TARGETED GENE DISRUPTION METHODS AND IMMUNOGENIC COMPOSITIONS
20200188498 ยท 2020-06-18
Inventors
Cpc classification
A61K39/118
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
Targeted disruption of a specific gene and its subsequent restoration in obligate intracellular bacteria remains extremely challenging due to their absolute requirement for residence inside a host cell to replicate. Here, targeted allelic exchange mutations were created to inactivate two genes and then to restore one of the two genes of a rickettsial pathogen, Ehrlichia chaffeensis. These methods were then also successfully utilized in Ehrlichia canis and Anaplasma phagocyophilum. The resultant mutated pathogens are useful in immunogenic compositions for reducing the incidence of or severity of infection with ricksettsial pathogens.
Claims
1. An immunogenic composition comprising: a Rickettsiale or Chlamydiale bacteria having a targeted allelic exchange mutation therein; and a component selected from the group consisting of a veterinary-acceptable carrier, a pharmaceutical-acceptable carrier, an adjuvant, a preservative, a buffer, an antibiotic, cell culture supernatant, an immunomodulatory agent, and any combination thereof.
2. The immunogenic composition of claim 1, wherein said Rickettsiale or Chlamydiale bacteria is selected from the group consisting of species of Ehrlichia, Anaplasma, Neorickettsia, Rickettsia, Orientia and Chlamydia.
3. The immunogenic composition of claim 2, wherein the Ehrlichia bacteria species is selected from the group consisting of Ehrlichia chaffeensis, Ehrlichia ruminatium, and Ehrlichia canis.
4. The immunogenic composition of claim 2, wherein the Anaplasma bacteria is selected from the group consisting of Anaplasma phagocytophilum, Anaplasma platys, and Anaplasma marginale.
5. The immunogenic composition of claim 1, wherein the targeted allelic mutation attenuates the bacteria and/or inactivates a gene.
6. (canceled)
7. The immunogenic composition of claim 6, wherein the gene functions as an aid to replication.
8. The immunogenic composition of claim 2, wherein the targeted allelic exchange mutation is in a location selected from the group consisting of: a) Ech_0379 or Ech_0660 in Ehrlichia chaffeensis or homologous genes from other strains of the same species or from other Ehrlichia species; b) Ecaj_0381 in Ehrlichia canis or in homologous genes from other strains of the same species or from other Ehrlichia species; c) APH_0634 in Anaplasma phagocytophilum or in homologous genes from other strains of the same species or from other Anaplasma species d) Ech_0660 or a homolog thereof in other related Ehrlichia chaffeensis strains or other related Ehrlichia species and their strains.
9. (canceled)
10. (canceled)
11. (canceled)
12. The immunogenic composition of claim 1, wherein said component is an adjuvant selected from the group consisting of a saponin, a cyclic GMP-AMP, montanide gel, or any combination thereof.
13. The immunogenic composition of claim 1, further comprising an antigen from another disease causing organism.
14. The immunogenic composition of claim 1, wherein said bacteria includes a sequence with at least 70% sequence identity with SEQ ID NO. 35, 54, or 55.
15. (canceled)
16. (canceled)
17. A method of reducing the incidence of or severity of at least one clinical sign caused by a Rickettsiale or Chlamydiale bacteria comprising the step of: administering an immunogenic composition at least once, wherein said immunogenic composition comprises a Rickettsiale or Chlamydiale bacteria having a targeted allelic exchange mutation therein and a component selected from the group consisting of a veterinary-acceptable carrier, a pharmaceutical-acceptable carrier, an adjuvant, a preservative, a buffer, a stabilizer, an antibiotic, cell culture supernatant, an immunomodulatory agent, and any combination thereof.
18. The method of claim 17, wherein said immunogenic composition is administered using an administration mode selected from the group consisting of intravenously, intramuscularly, intranasally, intradermally, intratracheally, intravaginally, intravenously, intravascularly, intraarterially, intraperitoneally, orally, intrathecally, by direct injection into any target tissue, or any combination thereof.
19. (canceled)
20. (canceled)
21. The method of claim 17, wherein said reduction in incidence is at least 10% and is in comparison to a group of animals that have not received an administration of the immunogenic composition.
22. (canceled)
23. The method of claim 17, wherein said reduction in severity is at least 10% in comparison to a group of animals that have not received an administration of the immunogenic composition.
24. The method of claim 17, wherein the Rickettsiale or Chlamydiale bacteria is selected from the group consisting of species of Ehrlichia, Anaplasma, Neorickettsia, Rickettsia, Orientia and Chlamydia.
25. The method of claim 24, wherein the Ehrlichia bacteria is selected from the group consisting of Ehrlichia chaffeensis, Ehrlichia ruminatium, and Ehrlichia canis.
26. The method of claim 24, wherein the Anaplasma bacteria is selected from the group consisting of Anaplasma phagocytophium, Anaplasma platys, and Anaplasma marginale.
27. The method of claim 17, wherein the targeted allelic exchange mutation inactivates a gene.
28. (canceled)
29. The method of claim 17, wherein the targeted allelic exchange mutation is in a location selected from the group consisting of: a) Ech_0379, or Ech_0660 in Ehrlichia chaffeensis or in gene homologs having 70% or more homology to Ech_0379 or Ech_0660 and belonging to different geographic isolates and strains of the same organism or other related Ehrlichia species; b) Ecaj_0381 in Ehrlichia canis or in gene homologs having 70% or more homology to Ecaj_0381 and belonging to different geographic isolates and strains of the same organism or other related Ehrlichia species; c). APH_0634 in Anaplasma phagocytophilum or in gene homologs having 70% or more homology to APH_0634 and belonging to different geographic isolates and strains of the same organism or other related Anaplasma species
30. (canceled)
31. (canceled)
32. (canceled)
33. The method of claim 17, wherein said bacteria includes a sequence with at least 70% sequence identity with SEQ ID NO. 35, 54, or 55
34. The method of claim 17, wherein said animal is selected from the group consisting of pigs, cattle, goats, horses, dogs, deer, coyote, cats, and poultry.
35. The method of claim 17, wherein said animal is between 3 weeks and 6 months of age when receiving said administration.
36. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
DETAILED DESCRIPTION OF THE INVENTION
[0056] The present disclosure provides for a method of providing stable, immunogenic bacteria capable of producing an immunogenic response in a host. The method preferably comprises the steps of a targeted disruption in the genome of the bacterial strain and then performing an allelic exchange.
[0057] The present disclosure provides for an immunogenic composition or vaccine that comprises administration of the immunogenic bacteria disclosed herein. The immunogenic bacteria for use in the immunogenic composition or vaccine may be killed, modified killed, modified live, a recombinant protein, a protein, and combinations thereof. In preferred forms, the modified live immunogenic bacteria are attenuated.
[0058] A method for preventing or treating at least one of rickettsioses, ehrlichiosis, Rocky Mountain Spotted Fever, human monocyte ehrlichiosis, granulocytic anaplasmosis, and/or anaplasmosis is provided. The steps of the method generally include administration of the immunogenic composition or vaccine disclosed herein to a human or animal in need thereof.
[0059] A method for reducing the incidence or severity of clinical symptoms associated with at least one of rickettsioses, ehrlichiosis, Rocky Mountain Spotted Fever, human monocyte ehrlichiosis, granulocytic anaplasmosis, and/or anaplasmosis is provided, where the steps generally include administration of the immunogenic composition or vaccine disclosed herein to a human or animal in need thereof. The clinical symptoms generally include, but are not limited to, fever, headache, chills, malaise, muscle pain, abdominal pain, nausea, vomiting, diarrhea, confusion, conjunctival injection (red eyes), rash, and combinations thereof. Preferably the clinical symptoms associated with at least one of rickettsioses, ehrlichiosis, Rocky Mountain Spotted Fever, human monocyte ehrlichiosis, granulocytic anaplasmosis, and/or anaplasmosis are reduced in frequency and/or severity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or reduced by 100%. This is in comparison to an animal or human not receiving the immunogenic composition or vaccine of the present disclosure. Comparisons to groups of animals or humans is also contemplated herein.
[0060] The recipient of the product and method of the present disclosure may be a human or an animal. The animal is preferably selected from, but not limited to, porcine, pigs, cattle, goats, horses, dogs, deer, coyote, cats, poultry, and other related wild and domestic animals. In a preferred embodiment, the recipient is a human, a dog, a cow or cattle, a horse, or a pig.
[0061] Modified or modified live nucleotide sequence will be understood as meaning any nucleotide sequence obtained by mutagenesis according to techniques well known to the person skilled in the art, and containing modifications with respect to the normal sequences according to the disclosure, for example mutations in the regulatory and/or promoter sequences of polypeptide expression, especially leading to a modification of the rate of expression of said polypeptide or to a modulation of the replicative cycle.
[0062] Nucleotide, polynucleotide or nucleic acid sequence will be understood according to the present disclosure as meaning both a double-stranded or single-stranded DNA in the monomeric and dimeric (so-called in tandem) forms and the transcription products of said DNAs.
[0063] It must be understood that the present disclosure does not relate to the genomic nucleotide sequences taken in their natural environment, that is to say, in the natural state. It concerns sequences for which it has been possible to isolate, purify or partially purify, starting from separation methods such as, for example, ion-exchange chromatography, by exclusion based on molecular size, or by affinity, or alternatively fractionation techniques based on solubility in different solvents, or starting from methods of genetic engineering such as amplification, cloning and subcloning, it being possible for the sequences of the disclosure to be carried by vectors. Further, the sequences have been altered from what is found in nature to include mutations induced through site-directed mutagenesis or other attenuation techniques, such as serial passaging, further demonstrating that the sequences are made by the hand of man and not found in nature.
[0064] The attenuated modified live vaccine or immunogenic composition of the present invention does not contain a nucleotide or amino acid sequence found in nature, as it has been constructed by the hand of man. Therefore, the immunogenic composition or vaccine of the present invention is markedly different from what is found in nature. Similar to Example 5 for the Nature-Based Product Examples of eligible subject matter under 35 U.S.C. 101 issued by the US Patent Office in 2014, the immunogenic composition or vaccine of the present invention is like claim 2 of that example because the immunogenic composition or vaccine gene has additional elements, such as the mutations within the sequence or inactivation of the virus that provides it with a functionally different characteristic than, for example, naturally occurring E. chaffeensis.
[0065] About 1 kb of E. chaffeensis genomic DNA segments upstream and downstream of the previously defined random insertion mutation sites of the Ech_0230 and Ech_0379 gene were obtained by PCR and cloned into a plasmid vector. The promoter segment of E. chaffeensis elongation factor Tu gene, Tuf-2, (Ech_0407) was similarly cloned in front of the aadA gene coding sequence into a separate plasmid (aadA gene confers resistance to spectinomycin and streptomycin). Tuf-2 gene promoter (tuf) was chosen for aadA protein expression because it drives the expression of a highly conserved and constitutively expressed protein, Tu that is necessary for the polypeptide elongation process in the protein translation machinery. Further, our bioinformatics analysis and transcription mapping by primer extension experiment suggested that it is a strong promoter responsible for transcribing genes, most of which encode for 30S and 505 ribosomal proteins, and having multiple transcription start sites (not shown). The aadA gene was chosen as it works well in conferring antibiotic resistance in E. chaffeensis and in Anaplasma species. The tuf-aadA segment was engineered into the homologous recombination constructs of Ech_0230 and Ech_0379 (pHR-Ech_0230-tuf-aadA and pHR-Ech_0379-tuf-aadA, respectively). Linear DNA fragments from the constructs containing the 5 and 3 homology arms of the genes separated by the tuf-aadA segment were generated by PCR for use in creating targeted mutations. To create a rescue mutagenesis template in reversing the targeted gene mutation within the Ech_0379 gene, 0.5 kb fragment downstream from the mutation site of the gene was obtained by PCR from E. chaffeensis genome and it was engineered into the pHR-Ech_0379-tuf-aadA construct to generate a modified construct; pHR-res-Ech_0379-Amtr-mCh-Gent containing the entire Ech_0379 gene ORF at the 5 end followed by the presence of the Amtr promoter, the ORFs of mCherry and the gentamicin resistance cassettes (Gent) (Amtr-mCh-Gent) and a 1 kb genomic segment containing the 3 portion of the Ech_0379 gene. Gent was codon optimized for efficient translation in E. chaffeensis. Linear fragments from the rescue construct were then prepared which contained the 5homology arm beginning with the Ech_0379 gene followed by Amtr-mCh-Gent segment and the 3 end genomic segment downstream to the Ech_0379 insertion to serve as the 3 homology arm. Linear DNA fragments to disrupt Ech_0230 or Ech_0379 genes were electroporated into host cell-free wild type E. chaffeensis organisms recovered from ISE6 tick cells and then allowed to re-infect ISE6 tick cells. The mutants were selected for their ability to grow in the medium containing spectinomycin and streptomycin for several weeks and then allowed to infect macrophage cell line, DH82, for continued growth for several months. For rescue mutation experiment, linear DNA fragments of the Ech_0379 gene restoration template were similarly electroporated into E. chaffeensis organisms containing mutation in the Ech_0379 gene. E. chaffeensis cultures with Ech_0379 gene restored were then selected by their ability to grow in the medium containing gentamicin. Following the recovery of E. chaffeensis cultures growing in the media containing antibiotics, targeted gene inactivations in Ech_0230 or Ech_0379 were confirmed by two insertion specific PCR assays targeting 1) to the genomic region 5 to the allelic exchange site and to the insertion specific DNA, and 2) to the insertion DNA and to the 3 of the allelic exchange site on the genome. Clonal purity was then confirmed by another PCR assay targeting the genomic regions upstream and downstream of the allelic exchange insertion sites. The integrity of the PCR products was confirmed by PCR-DNA sequence analysis. For Ech_0379 gene restoration mutant generation was also assessed for the mCherry protein expression by fluorescence microscopy (
[0066] This written description uses examples to disclose the invention, including the best mode, and also to enable any person skilled in the art to practice the invention, including making and using any devices or systems and performing any incorporated methods. The patentable scope of the invention is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.
EXAMPLES
Example 1
[0067] Materials and Methods
[0068] In Vitro Cultivation of E. chaffeensis.
[0069] E. chaffeensis Arkansas isolate was continuously cultivated in ISE6 tick cell line, an I. scapularis embryonic cell line, as described earlier (Elwell, C., Mirrashidi, K., and Engel, J., Nat. Rev. Microbial.; 14, 385-400 (2016). The canine macrophage cell line (DH82) was also used to cultivate E. chaffeensis by following the protocols reported earlier (Walker, D. H., Paddocl, C. D. and Dumler, J. S., Med Clin North Am; 92, 1345-1361 (2008)).
[0070] Construction for Homologous Recombination Plasmids and Segments.
[0071] All the primers used for the preparation of recombinant plasmid constructs developed for the targeted mutagenesis experiments are described in Table 1. Plasmids used and prepared in this study were listed in Table 2.
TABLE-US-00001 TABLE1 Listofoligonucleotidesusedinthisstudy. Uppercasesequencesaregenespecific;lowercasesequencesare GibsonAssemblyoverlaps. Primer* Sequence Orientation Size(bp) HOMOLOGOUSRECOMBINATIONCONSTRUCTS: ForEch_0230genedisruption Ech_0230genesegmentcloning RRG1591 TATGGGCCTAAGATAGTATTACC forward 2074 (SEQIDNo.1) RRG1602 AAGACACACAAGAACATGACACTGCC reverse (SEQIDNo.2) InsertionspecificprimerstosplittheplasmidconstructofpHR-Ech_0230 RRG1599 gatcaccaaggtagtcggcaaataactcgagTATATA forward 6081 TAATCATGTATCGATTATATATAACTGTG TGC(SEQIDNo.3;PRIMER) RRG1592 cctaattaaaaaaagtcaaaattaatagtcacatttttctcga reverse gCTGTAGTACCATGTGTTACTTACCCTCT TTC(SEQIDNo.4,PRIMER) ForEch_0230genedisruption Ech_0379genesegmentcloning RRG1603 ACCTGCTGTACTGAGTATGTTCTTG forward 2546 (SEQIDNo.5) RRG1608 AGACAAGAACATGCTTCAGGTGCTAC reverse (SEQIdNo.6) InsertionspecificprimerstosplittheplasmidconstructofpHR-Ech_0379 RRG1604 cctaattaaaaaaagtcaaaattaatagtcacatttttctcga forward 6552 gTGCTGCATTAATTCTATGTAATTATCTTT AG(SEQIDNo.7-PRIMER) RRG1605 gatcaccaaggtagtcggcaaataactcgagTATTAT reverse GCTTTATAAATGTTCTCAGTCTATTGGC (SEQIDNo.8-PRIMER) ForcloningTuf-2(Ech_0407)promoter RRG1595 AAAAATGTGACTATTAATTTTGACTTTTTT forward 387 TAATTAGG(SEQIDNo.9;PROMOTER) RRG1596 gcgatcaccgcttccctcatAAACAAATACCTTTA reverse ACATCATTAAACCATTTC(SEQIDNo.10; PROMOTER) ForcloningaadAgene RRG1597 gaaatggtttaatgatgttaaaggtatttgtttATGAGGG forward 789 AAGCGGTGATCGC(SEQIDNo.11) RRG1598 TTATTTGCCGACTACCTTGGTGATC reverse IDNo.12) ForEch_0379genefunctionrestoration Ech_03793endsegmentcloning RG8 GATAATTACATAGAATTAATGCAGCATAT forward 427 TATGCTTTATAAATGTTCTCAG(SEQID No.13) RG9 GCATGCGGCGATCGTTCTAGGAGCTATA reverse AATCTACACTTTCTTCAAC(SEQIDNo. 14) ForcloningAmtrpromoterwithmCherrygene(Amtr-mCh) RG10 CTCCTAGAACGATCGCCGCATGCTAGC forward 950 (SEQIDNo.15;PRIMER) RG11 AATTTAATCCCTATTTGTATAATTCG reverse (SEQIDNo.16;PRIMER) ForcloninggentamycingenefromplasmidpEch_rpsl-GENT RG12 atacaaatagggattaaattATGTTAAGATCATCA forward 563 AATGATG(SEQIDNo.17) RRG914 ACTACTAGTTTATGTTGCTGTACTTGGAT reverse CAATATC(SEQIDNo.18) Insertionspecificprimerstosplittheplasmidconstructof pHR-Ech_0379forrescueconstruct RG6 TGCTGCATTAATTCTATGTAATTATCTTTA forward 6499 G(SEQIDNo.19;PRIMER) RG22 tacagcaacataaactagtagtTATTATGCTTTATA reverse AATGTTCTCAGTCTATTGGC(SEQIDNo. 20;PRIMER) PRIMERSFORMUTANTSCREENING: Ech_0230disruptionmutant PCRI RRG1944 ATTAGTGCTATGGCATTTGGTC(SEQID forward 1525 No.21) RRG1596 reverse PCRII RRG1597 CAATTTACATGACATACTAACAAGC(SEQ forward 2057 IDNo.22) RRG1945 reverse PCRIII RRG1944 forward 3582 RRG1945 reverse Ech_0379disruptionmutant PCRI RRG1946 TGAGTGCTATGATACTCAAAGC(SEQID forward 1779 No.23) RRG1596 reverse PCRII RRG1597 AGAATCAACAAGGCCTACATACC(SEQ forward 2352 IDNo.24) RRG1947 reverse PCRIII RRG1946 forward 4131 RRG1947 reverse Ech_0379rescuemutant PCRI RRG1946 TCCGCAGGATGTTTCACATA(SEQIDNo. forward 2243 25) RG97 reverse PCRII RRG94 AAGCAAATGCTTTAGGTGCAT(SEQID forward 1711 No.26) RRG1947 reverse PCRIII RRG1946 forward 4824 RRG1947 reverse SOUTHERNBLOTPROBEAMPLIFICATIONPRIMERS: aadAgeneprobe RRG1200 GTTACGGTGACCGTAAGGCTT(SEQID forward 603 No.27;PRIMER) RRG1201 CACGTAGTGAACAAATTCTTCCAACTG reverse (SEQIDNo.28;PRIMER) Ech_0379geneprobe RRG1282 TGAAAATCTGATCGATAGTGCTGTGG forward 384 (SEQIDNo.29;PRIMER) RRG1283 GGTTGCATTCCCTACAACCTTAG(SEQID reverse No.30;PRIMER) RT-PCRPRIMERS: Ech_0230 RG26 GCTTTGGATTGTTTGTCTTA(SEQIDNo. forward 320 31;PRIMER) RG27 TCCATCCCATAACAAATCTA(SEQIDNo. reverse 32;PRIMER) Ech_0379 RRG1276 CTAAGGTTGTAGGGAATGCAACC(SEQ forward 376 IDNo.33;PRIMER) RRG1277 ACAAGGTAAGTACCTTGCTTGCTC(SEQ reverse IdNo.34;PRIMER) *Sequence for the primers was provided only once if a primer is listed multiple times.
TABLE-US-00002 TABLE 2 Plasmids and E. coli strains used in this study Name Description Reference pCis mCherry-SS Himar transposase, mCherry and Himar A7 aadA gene expression driven by Amtr promoter pHR-Ech_0230 Ech_0230 homology arms; This study pCR2.1-TOPO vector pHR-Ech_0379 Ech_0379 homology arms, This study pCR2.1-TOPO vector pHR-Ech_0230- Ech_0230 homology arms, aadA This study tuf-aadA expression driven by tuf-2 promoter, pCR2.1-TOPO vector pHR-Ech_0379- Ech_0379 homology arms, aadA This study tuf-aadA expression driven by tuf-2 promoter, pCR2.1-TOPO vector pHR-rescue- Ech_0379 homology arms, mCherry This study Ech_0379- and gentamycin expression driven Amtr-mCh-Gent by Amtr promoter, pCR2.1-TOPO vector pEch_rpsl-GENT Codon optimized gentamycin gene GenScript(will for Echrlichia genome, PUC57 submit seq to vector NCBI)
[0072] An illustration of the detailed molecular steps followed in preparing the constructs for allelic exchange mutagenesis experiments are depicted in
[0073] For constructing the Ech_0379 gene function rescue template, the 3 end 0.5 kb fragment downstream from the mutation site by PCR using E. chaffeensis genomic DNA was generated as the template (genomic coordinates are 374,462 to 374,837). The Amtr-mCherry (Amtr-mCh) DNA segments constituting the Anapmasma marginale transcription regulator (Tr) gene promoter and mCherry ORF were amplified using pCis mCherry-SS Himar A7 plasmid as the template. The gentamicin resistance gene coding sequence (Gent) was codon optimized commercially (GenScript, Piscataway, N.J.) (GenBank # KY977452) as per the frequently found codons of E. chaffeensis genome. The Gent segment was then used to clone downstream to Amtr-mCh fragment to generate Amtr-mCh-Gent fusion fragment. The 3 end 0.5 kb Ech_0379 segment was then ligated at the 5 end of the Amtr-mCh-Gent fragment by performing overlapping PCR and the final amplicon was subsequently cloned into the Ech_0379-tuf-aadA-HR 1 construct to replace the tuf-aadA segment with Amtr-mCh-Gent segment containing the 3 end 0.5 kb Ech_0379 ORF segment by performing the Gibson Assembly cloning strategy. The final Ech_0379 rescue plasmid construct; pHR-res-Ech_0379-Amtr-mCh-Gent included the full length Ech_0379 ORF restored in front of its own promoter, followed by the Amtr-mCh-Gent and the 3 end 1 kb genomic segment of Ech_0379 gene (
[0074] Purification of Cell-Free E. chaffeensis Organisms.
[0075] Five ml of E. chaffeensis cell culture from about 80-90% infected confluent ISE6 cell culture flask was used to generate host cell-free E. chaffeensis organisms. Briefly, the infected cell suspension was recovered by centrifugation at 15,000 g for 10 min at 4 C. and after discarding the supernatant, 1.5 ml of ice-cold 0.3 M sucrose solution and 100 l volume of autoclaved rock tumbler grit #1 (60/90 grit silicon carbide, Lortone, Wash.) were added to the cell pellet and votexed using a table top vortexer at maximum speed for 30 sec to release bacteria from the infected host cells. The cell suspension was then centrifuged at 200 g for 10 min at 4 C. to pellet the host cell debris. The supernatant was carefully recovered into a 3 ml syringe and passed through a 1.6 m filter (Whatman Ltd., Piscataway, N.J.); the filtrate containing E. chaffeensis organisms were pelleted by centrifuging at 15,000 g for 10 min at 4 C. The cell pellet was washed twice with 0.3 M ice-cold sucrose solution resuspended in 45 l of 0.3 M ice-cold sucrose solution and used immediately for electroporation experiments.
[0076] Transformation of E. chaffeensis and Clonal Isolation of Mutants.
[0077] Between 3-10 g of purified linear DNA fragments from the allelic exchange mutagenesis plasmid constructs (outlined above) were added to the host cell-free E. chaffeensis organisms in 45 l volume, mixed gently and transferred the contents into a 1 mm gap electroporation cuvette (Bio-Rad Laboratories, Hercules, Calif.). The cuvette was incubated on ice for 15 min and then subjected to electroporation at 2,000 volts, 25 F and 400 S2 setting (Gene Pulser Xcell, Bio-Rad Laboratories, Hercules, Calif.). The electroporated cells were transferred to a micro centrifuge tube containing 0.5 ml of FBS and 1 ml of uninfected ISE6 cell suspension containing about 110.sup.6 ISE6 cells in tick cell culture infection media. The mixed sample was centrifuged at 5,000 g for 5 min, incubated at room temperature for 15 min, cells were then resuspended in 5 ml culture media and the entire contents were transferred to a T25 flask containing confluent ISE6 cells and incubated for 24 h in a humidified 34 C. incubator and then 100 g/ml each of spectinomycin and streptomycin were added to the culture medium; incubations were continued at 34 C. for several weeks to select mutants. Typically, mutants were detected by PCR analysis after two to three weeks, although the assessment continued for several weeks beyond this time point. Similar experiment was carried out to obtain Ech_0379 gene restoration mutant, except that the media containing 80 g/ml of gentamicin were used after 24 h of electroporation. Ech_0379 gene restoration mutant cultures were also assessed by detecting the expression of mCherry by examining the cultures using a Nikon Diaphot inverted microscope (Nikon, Melville, N.Y.). Once identified, the antibiotic resistant cultures were transferred to DH82 cell cultures for further growth and maintenance. Liquid nitrogen stocks were also prepared and stored within the first two weeks after the establishment of mutant strains.
[0078] Confirming the Presence of E. chaffeensis Mutants.
[0079] The cultures of E. chaffeensis which grew well in the presence of antibiotics were subsequently screened for allelic exchange mutation positives by genomic DNA analysis by insertion specific PCRs. Total genomic DNAs were recovered from the cultures using a Wizard Genomic DNA Purification Kit as per the manufacturer's instructions (Promega, Madison, Wis.). Three different PCR assays were performed using the purified genomic DNAs (
[0080] RNA Analysis by RT-PCR to Verify the Loss and Restoration of Transcription.
[0081] Total RNAs from wild type and mutant E. chaffeensis organisms grown in ISE6 or DH82 cell cultures were isolated by following the Tri-reagent total RNA isolation method as per the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo.). The RNA samples were then treated with RQ1 DNase (Promega, Madison, Wis.) at 37 C. for 60 min to remove any residual genomic DNAs. Primers targeting to Ech_0230 or Ech_0379 ORF were used in RT-PCR analysis and the presence of specific amplicons was assessed by 0.9% agarose gel analysis and by subjecting the products to DNA sequence analysis. Semi quantitative RT-PCR assays were performed as we previously described for assessing the mRNA expression from the genes Ech_0378, Ech_0379 and Ech_0380 using equal quantities of E. chaffeensis RNAs recovered from wild type, Ech_0379 gene disruption, and Ech_0379 gene restoration mutants (
Example 2
[0082] Materials and Methods In vitro cultivation of E. canis and Anaplasma phagocytophilum. E. canis and A. phagocytophilum are continuously cultivated in ISE6 tick cell line, an I. scapularis embryonic cell line, as described earlier (Munderloh, U. G. et al. J. Clin. Microbiol. 37, 2518-2524 (1999) and Cheng, C. & Ganta, R. R. Curr. Protoc. Microbiol. Chapter 3, Unit 3A 1 (2008)).
[0083] Construction for Homologous Recombination Plasmids and Segments.
[0084] All the primers used for the preparation of recombinant plasmid constructs are developed for the targeted mutagenesis experiments by following similar protocols as we described for E. chaffeensis, except that the pathogens' gene target specific primers are used. Similarly, the detailed molecular steps followed in preparing the constructs for allelic exchange mutagenesis experiments are similar to those depicted for E. chaffeensis by following standard molecular methods (Sambrook, J. & Russell, D. W. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (2001)). Briefly, about 2.0 kb genomic DNA segments spanning about 1 kb each from both sides of the previously identified mutation insertion sites of the genes are amplified from E. canis or A. phagocytophilum gene homologs that are similar to E. chaffeensis gene Ech_0660. The Ech_0660 homolog sequences of E. canis and A. phagocytophilum are provided herein as SEQ ID NO. 54 and SEQ ID NO. 55, respectively. The amplicons are first cloned into a plasmid vector and the Ehrlichia or Anaplasma gene promoter driving antibiotic selection marker gene, along with a fluorescent reporter gene are inserted into the final targeted gene disruption mutagenesis constructs to split the sequence of the bacteria to about equal halves. Linear fragments are then generated by PCR from the entire recombinant plasmids containing E. canis- or A. phagocytophilum-specific disruption gene segments. The amplicons are then purified and concentrated to 1 g/l in nuclease free water for use in the allelic exchange mutagenesis experiments to create targeted gene disruptions.
[0085] Purification of Cell-Free E. canis and A. phagocytophilum Organisms.
[0086] Purification method to recover host cell-free organisms of E. canis or A. phagocytophilum is essentially the same as E. chaffeensis described above in Example 1 except that the infected 80-90% infected confluent ISE6 cell culture flasks containing E. canis or A. phagocytophilum are used, respectively, to generate the specific host cell-free organisms by following the protocol as in Felsheim, R. F. et al. BMC Biotechnol. 6, 42 (2006).
[0087] Transformation of E. chaffeensis and Clonal Isolation of Mutants.
[0088] Three g of purified linear DNA fragments from the allelic exchange mutagenesis plasmid constructs (outlined above) were added to the host cell-free E. chaffeensis organisms in 45 l volume, mixed gently and transferred the contents into a 1 mm gap electroporation cuvette (Bio-Rad Laboratories, Hercules, Calif.). The cuvette was incubated on ice for 15 min and then subjected to electroporation at 2,000 volts, 25 F and 400 S2 setting (Gene Pulser Xcell, Bio-Rad Laboratories, Hercules, Calif.). The electroporated cells were transferred to a micro centrifuge tube containing 0.5 ml of FBS and 1 ml of uninfected ISE6 cell suspension containing about 110.sup.6 ISE6 cells in tick cell culture infection media. The mixed sample was centrifuged at 5,000 g for 5 min, incubated at room temperature for 15 min, cells were then resuspended in 5 ml culture media and the entire contents were transferred to a T25 flask containing confluent ISE6 cells and incubated for 24 h in a humidified 34 C. incubator and then 100 g/ml each of spectinomycin and streptomycin were added to the culture medium; incubations were continued at 34 C. for several weeks to select mutants. Typically, mutants were detected by PCR analysis after two to three weeks, although the assessment continued for several weeks beyond this time point. Similar experiment was carried out to obtain Ech_0379 gene restoration mutant, except that the media containing 80 g/ml of gentamicin were used after 24 h of electroporation. Ech_0379 gene restoration mutant cultures were also assessed by detecting the expression of mCherry by examining the cultures using a Nikon Diaphot inverted microscope (Nikon, Melville, N.Y.). Once identified, the antibiotic resistant cultures were transferred to DH82 cell cultures for further growth and maintenance. Liquid nitrogen stocks were also prepared and stored within the first two weeks after the establishment of mutant strains.
[0089] Confirming the Presence of E. canis or A. phagocytophilum Mutants.
[0090] The cultures of E. canis or A. phagocytophilum which grow well in the presence of antibiotics are screened for allelic exchange mutation positives by genomic DNA analysis by insertion specific PCRs. The protocols are the same as we described for E. chaffeensis.
[0091] RNA Analysis by RT-PCR to Verify the Loss and Restoration of Transcription.
[0092] Total RNAs from wild type and mutant E. canis or A. phagocytophilum organisms grown in ISE6 cell cultures are isolated by following the TRI-reagent total RNA isolation method and treated with RQ1 DNase. Pathogen gene specific primers are used in RT-PCR analysis and the presence of specific amplicons is assessed by agarose gel analysis and by subjecting the products to DNA sequence analysis (Sambrook, J. & Russell, D. W. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (2001)).
Example 3
[0093] Materials and Methods
[0094] In Vitro Cultivation and Cell-Free E. chaffeensis Recovery
[0095] E. chaffeensis Arkansas isolate wildtype and the mutants were grown in the canine macrophage cell line, DH82. Isolation and purification of cell-free E. chaffeensis wildtype and its mutants were carried out as follows. Briefly, the bacterial infection rate in DH82 cells was assessed with Diff-Quik staining. After 72 h of infection when the infection reached to about 80-90%, the culture from four T-150 confluent flasks was harvested and centrifuged at 500g for 5 min. Cellular pellets were resuspended in 1phosphate buffered saline (PBS) containing protease inhibitors (Roche, Indianapolis, Ind.) and cells were homogenized on ice by passing through, 15-20 strokes with a 23 g needle in a 10 mL syringe. Efficiency of homogenization, 80-90% lysis, was checked under light microscope. Whole cell lysate was centrifuged at 500g for 5 min at 4 C. The resulting supernatant containing cell-free Ehrlichia organisms was filtered through a 2 m sterile membrane filter (Millipore, Billerica, Mass.). Cell-free Ehrlichia from filtrates were pelleted by centrifuging at 15,000g for 15 min and the pellet was suspended in PBS and then layered onto 30% diatrizoate meglumine and sodium solution (Renografin) MD-76R (Mallinckrodt Inc, St. Louis, Mo.). The suspension was centrifuged for 1 h at 100,000g at 4 C. in a S50-ST swinging bucket rotor (Beckman, Indianapolis, Ind.). The pellet of cell-free Ehrlichia were washed at 15,000g for 15 min and used for experiments.
[0096] Bacterial mRNA Enrichment and Sequencing
[0097] Bacteria mRNA enrichment and cDNA library preparation and RNA sequencing were performed as follows: Briefly, RNA from wildtype and mutants were isolated from purified cell-free Ehrlichia using TRIzol Reagent (Sigma-Aldrich, St. Louis, Mo.). RNA samples were then treated with DNase I (Invitrogen, Carlsbad, Calif.) and bacterial RNA was enriched by removing host 18 S rRNA, 28 S rRNA, and polyadenylated mRNA using MICROBEnrich Kit (Ambion, Foster City, Calif.). The quantity and integrity of bacterial RNA before and after enrichment was assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, Mass.) and Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, Calif.). The Ribo-Zero Magnetic Kit was used to isolate mRNA from total RNA samples and then fragmented into short fragments as per the manufacturer's protocols (Epicentre, Madison, Wis.). Subsequently, cDNA was synthesized using the mRNA fragments as templates. Libraries of cDNAs for wildtype and mutants were prepared using the TruSeq RNA Sample Prep Kit (Illumina, Ingolstadt, Germany). Sample libraries were quantified using Agilent 2100 Bioanaylzer and library quality was assessed by Real-Time PCR (ABI StepOnePlus) prior to subjecting the samples to sequencing on Illumina HiSeq 4000 (Beijing Genomics Institute (BGI), Philadelphia, Pa.).
[0098] Bioinformatics Analysis
[0099] The original image data were transferred into raw sequence data via base calling. Raw reads were subjected to quality assessment to determine whether the raw reads were qualified for mapping. The bases with low quality (<20) were excluded from the analysis. Raw reads were then filtered to remove adapter sequences and low quality reads, then clean reads were aligned to the E. chaffeensis Arkansas strain complete genome as per the first annotated GenBank # CP000236.1 using SOAPaligner/SOAP2. This accession number was selected and used because our prior publications, and similarly other investigators, widely used it for referring to gene names and numbers listed in it. Not more than five mismatches were allowed in the alignment, which is a standard cut off used for the alignment analysis. The alignment data were used to calculate distribution of reads on reference genes and determine the gene coverage. Alignment results were assessed for quality check and then proceed with analysis of DGE. The gene expression level was calculated using RPKM method of normalizing for total read length and the number of sequencing reads. We used p-value<0.05, False Discovery Rate (FDR)0.001, and the absolute value of Log 2 Ratio1 as the threshold to judge the significance difference in gene expression. The FDR uses accurate p-values as a measure of control in multiple sample comparison of RNA seq data. Corrections for false positive and false negative errors were performed using the method described by Benjamini and Yekutieli.
[0100] Quantitative Real-Time Reverse Transcription PCR
[0101] SYBR green detection-based quantitative real-time reverse transcription PCR (qRT-PCR assays were performed to validate the gene expression changes observed in the RNA seq data analysis). Wildtype, ECH_0379, ECH_0490, and ECH_0660 mutants' RNAs used in generating the RNA seq data were also used to determine transcript levels by performing quantitative RT-PCR by SYBR Green assays using a SUPERSCRIPT III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen, Carlsbad, Calif.). RNA was reverse transcribed from all the replicates using SuperScript III and then quantitative-PCRs were performed in a 25 L reaction containing 0.5 M each of forward and reverse primers. Thermal cycler conditions were; 94 C. for 15 sec, 60 C. for 30 sec, and 74 C. for 15 sec for 40 cycles. Thirteen randomly selected differentially transcribed genes were used in validation experiments using StepOnePlus Real-Time PCR instrument (Applied Biosystems, Foster City, Calif.) and the data were analyzed by StepOne Software v2.3. E. chaffeensis 16 S rRNA was quantitated by real-time RT-PCR and used for normalization of RNA concentrations among different RNA batches, prior to performing the validation experiments. For qRT-PCR data, the delta-delta Ct (Ct) calculation was employed to calculate relative change in the expression and fold change was obtained by averaging the replicate values of gene expression and the standard error. Semi-quantitative one-step RT-PCR (Life Technologies, Carlsbad, Calif.) targeting to E. chaffeensis genes ECH_0490 and ECH_0492 near the transposon mutation downstream to ECH_0490 gene was performed with 30 cycles of amplification using the gene specific primers as described in a previous study (PLoS One; 10, e0132657 (2015)). Briefly, RNA from wildtype and ECH_0490 mutant were used as the templates for RT-PCR. One tube without reverse transcriptase or template RNA was used as negative control. One tube with DNA as the template was used as positive control. Thermal cycler conditions were as follows: 50 C. for 1 h for reverse transcription step then followed by 35 cycles of 94 C. for 30 sec, 55 C. for 30 sec, and 72 C. for 30 sec; finally a 2-min 72 C. extension step was part of the reaction.
[0102] The rickettsial pathogen Ehrlichia chaffeensis causes a tick-borne disease, human monocytic ehrlichiosis. Mutations within certain genomic locations of the pathogen aid in understanding the pathogenesis and in developing attenuated vaccines. Our previous studies demonstrated that mutations in different genomic sites in E. chaffeensis caused variable impacts on their growth and attenuation in vertebrate and tick hosts. Here, we assessed the effect of three mutations on transcriptional changes using RNA deep-sequencing technology. RNA sequencing aided in detecting 66-80% of the transcripts of wildtype and mutant E. chaffeensis. Mutation in an antiporter gene (ECH_0379) causing attenuated growth in vertebrate hosts resulted in the down regulation of many transcribed genes. Similarly, a mutation downstream to the ECH_0490 coding sequence resulted in minimal impact on the pathogen's in vivo growth, but caused major changes in its transcriptome. This mutation caused enhanced expression of several host stress response genes. Even though the ECH_0660 gene mutation caused the pathogen's rapid clearance in vertebrate hosts and aids in generating a protective response, there was minimal impact on the transcriptome. The transcriptomic data offer novel insights about the impact of mutations on global gene expression and how they may contribute to the pathogen's resistance and/or clearance from the host.
[0103] Ehrlichia chaffeensis is a tick-transmitted intracellular bacterial pathogen causing human monocytic ehrlichiosis (HME) and it also infects dogs, deer, goats, and coyotes. Mutations at certain genomic locations, leading to gene expression changes, impact the pathogen's ability to cause infection and persistence in a host. The genome of E. chaffeensis may have evolved within a host cell environment leading to the development of mechanisms to undermine the host immune response. Pathogenesis-associated E. chaffeensis genes are likely highly active in a host microenvironment and consistent with this hypothesis, differential gene expression in response to host cell defense is known to occur. Progress has been made towards identifying genes crucial for Ehrlichia survival in a host cell environment. However, to date only a few abundantly expressed genes are identified as associated with pathogenesis. Defining the genes involved in pathogenesis and virulence, and documenting their differential expression may aid in the discovery of novel proteins valuable as targets for therapeutic interventions and vaccine development for HME.
[0104] Genetically mutated intracellular pathogens are important resources for studying microbial pathogenesis, and also aid in the efforts of vaccine development. Our previous study demonstrated the feasibility of transposon-based mutations in E. chaffeensis. We also found that some insertion mutations resulting in transcriptional inactivation of membrane protein genes cause attenuation of the growth of the pathogen in vertebrate hosts. Insertions within the coding regions of ECH_0379 and ECH_0660 genes offered varying levels of protection against infection in a vertebrate host. In this study, we hypothesized that the mutations' specific genomic locations may impact global gene expression and contribute to the pathogen's altered survival, infection progression, and replication in a host cell environment. To test this hypothesis, we assessed the impact of three mutations, reported earlier by Cheng et al., on global gene transcription. We selected two mutants with mutations within the coding regions of the ECH_0660 gene encoding for a phage like protein (ECH_0660) and the ECH_0379 gene encoding for an anti-porter protein (ECH_0379). Insertion mutation in ECH_0660 gene is located at the nucleotide position 213 of the 555 base long open reading frame. Similarly, mutation in ECH_0379 gene is located at the nucleotide position 682 of the 1056 base long open reading frame. The third insertion mutant strain, ECH_0490, has the insertion mutation 166 nucleotides downstream from the stop codon of ECH_0490 gene.
[0105] High throughput RNA sequencing (RNA seq) technologies have proven to be reliable and robust tools for determining global transcriptome activity in obligate intracellular bacteria. Comparative genomic studies identified several classes of virulence factors involved in secretion and trafficking of molecules between the pathogen and host cells and modulation of the host immune response. However, studies focused on Ehrlichia gene expression have been limited mostly to outer membrane proteins genes, Type IV Secretion System (T4SS) genes, tandem repeat protein (TRP) genes, and ankyrin repeat genes (Anks). Among them, genes encoding for T4SS proteins and p28-OMP proteins have been found to be critical for pathogenicity.
[0106] The obligate intracellular nature of E. chaffeensis poses a challenge in obtaining cell-free Ehrlichia from host cells. Technical constraints in isolating Ehrlichia RNA from highly abundant host RNA remains an impediment in profiling of pathogen transcripts. To overcome this limitation, we used an effective cell lysis strategy followed by density gradient centrifugation. Further, we enriched Ehrlichia RNA by efficiently removing polyadenylated RNA (poly(A) RNA) and eukaryotic and prokaryotic ribosomal RNAs from host and bacteria RNA mixtures. Sequencing of the enriched RNA aided in the detection of transcripts for 66-80% of the annotated E. chaffeensis genes as per the annotated genome: GenBank # CP000236.1. Comparison of transcript levels from wildtype and mutant strains revealed the highest degree of modulation in immunogenic and secretory protein genes, particularly in the mutant strains of ECH_0490 and ECH_0379, while minimal changes were observed in the ECH_0660 mutant strain.
[0107] Results
[0108] Isolation and Purification of Cell-Free E. chaffeensis from Host Cells
[0109] The major challenge of undertaking transcriptome studies of intracellular pathogens is the difficulty in isolating host-cell free bacteria and subsequently recovering high-quality bacterial RNA. Rickettsial organisms, including E. chaffeensis, constitute only a very small fraction of isolated total RNA. Because of the presence of highly abundant host cell RNA, recovery of bacterial RNA is a challenge for executing RNA seq analysis experiments. In this study, we first purified the host cell-free bacteria from infected host cells (canine macrophage cell line, DH82) by employing an efficient cell lysis method, coupled with density gradient centrifugation protocols. Host cell lysis was performed to efficiently rupture the host cells without causing a major damage to the bacteria. E. chaffeensis organisms are about 0.5 to 1 m in diameter. Therefore, infected host cell lysate was filtered through 2 m membrane to remove most of the host cell debris. A high-speed Renografin density gradient centrifugation of the resulting E. chaffeensis cell suspension aided in pelleting bacteria while host cell debris remained at the top layer of the solution. After total RNA isolation and DNase treatment, Bioanalyzer analysis revealed that despite the prior fractionation of host cell-free bacteria, the host 28 S and 18 S RNA remained at high concentrations in the recovered RNA. Bacterial mRNA enrichment was carried out by depleting the host poly(A) RNA and eukaryotic ribosomal RNA using a bacterial RNA enrichment protocol, resulting in nearly undetectable levels of host 28 S and 18 S RNA. The absence of contaminating E. chaffeensis genomic DNA in the purified RNA samples was confirmed by real-time quantitative PCR using E. chaffeensis 16 S rRNA gene primers. We also confirmed the absence of DNA sequences in the RNA seq raw data by aligning 20 randomly selected E. chaffeensis intergenic non-coding DNA sequences (data not shown).
[0110] Ubiquitous Transcription of Genes in E. chaffeensis Mutants
[0111] Illumina HiSeq. 4000 RNA seq of E. chaffeensis wildtype and mutants generated between 75-130 million reads. The transcriptome data were deposited in the NCBI Bio-Project ID:PRJNA428837 and SRA accession:SRP128532 (found on the web at the ncbi.nlm.nih.gov/sra/SRP128532 site). Despite efficient depletion of host ribosomal RNA, only a fraction (less than 19%) of reads were mapped to E. chaffeensis genomes. Mapping of reads (10 reads minimum/gene) identified about 66-80% of the genes being expressed from the Ehrlichia genome as per the annotated genome (GenBank # CP000236.1); the transcriptome of wildtype organisms (n=3) contained transcripts for about 920 genes of the total of 1158 genes, and similarly 888, 895, and 768 gene transcripts (n=3) were identified in mutant organisms ECH_0660, ECH_0379, and ECH_0490, respectively (Table 3). The replicate RNA seq data of wildtype (R.sup.2=0.9) and mutants ECH_0379 (R.sup.2=0.93), ECH_0490 (R.sup.2=0.68) and ECH_0660 (R.sup.2=0.89) showed a high degree of expression correlation. The scatter plot expression data of wildtype vs. ECH_0379 (R.sup.2=0.18) and wildtype vs. ECH_0490 (R.sup.2=0.38) showed a negative correlation. Notably, the expression plot of wildtype vs. ECH_0660 showed a positive correlation (R.sup.2=0.96). Only transcripts with reads per kilobase transcriptome per million mapped reads (RPKM)1 were considered for differential expression analysis.
TABLE-US-00003 TABLE 3 No. of genes identified (>3 RPKM, 10 reads minimum) Replicate 1 Replicate 2 Replicate 3 Avg (std dev) Wildtype 888 900 973 920 (46) ECH_0379 920 882 883 895 (21) ECH_0490 841 670 793 768 (88) ECH_0660 780 917 969 888 (97)
[0112] Global Transcriptome of E. chaffeensis
[0113] Distribution of the transcripts in wildtype E. chaffeensis included 481 transcripts represented by less than five transcripts, followed by hypothetical protein transcripts (178) representing 19% of transcriptome, and 127 ribosomal protein gene transcripts (14%). Transcripts of major outer membrane proteins (22 transcripts) represent the next most abundant group. Conserved domain protein transcripts encoded from 14 genes are associated with NADH dehydrogenase I complex. Other highly expressed genes included molecular chaperones, ATP synthase, putative membrane protein, cytochrome c oxidase, GTP-binding protein, putative lipoprotein, translation elongation factor, ABC transporter, and DNA polymerases; all of which represented 0.5-1.7% of the transcriptome.
[0114] ECH_0379 mutation caused transcriptional down-regulation of many genes involved in antiporter activity, phage proteins, and those involved in transport and transcription function.
[0115] Differential gene expression (DGE) was determined by comparing the RPKM expression values of mutants and wildtype. Fold changes were considered significant with a p-value<0.05, False Discovery Rate (FDR)0.001, and consistency of expression values between replicates. The change in gene expression was not significant between wildtype and mutants for housekeeping genes. Based on these criteria, 41 genes were identified as predominantly downregulated and two genes were upregulated in the ECH_0379 gene mutant compared to wildtype (Table 4). The most prominent genes that showed a significant decrease in the transcription levels were those encoding for antiporter proteins, ABC transporters, and ATP-dependent Clp protease (ECH_0367). Four antiporter protein genes: monovalent cation/proton antiporter (ECH_0466), Na(+)/H(+) antiporter subunit C (mrpC) (ECH_0469), potassium uptake protein TrkH (ECH_1093), and nitrogen regulation protein NtrY (ECH_0299) showed a significant decline in the transcript levels. In addition, transcripts for two membrane transporters: cation ABC transporter permease protein transcript of the gene ECH_0517 and another ABC transporter permease protein transcript of the gene ECH_0972 were downregulated. Three genes coding for phage-like proteins {phage prohead protease (ECH_0032), phage portal protein (ECH_0033), and phage major capsid protein (ECH_0830)} were also downregulated in the mutant strain. Transcripts for 6 genes involved in transcription, namely DNA replication and repair protein RecF (ECH_0076), formamidopyrimidine-DNA glycosylase (ECH_0602), dimethyladenosine transferase (ECH_0648), GTP-binding protein EngA (ECH_0504), leucyl-tRNA synthetase (ECH_0794), and endonuclease III (ECH_0857) were also downregulated in this mutant strain. The enzymes of metabolic processes such as glutamate cysteine ligase (GCL) (ECH_0125), DNA/pantothenate metabolism flavoprotein (PMF) (ECH_0374), ATPase, AGF1 (ECH_0392), uroporphyrinogen III synthase (UPGS) (ECH_0480), diaminopimelate decarboxylase (DAPDC) (ECH_0485), biotin-acetyl-CoA-carboxylase ligase (BACL) (ECH_0848), and argininosuccinate lyase (ASL) (ECH_0937) are also down-regulated. Transcripts for 8 hypothetical protein genes; ECH_0021, ECH_0161, ECH_0264, ECH_0289, ECH_0725, ECH_0879, ECH_0913, and ECH_1053 were also among the downregulated genes in this mutant.
TABLE-US-00004 TABLE 4 Wildtype ECH_0379 Fold change gene gene (ECH_0379/Wildtype) expression expression FDR 0.001, Gene ID (RPKM) (RPKM) p-value <0.05 Gene name Down regulated genes ECH_0021 391 211 1.88 conserved hypothetical protein ECH_0032 82 26 3.2 phage prohead protease, HK97 family ECH_0033 41 20 1.53 phage portal protein, HK97 family ECH_0076 287 59 5 putative DNA replication and repair protein RecF ECH_0125 386 185 2.08 glutamate-cysteine ligase ECH_0161 81 42 1.92 hypothetical protein ECH_0188 586 121 5 putative surface protein ECH_0264 814 194 4.16 conserved hypothetical protein ECH_0289 102 52 1.96 hypothetical protein ECH_0299 1432 442 1.81 putative nitrogen regulation protein NtrY ECH_0367 3407 1784 1.92 ATP-dependent Clp protease, ATP-binding subunit ClpB ECH_0374 411 157 2.63 DNA/pantothenate metabolism flavoprotein family protein ECH_0392 845 159 5.55 ATPase, AFG1 family ECH_0466 432 252 1.72 monovalent cation/proton antiporter ECH_0469 137 52 5.55 Na(+)/H(+) antiporter subunit C ECH_0473 793 306 5.55 aromatic-rich protein family ECH_0480 319 92 3.22 uroporphyrinogen-III synthase ECH_0485 537 172 3.14 diaminopimelate decarboxylase ECH_0504 859 288 3.03 GTP-binding protein EngA ECH_0517 503 52 10 putative cation ABC transporter, permease protein ECH_0523 1525 159 10 conserved domain protein ECH_0541 251 124 2 5-formyltetrahydrofolate cyclo- ligase family protein ECH_0602 84 24 3.57 formamidopyrimidine-DNA glycosylase ECH_0648 399 138 2.94 dimethyladenosine transferase ECH_0725 648 280 2.32 conserved hypothetical protein ECH_0756 815 153 5.55 divalent ion tolerance protein CutA1 ECH_0789 1154 363 3.22 cytochrome c-type biogenesis protein CcmE ECH_0794 1593 306 5.26 leucyl-tRNA synthetase ECH_0830 397 123 3.22 phage major capsid protein, HK97 family ECH_0848 1015 253 4 biotinacetyl-CoA-carboxylase ligase ECH_0857 638 311 2.04 endonuclease III ECH_0864 455 246 1.85 conserved domain protein ECH_0879 520 153 3.44 hypothetical protein ECH_0913 570 114 5 conserved hypothetical protein ECH_0937 521 284 1.85 argininosuccinate lyase ECH_0972 524 285 1.85 ABC transporter, permease protein ECH_0998 722 332 2.17 ubiquinone/menaquinone biosynthesis methlytransferase UbiE ECH_1053 541 248 2.22 conserved hypothetical protein ECH_1063 201 106 1.92 modification methylase, HemK family ECH_1081 310 78 4 SURF1 family protein ECH_1084 684 364 1.88 AraM protein ECH_1093 973 320 2.32 putative potassium uptake protein TrkH ECH_1101 1143 190 6.25 prolipoprotein diacylglyceryl transferase Up regulated genes ECH_0684 1765 3651 2.06 ankyrin repeat protein type IV secretion system protein ECH_0495 942 1492 1.58 VirB4
[0116] Differential Transcriptional Regulation of T4SS and p-28 OMP Gene Cluster Genes in Mutant ECH_0490
[0117] In the ECH_0490 mutant strain, 37 genes were significantly downregulated and 17 genes were up-regulated (Table 5). Four of the downregulated genes belonged to the T4SS are ECH_0494 (VirB3), ECH_0496 (VirB6), ECH_0498 (VirB6), and ECH_0499 (VirB6); and a type I secretion membrane fusion protein (T1SS_HlyD) (ECH_0970). Molecular chaperone genes, such as a cold shock protein (CSP) (ECH_0298) and ATP-dependent Clp protease, and a ATP-binding subunit ClpA (ClpA) were also downregulated. The transport proteins including the protein export membrane protein (SecF) (ECH_0095), preprotein translocase (SecY) (ECH_0428), potassium uptake protein (TrkH) (ECH_1093), and nitrogen regulation protein (NtrY) (ECH_0299) were also among the downregulated genes. Metabolic enzymes involved in biosynthetic processes, {tetrahydropyridine-2-carboxylate N-succinyltransferasem (dapD) (ECH_0058), quinone oxidoreductase (ECH_0385), metalloendopeptidase, (MEP) (ECH_0644), peptide deformylase (PDF) (ECH_0939), serine/threonine phosphatase (PSP) (ECH_0964), pyrophosphatase (PPi) (ECH_1014), and orotate phosphoribosyltransferase (OPRTase) (ECH_1108)}, were also down-regulated. Transcription- and translation-related genes, such as elongation factors (EF-Tu) (ECH_0515), aminoacyl-tRNA synthetases (IARS) (ECH_0538), DNA-binding protein (HU) (ECH_0804), 3-5 exonuclease domain (ECH_1011), and DNA-binding response regulator (ECH_1012), were also downregulated.
TABLE-US-00005 TABLE 5 Wildtype ECH_0490 Fold change gene gene (ECH_0490/wildtype) expression expression FDR 0.001, Gene ID (RPKM) (RPKM) p-value <0.05 Gene name Down regulated genes ECH_0058 1902 1006 1.88 2,3,4,5-tetrahydropyridine-2- carboxylate N-succinyltransferase ECH_0085 1119 523 2.17 ABC transporter, ATP-binding protein ECH_0095 1921 990 1.96 protein export membrane protein SecF ECH_0264 814 310 5.55 conserved hypothetical protein ECH_0298 8295 3870 2.17 cold shock protein, CSD family; ECH_0299 719 314 2.17 putative nitrogen regulation protein NtrY ECH_0300 557 283 2 putative ribonuclease D ECH_0385 1659 663 2.5 quinone oxidoreductase ECH_0428 979 425 2.32 preprotein translocase, SecY subunit ECH_0470 1220 598 2 ribonuclease, Rne/Rng family ECH_0475 977 444 2.22 signal recognition particle protein ECH_0483 158 77 2.04 primosomal protein N ECH_0494 2326 1034 2.17 type IV secretion system protein VirB3 ECH_0496 1059 435 2.43 type IV secretion system protein VirB6 ECH_0498 1154 490 2.38 type IV secretion system protein,VirB6 family ECH_0499 1129 558 2 type IV secretion system protein,VirB6 family ECH_0515 1968 910 2.17 translation elongation factor Ts ECH_0525 1055 427 2.5 conserved domain protein ECH_0538 729 355 2.08 isoleucyl-tRNA synthetase ECH_0567 626 177 3.57 ATP-dependent Clp protease, ATP-binding subunit ClpA ECH_0585 475 229 2.08 conserved domain protein ECH_0644 1902 764 2.5 putative metalloendopeptidase, glycoprotease family ECH_0700 2670 1073 2.5 hypothetical protein ECH_0804 3113 1292 2.43 DNA-binding protein HU ECH_0820 409 167 2.5 conserved hypothetical protein ECH_0840 935 296 3.22 2-polyprenylphenol 6-hydroxylase ECH_0939 752 276 2.77 putative polypeptide deformylase ECH_0953 2914 1480 2 ribosomal protein L7/L12 ECH_0964 1281 557 2.32 serine/threonine phosphoprotein phosphatase ECH_0970 474 247 1.92 type I secretion membrane fusion protein, HlyD family ECH_1011 2253 1104 2.04 3-5 exonuclease family protein ECH_1012 3353 1605 2.08 DNA-binding response regulator ECH_1014 1661 536 3.12 inorganic pyrophosphatase ECH_1093 973 416 2.38 putative potassium uptake protein TrkH ECH_1108 1903 938 2.04 orotate phosphoribosyltransferase ECH_1139 545 285 1.92 major outer membrane protein OMP-1D Up-regulated genes ECH_0009 7047 16828 2.38 putative membrane protein ECH_0039 316 931 2.94 120 kDa immunodominant surface protein ECH_0166 42488 96364 2.26 conserved hypothetical protein ECH_0167 718 2654 3.70 tryptophanyl-tRNA synthetase ECH_0169 161 397 2.46 riboflavin biosynthesis protein RibD ECH_0230 991 4109 4.15 putative membrane protein ECH_0251 1042 2185 2.1 hypothetical protein ECH_0303 1018 2856 2.80 BolA family protein ECH_0367 849 1274 2.49 ATP-dependent Clp protease, ATP-binding subunit ClpB ECH_0450 1261 3710 2.94 conserved hypothetical protein ECH_0531 1363 11788 8.65 hypothetical protein ECH_0630 732 1688 2.30 FeS cluster assembly scaffold IscU ECH_0655 1840 2763 2.03 RNA polymerase sigma-32 factor ECH_0753 1932 4153 2.15 conserved hypothetical protein ECH_0818 374 1222 3.26 major facilitator family transporter ECH_0878 217 1126 5.17 hypothetical protein ECH_1121 1578 3132 3.1 major outer membrane protein Omp-1N ECH_1136 698 8270 2.37 major outer membrane protein OMP-1B ECH_1143 3957 8359 2.24 major outer membrane protein P28 major outer membrane protein ECH_1146 190 1100 6.73 P28-2
[0118] Upregulated protein genes in this mutant included 7 that belonged to the transmembrane protein category. Of these, four belonged to the p-28 OMP gene cluster {ECH_1143 (OMP-p28), ECH_1146 (OMP-p28-2), ECH_1136 (OMP-1B), and ECH_1121 (OMP-1N)}. In addition, two putative membrane protein genes (ECH_0009, ECH_0230) and an immunodominant surface protein gene (ECH_0039) were upregulated. Transcripts for the heat shock proteins ATP-dependent Clp protease, ClpA (ECH_0567) and ATP-binding chaperon, ClpB (ECH_0367), and the stress response-associated RNA polymerase sigma factor (RpoH) (ECH_0655) were also upregulated. Transcripts for two genes coding for iron sulfur proteins {BolA family protein (ECH_0303) and FeS cluster assembly scaffold (IscU) (ECH_0630)} were similarly up-regulated. We observed differential expression of six hypothetical protein genes, which included ECH_0166, ECH_0251, ECH_0450, ECH_0531, ECH_0753, and ECH_0878.
[0119] Mutation in ECH_0660 gene led to minimal transcriptional alterations
[0120] While we observed drastic gene expression changes in both ECH_0379 and ECH_0490 mutants, ECH_0660 mutant transcriptome showed minimal variations compared to wildtype; we observed only five genes as notably differentially expressed in this mutant (Table 6). The genes included nitrogen regulation protein (NtrY) (ECH_0299) and the ABC transporter permease protein (ECH_0972) as down-regulated genes, whereas the heme exporter protein CcmA (ECH_0295) and chaperonin (ECH_0364) were upregulated. We also identified several commonly differentially-expressed genes in ECH_0379 and ECH_0490 (Table 7). The ribonuclease D (ECH_0300) and potassium uptake protein (ECH_1093) were commonly down regulated in ECH_0379 and ECH_0490. T4SS protein VirB4 gene was down-regulated in ECH_0490 mutant, whereas this gene was up-regulated in ECH_0379 mutant. Contrary to this, ClpB was down-regulated in ECH_0379 mutant and upregulated in ECH_0490 mutant.
TABLE-US-00006 TABLE 6 Wildtype ECH_0660 Fold change gene gene (ECH_0660/Wildtype) expression expression FDR 0.001, Gene ID (RPKM) (RPKM) p-value <0.05 Gene name Down regulated genes ECH_0299 1432 720 2 putative nitrogen regulation protein NtrY ECH_0972 524 309 1.69 ABC transporter, permease protein Up regulated genes ECH_0295 336 631 1.87 putative heme exporter protein CcmA ECH_0364 6801 12150 1.78 chaperonin, 10 kDa conserved ECH_1147 1982 4756 2.39 hypothetical protein
TABLE-US-00007 TABLE 7 Wildtype Mutant gene gene Fold change expression expression FDR 0.001, Gene ID (RPKM) (RPKM) p-value <0.05 Gene name mutants Down regulated genes ECH_0299 1432 442 1.81 putative nitrogen ECH_0379 regulation protein NtrY ECH_0490 ECH_0264 814 310 2.63 conserved hypothetical ECH_0379 protein ECH_0490 ECH_0300 557 283 2 putative ribonuclease D ECH_0379 ECH_0490 ECH_0864 279 193 1.44 conserved domain protein ECH_0379 ECH_0490 ECH_1093 972 416 1.81 putative potassium uptake ECH_0379 protein TrkH ECH_0490 ECH_0495 833 517 1.63 type IV secretion system ECH_0490 protein VirB4 ECH_0367 3407 1783 1.92 ATP-dependent Clp ECH_0379 protease, ATP-binding subunit ClpB ECH_0745 712 437 1.63 conserved domain protein ECH_0379 Up regulated ECH_0495 942 1492 1.58 type IV secretion system ECH_0379 protein VirB4 ECH_0367 849 1275 2.49 ATP-dependent Clp ECH_0490 protease, ATP-binding subunit ClpB ECH_0745 547 920 1.68 conserved domain protein ECH_0490
[0121] Validation of RNA Seq Data by Quantitative Real-Time Reverse Transcription PCR
[0122] Quantitative real-time quantitative reverse transcriptase-PCR (qRT-PCR) analysis was carried out on thirteen randomly selected genes identified as differentially transcribed according to the RNA seq data. To generate qRT-PCR data, we first normalized RNA samples to a constitutively expressed E. chaffeensis gene coding for the 16S RNA as previously described in Cheng et al. Transcript abundance for 7 down-regulated genes in ECH_379 mutant, including ECH_0466 and mrpC, ClpB, ECH_0033, NtrY, TrkH, and ECH_0972 were validated. Similarly, 6 upregulated genes from ECH_0490 mutant strain, including four transcripts belonging to an OMP gene cluster (OMP-p28, OMP-1B, OMP-1N, OMP-p28-2) and one each from ClpB and RpoH genes were verified by qRT-PCR. Likewise, the down-regulation of transcripts for the ECH_0299 and ECH_0972 genes were confirmed in ECH_0660 mutant by qRT-PCR.
[0123] Discussion
[0124] Isolation of cell-free bacterial RNA from highly abundant host RNA is the first challenge in transcriptional profiling of intracellular pathogens. Rickettsiales require culturing in host cells and then need to be purified before extracting RNA for transcriptome evaluation experiments. To document the impact of three transposon mutations on E. chaffeensis transcription, we first developed a method for isolation and purification of host cell-free E. chaffeensis organisms, from which we isolated RNA and then subjected to next generation sequencing (NGS) analysis. To isolate cell-free E. chaffeensis, we started with an efficient host cell lysis protocol, and then filtration of whole cell lysate, followed by a renografin density gradient centrifugation. The second challenge was to obtain host cell-free RNA for transcriptome profiling. Previous studies report that bacterial RNA enrichment methods result in the enrichment of bacterial RNA reads only 3-10%. Isolation of host cell-free bacteria and the bacterial RNA purification steps implemented in our study allowed a greater enrichment of E. chaffeensis RNA. In our current studies, we were able to enrich the bacterial RNA, which helped in generating up to 19% high mapping RNA reads. Notably, deep RNA sequencing analysis aided in mapping 80% of E. chaffeensis genes expressed in infected macrophage host cells.
[0125] Among the highly expressed genes, the p28-OMP multigene cluster was dominant in the transcriptome. The E. chaffeensis p28-OMP multigene locus contains 22 tandemly arranged genes coding for the bacterial immunodominant proteins. The presence of all 22 transcripts in the RNA seq data suggest that the gene cluster is among the most abundantly expressed genes. These observations are consistent with our previous proteomic study where we reported the p28-OMP genes' expression abundance. NADH dehydrogenase I complex genes were also highly expressed in E. chaffeensis. NADH dehydrogenase counters the phagosomal NOX2 response to inhibit host cell apoptosis34. T4SS effector proteins in some pathogenic bacteria are considered as important in manipulating a host gene expression to undermine the host immune response. The contributions of T4SS effectors in pathogenicity are already reported for rickettsiales, including for A. marginale, A. phagocytophilum, E. canis, and E. chaffeensis. The RNA seq analysis identified several transcripts encoding for T4SS proteins, including VirB3, B4, B6, B8, B9, B10, and B11. Chaperone protein genes DnaK, DnaJ, GroE, and ClpB were also highly expressed in both wildtype and mutant strains. The presence of such proteins involved in cell homeostasis and the oxidative stress response is reported in other rickettsiales, suggesting that their gene products are also critical for the E. chaffeensis stress response if the pathogen proteome is similarly altered as per the transcriptome reported in the current study. Indeed, our recent study suggests that the stress response proteins are important for E. chaffeensis. Other highly expressed protein genes included those encoding for housekeeping ribosomal proteins involved in protein synthesis, putative membrane proteins, ABC transporter, and lipoprotein; all of which are likely important for the pathogen's protein synthesis, transport, trafficking, and effector secretion into the host cells. ATP synthase subunit, cytochrome c oxidase, DNA polymerases, GTP-binding protein and translation elongation factors involved energy metabolism, cell division, and transcriptional regulation were also among the highly expressed genes in both wildtype and mutant organisms. The extent of transcriptome coverage is higher than the previously reported for E. chaffeensis in ISE6 and AAE2 tick cells8. This is substantial for both the enhanced detection of intracellular pathogen transcripts and also because of the abundance of gene expressions observed. Higher coverage of the transcriptome likely resulted from deep sequencing of the RNAs by next-generation sequencing compared to microarray analysis. This global set of highly expressed genes may represent products involved in pathogenicity, replication and survival of E. chaffeensis in host cell environment. Four transcripts that code for ankyrin repeat proteins, which are shown to mediate protein-protein interactions, were also identified in the transcriptome. Notably, the transcriptome from the wildtype and mutant organisms contained 216 transcripts that code for hypothetical proteins with unknown function. As these were within the core transcriptome, we anticipate that they represent an important set of transcribed genes for E. chaffeensis replication.
[0126] Transcription from large numbers of genes in ECH_0379 mutant was found to be reduced compared to wildtype. Genes representing antiporters, ABC transporters, chaperons, metabolic enzymes, and transcription regulators are among the down-regulated genes (Table 4). We predict that the mutation in the anti-porter protein gene caused a metabolic depression. Antiporter and transport proteins play an important role in the transport of ions and solutes across the cell membranes of bacteria. Antiporters are integral membrane proteins that perform secondary transport of Na+ and/or K+ for H+ across a phospholipid membrane. The E. chaffeensis genome contains several genes having homology to antiporter proteins or their subunits, suggesting that they are needed for the pathogen's intraphagosomal replication and survival in a host. In particular, antiporters aid bacteria in maintaining pH, salt, and temperature conditions. We observed a significant decline in transcription of antiporter genes such as monovalent cation/H+antiporter subunit C (ECH_0469) and ECH_0466. Disrupting the antiporter function or preventing their expression may affect the pathogen's growth in vivo. Indeed, mutation in the ECH_0379 gene resulted in the attenuated growth of the organism in both an incidental host (dog) and in the reservoir host (white-tailed deer). ABC transporters also are involved in uptake of ions and amino acids and may play an important role in a pathogen's ability to infect and survive in a host cell environment. The ECH_0379 mutant had low levels of transcriptional activity of the genes ECH_0517 and ECH_0972 encoding for ABC transporters, which function at different stages in the pathogenesis of infection. These proteins promote the survival of pathogens in the host microenvironments. The mutation possibly interferes with transport mechanisms, thereby affecting its ability to infect and survive in host cells. The mutation may have also caused alterations to the transcriptions of genes involved in physiological responses, such as regulating the pathogen's metabolic activities. We also found down-regulation of several transcripts encoding for metabolic enzymes: glutamate-cysteine ligase, DNA/pantothenate metabolism flavoprotein family protein, ATPase, uroporphyrinogen-III synthase, diaminopimelate decarboxylase, biotin-acetyl-CoA-carboxylase ligase, and argininosuccinate lyase. In general, a pathogen's survival in an intracellular environment depends on its ability to derive nutrients from the host cell. Pathogenic bacteria use metabolic pathways and virulence-associated factors that undermine the host immune system so that they can derive nutrients from their host cells. It is possible that the downregulation of the transcripts from the aforementioned genes in the ECH_0379 mutant hampers the bacterial metabolic response and its capacity to derive nutrients from the host. The mutation also caused decreased expression of genes encoding DNA replication and repair protein, formamidopyrimidine-DNA glycosylase, dimethyladenosine transferase, and leucyl-tRNA synthetase. This may have also contributed to defects in pathogen's intracellular growth and survival. Our prior studies suggest that despite the mutant's attenuated growth, it failed to offer complete protection against wildtype infection challenge. If the changes in the transcriptome correlate with changes in the proteome, variations in the mutant organisms' protein expression relative to the wildtype E. chaffeensis may result in an altered host response, thus making the host less effective in initiating a protective host response when exposed to the mutant organisms.
[0127] Pathogenic bacteria produce T4SS effectors to weaken the host cell gene expression and contributes to bacterial virulence. RNA seq data suggested declined expressions of various T4SS component protein gene transcripts in ECH_0490 mutant. We also observed decreased transcription of chaperone proteins and several genes involved in the transcription and translational machinery, and exonuclease and DNA-binding regulator gene transcripts in the ECH_0490 mutant strain. On the contrary, ClpB (a major stress response heat shock protein) and RpoH (stress response RNA polymerase transcriptional subunit) showed increased transcription in the mutant.
[0128] Chaperone proteins play a key role in protein disaggregation and in aiding the pathogen to overcome the likely host cell-induced stress. ClpB reactivates aggregated proteins accumulating under stress conditions and it was abundantly expressed during replication stage of E. chaffeensis. Preventing or reducing protein aggregation and the associated protein inactivation during the bacterial growth within a host cell may benefit the pathogen in enhancing its survival. The RNA polymerase transcription regulator, RpoH, is also important for the pathogen's continued growth as it aids in promoting the expression of stress response proteins. Consistent with the prediction, increased expression of ClpB and RpoH was observed in the current study for ECH_0490 mutant. The enhanced expression from these two important genes likely enables the mutant to grow similarly to wildtype E. chaffeensis in vertebrate and tick hosts, as reported in our previous studies. Outer membrane proteins perform a variety of functions such as invasion, transport, immune response, and adhesion that are vital to the survival of Ehrlichia species, including E. chaffeensis and E. ruminantium in a host. The ECH_0490 mutant had increased abundance of OMPs compared to wildtype organisms. We found seven transmembrane genes coding for immunodominant P28/OMP family of proteins (OMP_p28, OMP_p28-2, OMP-1B, and OMP-1N) and membrane proteins (ECH_0039, ECH_0009, and ECH_0230) to be upregulated. Significant changes in the abundance of the outer membrane proteins may be associated with overall changes in the membrane architecture, thereby altering the pathogen's susceptibility to host defense. The transcriptional changes noted in the ECH_0490 mutant may not have had any negative impact on the pathogen, as the mutant grows similar to the wildtype pathogen both in white-tailed deer (the reservoir host) and in dogs (an incidental host), and in its tick host, Amblyomma americanum. Transcriptional activity assessment of the genes ECH_0490 (lipoic acid synthetase) and ECH_0492 (putative phosphate ABC transporter), both of which are located up and down stream to the transposon insertion mutation, respectively, suggested that the mutation has no effect on these genes' transcription. The diverse changes in the transcriptome of the mutant, while having no impact near the mutation site, suggest that the mutation impacted global gene expression and yet did not adversely affect the pathogen's survival in vertebrate and tick hosts.
[0129] The most notable observation was the apparent minimal variation in the transcriptome of the ECH_0660 mutant compared to the wildtype E. chaffeensis. Importantly, mutation within ECH_0660 gene causes severe growth defects in vivo in vertebrate hosts. Further, infection with this mutant also initiates a strong host response and confers protection against wildtype pathogen infection challenge. In the current study, we observed only minor changes in the gene expression in this mutant compared to wildtype. The minor changes in gene expression included genes encoding for putative nitrogen regulation protein, ABC transporter, heme exporter protein and GroES, but the variations were significantly less compared to numerous changes described in the previous two mutants. Together, these data suggest that the mutation in ECH_0660 gene led to fewer transcriptional alterations. Assuming that the proteomes of the wild type and mutant strains of E. chaffeensis are similarly altered as the transcriptomes, then ECH_0660 mutant proteome may be very similar to the wildtype bacterium. The greater degree of similarity between this mutant and the wildtype may enable the vertebrate hosts to recognize this mutant as closer to wildtype organism, thus inducing a stronger host response that mimics wildtype infection. The replication defect reported earlier with this mutant may have resulted due to the loss of gene expression from fewer genes such as ECH_0659 and ECH_0660, while maintaining most of the transcriptome similar to the wildtype.
CONCLUSIONS
[0130] RNA deep sequencing studies in intracellular bacteria are still a major challenge. The RNA seq data reported here provide the first snapshot of comparative transcriptomics of E. chaffeensis. Sequencing of enriched bacterial RNA from wildtype and mutant strains yielded a high coverage of genes. A mutation in the ORF of ECH_0379 gene caused drastic down-regulation of genes leading to metabolic depression, which may have contributed to the mutant's attenuation in vertebrate hosts. While a mutation downstream to the protein coding sequence of ECH_0490 gene induced global changes in gene expression, up regulation of stress response regulatory genes may have helped the mutant survive in the vertebrate hosts and tick hosts. A mutation within ECH_0660 gene coding sequence resulted in few transcriptional changes, thus keeping the integrity of its transcriptome similar to wildtype. While the transcriptome data are suggestive of protein expression variations, additional experimental validation from protein analysis studies is necessary to confirm the results. Together, this study offers the first detailed description of transcriptome data for E. chaffeensis, suggesting that variations observed in the pathogen's ability to survive in a host and the host's ability to induce protection against the pathogen may be the result of global changes in the gene expression, which in turn may impact changes in the pathogen's proteome.