SCHIZOCHYTRIUM LIMACINUM STRAIN, BUILDING METHOD THEREFOR AND APPLICATION THEREOF
20200190545 ยท 2020-06-18
Assignee
Inventors
- He HUANG (Nanjing, Jiangsu Province, CN)
- Lujing REN (Nanjing, Jiangsu Province, CN)
- Shenglan CHEN (Nanjing, Jiangsu Province, CN)
- Lingjun GENG (Nanjing, Jiangsu Province, CN)
- Xiaojun JI (Nanjing, Jiangsu Province, CN)
- Xuechao HU (Nanjing, Jiangsu Province, CN)
Cpc classification
C12P7/6472
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a Schizochytrium limacinum strain, a building method therefor and an application thereof. The strain disclosed is classified and named as Schizochytrium sp. HX-RS, and the preservation number is CCTCC NO: M2017046. An acyltransferase functional domain originating from shewanella PKS enzyme is adopted instead of an acyltransferase functional domain originating from schizochytrium sp. PKS enzyme, and the strain is obtained by performing flat panel screening and acclimation screening with a high rotation speed and a low temperature.
Claims
1. A Schizochytrium sp. strain, characterized in that the Schizochytrium sp. strain is classified and named as Schizochytrium sp. HX-RS with preservation number of CCTCC NO: M2017046.
2. Construction method of the strain according to claim 1, characterized by comprising the following steps: (1) taking Schizochytrium sp. HX-308 as an original strain, knocking out the acyltransferase domain (AT) in the genome of the original strain, and introducing the acyltransferase domain (AT) of an exogenous strain to build a recombinant strain; wherein the exogenous strain is Shewanella sp. (SCRC-2738); (2) screening the recombinant strain constructed in step (1) on a resistant plate containing bleomycin, transferring the screened recombinant strain into a shake flask, performing domestication at a rotation speed of 180-250 rpm and a temperature of 18-25 C., and screening the strain with high growth speed and high unsaturated fatty acid content.
3. The construction method according to claim 2, characterized in that the method for knocking out the acyltransferase domain (AT) in the genome of the original strain in step (1) is to knock out the gene of the acyltransferase domain (AT) in the genome of Schizochytrium sp. by taking the upstream and downstream regions of the acyltransferase domain (AT) as homologous recombination fragments and the bleomycin-resistant gene expression cassette as a screening marker; the nucleotide sequence of the upstream homologous arm of the acyltransferase domain (AT) is shown as SEQ ID NO: 1, and the nucleotide sequence of the downstream homologous arm of the acyltransferase domain (AT) is shown as SEQ ID NO: 2.
4. The construction method according to claim 3, characterized in that the method for introducing the acyltransferase domain (AT) of the exogenous strain in step (1) is to build homologous recombination fragments containing the expression cassette of the Shew-AT gene by taking the upstream and downstream regions of the acyltransferase domain (AT) as homologous recombination fragments, and the expression cassette of the Shew-AT gene sequentially contains a ubiquitin promoter, the Shew-AT gene and a ubiquitin terminator; and the nucleotide sequence of the Shew-AT gene is shown in SEQ ID NO: 3.
5. The construction method according to claim 2, characterized in that the domestication mode of the recombinant strain in step (2) comprises steps of screening on the resistant plate containing zeocin, and transferring the screened recombinant strain into the shake flask, one generation every 24 hours, 30-50 generations in total; wherein the concentration of zeocin in the plate is 15-45 g/mL.
6. Application of the strain in co-production of Eicosapentaenoic Acid (EPA) and Docosahexaenoic Acid (DHA) according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0027]
[0028]
[0029]
[0030]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0031] The media used in the following examples are as follows:
[0032] Seed media: glucose 30-60 g/L, yeast extract 2-4 g/L, sodium glutamate 8-15 g/L, KH.sub.2PO.sub.4 2-5 g/L, CaCl.sub.2.H.sub.2O 0.5-4 g/L/1, MgCl.sub.2 2-5 g/L, NaCl 10-20 g/L, KCl 1-4 g/L, MgSO.sub.4.7H.sub.2O 2-6 g/l, FeCl.sub.3 0.1-0.5 g/l.
[0033] Fermentation media: glucose 60-120 g/L, yeast extract 2-46 g/L, sodium glutamate 15-20 g/L, NaCl 15-20 g/L, MgCl.sub.2 2-5 g/L, (NH.sub.4).sub.2SO.sub.4 2-8 g/L, KH.sub.2PO.sub.4 3-6 g/L, KCl 1-4 g/L, MgSO.sub.4.7H.sub.2O 3-5 g/L and FeCl.sub.3 0.1-0.5 g/L.
Example 1
[0034] This example illustrates the biological material source information of the invention.
[0035] Schizochytrium sp. HX-308 has been preserved in China Center for Type Culture Collection (CCTCC), with preservation number of CCTCC No.: M209059.
[0036] The domesticated Schizochytrium sp. HX-RS, a genetically engineered strain of schizochytrium sp., is preserved in China Center for Type Culture Collection (CCTCC), with the preservation number of CCTCC No: M2017046.
[0037] Vector PBS-Zeo: Constructed by this laboratory independently.
[0038] Vector PMD19-T (simple): Commercial vector, purchased from TaKaRa Company.
Example 2
[0039] This example illustrates the construction of a recombinant plasmid PBS-Zeo-AT for knock-out of AT functional domain.
[0040] The steps for constructing the plasmid PBS-Zeo-AT are shown in
[0041] 1. Obtaining Upstream and Downstream Homologous Arms of an AT Gene of Schizochytrium sp.
[0042] (1) Obtaining an Upstream Homologous Arm of an AT Gene of Schizochytrium sp.
[0043] Designing primers ATup-s and ATup-A according to the AT gene sequence obtained through sequencing to amplify the upstream homologous arm of Schizochytrium sp. HX-308, and connecting such arm to a PMD19-T vector to obtain a recombinant plasmid pMD19-ATup. Wherein
TABLE-US-00001 ATup-Ssequence: 5AAGGAAAAAAGCGGCCGCTGCTATTCCGTGCTCCTCTC3, ATup-Asequence: 5GCTCTAGAGCGCCTTGGGCGTGATGTTGAG3.
[0044] (2) Obtaining a Downstream Homologous Arm of an AT Gene of Schizochytrium sp.
[0045] Designing primers ATdown-S and ATdown-A according to the obtained AT gene sequence to amplify the downstream homologous arm, and connecting such arm to a pMD19-T vector to obtain a recombinant plasmid pMD19-ATdown.
TABLE-US-00002 ATdown-Ssequence: 5CCGGAATTCCGGTGGAACAAGGCTCTGGCCGT3; ATdown-Asequence: 5CGGGGTACCCCGGACGCCAGGAACAAGGTGGG3.
[0046] 2. Constructing a Plasmid PBS-Zeo-ATup
[0047] Performing double enzyme digestion on plasmids pMD19-ATup and PBS-Zeo by use of NotI and XbaI restriction incision enzymes respectively, and then connecting the gel-extracted ATup fragment to the linearized PBS-Zeo vector to obtain the recombinant plasmid PBS-Zeo-ATup.
[0048] 3. Constructing a Plasmid PBS-Zeo-AT
[0049] Performing double enzyme digestion on plasmids pMD19-ATdown and PBS-Zeo-ATup by use of EcoRI and KpnI restriction incision enzymes respectively, and then connecting the gel-extracted ATdown fragment to a linearized PBS-Zeo-ATup vector to obtain the recombinant plasmid PBS-Zeo-AT.
Example 3
[0050] This example describes the production of oil by an acyltransferase AT-deficient Schizochytrium sp. Strain.
[0051] Performing double enzyme digestion on the plasmid PBS-Zeo-AT by use of two restriction incision enzymes NotI and KpnI, and then purifying fragments containing AT upstream and downstream homologous arms and bleomycin by a Takara gel extraction kit; transforming the fragments into Schizochytrium sp. HX-DS by electroproration; coating the transformed bacterial solution on a plate containing 20 g/mL bleomycin, and culturing it in dark at 30 C. for 2 days; picking out positive single colony shake flask for culturing, extracting genome for PCR verification, and naming the correct defective bacterium Schizochytrium sp. HX-DS.
[0052] Inoculating the obtained engineering bacteria into seed media at a temperature of 30 C. and a rotation speed of 170 rpm, measuring cell dry weight and fatty acid content respectively, and comparing such parameters with those of the original strain under the same conditions. The results are shown in
TABLE-US-00003 TABLE 1 Comparison of distribution difference between fatty acids in seeds of Schizochytrium sp. HX-DS and the original strain Fatty acid Composition of fatty acid/% (% TFA) Original strain Schizochytrium sp. HX-DS C14:0 2.25 0.26 10.24 0.24 C16:0 17.95 0.25 32.96 0.31 C18:0 0.33 0.02 0.72 0.05 EPA 1.04 0.02 1.13 0.05 DPA 19.87 0.14 12.51 0.11 DHA 49.52 0.23 35.20 0.17
[0053] As shown in
[0054] This example describes the fact that the changes of the AT domain of Schizochytrium sp. can affect the fatty acid types of the strain.
Example 4
[0055] Construction of a Recombinant Plasmid PBZ-Shew-AT
[0056] The steps for constructing the plasmid PBZ-Shew-AT are shown in
[0057] 1. Cloning a ubiquitin promoter, Shew-AT and a ubiquitin terminator
[0058] Referring to the ubiquitin promoter, SHEW-AT (AT gene of SHEWANELA SP. SCRC-2738) and ubiquitin terminator gene sequences in NCBI, which were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., taking the synthesized plasmids pUC-Ubiquitin promoter, pUC-Shew-AT and pUC-Ubiquitin terminator as templates, and designing the following primer sequences to amplify three gene fragments:
TABLE-US-00004 Promoter-S: 5GCTCTAGAGCCGTTAGAACGCGTAATACGACTCAC3 Promoter-A: 5CCGAGGCCTTCGGCGTTTGCTCCACTTCGTCTTATCCTCAGTCATGTT GG3 Shew-S: 5CCAACATGACTGAGGATAAGACGAAGTGGAGCAAACGCCGAAGGCCTC GG3 Shew-A: 5TTAGTTTAGTCCGACTTGGCCTTGGTTAGACCTCACCCTGAAGGAGGT GA3 Terminator-S: 5TCACCTCCTTCAGGGTGAGGTCTAACCAAGGCCAAGTCGGACTAAACT AA3 Terminator-A: 5CGGGATCCACCGCGTAATACGACTCACTATAGG3
[0059] 2. Fusing PCR to connect the ubiquitin promoter, Shew-AT and the ubiquitin terminator to construct a vector P-SHEW-AT-T. Splice the DNA fragment ubiquitin promoter, Shew-AT and ubiquitin terminator to obtain a three-gene splicing fragment through PCR fusion reaction, and connecting the obtained fragment with a pMD19-T(Simple) vector to obtain the recombinant plasmid P-SHEW-AT-T.
[0060] 3. Constructing a vector PBZ-Shew-AT
[0061] Performing double enzyme digestion on plasmids P-Shew-AT-T and PBS-Zeo-AT by use of XbaI and BamHI restriction incision enzymes respectively, and then connecting the gel-extracted Shew-AT gene expression cassette fragment to a place between the AT upstream homologous arm and bleomycin resistant gene fragment in PBS-Zeo-AT to construct the vector PBS-Shew-AT.
Example 5
[0062] Construction of SHEW-AT Substitute Schizochytrium sp. Strain
[0063] Performing double enzyme digestion on the plasmid PBZ-Shew-AT by use of two restriction incision enzymes NotI and KpnI, and then purifying target fragments containing Shew-AT and bleomycin by a Takara gel extraction kit; transforming the fragments into Schizochytrium sp. by electroproration (parameters: 0.5-0.8 KV, 150-200 , 45-55 F); coating the transformed bacterial solution on a plate containing 20 g/mL bleomycin, culturing it in dark at 30 C. for 2 days; and picking out positive single colony shake flask for culturing, extracting genome for PCR verification, and naming the correct defective bacterium Schizochytrium sp. HX-RS0.
[0064] Inoculating the obtained engineering strain into seed media for investigation of the seed's properties at a temperature of 30 C. and a rotation speed of 170 rpm. Observing cell morphology, measuring the cell dry weight, and comparing the fatty acid content with that of the original strain under the same conditions. The results are shown in
TABLE-US-00005 TABLE 2 Comparison of distribution difference between fatty acids in seeds of Schizochytrium sp. HX-RS0 and the original strain (Percentage of total fatty acid content) Fatty acid Composition of fatty acid/% (% TFA) Original strain Schizochytrium sp. HX-RS0 C14:0 2.25 0.26 6.61 0.41 C16:0 17.95 0.25 22.83 0.24 C18:0 0.33 0.02 0.48 0.01 C22:0 1.22 0.08 0.95 0.06 EPA 1.04 0.02 3.84 0.02 DPA 19.87 0.14 13.64 0.16 DHA 49.52 0.23 47.2 0.17
[0065] The results show that Schizochytrium sp. HX-RS0 restored its growth, and its biomass reached 31.3 g/L after 2 days of culturing, which was still lower than that of the original strain. The cell morphology was uniform and petal-like, which was obviously superior to that of the original strain, and the EPA content of Schizochytrium sp. HX-RS0 reached 3.84%, 72.9% higher than that of the original strain. The DHA content was recovered from 35.2% to 47.2%, but slightly lower than that of the original strain.
Example 6
[0066] Domestication of Shew-AT Substitute Schizochytrium sp. Strain
[0067] Domesticating the Shew-AT substitute Schizochytrium sp. HX-RS0 strain obtained in Example 5 at high rotation speed and low temperature, screening such strain on a resistant plate containing bleomycin, and transferring it to one generation every 24 hours, totally 30-50 generations. The concentration of zeocin in the plate is 15-45 g/mL, the rotation speed for screening is 180-250 rpm and the temperature is 18-25 C.
[0068] Taking the biomass, DHA and EPA contents of the strain as assessment indexes, and screening out 20 strains with high DHA and EPA contents. The biomass, DHA and EPA contents of four strains (named and numbered as Schizochytrium sp. HX-RS0-4, Schizochytrium sp. HX-RS0-6, Schizochytrium sp. HX-RS0-12 and Schizochytrium sp. HX-RS0-16 in sequence) were 10% higher than those of the original strain; fermenting 4 strains of domesticated strain for verification; culturing the 4 obtained strains in seed media for 3 generations, and then inoculating the seed solution into 100 mL fermentation culture medium with 10% (v/v) inoculation amount at a temperature of 30 C. and a rotation speed of 170 rpm; terminating the fermentation when 100 g/L glucose in the culture medium was exhausted; measuring the cell dry weight, oil content, and contents of DHA and EPA respectively; and comparing the fermentation parameters with those of the original strain and the undomesticated strains under the same conditions. The results are shown in Table 3.
TABLE-US-00006 TABLE 3 Comparison of fermentation results between domesticated strain, original strain and undomesticated strain Fermentation parameter Biomass Oil content DHA content EPA content Fermentation Strain (g/L) g/L (%) (%) time (h) Original strain 45.94 17.3 45.2 1.39 48 Schizochytrium sp. HX-RS0 46.76 17.5 46.4 3.81 48 Schizochytrium sp. HX-RS0-4 52.18 18.1 49.9 3.98 44 Schizochytrium sp. HX-RS0-6 56.62 19.8 51.2 4.31 42 Schizochytrium sp. HX-RS0-12 58.24 19.6 51.4 4.42 39 Schizochytrium sp. HX-RS0-16 55.12 18.8 50.9 4.38 40
[0069] As shown in Table 3, comprehensive comparison shows that Schizochytrium sp.HX-RS0-12 strain was the most obvious strain of the four domesticated engineering bacteria, with higher biomass, oil content, and DHA and EPA contents. The obtained strain was named as Schizochytrium sp. HX-RS, which is the strain screened by the invention.
Example 7
[0070] Supplementary Fermentation of Schizochytrium HX-RS 5 L Fermentation Tank
[0071] Inoculating the final Schizochytrium sp. HX-RS seed solution into a sterilized 5 L fermentation tank containing 3 L fermentation medium at an inoculation amount of 10% (v/v); and taking silicone SE-2 as a defoaming agent during the fermentation process, and fermenting and culturing it for 5 days at a temperature of 30 C., an aeration ratio of 1 vvm and a stirring speed of 170 rpm. At the end of fermentation, the biomass and the oil output of the original strain were 102.71 g/L and 52.46 g/L respectively. EPA and DHA accounted for 1.41% and 44.9% of the total fatty acid respectively. EPA and DHA yields reached 0.78 g/L and 24.8 g/L respectively. The biomass and the oil output of HX-RS strain reached 115.34 g/L and 69.6 g/L respectively. EPA and DHA accounted for 4.68% and 51.3% of the total fatty acid respectively. EPA and DHA outputs reached 3.32 g/L and 36.4 g/L respectively. It can be seen that, compared with the original strain, the oil content increased by 32.67%, the EPA and DHA contents increased by 69.9% and 14.3%, respectively, and the EPA and DHA outputs increased by 76.3% and 46.8%, respectively.