003/091279
[0296] WO/2004/043405
[0297] WO/2008/152447
[0298] WO/2005/007683
[0299] WO/2006/059846
[0300] Ziebandt, A. K., H. Kusch, M. Degner, S. Jaglitz, M. J. Sibbald, J. P. Arends, M. A. Chlebowicz, D. Albrecht, R. Pantucek, J. Dokar, W. Ziebuhr, B. M. Brker, M. Hecker, J. M. van Dijl, and S. Engelmann. 2010. Proteomics uncovers extreme heterogeneity in the Staphylococcus aureus exoproteome due to genome plasticity and variant gene regulation. Proteomics 285(47)36794-36803.