GENERATING HUMAN CELLS CAPABLE OF PRODUCING INSULIN IN RESPONSE TO GLUCOSE OR GLP-1
20200190468 ยท 2020-06-18
Assignee
Inventors
- Yasuhiro Ikeda (Rochester, MN, US)
- Yaxi Zhu (Rochester, MN, US)
- Aleksey Matveyenko (Rochester, MN, US)
- Andre Terzic (Rochester, MN)
- YOGISH C. KUDVA (Rochester, MN, US)
- Dennis A. Wigle (Rochester, MN, US)
Cpc classification
C12N5/0606
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2800/40
CHEMISTRY; METALLURGY
C12N2501/00
CHEMISTRY; METALLURGY
C12N2506/00
CHEMISTRY; METALLURGY
C12N2501/335
CHEMISTRY; METALLURGY
G01N33/50
PHYSICS
C12N5/0696
CHEMISTRY; METALLURGY
A61K35/545
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
Abstract
This document provides methods and materials related to generating human cells capable of producing insulin in response to glucose or GLP-1. For example, methods and materials for introducing nucleic acid vectors into human stem cells (e.g., human induced pluripotent stem cells) at particular stages of differentiation to create human cells having the ability to produce and secrete human insulin in response to glucose, GLP-1, or both glucose and GLP-1 as measured by a sensitive perifusion assay are provided.
Claims
1. A population of differentiated cells obtained from embryonic stem cells or induced pluripotent stem cells, wherein the cells of said population produce insulin in response to glucose and in response to GLP-1 as measured by a perifusion assay.
2. The population of differentiated cells of claim 1, wherein said cells are human cells.
3. The population of differentiated cells of claim 1, wherein said cells lack exogenous nucleic acid.
4. The population of differentiated cells of claim 1, wherein said cells produce insulin in less than five minutes (e.g., in less than four, three, two, or one minute) in response to at least 16 mM of glucose and in response to at least 100 nM of GLP-1 as measured by a perifusion assay.
5. A method for obtaining a population of differentiated cells obtained from embryonic stem cells or induced pluripotent stem cells, wherein said differentiated cells produce insulin in response to glucose or GLP-1, wherein said method comprises: (a) introducing a vector comprising nucleic acid encoding a PDX1 polypeptide into differentiating cells of an embryonic stem cell population or of an induced pluripotent stem cell population at or during the definitive endoderm stage to form a first cell population, (b) introducing a vector comprising nucleic acid encoding an NGN3 polypeptide into cells of said first cell population at or during the pancreatic endoderm stage to form a second cell population, and (c) introducing a vector comprising nucleic acid encoding a MAFA polypeptide into cells of said second cell population at or during the primitive beta cell stage to form said population of differentiated cells.
6. The method of claim 5, wherein said induced pluripotent stem cells are human induced pluripotent stem cells.
7. The method of claim 5, wherein said differentiated cells produce insulin in response to high glucose or GLP-1 as measured by a perifusion assay.
8. The method of claim 5, wherein said vector of said step (a), (b), or (c) is a lentiviral vector.
9. The method of claim 5, wherein said vector of said step (a), (b), and (c) is a lentiviral vector.
10. The method of claim 5, wherein the total number of days starting with said induced pluripotent stem cells to forming said population of differentiated cells is 20 or less days.
Description
DESCRIPTION OF THE DRAWINGS
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION
[0033] This document provides methods and materials related to generating human cells capable of producing insulin in response to glucose or GLP-1. For example, this document provides methods and materials for introducing nucleic acid vectors into human stem cells (e.g., human induced pluripotent stem cells or embryonic stem cells) at particular stages of differentiation to create human cells having the ability to produce and secrete human insulin in response to glucose, GLP-1, or both glucose and GLP-1 as measured by a sensitive perifusion assay. This document also provides cells (e.g., human cells) that underwent guided differentiation from induced pluripotent stem cells, compositions containing cells that underwent guided differentiation from induced pluripotent stem cells, and methods for using cells that underwent guided differentiation from induced pluripotent stem cells (e.g., methods for using such cells to treat diabetes).
[0034] As described herein, the methods and materials provided herein can be used to guide the differentiation of pluripotent stem cells (e.g., human induced pluripotent stem cells or embryonic stem cells) into more specialized cells that have the ability to produce insulin in response to glucose or GLP-1 as measured by a sensitive perifusion assay. Such a perifusion assay can be used to assess dynamic insulin secretion of pluripotent stem cell-derived insulin-producing cells in vitro and can be performed as described elsewhere (e.g., Song et al., J. Clin. Endocrinol. Metab., 87(1):213-21 (2002)). Briefly, basal glucose perfusate (4 mM glucose) can be delivered from 0-30 minutes followed by 30 minutes of high glucose perfusate (16 mM glucose), 30 minutes of high glucose and GLP-1 perfusate (16 mM glucose+GLP-1), and 10 minutes of a non-specific insulin secretagogue (KCl) to the perifusion chambers containing stem cell-derived cells, and the effluent can be collected in one minute intervals for subsequent determination of insulin concentrations. Human C-peptide (insulin byproduct) concentrations can be measured by ELISA. Minute-by-minute insulin/C-peptide concentration profiles can be analyzed to determine rates of basal and glucose-stimulated insulin secretion.
[0035] Any appropriate embryonic stem cell population or induced pluripotent stem cell population can be used to make cells having the ability to produce insulin in response to glucose or GLP-1. For example, induced pluripotent stem cell population produced as described elsewhere (Fusaki et al., Proc. Jpn. Acad., Ser. B, 85:348-362 (2009); Yu et al., Science, 324(5928):797-801 (2009); VandenDriessche et al., Blood, 114(8):1461-8 (2009); Subramanyam et al., Nature Biotechnology, 29(5):443-8 (2011); Anokye-Danso et al., Cell. Stem Cell, 8(4):376-88 (2011)) can be used as described herein.
[0036] Once embryonic stem cells or induced pluripotent stem cells are obtained, the cells can be processed through a differentiation procedure that involves multiple steps (e.g., six steps). In some cases, throughout the process, the same basal medium (MCDB 131 medium supplemented with Glutamate, antibiotics (e.g., penicillin and streptomycin), 10 mM glucose, and 1.5 g/L sodium bicarbonate) can be used. During step 1, the cells can be cultured to generate endoderm cells. This step 1 can last about three days. In general, the cells are cultured in basal medium that can be further supplemented with serum (e.g., such as from about 0.2 percent to about 2 percent of FCS), activin A (e.g., from about 20 to about 500 ng/mL), and a GSK3b inhibitor (e.g., from about 0.5 to about 20 M of CHIR-99021; SelleckChem, S2924). Other ingredients that optionally can be used include, without limitation, bovine serum albumin (BSA), GDF8, sodium bicarbonate, and glucose. At some point during step 1 (e.g., during day 2 or day 3), a vector (e.g., a lentiviral vector) designed to express a PDX1 polypeptide (e.g., a human PDX1 polypeptide) can be introduced into the cells. For example, the cells can be infected with a lentiviral vector designed to express a human PDX1 polypeptide. A PDX1 polypeptide can have the amino acid sequence set forth in GenBank Accession Number NP_000200.1 (e.g., GI No. 136125) or as set forth in
[0037] During step 2, the cells can be cultured to generate primitive gut tube-like cells. This step 2 can last about two days. In general, the cells are cultured in basal medium that can be supplemented with serum (e.g., from about 0.2 percent to about 2 percent FCS), ascorbic acid (e.g., from about 0.1 to about 1.0 mM), and FGF7 (e.g., from about 10 to about 200 ng/mL). Other ingredients that optionally can be used include, without limitation, BSA, sodium bicarbonate, and glucose. In some cases, primitive gut tube-like cells can be identified using the following nuclear expression profile: HNF1 and HNF4.
[0038] During step 3, the cells can be cultured to generate posterior foregut-like cells. This step 3 can last about two days. In general, the cells are cultured in basal medium that can be supplemented with a sodium bicarbonate solution (e.g., from about 0.5 to about 5 g/L), FCS (e.g., from about 0.5 to about 5 percent), ascorbic acid (e.g., from about 0.05 to about 1.0 mM), FGF7 (e.g., from about 10 to about 50 ng/mL), SANT-1 (e.g., from about 0.05 to about 1.0 M), retinoic acid (e.g., from about 0.2 to about 5.0 M), an ALK2/3 inhibitor (e.g., from about 10 to about 500 nM of an ALK2/3 inhibitor such as LDN193189), Insulin-Transferrin-Selenium-Ethanolamine (ITS-X; Life Technologies, Cat #51500056; e.g., from about 0.2 to about 2 percent), and a PKC activator (e.g., from about 40 to about 1000 nM of a PKC activator such as TPB). Other ingredients that optionally can be used include, without limitation, BSA, glucose, and Indolactam V. In some cases, posterior foregut-like cells can be identified using the following nuclear expression profile: PDX1.
[0039] During step 4, the cells can be cultured to generate pancreatic endoderm cells. This step 4 can last about three days. In general, the cells are cultured in basal medium that can be supplemented with sodium bicarbonate solution (e.g., from about 0.5 to about 5.0 g/L), FCS (e.g., from about 0.5 to about 5.0 percent), ascorbic acid (e.g., from about 0.05 to about 1.0 mM), FGF7 (e.g., from about 0.4 to about 10 ng/mL), SANT-1 (e.g., from about 0.05 to about 1.0 M), retinoic acid (e.g., from about 0.01 to about 0.5 M), an ALK2/3 inhibitor (e.g., from about 40 to about 1000 nM of an ALK2/3 inhibitor such as LDN193189), ITS-X (e.g., from about 0.2 to about 2 percent), and a PKC activator (e.g., from about 40 to about 1000 nM of a PKC activator such as TPB). Other ingredients that optionally can be used include, without limitation, BSA, glucose, and Indolactam V. At some point during the last half of step 3 and the first half of step 4, a vector (e.g., a lentiviral vector) designed to express a NGN3 polypeptide (e.g., a human NGN3 polypeptide) can be introduced into the cells. For example, the cells can be infected with a lentiviral vector designed to express a human NGN3 polypeptide. A NGN3 polypeptide can have the amino acid sequence set forth in GenBank Accession Number NP_066279.2 (e.g., GI No. 1292057) or as set forth in
[0040] During step 5, the cells can be cultured to generate pancreatic endocrine progenitor cells. This step 5 can last about three days. In general, the cells are cultured in basal medium that can be supplemented with sodium bicarbonate solution (e.g., from about 0.5 to about 5.0 g/L), glucose (e.g., from about 1 to about 10 L/mL of 45% glucose solution), FCS (e.g., from about 0.5 to about 5.0%), SANT-1 (e.g., from about 0.05 to about 1.0 M), retinoic acid (e.g., from about 0.01 to about 0.5 M), an ALK5 inhibitor II (e.g., Enzo Life Sciences, Cat # ALX-270-445, from about 1 to about 50 M), an ALK2/3 inhibitor (e.g., from about 10 to about 500 nM of an ALK2/3 inhibitor such as LDN193189), a thyroid hormone T3 (e.g., from about 0.2 to about 5 M of a thyroid hormone such as T3 3,3,5-Triiodo-L-thyronine sodium salt, Sigma, T6397), zinc sulfate (e.g., from about 2 to about 50 M), heparin (e.g., from about 2 to about 50 g/mL), and ITS-X (e.g., from about 0.2 to about 2.0 percent). Other ingredients that optionally can be used include, without limitation, BSA, betacellulin, GLP-1, exendin-4, Trolox, N-acetyl cysteine, AXL inhibitor, EGF, HGF, and CNTF. Pancreatic endocrine progenitor cells can be identified using the following nuclear expression profile: PDX1 and NEUROD1.
[0041] During step 6, the cells can be cultured to generate glucose-responsive/insulin-positive cells (i.e., mature beta cells) as well as glucagon (GCG)-secreting alpha cells, another component of human pancreatic islets controlling glucose homeostasis. This step 6 can last about three to ten days. In general, the cells are cultured in basal medium that can be supplemented with sodium bicarbonate solution (e.g., from about 0.5 to about 5.0 g/L), glucose (e.g., from about 1 to about 10 L/mL of 45% glucose solution), FCS (e.g., from about 0.5 to about 5 percent), thyroid hormone T3 (e.g., from about 0.2 to about 5 M), an ALK5 inhibitor II (e.g., from about 1 to about 50 M), zinc sulfate (e.g., from about 2 to about 50 M), an ALK2/3 inhibitor (e.g., from about 10 to about 500 nM of an ALK2/3 inhibitor such as LDN193189), ITS-X (e.g., from about 0.2 to about 2.0 percent), heparin (e.g., from about 2.0 to about 50 g/mL), and gamma secretase inhibitor XX (e.g., from about 20 to about 500 nM). Other ingredients that optionally can be used include, without limitation, BSA, betacellulin, GLP-1, exendin-4, Trolox, N-acetyl cysteine, AXL inhibitor, EGF, HGF, and CNTF. At some point between the end of step 5 and during step 6, a vector (e.g., a lentiviral vector) designed to express a MAFA polypeptide (e.g., a human MAFA polypeptide) can be introduced into the cells. For example, the cells can be infected with a lentiviral vector designed to express a human MAFA polypeptide. A MAFA polypeptide can have the amino acid sequence set forth in GenBank Accession Number NP_963883.2 (e.g., GI No. 912661) or as set forth in
[0042] In some cases, a non-integrating viral vector can be used to introduce a nucleic acid designed to express a PDX1 polypeptide, an NGN3 polypeptide, or a MAFA polypeptide into cells as described herein. Examples of non-integrating viral vectors that can be used as described herein include, without limitation, Sendai viral vectors, measles viral vectors, parainfluenza viral vectors, adenoviral vectors, adeno-associated virus vectors, and non-integrating lentiviral vectors with mutated integrase.
[0043] Any appropriate method can be used to introduce nucleic acid (e.g., a nucleic acid vector) designed to express a PDX1 polypeptide, an NGN3 polypeptide, or a MAFA polypeptide into a cell. For example, a nucleic acid vector encoding a PDX1 polypeptide, an NGN3 polypeptide, or a MAFA polypeptide can be transferred to the cells using recombinant viruses that can infect cells, or liposomes or other non-viral methods such as electroporation, microinjection, transposons, phage integrases, or calcium phosphate precipitation, that are capable of delivering nucleic acids to cells. The exogenous nucleic acid that is delivered typically is part of a vector in which a regulatory element such as a promoter is operably linked to the nucleic acid of interest. The promoter can be constitutive or inducible. Non-limiting examples of constitutive promoters include cytomegalovirus (CMV) promoter and the Rous sarcoma virus promoter. As used herein, inducible refers to both up-regulation and down regulation. An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, phenolic compound, or a physiological stress imposed directly by, for example heat, or indirectly through the action of a pathogen or disease agent such as a virus.
[0044] Additional regulatory elements that may be useful in vectors, include, but are not limited to, polyadenylation sequences, translation control sequences (e.g., an internal ribosome entry segment, IRES), enhancers, or introns. Such elements may not be necessary, although they can increase expression by affecting transcription, stability of the mRNA, translational efficiency, or the like. Such elements can be included in a nucleic acid construct as desired to obtain optimal expression of the nucleic acids in the cells. Sufficient expression, however, can sometimes be obtained without such additional elements.
[0045] Vectors also can include other elements. For example, a vector can include a nucleic acid that encodes a signal peptide such that the encoded polypeptide is directed to a particular cellular location (e.g., the cell surface) or a nucleic acid that encodes a selectable marker. Non-limiting examples of selectable markers include puromycin, adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418, APH), dihydrofolate reductase (DHFR), hygromycin-B-phosphtransferase, thymidine kinase (TK), sodium iodine symporter (NIS), and xanthin-guanine phosphoribosyltransferase (XGPRT). Such markers are useful for selecting stable transformants in culture.
[0046] Any appropriate non-viral vectors can be used to introduce nucleic acid encoding a PDX1 polypeptide, an NGN3 polypeptide, or a MAFA polypeptide into cells. Examples of non-viral vectors include, without limitation, vectors based on plasmid DNA or RNA, retroelement, transposon, and episomal vectors. Non-viral vectors can be delivered to cells via liposomes, which are artificial membrane vesicles. The composition of the liposome is usually a combination of phospholipids, particularly high-phase-transition-temperature phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Transduction efficiency of liposomes can be increased by using dioleoylphosphatidylethanolamine during transduction. See, Felgner et al., J. Biol. Chem., 269:2550-2561 (1994). High efficiency liposomes are commercially available. See, for example, SuperFect from Qiagen (Valencia, Calif.).
[0047] In some cases, the culturing steps described herein can be performed using culture conditions that do not involve the use of serum or feeder cells. For example, steps 1-6 can involve culturing the cells in medium lacking serum (e.g., human or non-human serum) and lacking feeder cells (e.g., human or non-human feeder cells). In such cases, BSA and ITS-X can be used.
[0048] In some cases, when non-integrated vectors or nucleic acid transfection methods are used to introduce PDX1, NGN3 and/or MAFA, after the cells capable of producing insulin in response to glucose or GLP-1 are formed, the cells can be maintained in culture such that they become devoid of any introduced exogenous nucleic acid.
[0049] In some cases, the cells capable of producing insulin in response to glucose or GLP-1 as described herein can be administered to a human diagnosed with diabetes (e.g., type 1 diabetes) to treat or reduce the symptoms of diabetes. For example, about 110.sup.9 to about 110.sup.10 cells capable of producing insulin in response to glucose or GLP-1 as described herein can be administered into a portal vein, liver, or subcutaneous space of a human with diabetes via infusion or after encapsulation into a transplantable immune-protecting device. Once these cells are administered to the human, the severity of the diabetes symptoms can become less severe. In some cases, the stem cell-derived glucagon-producing cells can prevent hypoglycemia induced by exogenous insulin therapy in patients with diabetes.
[0050] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1Generating Differentiated Cells from iPSCs
[0051] The following was performed to produce human cells having the ability to produce and secrete human insulin in response to glucose or GLP-1. iPSCs were obtained as described elsewhere (Hu et al., Blood, 117(14):e109-19 (2011)). Basal medium was created by supplementing MCDB131 medium (500 mL) with 1 Glutamax, 1 Antibiotics (P&S), 900 L of D-glucose solution (45%, Sigma G8769), and 10 mL of sodium bicarbonate solution (7.5%, Sigma S8761).
[0052] Step 1 involved generating definitive endoderm cells, which lasted 3 days. Before starting differentiation, the iPSCs were plated on Matrigel-coated 12- or 6-well plates and maintained for few days until reaching 50-80% confluence. Some spaces were observed between iPSC colonies. On day 1, the cells were first rinsed with DPBS without Mg2+ and Ca2+ and then cultured in the basal medium, supplemented with 0.5% FCS, 100 ng/mL Activin A, and 3 M of CHIR-99021 (GSK3b inhibitor, SelleckChem, S2924) (2 mL each for a well of a 6-well-plate, 1 mL for a 12-well-plate). The cells were incubated for one day. On days 2-3, the culture supernatants were removed, and the cells were incubated with the basal medium with 0.5% FCS and 100 ng/mL Activin A (both day 2 and day 3). Also, on day 2, the cells were infected with a lentiviral vector designed to express a human PDX1 polypeptide.
[0053] Step 2 involved generating primitive gut tube-like cells, which lasted 2 days. Briefly, on day 4 of differentiation, the cells were rinsed with DPBS without Mg2+ and Ca2+ once, and the culture supernatants were replaced with basal medium with 0.5% FCS, 0.25 mM ascorbic acid (AA; Sigma, Cat # A4544), and 50 ng/mL of FGF7 (R&D Systems). On day 5, the cells were fed fresh medium with the same ingredients.
[0054] Step 3 involved generating posterior foregut-like cells, which lasted 2 days. On day 6, the culture supernatants were replaced with basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 2% FCS, 0.25 mM ascorbic acid (AA), 50 ng/mL of FGF7, 0.25 M SANT-1 (Shh inhibitor, Sigma, Cat # S4572), 1 M retinoic acid (RA; Sigma, Cat # R2625), 100 nM LDN193189 (LDN; ALK2/3 inhibitor, Stemgent, Cat #04-0019), 1:200 ITS-X (Life technologies, Cat #51500056), and 100 nM TPB (PKC activator, also called alpha amyloid protein modulator). On day 7, the cells were fed fresh medium with the same ingredients.
[0055] Step 4 involved generating pancreatic endoderm cells, which lasted 3 days. On day 8, the culture supernatants were replaced with basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 2% FCS, 0.25 mM AA, 2 ng/mL of FGF7, 0.25 M SANT-1, 0.1 M RA, 200 nM LDN, 1:200 ITS-X, and 100 nM TPB. In addition, the cells were infected with a lentiviral vector designed to express a human NGN3 polypeptide either on day 7 (end of Step 3) or on day 8 (beginning of Step 4). On days 9 and 10, the cells were fed fresh medium with the same ingredients.
[0056] Step 5 involved generating pancreatic endocrine progenitor cells, which lasted 3 days. On day 11, the cells were cultured in basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 4 L/mL of 45% glucose solution, 2% FCS, 0.25 M SANT-1, 10 M ALK5 inhibitor II (Enzo Life Sciences, Cat # ALX-270-445), 0.05 M RA, 1 M thyroid hormone T3 (3,3,5-Triiodo-L-thyronine sodium salt, Sigma, T6397), 100 nM LDN, 1:200 ITS-X, 10 M zinc sulfate (Sigma, Z0251), and 10 g/mL of heparin (Sigma, H3149). On days 12 and 13, the cells were fed fresh medium with the same ingredients.
[0057] Step 6 involved generating NKX6.1.sup.+/insulin.sup.+ cells, which lasted 7 days. On day 14, the cells were cultured in basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 4 L/mL of 45% glucose solution, 2% FCS, 1 M T3, 10 M ALK5 inhibitor II, 10 M zinc sulfate, 100 nM LDN, 1:200 ITS-X, 10 g/mL of heparin, and 100 nM gamma secretase inhibitor XX (EMD MilliPore, Cat #565789). The cells were infected with a lentiviral vector designed to express a human MAFA polypeptide on day 16. In addition, the cells were fed fresh medium with the same ingredients each of the seven days of Step 6.
[0058] The cells produced using these six steps were evaluated for insulin expression (via C-peptide release) in response to glucose (4 mM or 16 mM), GLP-1 (100 nM), or KCL (30 mM potassium chloride, a powerful membrane-depolarizing agent to induce insulin release). In addition, cells produced using the identical protocol with the sole exception of only one infection during step 1 with a lentiviral vector designed to express one of the following seven polypeptides were assessed for comparison: PDX1, NKX6.1, NKX2.2, NGN3, MAFA, MAFB, or NEUROD1.
[0059] The combined introduction of a vector designed to express a PDX1 polypeptide during the definitive endoderm stage (Step 1), of a vector designed to express a NGN3 polypeptide during the pancreatic endoderm stage (Step 4), and of a vector designed to express a MAFA polypeptide during the primitive beta cell stage (Step 6) resulted in cells capable of producing insulin in response to glucose or GLP-1 (
[0060] The iPSC differentiation process was repeated with lentiviral introductions of PDX1, NGN3, and MAFA at Steps 1, 4, and 6, respectively. As a control, iPSCs were differentiated without lentiviral vector infection. Upon perifusion assays, the temporal C-peptide secretion patterns were determined using averages of six independent samples (
[0061] These results demonstrate that human cells having the ability to produce insulin in response to glucose, GLP-1, or both can be produced from stem cells (iPSCs) by introducing a nucleic acid vector designed to express a PDX1 polypeptide into the cells at or during the definitive endoderm stage, by introducing a nucleic acid vector designed to express a NGN3 polypeptide into the cells at or during the pancreatic endoderm stage, and by introducing a nucleic acid vector designed to express a MAFA polypeptide into the cells at or during the primitive beta cell stage. Such insulin production can be insulin production as measured by a sensitive perifusion assay.
Example 2Targeted Derivation of Organotypic Glucose- and GLP-1-Responsive Beta Cells Prior to Transplantation into Diabetic Recipients
[0062] Some of the results provided in this Example 2 were presented in Example 1 and are being represented in this Example 2.
Cells
[0063] 293T cells were cultured in DMEM medium supplemented with 10% fetal calf serum and antibiotics. Undifferentiated iPSC line IISH2i-BM9 (WiCell, Madison, Wis.) at passage 10-30 was cultured on Matrigel (Corning, Corning, N.Y., #354277) -coated plates in mTeSR1 medium (StemCell Technologies, Vancouver, Canada, #05850). Cultures were fed every day with mTeSR1 medium.
Lentiviral Vectors
[0064] Lentiviral vector genome plasmid, pSIN-CSGW-PKG-puro, which supports EGFP expression and puromycin selection, was obtained from Dr. Paul Lehner (Cambridge Institute for Medical Research). Codon-optimized ORF sequences for beta-cell factors, including PDX1, NEUROG3, NKX2.2, NKX6.1, NEUROD1, MAFA, MAFB and ESRRG, were designed and synthesized (GenScript, Piscataway, N.J.), and cloned into the place of the EGFP gene in pSIN-CSGW-PKG-puro with the unique BamHI and XhoI sites. Resulting vector plasmids were designated as pLenti-PDX1, pLenti-NEUROG3, pLenti-NKX2.2, pLenti-NKX6.1, pLenti-NEUROD1, pLenti-MAFA, pLenti-MAFB and pLenti-ESRRG, respectively. The internal spleen focus-forming virus (SFFV) promoter drives the expression of beta-cell factors. Lentiviral vectors were produced by plasmid transfection in 293T cells as described elsewhere (Tonne et al., Clin. Chem., 57:864-873 (2011)), concentrated by ultracentrifugation and re-suspended in phosphate buffered saline (PBS). Lentiviral titers were determined by puromycin selection.
Guided Differentiation and Stepwise Lentiviral Vector Transduction
[0065] Guided differentiation was initiated 48 hours following seeding, with a 60-80% starting confluency with some spaces between iPSCs colonies. The basal medium was prepared by supplementing MCDB131 medium (Thermo Fisher Scientific, Waltham, Mass., #10372019) with 1 Glutamax (Thermo Fisher Scientific, #35050061), 50 U/mL Penicillin, 50 g/mL Streptomycin, 0.02% D-Glucose solution (45%, Sigma-Aldrich, St. Louis, Mo., # G8769) and 2% Sodium Bicarbonate Solution (7.5%, Sigma-Aldrich, # S8761). Step 1 (S1, 3 days); Day 1 iPSCs were first rinsed with PBS without Mg.sup.2+ and Ca.sup.2+ and then cultured in the basal medium further supplemented with 0.5% FBS (Thermo, # A3160602), 100 ng/mL Activin A (R&D Systems, Minneapolis, Minn., #338-AC-050) and 3 M of CHIR-99021 (SelleckChem, Houston, Tex., # S2924). Cells were cultured in 2 mL media each for a well of a 6-well-plate, 1 mL for a 12-well-plate. At day 2, culture supernatants were removed, and cells were incubated with the basal medium with 0.5% FBS and 100 ng/mL Activin A. Cells were further infected with the Lenti-PDX1 vector once at an approximate MOI of 30 on day 2. For the screening of single lentiviral vectors for individual factors, each lentiviral vector was delivered at this time point. At day 3, culture supernatants were replaced by the basal medium with 0.5% FBS and 100 ng/mL Activin A. Step 2 (S2, 2 days); Cells were rinsed with PBS, then cultured with the basal medium 0.5% FBS, 0.25 mM ascorbic acid (Sigma- Aldrich, # A4544) and 50 ng/mL of FGF7 (R&D Systems, #251-KG-050). Culture supernatants were replaced with the same, fresh medium at day 2. Step 3 (S3, 2 days); the culture supernatants were replaced to the basal medium, further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 2% FBS, 0.25 mM ascorbic acid, 50 ng/mL FGF7, 0.25 M SANT-1 (Sigma-Aldrich, # S4572), 1 M retinoic acid (Sigma-Aldrich, # R2625), 100 nM LDN193189 (Stemgent, Lexington, Mass., #04-0019), 1:200 ITS-X (Thermo Fisher Scientific, #51500056), and 100 nM alpha amyloid protein modulator (also called TPB, EMD Millipore, Billerica, Mass., #565740). Medium was changed every day. Step 4 (S4, 3 days); the culture supernatants of S3 cells were replaced with the basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 2% FBS, 0.25 mM ascorbic acid, 2 ng/mL of FGF7, 0.25 M SANT-1, 0.1 M retinoic acid, 200 nM LDN193189, 1:200 ITS-X, and 100 nM TPB. Cells also were infected with the Lenti-NEUROG3 vector at an approximate MOI of 30 once on day 7 (end of Step 3) or day 8 (beginning of Step 4). Medium changed every day with the fresh media. Step 5 (S5, 3 days); cells were cultured in the basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 4 L/mL of 45% glucose solution, 2% FBS, 0.25 M SANT-1, 10 M ALK5 inhibitor II (Enzo Life Sciences, Farmingdale, N.Y., # ALX-270-445), 0.05 M retinoic acid, 1 M thyroid hormone (Sigma-Aldrich, # T6397), 100 nM LDN193189, 1:200 ITS-X, 10 M zinc sulfate (Sigma-Aldrich, # Z0251) and 10 g/mL heparin (Sigma-Aldrich, # H3149). Medium was replaced every day. Step 6 (S6, 7 days); culture media were replaced with the basal medium further supplemented with 14 L/mL of 7.5% sodium bicarbonate solution, 4 L/mL of 45% glucose solution, 2% FBS, 1 M thyroid hormone, 10 M ALK5 inhibitor II, 10 M zinc sulfate, 100 nM LDN193189, 1:200 ITS-X, 10 g/mL heparin, and 100 nM gamma secretase inhibitor XX (EMD Millipore, Billerica, Mass., #565789) for 7 days. Cells also were infected with the Lenti-MAFA vector at an approximate MOI of 30 once, on day 14, 15, or 16. Fresh medium was fed every day.
qRT-PCR
[0066] For quantitative reverse transcription polymerase chain reaction (qRT-PCR), total RNA from differentiated iPSCs at indicated time points was isolated using Trizol according to the manufacturer instructions. cDNAs were then synthesized by reverse transcription from 200 ng of total RNA using SuperScript III Reverse Transcriptase, dNTP solutions, RNaseOUT and Random Hexamer. Hotstart Taq DNA polymerase and primer pairs for human INS, GCK, GLP1R, ESRRG, SLC6A5, SLC30A8, ABCC8, KCNJ11, CACNA1D, CACNA2D3, PCSK1 and PCSK2 were used. Sequence of the primers used for qRT-PCR was listed in Table 1. The PCR conditions were 95 C. for 10 minutes enzyme activation, 95 C. for 15 seconds denaturation, 60 C. for 60 seconds annealing and extension, and overall 40 cycles were performed.
TABLE-US-00001 TABLE1 SEQ SEQ Gene ID ID Name FWD(5to3) NO: REV(5to3) NO: ABCC8 CGTCTTAGCTGTGCTTCTGT 15 CTTGGTCTGTATTGCTCCTCTC 16 CACNA1D GGGAGCAGGAGTATTTCAGTAG 17 GATGTTTCTGCCTGGGTATCT 18 CACNA2D3 GATGGCCTCCAACTGGTAAA 19 CATGTTTCAGGTGTGCTTCTTC 20 ERRG TCTCTACCCTTCTGCTCCTATC 21 GCATCGAGTTGAGCATGTATTC 22 GAPDH GCGCCCAATACGACCAA 23 CTCTCTGCTCCTCCTGTTC 24 GCK GATGCACTCAGAGATGTAGTCG 25 TGAAGGTGGGAGAAGGTGAG 26 GLP1R CTCCTTCTCTGCTCTGGTTATC 27 CAGGTTCAGGTGGATGTAGTT 28 INS CTTCACGAGCCCAGCCA 29 ATCAGAAGAGGCCATCAAGC 30 KCNJ11 ATGAGGACCACAGCCTACT 31 GGAATCTGGAGAGATGCTGAAC 32 PCSK1 CAGACAGCATCTACACCATCTC 33 GTGTAATCTCCGCTGCTGTAA 34 PCSK2 GACCTGGCCTCCAACTATAATG 35 TGTGTACCGAGGGTAAGGATAG 36 SLC30A8 GCATGCCCTTGGAGATCTATT 37 GCAGATTGGGTCGGCTATTT 38 SLC6A5 GAAAGTCTGCTGGGCATTTG 39 CACCATGGACCAGTTAGGATAG 40
RNA Sequencing
[0067] For RNA sequencing, a total 200 ng RNA from differentiated iPSCs at indicated time points was isolated using RNeasy Mini Kit. Library preparation (TruSeq mRNA v2 (TMRNA)) and next-generation sequencing and analysis (standard secondary analysis pipeline, MAPRSeq) were performed. Heatmaps were depicted using Graphpad Prism.
Immunofluorescence Staining
[0068] Lentiviral vector-infected 293T cells were fixed with 4% paraformaldehyde (PFA) for 20 minures. After fixation, cells were washed once with PBS and were then permeabilized with 0.3% Triton X-100 in PBS for 10 minutes. Cells were then washed with PBS twice and were blocked with 5% FBS in PBS for 1 hour. Cells were incubated overnight with rabbit anti-human PDX1 (1:200, Abcam, Cambridge, Mass., # AB47267), rabbit anti-human NEUROG3 (1:50, DSHB, Iowa City, Iowa, # F25A1B3), rabbit anti-human MAFA (1:200, Abcam, # AB47267), goat anti-human NKX6.1 (1:100, R&D Systems, # AF5857), rabbit anti-human Neurod1(1:200, Sigma, # N3663), mouse anti-human NKX2.2 (1:50, DSHB, #74.5A5), anti-human ESRRG (1:100, Abcam, # AB131593), or mouse anti-human MAFB (1:25, R&D Systems, # MAB3810) overnight at 4 C., followed by incubation with secondary antibodies for 1 hour at room temperature.
[0069] For the characterization of psBCs, undifferentiated iPSCs were seeded on chamber slides and subjected to the differentiation protocol described above. Differentiated cells were fixed at the indicated time points and were permeabilized and blocked as described above. Cells were incubated overnight with guinea pig anti-human insulin (1:400, Dako, Santa Clara, Calif., # A056401), goat anti-human NKX6.1 (1:100), rabbit anti-human Neurod1(1:200), mouse anti-human NKX2.2 (1:50), mouse anti-human glucagon (1:300, Abcam, # ab10988-100), rabbit anti-human somatostatin (1:100, Santa Cruz, Dallas, Tex., # sc-20999), or mouse anti-human C-peptide (1:400, Thermo Fisher Scientific, # MA1-19159) overnight at 4 , followed by incubation with secondary antibodies for 1 hour at room temperature.
[0070] Mouse kidneys with the grafts were harvested and frozen in OCT Compound. 7 m pancreatic cryosections were immediately fixed, permeabilized and then blocked as described above. Slides were then incubated with guinea pig anti-human insulin (1:400), goat anti-human NKX6.1 (1:100), rabbit anti-human Neurod1 (1:200), mouse anti-human NKX2.2 (1:50), mouse anti-human glucagon (1:300), or rabbit anti-human somatostatin (1:100) overnight at 4, followed by secondary antibody incubation for 1 hour at room temperature. Images were taken using a Zeiss LSM 780 confocal laser scanning microscope and analyzed with Zeiss imaging software. Fluorescence intensity were analyzed by Image J software.
Flow Cytometry
[0071] iPSC-derived psBCs were dispersed into single-cell suspension by incubation in Trypsin at 37 C. for 10 minutes and quenched with 3-4 volumes of FCS-containing culture media, and cells were spun down for 5 minutes at 800 g. Cells were transferred to a 1.7 mL microcentrifuge tube, fixed in 4% PFA, permeabilized with 0.3% Triton-X and then blocked with 5% FBS for 1 hour. Cells were incubated overnight with guinea pig anti-human insulin (1:400), mouse anti-human glucagon (1:300), and mouse anti-human C-peptide (1:400) at 4 C. After washing three times with 5% FBS, cells were stained with secondary antibodies. Cell then were washed and filtered through a 35-m mesh Falcon tube, and analyzed using the LSR-II flow cytometer (BD Biosciences). Analysis of the results was performed using FlowJo software.
Electron Microscopy
[0072] iPSC-derived psBCs were fixed at room temperature. Cell samples were processed and analyzed by transmission Electron Microscopy.
In vitro GSIS assay
[0073] An islet perifusion system (Biorep technologies, Miami Lakes, Fla.) was used. Approximately 110.sup.6 psBCs, differentiated in wells of 48-well plates, were first incubated in 4 mM glucose Krebs Ringer Bicarbonate buffer supplemented with 0.2% BSA for 30 minutes at 37 C. Cells were then gently scraped off from the well, transferred into a sterile 1.5 mL eppendorf tube, and centrifuged at room temperature for 5 minutes. Cell pellets were transferred into the perifusion chamber and were washed for 40 minutes in the perfusion system with 4 mM glucose buffer, which were preheated to 37 C. and oxygenized with 95% O.sub.2 and 5% CO.sub.2. After washing, cells were exposed to 4 mM glucose perifusate for 32 minutes, followed by 32 minutes of 16 mM glucose buffer, 32 minutes of 16 mM glucose buffer supplemented with 100 nM GLP-1 (Peprotech, Rocky Hill, N.J., #130-08-1MG), 32 minutes of 4 mM glucose buffer and finally 8 minutes of 16 mM glucose buffer supplemented with 30 mM KCL. Effluent was collected in 2-minute intervals and assayed for human C-peptide by ELISA (Alpco, Salem, N.H., #80-CPTHU-CH01) for subsequent determination of basal and GSIS. Stepwise PNM transduction study was performed in triplicate.
Mice Transplantation Studies
[0074] Immunodeficient Fox Chase SCID-Beige mice, aged 8-10 weeks, were purchased from Charles River Laboratory. To induce diabetes, mice received 50 mg/kg body weight streptozotocin (STZ, Sigma, # S0130) intraperitoneally over the course of five consecutive days. Mice with nonfasting blood glucose levels over 250 mg/dL after STZ administration were used and randomized into four groups in the following experiment. PsBCs clusters (approximately 50 million cells per mouse), and human beta-cell line (EndoC-H2 cells, approximately 5 million cells per mouse) were gently scraped off or trypsinized and transferred into a 15 mL conical vial. After spinning for 5 minutes at 800 g, cells were loaded into a catheter for cell delivery into the kidney capsules (E l Khatib et al., Gene Ther., 22:430-438 (2015)). 1 day, 4 day, and 1, 2, 3, 5, 7, 9, 11, and 13 weeks after the surgery, fasting (16 hours) blood glucose was tested using glucose monitor and strip. To measure glucose-responsive C-peptide secreion, fasting blood and 30 minutes blood after an intraperitoneal injection of D-(+)-glucose at 2 g/kg body weight was collected through retro orbital bleeding every two weeks. Serum was separated out using Microvettes (Sarstedt, Nmbrecht, Germany, #20.1278.100) and stored at 80 C. until ELISA analysis. At indicated time points, kidneys containing the grafts were dissected from the mice, embedded and frozen in OCT compound. Immunostaining was performed as described above. No statistical method was used for sample size estimation. Investigators were not blinded to the group allocations. Mice transplantation study was performed in duplicate.
Intraperitoneal Glucose Tolerance Test (IPGTT)
[0075] To measure glucose handling capacity in vivo, mice were fasted (16 hours), and blood glucose was tested at 0 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes after IP injection of D-(+)-glucose at 2 g/kg body weight.
Sample Size and Statistical Analysis
[0076] All data represent the meansS.E.M. of three to nine samples, as indicated in the Figure legends for the Figures of Example 2. Group comparisons were analyzed by unpaired or paired t tests, one sample t test, and one-way ANOVA with Tukey test through IBM SPSS Statistics 22. Bar graphs, heatmaps, curves, box and whisker plots were generated with GraphPad Prism? and Excel 2010.
Results
Screening of Beta-Cell Transcription Factor(s) for Improved Glucose- and GLP-1-Responsive Insulin Secretion in psBCs
[0077] Lentiviral vectors carrying codon-optimized ORFs of transcription factors critical for beta-cell development and function, including PDX1, NKX6.1, NKX2.2, MAFA, MAFB, NEUROD1, NEUROG3 and ESRRG (
[0078] To determine whether the introduction of a single, key beta-cell transcription factor could improve the glucose-responsiveness of psBCs, Si iPSC progeny were first transduced with a single lentiviral vector carrying a beta-cell factor. Since over-expression of PDX1, NEUROG3 and MAFA has been shown to transdifferentiate liver and pancreatic exocrine cells into insulin-producing cells (Zhu et al., Stem Cell Res. Ther., 8:64 (2017)), iPSC progeny also were transduced with a combination of lentiviral vectors expressing the PDX1, NEUROG3 and MAFA triad, at Stages 1, 4 and 6, respectively. Perifusion experiments of S6 psBCs demonstrated very low level, no glucose-responsive C-peptide secretion by unmodified (NULL) or EGFP vector-infected control cells (
[0079] Stepwise PDX1, NEUROG3, and MAFA transduction facilitated generation of glucose- and GLP-1-responsive psBCs. To assess the reproducibility of generation of glucose- and GLP-1-responsive psBCs by PNM transduction, the dynamics of C-peptide secretion from S6 psBCs with or without PNM transduction were analyzed. Rapid responses were observed in C-peptide secretion from PNM transduced S6 psBCs upon sequential increases of glucose levels from 4 to 16 mM, addition of GLP-1 to 16 mM glucose, and in 30 mM KCl depolarization (
[0080] To further assess the contributions of PDX1 (Stage 1), NGN3 (Stage 4), and MAFA (Stage 6), the impact of transduction of different combinations of P/N/M was determined. All psBC that include NGN3 (NGN3 alone, PDX1+NGN3, NGN3+MAFA, and PDX1+NGN3+MAFA) exhibited increased levels of INS and NKX6.1 transcripts (
Mature Beta-Cell Characteristics Found in PNM Transduced psBCs
[0081] The expression of beta-cell markers in PNM-transduced (S6-PNM) and control (S6-NULL) psBCs were characterized. Immunohistochemistry revealed that C-peptide signals were frequently co-localized with insulin (INS) signals in both S6-PNM and S6-NULL psBCs (
[0082] Transmission electron microscopy analysis was performed to characterize ultra-structures of secretory granules in S6-NULL and S6-PNM psBCs (
Global Gene Expression Profiling Identifies Accelerated Induction of Glucose Sensing and Insulin Secretion Genes Upon PNM Transduction
[0083] To further understand the impact of PNM transduction on iPSC differentiation into psBCs, next generation RNAseq analyses were performed using RNA samples from psBCs at the end of Stage 5 (control S5-NULL cells vs. S5-PN cells, 13 days after differentiation, before S6 MAFA transduction) as well as psBCs at the end of Stage 6 (control S6-NULL cells vs. S6-PNM, 20 days after differentiation). The top 30 up-regulated genes for S5-PN and S6-PNM identified key genes relevant to beta-cell development and function including INS, NKX2.2, NKX6.1, PAX2, PCSK1 (PC1), as well as insulin granule exocytosis, such as CHGA, SCG2/CHGC, SCGN, CPLX1 and CPLX2. The major type 1 diabetes antigen genes, including INS, IA-2 (PTPRN) and GAD65 (GAD2), also were prioritized. Other notable genes identified in both S5 and S6 stages included SLC6A5/GLYT2, which controls a glycine-insulin autocrine feedback (Yan-Do et al., Diabetes, 65:2311-2321 (2016)), BHLHE22 regulating insulin gene expression (Melkman-Zehavi et al., EMBO J., 30:835-845 (2011)) and a plasma membrane Ca.sup.2+-ATPase, ATP2B2/PMCA2, which affects GSIS and beta-cell proliferation (Pachera et al., Diabetologia, 58:2843-2850 (2015)) (
PNM-Modified psBCs Demonstrate Glucose-Responsive Insulin Secretion In Vivo
[0084] To evaluate the glucose-responsive insulin secretory capacity of PNM-modified psBCs in vivo, approximately 50 million S6 psBCs were transplanted in the kidney capsules of immunodeficient SCID-beige mice with STZ-induced diabetes (
[0085] Fasting human C-peptide levels in S6-PNM-transplanted mice gradually increased overtime, from 3 pg/mL at 1 week to 1,172 pg/mL at 13 weeks post transplantation (
[0086] Prospectively, 13 weeks after transplantation, the kidneys with psBC grafts were harvested from the recipient mice. Further analysis revealed that the insulin-positive cells in S6-PNM and S6-NULL grafts were largely monohormonal. However, S6-PNM grafts contained rich clusters of insulin-positive cells, whereas in S6-NULL grafts the insulin-positive cells were scattered (
Other Embodiments
[0087] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.