Surface display of functional proteins in a broad range of gram negative bacteria

10683509 ยท 2020-06-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for the surface display of a recombinant polypeptide on the surface of a host cell, said method comprising the steps: (a) providing a host cell transformed with a nucleic acid fusion operatively linked with an expression control sequence, said nucleic acid fusion comprising: (i) a portion encoding a signal peptide, (ii) a portion encoding the recombinant polypeptide to be displayed, (iii) a portion encoding a transmembrane linker, and (iv) a portion encoding the trans porter domain of an EhaA protein, and (b) culturing the host cell under conditions wherein the nucleic acid fusion is expressed and the expression product comprising the recombinant polypeptide is displayed on the surface of the host cell.

Claims

1. A method for displaying a recombinant polypeptide on the surface of a host cell, said method comprising the steps: (a) providing a host cell transformed with a nucleic acid fusion operatively linked with an expression control sequence, said nucleic acid fusion comprising: (i) a portion encoding a signal peptide allowing for transport into the periplasm through the inner cell membrane, (ii) a portion encoding the recombinant polypeptide to be displayed, (iii) a portion encoding a transmembrane linker, and (iv) a portion encoding the transporter domain of an EhaA protein, and (b) culturing the host cell under conditions wherein the nucleic acid fusion is expressed and the expression product comprising the recombinant polypeptide is displayed on the surface of the host cell, wherein the host cell is a Gram negative bacterium, with the proviso that the Gram negative bacterium is not E coli, wherein the transporter domain of the EhaA protein is encoded by a sequence comprising a sequence selected from the group consisting of: (1) a nucleotide sequence comprising SEQ ID NO:18, (2) a nucleotide sequence encoding SEQ ID NO:19, (3) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:18 or/and a sequence encoding SEQ ID NO: 19, and (4) nucleotide sequences which encode the polypeptides encoded by (1), (2) or/and (3) within the scope of the degeneracy of the genetic code; wherein the transmembrane linker is encoded by a sequence comprising a sequence selected from the group consisting of (I) a nucleotide sequence comprising SEQ ID NO:16, (II) a nucleotide sequence encoding SEQ ID NO:17, (III) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:16 or/and a sequence encoding SEQ ID NO: 17, and (IV) nucleotide sequences which encodes the polypeptides encoded by (I), (II) or/and (III) within the scope of the degeneracy of the genetic code.

2. The method of claim 1, wherein the nucleic acid fusion further comprises at least one nucleic acid sequence encoding an affinity tag.

3. The method of claim 2, wherein a nucleic acid sequence defined in claim 2 is flanking the portion (ii) encoding the recombinant polypeptide to be displayed.

4. The method of claim 3, wherein the nucleic acid sequence is separated from portion (ii) by a sequence encoding at least one protease recognition sequence.

5. The method of claim 4, wherein the at least one protease recognition sequence is independently selected from factor Xa cleavage site, OmpT cleavage site, and TEV protease cleavage site.

6. The method of claim 2, wherein the affinity tag is independently selected from His.sub.6 and epitopes.

7. The method of claim 1, wherein the nucleic acid fusion comprises a nucleotide sequence encoding at least one protease recognition sequence, said nucleotide sequence being located between portions (ii) and portion (iii).

8. The method of claim 7, wherein the at least one protease recognition sequence is independently selected from factor Xa cleavage site, OmpT cleavage site, and TEV protease cleavage site.

9. The method of claim 1, wherein the portion (ii) encoding the recombinant polypeptide to be displayed is flanked by at least one sequence comprising a multiple cloning site.

10. The method according to claim 1 wherein the transporter domain of the EhaA protein forms a -barrel structure.

11. The method of claim 1, wherein the transmembrane linker (ii) comprises a sequence selected from the group consisting of: (a) an amino acid sequence comprising SEQ ID NO:17, and (b) sequences which are at least 95% identical to the sequences of (a).

12. The method of claim 1, wherein the transporter domain of the EhaA protein (iii) comprises a sequence selected from the group consisting of: (a) an amino acid sequence comprising SEQ ID NO:19, and (b) sequences which are at least 95% identical to the sequence of (a).

13. The method of claim 1, wherein the sequence of the nucleic acid fusion has a codon usage adapted to the host cell.

14. The method of claim 1, wherein the amino acid sequences encoded by nucleic acid sequences (i) to (iv) are arranged from N terminal to C terminal.

15. The method of claim 1, wherein the nucleic acid sequences (i) to (iv) are arranged from 5 to 3.

16. The method of claim 1, wherein the transporter domain of an EhaA protein is heterologous with respect to the host cell.

17. The method of claim 1, wherein the host cell is a bacterium.

18. The method of claim 1, wherein the bacterium is a Gram negative bacterium.

19. The method of claim 1, wherein the bacterium is selected from Salmonella spp., Zymomonas spp., Zymobacter spp., Pseudomonas spp., Cupriavidus spp., Rhodobacter spp., Acinetobacter spp., Gluconobacter spp., Gluconacetobacter spp., Acidomonas spp., Acetobacter spp., Paracoccous spp., Rhizobium spp., and Xanthomonas spp.

20. A recombinant vector comprising the nucleic acid fusion as defined in claim 1, operatively linked to an expression control sequence.

21. A recombinant vector comprising: (i) a portion encoding a signal peptide allowing for transport into the periplasm through the inner cell membrane, (ii) a portion encoding a multiple cloning site, (iii) a portion encoding a transmembrane linker, and (iv) a portion encoding the transporter domain of an EhaA protein, wherein the transporter domain of the EhaA protein is encoded by a sequence comprising a sequence selected from the group consisting of: (1) a nucleotide sequence comprising SEQ ID NO:18, (2) a nucleotide sequence encoding SEQ ID NO:19, (3) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:18 or/and a sequence encoding SEQ ID NO: 19, and (4) nucleotide sequences which encode the polypeptides encoded by (1), (2) or/and (3) within the scope of the degeneracy of the genetic code, and wherein the transmembrane linker is encoded by a sequence comprising a sequence selected from the group consisting of: (I) a nucleotide sequence comprising SEQ ID NO:16, (II) a nucleotide sequence encoding SEQ ID NO:17, (III) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:16 or/and a sequence encoding SEQ ID NO: 17, and (IV) nucleotide sequences which encodes the polypeptides encoded by (I), (II) or/and (III) within the scope of the degeneracy of the genetic code.

22. The vector of claim 21, wherein the multiple cloning site is suitable for integration of a nucleic acid sequence encoding a recombinant polypeptide in frame with portions (i), (ii) and (iv).

23. The vector of claim 21, wherein the nucleic acid sequences (i) to (iv) are arranged from 5 to 3.

24. A recombinant host cell comprising the recombinant vector as claimed in claim 21.

25. A method for producing a host cell capable of displaying a recombinant polypeptide on the surface, said method comprising the steps (a) providing a vector comprising: (i) a portion encoding a signal peptide allowing for transport into the periplasm through the inner cell membrane, (ii) a portion encoding a multiple cloning site, (iii) a portion encoding a transmembrane linker, and (iv) a portion encoding the transporter domain of an EhaA protein (b) inserting a sequence encoding the recombinant polypeptide to be displayed into the multiple cloning site (iv), and (c) performing the method of claim 1, wherein the transporter domain of the EhaA protein is encoded by a sequence comprising a sequence selected from the group consisting of: (1) a nucleotide sequence comprising SEQ ID NO:18, (2) a nucleotide sequence encoding SEQ ID NO:19, (3) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:18 or/and a sequence encoding SEQ ID NO: 19, and (4) nucleotide sequences which encode the polypeptides encoded by (1), (2) or/and (3) within the scope of the degeneracy of the genetic code, and wherein the transmembrane linker is encoded by a sequence comprising a sequence selected from the group consisting of: (I) a nucleotide sequence comprising SEQ ID NO:16, (II) a nucleotide sequence encoding SEQ ID NO:17, (Ill) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:16 or/and a sequence encoding SEQ ID NO: 17, and (IV) nucleotide sequences which encodes the polypeptides encoded by (I), (II) or/and (III) within the scope of the degeneracy of the genetic code.

26. A method for displaying a recombinant polypeptide on the surface of a host cell, said method comprising the steps: (a) providing a host cell transformed with a nucleic acid fusion operatively linked with an expression control sequence, said nucleic acid fusion comprising: (i) a portion encoding a signal peptide allowing for transport into the periplasm through the inner cell membrane, (ii) a portion encoding the recombinant polypeptide to be displayed, (iii) a portion encoding a transmembrane linker, and (iv) a portion encoding the transporter domain of an EhaA protein, and (b) culturing the host cell under conditions wherein the nucleic acid fusion is expressed and the expression product comprising the recombinant polypeptide is displayed on the surface of the host cell, wherein the recombinant polypeptide to be displayed is selected from an endoglucanase, an exoglucanase and a -glucosidase, and combinations thereof, wherein the host cell is a Gram negative bacterium, and wherein the transporter domain of the EhaA protein is encoded by a sequence comprising a sequence selected from the group consisting of: (1) a nucleotide sequence comprising SEQ ID NO:18, (2) a nucleotide sequence encoding SEQ ID NO:19, (3) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:18 or/and a sequence encoding SEQ ID NO: 19, and (4) nucleotide sequences which encode the polypeptides encoded by (1), (2) or/and (3) within the scope of the degeneracy of the genetic code, and wherein the transmembrane linker is encoded by a sequence comprising a sequence selected from the group consisting of: (I) a nucleotide sequence comprising SEQ ID NO:16, (II) a nucleotide sequence encoding SEQ ID NO:17, (III) nucleotide sequences comprising a sequence being at least 95% identical to SEQ ID NO:16 or/and a sequence encoding SEQ ID NO: 17, and (IV) nucleotide sequences which encodes the polypeptides encoded by (I), (II) or/and (III) within the scope of the degeneracy of the genetic code.

27. A method for displaying a recombinant polypeptide on the surface of a host cell according to claim 1, wherein the sequence of the nucleic acid fusion has a codon usage adapted to the host cell.

28. A method for displaying a recombinant polypeptide on the surface of a host cellusing a Maximized Autotransporter Expression System, said method comprising: (a) providing a host cell transformed with a nucleic acid fusion operatively linked with an expression control sequence, said nucleic acid fusion comprising: (i) a portion encoding a signal peptide which is a cholera toxin B subunit signal peptide, (ii) a portion encoding the recombinant polypeptide to be displayed, wherein said recombinant polypeptide is selected from the group consisting of an endoglucanase, an exoglucanase and a -glucosidase, (iii) a portion encoding a transmembrane linker, wherein said transmembrane linker is encoded by a sequence comprising a sequence selected from the group consisting of: (1) a nucleotide sequence comprising SEQ ID NO:16, (2) a nucleotide sequence encoding SEQ ID NO:17, (3) a nucleotide sequence comprising a sequence which is at least 95% identical to SEQ ID NO:16 and/or a sequence encoding SEQ ID NO: 17, and (4) nucleotide sequences which encode the polypeptides encoded by (1) or/and (2) within the scope of the degeneracy of the genetic code, (iv) a portion encoding the transporter domain of an EhaA protein, wherein the transporter domain of the EhaA protein is encoded by a sequence comprising a sequence selected from the group consisting of: (A) a nucleotide sequence comprising SEQ ID NO:18, (B) a nucleotide sequence encoding SEQ ID NO:19, (C) a nucleotide sequence comprising a sequence which is at least 95% identical to SEQ ID NO:18 and/or a sequence encoding SEQ ID NO: 19, and (D) a nucleotide sequence which encodes the polypeptides encoded by (A), (B) or/and (C) within the scope of the degeneracy of the genetic code, and (b) culturing the host cell under conditions wherein the nucleic acid fusion is expressed and the expression product comprising the recombinant polypeptide is displayed on the surface of the host cell, wherein the host cell is a Gram negative bacterium, with the proviso that the Gram negative bacterium is not E coli.

29. The method according to claim 1, wherein said recombinant polypeptide is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO:23, SEQ ID NO: 24, and SEQ ID NO:25.

30. The method of claim 1, wherein the signal peptide is a CtxB signal peptide.

31. The method of claim 1, wherein the signal peptide is obtained from a gram-negative bacterium.

Description

(1) Further, the present invention shall be further illustrated by the following figures and examples:

(2) FIG. 1: Use of the MATE system for the transport of 6His to the outer membrane. E. coli BL21 cells were grown in LB medium to OD.sub.600 of 0.5. Protein expression was induced by the addition of 1 mM IPTG, and the cells were harvested after 1 hour. Outer membrane proteins were isolated according to the modified method of Hantke et al. (1981). (A) SDS-PAGE of outer membrane proteins. (B) Western blot with antibody against 6His. M=PageRuler prestained protein marker, 1=cells with negative control plasmid, expressing an unrelated peptide with AIDA-I (pST005), 2=cells with empty vector (pJExpress401), 3=cells with pMATE-MT004 without the addition of IPTG, 4=cells with pMATE-MT004 with 1 mM IPTG for the induction of protein expression. The arrow indicates the band associated with the MATE fusion protein. Equal amounts of protein were loaded in the gels used for Coomassie staining and Western blots.

(3) FIG. 2: Protease accessibility assay to confirm the surface display of GFP in E. coli with the MATE system. E. coli UT5600 cells containing pMATE-MT006 were harvested after the induction of protein expression with IPTG, and outer membrane proteins were isolated according to the modified method of Hantke (1981). (A) SDS-PAGE with Coomassie stain. (B) Western blot with polyclonal rabbit anti-GFP. M=PageRuler prestained protein marker, 1=cells without induction of protein expression (no IPTG), 2=cells with induction of protein expression, 3=cells with induction of protein expression and trypsin treatment. Samples were diluted 1:20 in loading buffer for Western blotting.

(4) FIG. 3: Secretion of GFP into the cell growth media using the MATE system, based on the cleavage by the E. coli protease OmpT. E. coli cells containing pMATE-MT006 were grown in LB medium until OD.sub.600 0.5, and then expression of the fusion protein was induced with IPTG. After 1.5 h the cells were removed from the growth media by centrifugation followed by filtration. The proteins in the media were then concentrated by TCA precipitation and analysed with 12.5% SDS-PAGE. (A) SDS-PAGE with Coomassie stain showing all proteins released into the growth media. (B) Western blot to detect GFP released into the growth media c). M=PageRuler prestained protein marker, 1=E. coli UT5600 (OmpT negative strain), 2=E. coli UT2300 (OmpT positive parent strain). Equal amounts of protein were loaded for SDS-PAGE and Western blot.

(5) FIG. 4: Sample of mCherry and its negative control harvested from the supernatant of OmpT-positive and OmpT-negative E. coli strains. The RFP mCherry was secreted into the cell growth media using the pMATE-System, based on the cleavage by the E. coli protease OmpT. The OmpT-positive E. coli strain UT3200 and its derivate OmpT-negative strain E. coli UT5600 harbouring pMATE-SI015 were grown in LB medium until OD.sub.600 0.5, and then expression of the fusion protein was induced with 1 mM IPTG for 24 h. Cells were removed from the growth media by centrifugation. The supernatant of both strains was loaded on a Ni-NTA column for purification of 6His mCherry.

(6) FIG. 5: SDS-PAGE with Coomassie stain of putative secreted affinity purified 6His mCherry from OmpT-positive E. coli UT2300 and its derivate OmpT-negative strain E. coli UT5600 each harbouring the pMATE-SI015 plasmid. E. coli cells containing pMATE-SI015 were grown in LB media until OD.sub.600 0.5, and then expression of the fusion protein was induced with 1 mM IPTG. After 24 h the cells were removed from the growth media by centrifugation. The supernatant of both strains was loaded on a Ni-NTA column. 6His proteins were eluted with 500 mM imidazole. After protein concentration, the eluate was loaded on a 10% polyacrylamide gel and subsequently stained with Coomassie. M=PageRuler prestained protein marker, 1=E. coli UT2300 harbouring pMATE-SI015 (OmpT positive parent strain), 2=E. coli UT5600 harbouring pMATE-SI015 (OmpT negative strain).

(7) FIG. 6: Western blot showing the release of surface-displayed GFP into the supernatant by Factor Xa protease. Protein expression in E. coli UT5600 cells containing pMATE-MT006 was induced with 1 mM IPTG. Cells were washed and incubated for 16 h in buffer containing Factor Xa. Proteins were concentrated from the supernatant, separated by 12.5% SDS-PAGE. Western blotting was conducted with a polyclonal 1 against GFP as described in the materials and methods. M=PageRuler prestained protein marker, 1=Factor Xa protease alone 2=supernatant from cells without induction of protein expression (no IPTG), 3=supernatant from cells without induction of protein expression (no IPTG)+Factor Xa protease, 4=supernatant from cells with induction of protein expression, 5=supernatant from cells with induction of protein expression+Factor Xa protease.

(8) FIG. 7: Structure of the EstA-autotransporter fusion protein. Illustration of the parts from the fusion protein necessary for the surface display of the B. gladioli estA catalytic domain using the MATE system. SP=signal peptide. Restriction sites used for cloning are underlined.

(9) FIG. 8: Photometric esterase activity assay, based on the release of p-nitrophenol from pnitrophenyl acetate by E. coli whole cells. Cells contained either a MATE expression plasmid (pMATE-SI010) or an Autodisplay expression plasmid (pES01) for the surface expression of the estA esterase as an autotransporter passenger.OD.sub.600 of cells in the assay was adjusted to 0.2.

(10) FIG. 9: Photometric activity assay after protease digestion. Release of pnitrophenol from pnitrophenyl acetate by either proteinase K treated or untreated whole cells of S. enterica and S. enterica pMATE-SI010 after 2 h of induction with 0.5% L-arabinose at 30 C. Final OD.sub.600 in assay was adjusted to 0.2.

(11) FIG. 10: Photometric esterase activity assay of whole cells, based on the hydrolysis of pnitrophenyl acetate. Protein expression was induced for 2 h with 0.5% L-arabinose at 30 C. Final OD.sub.600 in assay was adjusted to 0.2.

(12) FIG. 11: Photometric esterase activity assay of whole cells based on the hydrolysis of pnitrophenyl acetate. Protein expression was induced by 2 h with 0.5% L-arabinose at 30 C. (A) E. coli UT5600 or (B) P. putida KT2440.

(13) FIG. 12: Flow cytometry analysis of cells displaying the EstA catalytic domain on the surface. After cleavage of the signal peptide, the Nterminal region of the EstA fusion protein is expected to contain a 6His affinity tag. Cells of P. putida KT2440 were analysed after incubation of the samples with two antibodies, a primary monoclonal anti-6His antibody and a secondary fluorescein-labelled detection antibody. (A) P. putida KT2440 cells without plasmid (negative control) and (B) P. putida KT2440 pMATE-SI010 cells displaying EstA catalytic domain on the surface.

(14) FIG. 13: Protein content and esterase activity of whole cells expressing EstA using the MATE system in E. coli and P. putida. Cells were grown until OD.sub.600 0.6, and gene expression induced by 0.5% (w/v) L-arabinose for 2 h at 30 C. (200 rpm). Cell suspensions were adjusted to an OD of 1 and after harvest. Proteins from whole cells were boiled in SDS-PAGE sample buffer for 30 minutes. The amount of protein loaded on each lane was normalised based on the optical density of the cell solution. (A) SDS-PAGE followed by Coomassie stain for total protein (B) SDS-PAGE followed by renaturation of the enzymes, and ingel stain for esterase activity (B) Designations: M: PageRuler prestained protein marker, 1: control, E. coli UT5600 without plasmid, 2: E. coli UT5600 pMATE-SI010 (EstA as passenger), 3: P. putida KT2440 pMATE-SI010 (EstA as passenger), 4: control, P. putida KT2440 pMATE-SI005 (6His as passenger).

(15) FIG. 14: Protein content and esterase activity of outer membranes after the expression of EstA using the MATE system in E. coli and P. putida. SDS-PAGE (10% w/v) analysis of outer membrane preparations and outer membrane preparations from whole cells after treatment with proteinase KK. Outer membrane proteins were isolated from E. coli UT5600 and P. putida

(16) KT2440 strains. Cells were grown until OD.sub.600 0.6, and protein expression induced by 0.5% (w/v) Larabinose for 2 h at 30 C. (200 rpm). Cells were either used directly for preparations of outer membranes or with a prior incubation step with proteinase K and subsequent outer membrane preparation. (A)

(17) Coomassie stain and (B) esterase activity stain after renaturation of enzymes. M: PageRuler prestained protein marker, 1: control, E. coli UT5600 without plasmid, 2: control, proteinase K treated E. coli UT5600 without plasmid, 3: E. coli UT5600 pMATE-SI010 (EstA as passenger), 4: proteinase K treated E. coli UT5600 pMATE-SI010, 5: P. putida KT2440 pMATE-SI010, 6: proteinase K treated P. putida KT2440, 7: control, P. putida KT2440 pMATE-SI005 (6His as passenger), 8: control, proteinase KK treated P. putida KT2440 pMATE-SI005.

(18) FIG. 15: Comparison of surface displayed esterase activity in E. coli and P. putida using the MATE system after correcting for intracellular activity. Data was reanalysed from FIG. 11. The activity from strains treated with proteinase K was subtracted from the overall activity seen in the whole cell assay.

(19) FIG. 16: SDS-PAGE (A) and Western Blot (B) analyses of Z. mobilis outer membrane preparations. Z. mobilis cells were cultivated in ZM Medium at 30 C., 60 rpm until OD.sub.575 reached 0.6. Protein expression was, when needed, induced by addition of L-arabinose to a final concentration of 0.2% and incubation for further 2 h. Cells were then harvested and either used directly for preparations of outer membranes or incubated with 2.5% trypsin in 0.2 mol/L Tris-HCl pH 8.0 for 1 h at 37 C., 200 rpm prior to outer membrane protein isolation. Proteins were then separated by SDS-PAGE and (A) Coomassie stained or (B) transferred to a nitrocellulose membrane stained with anti-6His primary antibodies. M: PageRuler prestained protein marker, 1: Z. mobilis without plasmid, induced, 2: Z. mobilis with plasmid, induced, 3: Z. mobilis with plasmid, not induced, 4: Z. mobilis with plasmid, induced and treated with Trypsin prior to outer membrane protein isolation.

(20) FIG. 17: Esterase acitivity staining of Z. mobilis outer membrane preparations. Z. mobilis cells were cultivated in ZM Medium at 30 C., 60 rpm until OD.sub.578 reached 0.6. Protein expression was, when needed, induced by addition of L-arabinose to a final concentration of 0.2% and incubation for further 2 h. Cells were then harvested and either used directly for preparations of outer membranes or incubated with 2.5% trypsin in 0.2 mol/L Tris-HCl pH 8.0 for 1 h at 37 C., 200 rpm prior to outer membrane protein isolation. Proteins were then separated by SDS-PAGE and esterase activity stained. M: PageRuler prestained protein marker, 1: Z. mobilis without plasmid, induced, 2: Z. mobilis with plasmid, induced, 3: Z. mobilis with plasmid, not induced, 4: Z. mobilis with plasmid, induced and treated with Trypsin prior to outer membrane protein isolation.

(21) FIG. 18: Plasmid map of pMATE-MT004.

(22) FIG. 19: Plasmid map of pMATE-MT006.

(23) FIG. 20: Plasmid map of pMATE-SI005.

(24) FIG. 21: Plasmid map of pMATE-SI009.

(25) FIG. 22: Plasmid map of pMATE-SI010.

(26) FIG. 23: Plasmid map of pMATE-SI012.

(27) FIG. 24: Plasmid map of pMATE-SI015.

(28) FIG. 25: Alignment of EhaA (natural sequence and codon-optimized sequence) and AIDA-I.

(29) FIG. 26: Plasmid map of pMATE-PT004.

(30) FIG. 27: SDS-PAGE of outer membrane isolates of Z. palmae cells. Cells were cultivated as described previously and, when necessary, induced at OD.sub.578=0.5 for one hour with 0.2% arabinose. Outer membrane fraction was isolated, separated in a 12.5% polyacrylamide gel and stained with Coomassie Brilliant Blue. 1: Prestained protein ladder, molecular weight in kDa is indicated on the left. 2: Z. palmae wildtype cells, induced. 3: Z. palmae pMATE-PT004 cells, not induced. 4: Z. palmae pMATE-PT004 cells, induced. 5: Z. palmae pMATE-PT004 cells, induced and digested with trypsin.

(31) FIG. 28: Photometric CMC hydrolysis activity of Z. palmae whole cells based on the detection of reduced sugar formation via DNS assay. Cells were cultivated as described above and, when necessary, induced at OD.sub.578=0.5 for one hour with 0.2% arabinose, adjusted to OD.sub.578=25 and incubated with 1% CMC in sodium-citrate buffer, pH 6.0, for ten minutes. Cells were then removed and the supernatant applied to a DNS assay. Absorption values of blank samples (buffer and substrate) were substracted from the absorption values of cell samples.

(32) FIG. 29: Photometric CMC hydrolysis activity of Z. mobilis whole cells based on the detection of reduced sugar formation via DNS assay. Cells were cultivated as described above and, when necessary, induced at OD.sub.578=0.5 for one hour with 0.2% arabinose, adjusted to OD.sub.578=25 and incubated with 1% CMC in sodium-citrate buffer, pH 6.0, for ten minutes. Cells were then removed and the supernatant applied to a DNS assay. Absorption values of blank samples (buffer and substrate) were substracted from the absorption values of cell samples.

(33) FIG. 30: FACS-histogram of Z. palmae wildtype cells, treated with anti-6His 1 antibody and Dylight-633 conjugated 2 antibody; event count approx. 50,000.

(34) FIG. 31: FACS-histogram of induced Z. palmae pMATE-PT004 cells, treated with anti-6His 1 antibody and Dylight-633 conjugated 2 antibody; event count approx. 50,000.

(35) FIG. 32: Use of the pMATE system for the transport of cellulases to the outer membrane of P. putida. Cells were grown at 30 C. in LB medium to OD.sub.578 of 0.5. Protein expression was induced by the addition of 0.2% (w/v) L-arabinose for 4 h at 30 C. Cells were harvested and the outer membrane proteins were isolated according to the modified method of Hantke et al. (1981). SDS PAGE of outer membrane proteins was stained with Coomassie. M: prestained protein marker, 1: P. putida KT2440 pMATE-exoglucanase without L-arabinose, 2: P. putida KT2440 pMATE-exoglucanase with L-arabinose, 3: P. putida KT2440 pMATE-endoglucanase without L-arabinose, 4: P. putida KT2440 pMATE-endoglucanase with L-arabinose, 5+9: P. putida KT2440 without plasmid, non-induced, 6: P. putida KT2440 without plasmid, induced, 7: P. putida KT2440 pMATE-3-glucosidase without L-arabinose, 8: P. putida

(36) KT2440 pMATE--glucosidase with L-arabinose. The arrow indicates the band associated with the pMATE fusion protein.

(37) FIG. 33: Photometric exoglucanase activity assay of whole cells based on the hydrolysis of p-nitrophenyl--D-cellobioside. Protein expression was induced for 4 h with 0.2% L-arabinose at 30 C. Final OD.sub.578 of cells was adjusted to 0.5.

(38) FIG. 34: Photometric endoglucanase activity assay of whole cells based on the detection of reducing sugars released from carboxymethylcellulose via DNS assay. Protein expression was induced for 4 h with 0.2% L-arabinose at 30 C. Final OD.sub.578 of cells was adjusted to 20.

(39) FIG. 35: Photometric -glucosidase activity assay of whole cells based on the hydrolysis of p-nitrophenyl--D-glucopyranoside. Protein expression was induced for 4 h with 0.2% L-arabinose at 30 C. Final OD.sub.578 of cells was adjusted to 20.

(40) FIG. 36: Total pMATE-cellulase activity using the FPA at 55 C. Reducing sugars released from filter paper was detected via DNS assay. BS: Blank substrate (filter paper in buffer); pMATE-cellulase-mix: exoglucanase, endoglucanase and -glucosidase expressing cells were mixed in equal parts. Protein expression was induced for 4 h with 0.2% L-arabinose at 30 C. Final OD.sub.578 of total cells was adjusted to 50.

(41) FIG. 37: EFB hydrolysis by pMATE-cellulases at 55 C. for 4 d. Reducing sugars released from 2.5% (dry weight) was detected via DNS assay. BS: Blank substrate (EFB in buffer); pMATE-cellulase-mix: exoglucanase, endoglucanase and -glucosidase expressing cells were mixed in equal parts. Protein expression was induced for 4 h with 0.2% L-arabinose at 30 C. Final OD.sub.578 of total cells was adjusted to 20.

(42) FIG. 38: Plasmid map of pMATE-exoglucanase. Annotation of the pMATE-exoglucanase plasmid:

(43) TABLE-US-00019 Feature position AraC 4-902 bp araBAD promoter 912-1184 bp CtxB SP sequence 1227-1307 bp 6xHis 1308-1325 bp fXa cleavage site 1326-1337 bp exoglucanase 1338-3719 bp OmpT cleavage site 3720-3731 bp fXa cleavage site (2.nd) 3732-3743 bp PEYFK epitope 3747-3761 bp MATE linker and -barrel 3762-5228 bp pBBR1 rep gene (broad host rep) 5550-6212 bp KanR (kanamycine resistence cassette) 7746-8540 bp

(44) FIG. 39: Plasmid map of pMATE-endoglucanase. Annotation of the pMATE-endoglucanase plasmid:

(45) TABLE-US-00020 Feature position AraC 4-902 bp araBAD promoter 912-1184 bp CtxB SP sequence 1227-1307 bp 6xHis 1308-1325 bp fXa cleavage site 1326-1337 bp endoglucanase 1338-2759 bp OmpT cleavage site 2760-2771 bp fXa cleavage site (2.nd) 2772-2783 bp PEYFK epitope 2787-2801 bp MATE linker and -barrel 2802-4268 bp pBBR1 rep gene (broad host rep) 4590-5252 bp KanR (kanamycine resistence cassette) 6786-7580 bp

(46) FIG. 40: Plasmid map of pMATE--glucosidase. Annotation of the pMATE-beta-glucosidase plasmid:

(47) TABLE-US-00021 Feature position AraC 4-902 bp araBAD promoter 912-1184 bp CtxB SP sequence 1227-1307 bp 6xHis 1308-1325 bp fXa cleavage site 1326-1337 bp -glucosidase 1338-2690 bp OmpT cleavage site 2691-2702 bp fXa cleavage site (2.nd) 2703-2714 bp PEYFK epitope 2718-2732 bp MATE linker and -barrel 2733-4199 bp pBBR1 rep gene (broad host rep) 4521-5183 bp KanR (kanamycine resistence cassette) 6717-7511 bp

EXAMPLE 1

(48) Surface Expression of 6His in E. coli using the MATE System

(49) In this example, the MATE system is used to display a short peptide (6His) on the surface of E. coli.

(50) Bacterial Strains

(51) E. coli BL21 (8, F, dcm, ompT, Ion, hsdS(rB.sup. mB.sup.), gal) and E. coli BL21 (DE3) (B, F, dcm, ompT, Ion, hsdS(rB.sup. mB.sup.), gal (DE3)) were used for expression experiments.

(52) Plasmid Construction

(53) The gene encoding the pMATE autotransporter fusion protein was synthesised commercially in the pJexpress-401 plasmid vector (DNA2.0, USA) to create pMATEMT004. The pJExpress401 plasmid backbone contained an rrnB1/B2 terminator, kanamycin resistance gene, LacI repressor, pUC on as well as rpn and bla terminators. Expression of the fusion protein was under the transcriptional control of an Isopropyl -D-1-thiogalactopyranoside (IPTG) inducible T5 promoter.

(54) The fusion protein included an N-terminal signal peptide from the cholera toxin B subunit (CtxB), a 6His tag, a multiple cloning site, and the autotransporter domain, which consists of a linker and Pbarrel region.

(55) Protease cleavage sites (Factor Xa and OmpT) were incorporated after the multiple cloning site. A second Factor Xa cleavage site was inserted after the 6His, for removal of this affinity tag after purification. An epitope (PEYFK) for a monoclonal antibody (D142) was inserted after the protease cleavage sites.

(56) The pMATE contains the EhaA autotransporter domain (GenBank Accession No. Q8X6C1). This autotransporter domain has never before been used for the display of recombinant proteins in bacteria; however the full native protein is known to increase cell-cell interactions when overexpressed in E. coli (Wells et al. 2008). To define the border between the original passenger and the autotransporter domain, we aligned the EhaA polypeptide sequence against the Cterminal AIDAI fragment used for Autodisplay (GenBank Accession No. Q03155, Maurer et al. 1997). The sequence encoding the signal peptide and EhaA fragment was codon optimised for E. coli according the algorithm of Welch et al. (2009). The codon usage was further altered to remove some restriction sites, and to minimise predicted RNA 2 structure in the region encoding the CtxB signal peptide.

(57) SDS-PAGE and Western Blot 40 ml of LB media was inoculated with 1 ml from an overnight culture of E. coli BL21 or BL21 (DE3) containing the plasmid of interest. The cultures were then incubated at 37 C., 200 rpm until they reached an OD.sub.600 of 0.5. Protein expression was induced by the addition of 1 mM IPTG, and the cells harvested one hour after induction. Outer membrane proteins were prepared according to the rapid isolation protocol of Hantke (1981) with modifications as described previously (Jose and von Schwichow, 2004). Proteins were separated with 10% sodium-dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Laemmli 1970). Proteins were visualised after SDS-PAGE by staining with Coomassie Brilliant Blue R250. For Western blots, proteins were transferred onto a nitrocellulose membrane using standard electroblotting techniques (Mini-trans blot, Bio-Rad, USA). For the 1 antibody we used a mouse monoclonal anti-6-His IgG (Dianova, Germany). For the 2 antibody we used a horseradish peroxidase-conjugated anti-mouse IgG (Antibodies-online, USA). All solutions for Western blotting were based on Tris/Cl buffered saline (TBS, pH 7.4). The membrane was first blocked with 3% BSA, and incubated with a 1:1000 of 1 antibody for 3 hours. The membrane was then washed in TBS, and incubated for 2 hours with a 1:6000 dilution of 2 antibody. The blot was then washed and incubated with Pierce enhanced chemiluminescent (ECL) western blotting substrate (Thermo Scientific, USA), exposed to X-ray film.
Results and Discussion

(58) SDS-PAGE and Western blots revealed a protein of 60-65 kDa in the outer membrane of E. coli containing pMATE-MT004 (FIG. 1). The nucleotide sequence of pMATE-MT004 is described by SEQ ID NO:3 (FIG. 18). The predicted size of the autotransporter fusion protein with 6His as a passenger was 57.6 kDa after cleavage of the N-terminal signal peptide. The autotransporter fusion protein encoded by pMATE-MT004 is described by SEQ ID NO:4. The fusion protein was visible in all cases as a single band after SDS-PAGE, confirming that the MATE system did not suffer from limitations in the sec secretion or signal peptidase cleavage. The fusion protein was also visible from cells without the induction of protein expression (no IPTG). This suggests some leaky expression of the T5 promoter under these conditions, although the protein band seen after SDS-PAGE was much more intense after induction with IPTG.

(59) Overall, this example shows that the MATE system can transfer a peptide to the outer membrane of E. coli. It shows that the 6His is a suitable epitope for Western blotting, in order to detect the location of the fusion protein after SDS-PAGE.

EXAMPLE 2

(60) Surface Expression of GFP in E. coli using the MATE System

(61) In this example, the MATE system is used to display a fulllength protein (GFP) on the surface of E. coli.

(62) Bacterial Strains

(63) E. coli Stellar cells were used for cloning experiments [F, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, 80d lacZ M15, (lacZYAargF) U169, (mrrhsdRMSmcrBC), mcrA, ] (Clontech, USA). Expression experiments were carried out in Escherichia coli UT5600 [F.sup., ara-14, leuB6, secA6, lacY1, proC14, tsx-67, (ompT-fepC)266, entA403, trpE38, rfbD1, rpsL109(Str.sup.r), xyl-5, mtl-1, thi-1] (Grodberg and Dunn, 1988).

(64) Plasmid Construction

(65) The gene encoding GFP (GFPmut2) was inserted into pMT004 to form pMATE-MT006 (FIG. 19) using ligation independent cloning techniques (In-Fusion Eco-Dry kit, Clontech). The nucleotide sequence of pMATE-MT006 is described by SEQ ID NO:5. The autotransporter fusion protein encoded by pMATE-MT004 is described by SEQ ID NO:6. The GFP insert was amplified from the plasmid pKE19 using the primers MT15 (GCTCGTCGTGCTATTGAGGGCCGCATCCCGG) and MT16 (ACGACCTTCGATATGATGGTGATGGTGGTGGGT) and polymerase chain reaction (PCR). The backbone plasmid was amplified with PCR using the primers MT17 (CATATCGAAGGTCGTatgagtaaaggagaagaacttttc) and MT18 (AATAGCACGACGAGCgcctttgtatagttcatccatgcc), which contained a 15 by overlap to the PCR product of GFP, as required for InFusion cloning. The two PCR Products were joined to form the plasmid pMATE-MT006 using standard In-Fusion techniques (Eco-Dry kit, Clontech) and transformed into E. coli Stellar chemically competent cells (Clontech).

(66) Protease Accessibility Assay

(67) E. coli UT5600 cells containing pMATE-MT006 were grown in LB medium to OD.sub.600 of 0.5. Protein expression was induced by the addition of 1 mM IPTG, and the cells were harvested after 1 hour. For trypsin treatment, cells were incubated with 1.2 g.Math.ml.sup.1 of Trypsin (6000 NFU.ml.sup.1) while shaking for 1 hour at 37 C. Outer membrane proteins were isolated, and proteins were separated by 12.5% SDS-PAGE. Gels were stained for total protein with Coomassie Brilliant Blue R-250. For Western blots, proteins were transferred to PVDF membranes (Mini-trans blot, Bio-Rad, USA). The blot was blocked in TBS containing 5% milk powder, and incubated with a 1:2000 dilution of polyclonal rabbit anti-GFP IgG (GeneTex #GTX26556) overnight at 4 C. while shaking. The membrane was then washed with 0.1% Tween in TBS, and incubated for 2 hours with a 1:10 000 dilution of 2 antibody, horseradish peroxidase coupled anti-rabbit IgG (Promega #W401B). Horseradish peroxidase activity was detected with luminol reagent (sc-2048, SantaCruz Biotechnology, USA) and a chemiluminescence imager (Chemocam, Intas).

(68) Pierce enhanced chemiluminescent (ECL) western blotting substrate (Thermo Scientific, USA), and viewed with an ECL imager.

(69) Results and Discussion

(70) A protein of approximately 105 kDa was found in the outer membrane in cells expressing GFP in the MATE system in E. coli. The apparent molecular weight is higher than the expected size of the fusion protein after cleavage of the Nterminal signal peptide (84 kDa). The 105 kDa band was detected with the antiGFP antibody (FIG. 2), confirming that it corresponded to the GFPautotransporter fusion protein.

(71) We conducted a protease accessibility test to confirm the passenger domain was exposed to the surface. The protease trypsin is too large to enter the cell, therefore the trypsin accessibility of an Nterminal passenger domain demonstrates surface exposure. In contrast, Nterminal regions that are inaccessible to trypsin are presumed to be translocation intermediates, or misfolded proteins in the cytoplasm.

(72) The band corresponding to the MATE fusion protein was significantly reduced after trypsin treatment (FIG. 2). This is strong evidence that the passenger was exposed to the surface. The OmpA band at 37 kDa was unaffected by protease treatment, ensuring that the protease digestion did not affected membrane integrity. Overall, the data confirms that GFP was transported to the cell surface with high efficiency using the MATE system.

EXAMPLE 3

(73) Secretion of a Recombinant Protein into the Medium using the MATE System

(74) In this example, the MATE system utilises the OmpT protease to enable the secretion of a fulllength protein.

(75) In this example, we show that GFP is secreted into the growth media after when expressed in OmpT positive strains using the MATE system.

(76) Materials and Methods

(77) pMATE-MT006 was transformed into E. coli UT2300 [F.sup., ara-14, leuB6, secA6, lacY1, proC14, tsx-67, entA403, trpE38, rfbD1, rpsL109(Str), xyl-5, mtl-1, thi-1] and its OmpT deficient derivate E. coli UT5600 [F.sup., ara-14, leuB6, secA6, lacY1, proC14, tsx-67, (ompT-fepC)266, entA403, trpE38, rfbD1, rpsL109(Str.sup.r), xyl-5, mtl-1, thi-1] (Grodberg and Dunn, 1988). 40 ml of LB medium was inoculated with 0.4 ml of an overnight culture, and grown until OD.sub.600 0.5 at 37 C., 200 rpm. 1 mM of IPTG was added, and the cells were incubated for another 1.5 hours. Cells were then removed by centrifugation (3750 g, 30 min, 4 C.) followed by vacuum filtration (0.45 m HVLP membrane, Millipore).

(78) Proteins secreted into the LB media were concentrated by TCA/Acetone precipitation. TCA (80% w/v) was added to the 40 ml of LB medium to a final concentration of 8.5%. The sample was then incubated for 1 h at 4 C., followed by centrifugation (3750 g, 30 min, 4 C.). The supernatant was then discarded except for a small amount (3 ml) which was used to resuspend the pellet and transfer to 1.5 ml tubes. After centrifugation at 18 000 g for 30 min, the pellet was resuspended in 1 ml of icecold acetone and followed by centrifugation. The pellet was then resuspended in icecold acetone in water (80% v/v) followed by centrifugation. The pellet was then dried for 20 min on a 37 C. heating block, and resuspended in 200 l of 1SDS sample buffer containing 100 mM of dithiothreitol (DTT). Proteins were dissolved by heating at 96 C. for 50 min with vigorous vortexing.

(79) Proteins were separated by 12.5% SDS-PAGE and proteins visualised with Coomassie Brilliant Blue R250. Western blotting was conducted using a 1 antibody against GFP (rabbit polyclonal anti-GFP, #GTX26556, GeneTex) and a 2 goat anti-rabbit IgG antibody, coupled with horseradish peroxidase (#W401B, Promega). After SDS-PAGE, proteins were transferred onto a PVDF membrane using standard electroblotting techniques (Mini-trans blot, Bio-Rad). All solutions for Western blotting were based on Tris/Cl buffered saline (TBS, pH 7.4). The membrane was blocked for 1 h with 5% milk powder (blotting grade, Roth). It was then incubated for overnight in a 1:1000 dilution of 1 antibody, at 4 C. while shaking. The membrane was then washed with 0.1% Tween in TBS and incubated for 1.5 hours with a 1:6000 dilution of 2 antibody. Horseradish peroxidase activity was detected with luminol reagent (sc-2048, SantaCruz Biotechnology, USA) and a chemiluminescence imager (Chemocam, Intas).

(80) Results and Discussion

(81) To facilitate secretion via OmpT cleavage, we inserted an artificial OmpT cleavage site (Ala-Arg-Arg-Ala) into the MATE autotransporter in between the passenger and the linker. Because the EhaA autotransporter region has never before been used for surface display of a recombinant passenger, we were unsure whether OmpT would facilitate cleavage, and we were also unsure if the autotransporter domain would facilitate self-proteolysis as seen for autotransporters in the SPATE family.

(82) To test if this artificial OmpT cleavage site could allow protein secretion, we transferred the plasmid pMATE-MT006 into OmpT positive strain UT2300 and looked for the presence of GFP in the growth media. Western blotting clearly showed the presence of GFP in the growth media of E. coli UT2300 pMATE-MT006 (FIG. 3). In contrast, we did not detect any GFP in the growth media after expression in the OmpT deficient derivate strain E. coli UT5600. The GFP visualised by Western blotting was visible as a single band with an apparent molecular weight of 30 kDa. The size of the GFP fragment detected by Western blotting strongly suggests that OmpT indeed cleaved at the artificial Ala-Arg-Arg-Ala site within the fusion protein. We did not see this band after SDS-PAGE followed by Coomassie staining, suggesting the amount of secreted protein was low. Nevertheless, we confirmed the ability to secrete proteins using this system, which should allow purification of the 6His containing passengers, followed by cleavage of the 6His region with Factor Xa.

(83) When testing a new autotransporter system, it is important to determine if the surface displayed passengers are naturally released into the media by self-proteolysis. Self-proteolysis would reduce the amount of protein at the surface, and therefore reduce efficiency in biocatalysis or screening. In the MATE system we found no evidence that the passengers are released into the growth media by self-proteolysis. After surface expression in an OmpT negative strain (E. coli UT5600), GFP could be detected clearly in the outer membrane (see FIG. 2) but not in the growth media (FIG. 3). This reaffirms the efficiency of the MATE system for surface display in OmpT negative strains of E. coli. Since we did not detect any alternative OmpT fragments, it might be possible that the EhaA autotransporter linker does not contain any natural OmpT cleavage sites. This might allow the efficient surface expression using the MATE system in OmpT positive strains of E. coli.

(84) Overall, our experiments show the feasibility of OmpT mediated secretion of recombinant passengers using the MATE system. OmpT did not cleave the passenger protein GFP, despite the presence of a typical OmpT recognition site within the primary sequence. We show for the first time that an artificial OmpT cleavage site can be used for the release of surface displayed passengers. In comparison to SPATE-like autoproteolytic cleavage, release by OmpT has the advantage that the same plasmid can be used for both surface display and secretion by simply varying the expression strain. This might have advantages in high-throughput approaches for protein expression and screening.

EXAMPLE 4

(85) Secretion and Purification of Functional mCherry Protein using the MATE System in E. coli

(86) Introduction

(87) In this example, we show that mCherry is secreted into the growth media after expression in OmpT positive strains using the MATE system. The outer membrane protein T (OmpT) of E. coli is a surface membrane serine protease and is the prototypical member of the omptin family of gram-negative bacteria (Mangel, Toledo et al. 1994). Recombinant passengers have previously been shown to be secreted into the media, after surface display using autotransporters in OmpT containing E. coli strains. In all previous cases, an OmpT cleavage site was found within the autotransporter linker region. In our case it was unknown whether OmpT would facilitate cleavage, as the autotransporter within the MATE system (EhaA) has not been previously tested for the recombinant expression of passenger proteins. For this reason, we inserted an artificial OmpT cleavage site (Ala-Arg-Arg-Ala) to the Cterminal region of the recombinant passenger. Sevastsyanovich et al. already described the secretion of red fluorescent protein (RFP) mCherry by utilization of a serine protease autotransporter of the Enterobacteriaceae (SPATEs, Sevastsyanovich et al. 2012). In comparison to the cleavage procedure of the passenger domain of SPATES, the passenger of the MATE system is released by the endogenous protease OmpT by recognition of the artificial OmpT cleavage site within the plasmid.

(88) Materials and Methods

(89) Construction of pMATE-SI015

(90) A ligation independent cloning was used for construction of pMATE-SI015

(91) (In-Fusion Eco-Dry Kit, Clontech). The nucleotide sequence of pMATE-SI015 is described by SEQ ID NO:13 (FIG. 24). The autotransporter fusion protein encoded by pMATE-SI015 is described by SEQ ID NO:14. Therefore the pMATE-MT004 plasmid backbone was amplified with PCR using the primers S1020 (GCTCGTCGTGCTATTGAGGGCCGCATCCC) and PQ019

(92) (ATGATGGTGATGGTGGTGGGTGATGTTCTG). The gene encoding mCherry was amplified using the primers SI021 (AATAGCACGACGAGCcttgtacagctcgtccatgccgccggtgg) and PQ024 (CACCATCACCATCATATGGTGAGCAAGGGCGAGGAGGATAACATG), which contained a 15 by overlap to the PCR product of the pMATE-MT004 plasmid backbone, as required for InFusion cloning. The two PCR Products were joined to form the plasmid pMATE-SI015 using standard In-Fusion techniques (Eco-Dry kit, Clontech) and transformed into E. coli Stellar chemically competent cells.

(93) Bacterial Strains and Purification of mCherry

(94) pMATE-SI015 was transformed into E. coli UT5600 and its OmpT positive parent strain E. coli UT2300 (Grodberg and Dunn, 1988).

(95) 800 ml of LB medium was inoculated with 8 ml of an overnight culture, and grown until OD.sub.600 0.5 at 37 C., 200 rpm. 1 mM of IPTG was added, and the cells were incubated for 24 hours. Cells were then removed by centrifugation (10,000 g, 20 min, 4 C.).

(96) Proteins secreted into the LB media were purified via the 6His epitope present in the secreted heterologous mCherry passenger. Therefore the obtained supernatant was loaded on a Ni-NTA column, which was before equilibrated with 10 column volumes of binding buffer containing 20 mM sodium phosphate, 0.5 M sodium chloride and 20 mM imidazole (pH 7.0). The column was washed once with 10 column volumes binding buffer and with 30 ml washing buffer, containing 20 mM sodium phosphate, 0.5 M sodium chloride and 100 mM imidazole (pH 7.0). Elution of the protein was carried out by addition of three times 2 ml Elution buffer containing 20 mM sodium phosphate, 0.5 M sodium chloride and 500 mM imidazole (pH 7.0). The eluted protein fractions were concentrated in microcon centrifugal filter devices with a cut-off size of 10 kDA (Merck Millipore). All steps were carried out at 4 C.

(97) The concentrated protein was resuspended in 40 l of 100 mM sodium phosphate buffer pH 7.0 plus 40 l of 2SDS sample buffer containing 200 mM of dithiothreitol (DTT). Protein samples were heated at 96 C. for 10 min.

(98) Equal amounts of protein samples were analysed by 10% SDS-PAGE and visualised by Coomassie stain.

(99) Results and Discussion

(100) The outer membrane protein T (OmpT) of E. coli is a surface membrane serine protease and is the prototypical member of the omptin family of gram-negative bacteria (Mangel, Toledo et al. 1994).

(101) As described for the secretion of GFP using the MATE system in example 3a), we also tested the artificial OmpT cleavage site for the secretion of monomeric red flourescent protein (RFP) mCherry. Therefore we transferred the plasmid pMATE-SI015 into OmpT positive strain E. coli UT2300 and looked for the presence of mCherry in the growth media.

(102) Supernatants from cultures of both E. coli UT2300 and E. coli UT5600 showed no visible difference. We then attempted to purify mCherry from the supernatant using a Ni-NTA column. After applying the supernatant to the Ni-NTA column and elution with 500 mM imidazole the sample of OmpT-positive strain E. coli UT2300 was indeed pink. In constrast, repeating this procedure with the supernatant from OmpT-negative cells resulted in an eluate which was clear. This suggests that mCherry was indeed displayed at the surface and then released by the OmpT protease in the OmpT (FIG. 4).

(103) The putative mCherry visualised by SDS-PAGE and subsequent Coomassie staining was visible as a single band with an apparent molecular weight of 30 kDa. In contrast, after expression and purification of the 6His proteins from the OmpT negative derivate strain E. coli UT5600 we did not detect any RFP in the growth media, suggesting by the absence of a band at the same molecular weight as it is the case for the OmpT positive strain (FIG. 5).

(104) The presence of a band with an apparent molecular weight of 100 kDa for both, the OmpT positive and OmpT negative strain protein samples, suggests the co-purification of the full autotransporter fusion protein either after cell lysis or by occurrence of vesicles containing the autotransporter fusion protein (FIG. 5).

(105) The size of the band from the eluate from E. coli UT2300 detected by SDS-PAGE with subsequent Coomassie stain strongly suggests that OmpT indeed cleaved at the artificial Ala-Arg-Arg-Ala site within the fusion protein and released the putative mCherry passenger. Overall, our experiments show the feasibility of OmpT mediated secretion of recombinant passengers using the MATE system. As it is described in Example 3a) for the GFP passenger, we did not detect any undesired cleavage of the mCherry passenger by OmpT. This example gives a further proof that the artificial OmpT cleavage site can be used for the release of surface displayed passengers. The OmpT mediated release has the advantage that the same plasmid can be used for both surface display and secretion. This allows greater flexibility than self-proteolysis, where it would be necessary to construct a second plasmid for surface display in which the residues necessary for self-proteolysis are removed.

EXAMPLE 5

(106) Release of Recombinant Passenger using Factor Xa, after Surface Display using the MATE System

(107) In this example, the MATE system is shown to enable the release of a fulllength protein using the specific protease Factor Xa.

(108) We showed earlier that the MATE system could be used for the constitutive secretion of a recombinant passenger in OmpT positive strains (Example 3). The secretome of E. coli is known to be relatively simple, reducing the costs associated with purification in comparison to intracellularly expressed proteins. However protein purification is still required to separate the recombinant protein of interest from other secreted proteins. For high-throughput screening, it would be beneficial to obtain small amounts of the protein of interest at higher purity. This could be achieved by first displaying the protein of interest on the cell surface, washing the cells in buffer, and then releasing the protein of interest into the buffer by the activity of a specific protease. The protein of interest can then be immediately assayed for functional activity. Optimally, the protease used to release the passenger is highly specific. In this example, we show that the protease Factor Xa can successfully release passengers displayed on the cell surface with the MATE system.

(109) E. coli UT5600 cells containing pMATE-MT006 were grown in an overnight culture in LB medium. 20 ml of LB medium was inoculated with 0.5 ml of overnight culture, and grown at 37 C., 200 rpm to OD.sub.600 of 0.5. Protein expression was induced by the addition of 1 mM IPTG, and the cells were harvested after 1.5 hour. Cells were washed in buffer consisting of 100 mM Tris/Cl pH 8, 50 mM NaCl, 1 mM CaCl.sub.2, and incubated for 16 h with 100 g.Math.ml.sup.1 of bovine Factor Xa protease (#33233, QIAGEN). Cells were removed by centrifugation at 14 000 g, and proteins within the supernatant were concentrated by TCA precipitation (final TCA concentration of 8%). Concentrated proteins from the supernatant were separated by 12.5% SDS-PAGE. Western blots were performed with polyclonal rabbit anti-GFP and horseradish peroxidase-coupled anti-rabbit IgG as described in Example 3.

(110) Soluble GFP (28 kDa) was detected in the supernatant after Factor Xa treatment of E. coli pMATE-MT006 (FIG. 6). No significant amounts of GFP were released without the addition of Factor Xa, suggesting that the MATE autotransporter does not undergo self-proteolysis as seen in SPATE autotransporters. The addition of the Factor Xa cleavage site after the passenger therefore allows the selective release of passengers from the cell surface.

(111) In combination with the 6His on the Nterminal region of the passenger, the selective release in the MATE system allows the rapid purification of proteins. As shown here, the cells can be washed before the release of the passenger into a buffer. This yields a purer form of the protein in comparison to a constitutive secretion system such as auto-proteolysis, where the passenger is released into the growth media and must be separated from other secreted proteins.

(112) The Factor Xa mediated release also allows a more rapid protease-accessibility assay in the MATE system. Usually a nonspecific protease such as trypsin or proteinase K is used, whereby the incubation time must be optimised for each system. Proteins transported to the surface with Autodisplay have also been released with purified Iga1 protease (Klauser 1992), however this enzyme is not commercially available and the mode of action is not extensively researched. Only recently has this been attempted with a commercially available, highly specific protease (Nla-TEV, Ko et al. 2012). Here, we show the detection of the passenger in the supernatant after incubation of the cells with Factor Xa, a rapid and simple method of proving surface display, without the need for antibodies or extensive optimisation of protease digestion. When optimised, it may be also possible to detect the decrease in cell-associated passenger after Factor Xa treatment. This technique allows rapid and simple protein purification, and may be compatible with highthroughput screening approaches for protein improvement or inhibitor detection.

EXAMPLE 6

(113) Functional Display of B. gladioli EstA Esterase on the Surface of E. coli with the MATE System

(114) In this example the EstA catalytic domain was functionally expressed on the surface of E. coli using the new MATE system.

(115) Plasmid Construction

(116) The plasmid pMATE-SI005 (FIG. 20, SEQ ID NO:7) was designed for the surface expression of proteins using the MATE system in a broad range of Gram negative bacteria. To create the plasmid, PCR products from three plasmids were combined using ligation independent cloning methods (In-Fusion, Clontech, USA). These fragments included the MATE autotransporter from pMATE-MT004, the rep and kanamycin resistance genes (aph) from pBBR1MCS-2 (Kovach et al. 1995), and two fragments from pBAD/gIII. The first fragment from pBAD/gIII contained the araBAD promoter and araC gene. The second fragment from pBAD/glIl contained the rrnB transcription terminator.

(117) The fusion protein encoded by pMATE-SI005 (SEQ ID NO:8) included a CtxB signal peptide, a small peptide passenger (6His), a multiple cloning site, OmpT and Factor Xa cleavage sites and a PEYFK epitope. The Cterminus contains the EhaA autotransporter linker and n-barrel.

(118) For the surface display of a functional esterase, the coding region of the catalytic domain of estA from Burkholderia gladioli was excised from pES01 (Schultheiss et al. 2002) via Xhol and Kpnl and subsequently inserted in pMATE-SI005 to create pMATE-SI010 (FIG. 7, and see plasmid map in FIG. 22).

(119) We conducted activity tests to determine if EstA catalytic domain was expressed in a functional form. For this purpose cells of E. coli UT5600 pMATE-SI010 and E. coli BL21(DE3) pES01 were cultivated at 30 C. E. coli UT5600 without any plasmid served as a control. E. coli UT5600 cells were induced with 0.5% (w/v) L-arabinose for 2 hours. Cells of E. coli BL21 (DE3) pES01 were also cultivated for 2 hours. Since pES01 plasmid encodes a promoter facilitating a constitutive gene expression there was no need for any induction. Photometric activity assays were performed with pnitrophenyl acetate as a model esterase substrate. To obtain standard conditions OD.sub.600 was adjusted to 0.2 for every measurement. In comparison to pES01 the MATE system gives vastly improved activity of surface-displayed esterase (FIG. 8).

EXAMPLE 7

(120) Functional Surface Display of EstA Catalytic Domain in Salmonella enterica using the MATE System

(121) In this example the MATE system was used for expression of the estA catalytic domain in a second non E. coli strain, namely S. enterica serovar Typhimurium. Autotransporter-mediated surface display has been previously conducted in Salmonella strains (van Gerven et al. 2009), which are genetically closely related to E. coli. However this provides the first confirmation that the vector is compatible in non E. coli strains.

(122) The broad host range plasmid pMATE-SI010 (FIG. 22, SEQ ID NO:9), encoding the new autotransporter EhaA and the catalytic domain of EstA (SEQ ID NO:10) was transferred to cells of S. enterica. Protein expression was induced with 0.5% (w/v) L-arabinose for two hours at 30 C., 200 rpm. To find out whether the EstA catalytic domain of the fusion protein was indeed exposed at the cell surface, proteinase K was added the whole cells.

(123) Proteinase K is too large to enter the cell envelope of S. enterica. This means, if the EstA catalytic domain is degraded by proteinase K, it must be accessible at the cell surface.

(124) Activity assays with pnitrophenyl acetate as a substrate were performed with either proteinase K treated or untreated whole cells containing S. enterica pMATE-SI010. Protein expression was induced for 2 h with 0.5% L-arabinose at 30 C. The final OD.sub.600 in the assay was adjusted to 0.2. We used S. enterica, without any plasmid as a negative control. Cells of S. enterica pMATE-SI010 exhibited similar activity in comparison to E. coli cells harbouring pMATE-SI010 plasmid (FIG. 9).

(125) The decrease in esterase activity at the surface after proteinase K treatment confirms that the estA catalytic domain was exposed to the surface. This confirmed that the MATE system functions not only in E. coli, but also in a closely related non E. coli species. The use of the MATE system in S. enterica may help in the development of vaccines. To our knowledge, this is the first time that surface display of a recombinant protein with an autotransporter has been successfully achieved in a Salmonella species.

EXAMPLE 8

(126) Functional Surface Display of EstA Catalytic Domain in Pseudomonas putida KT2440 with the MATE System

(127) In this example the MATE system was used for the functional expression of and enzyme in a Gram negative species more distantly related to E. coli.

(128) Functional surface display of estA in E. coli was carried out as described in Example 4. The broad host range plasmid pMATE-SI010, encoding the catalytic domain of the esterase EstA, was transferred to cells of P. putida KT2440 using standard chemical transformation techniques.

(129) Functional activity was first tested using continuous esterase microplate assays. Esterase activity in P. putida cells containing pMATE-SI010 was significantly higher than cells containing the control plasmid, pMATE-SI005 (FIG. 10). When adjusted to an equal OD600, activity was higher in E. coli than in P. putida.

(130) To confirm that this functional activity was at the cell surface, the esterase microplate assays were conducted with whole cells after incubation with proteinase K. Proteinase K is too large to cross the outer membrane. The loss of activity in whole cells after addition of proteinase K givesstrong evidence that the esterase is located at the cell surface. Using pnitrophenyl acetate as a substrate, activity assays were performed with either proteinase K treated or untreated whole cells of P. putida pMATE-SI010.

(131) P. putida cells expressing an esterase at the surface using the MATE system completely lost their esterase activity after treatment with proteinase K (FIG. 11). In comparison, approximately half of the esterase activity was lost in E. coli cells under the same conditions. This implies that the EstA esterase had a better accessibility to the protease in P. putida than in E. coli.

(132) We conducted flow cytometry analysis to confirm that the fusion protein containing the EstA fragment was exposed at the surface. The results are described in FIG. 12. P. putida KT2440 cells were grown in LB medium to an early exponential growth phase (OD.sub.600 of 0.5). After cell harvest and resuspension in phosphate buffered saline (PBS), expression of EstA was induced for 18 hours by adding Larabinose to a final concentration of 0.5%. Cells were then incubated for 18 hours at 30 C., 200 rpm. Cells were harvested by centrifugation, washed twice with PBS and resuspended to a final OD.sub.600 of 0.4. 1 ml of the cell suspension was centrifuged (90 s at 13.400 g), resuspended in 100 L of a solution that contained a monoclonal mouse anti-6His antibody (20 g.Math.ml.sup.1 in PBS, Thermo Scientific) and incubated for 60 min at 22 C. Cells were then washed twice with 500 L of PBS. The second incubation step was conducted in the dark (60 min, 22 C.) using 100 L of a rabbit antimouse IgG antibody conjugated with fluorescein (20 g.Math.ml.sup.1 in PBS). After washing twice in PBS, the cell pellet was resuspended in 1 ml of PBS for analysis. Samples were then analysed using a BD FacsAria III Cell Sorter (BD Biosciences, Heidelberg, Germany) at an excitation wavelength of 488 nm.

(133) The fully processed, surface-displayed EstA fusion protein was predicted to have an N-terminus consisting of a 6His affinity tag, the EstA fragment and MATE autotransporter domain. Using an antibody against the 6His epitope, approximately 50% of the cells were found in a population with high fluorescence and could be judged to contain the fusion protein at the surface. To determine whether non-stained cells represented incomplete surface expression, or simply sub-optimal antibody binding, we conducted further analyses of cellular and outer membrane proteins.

(134) As with many other esterases, EstA can be refolded after SDS-PAGE and functional activity measured using an ingel activity stain (Schultheiss et al. 2002). Briefly, proteins were heated for 30 min in loading buffer that contained DTT, and separated by 10% SDS-PAGE as per standard techniques (Laemmli 1970). The gels were then incubated in buffer containing 2.5% Triton-X100 until the esterase had refolded into an active form. The gels were then stained for esterase activity using 1naphthyl acetate as a substrate and Fast Blue RR as a conjugate dye.

(135) In the analysis of whole cells expressing EstA at the surface, SDS-PAGE followed by esterase staining revealed a band at approximately 105 kDa in both E. coli and P. putida (FIG. 13B). The expected size of the fusion protein after cleavage of the signal peptide was 91.2 kDa. As expected, this band was not visible after Coomassie staining, as it comprised only a small proportion of total cellular protein. A single esterase band was visible in P. putida, however esterase activity at the apparent molecular weight of 38 kDa and 60 kDa were also visible in E. coli.

(136) A further SDS-PAGE analysis was conducted to confirm the surface exposure of the EstA esterase in P. putida, when expressed using the MATE system. To find out whether the EstA catalytic domain of the fusion protein was indeed exposed at the cell surface, proteinase K was added the whole cells containing pMATE-SI010 after protein induction with 0.5% (w/v) L-arabinose for two hours at 30 C. Proteinase K is too large of a molecule to enter the cell envelope of E. coli, the decrease in bands associated with the fusion protein after Coomassie or esterase staining indicates the surface exposure of the esterase. SDS-PAGE with Coomassie stain allows a further control: OmpA has a Nterminal extension in the periplasm that is proteinase K sensitive, therefore the detection of intact OmpA indicates that the protease has not entered the periplasm due to cell leakiness.

(137) After isolation of membrane proteins from P. putida, the EstAautotransporter fusion protein was visible after SDS-PAGE with both Coomassie and esterase staining (FIG. 14). As we showed previously for the GFP fusion protein, the apparent molecular weight (MW) of the EstA-autotransporter fusion protein after SDS-PAGE (105 kDa) was higher than the molecular weight predicted from the primary sequence after accounting for signal peptide cleavage (91.2 kDa). It is not unusual for barrel proteins to show an altered apparent molecular weight after SDS-PAGE, as they remain partially folded and in some cases catalytically active in conditions that are strongly denaturing for other proteins. There was no difference in the apparent MW between the fusion protein expressed in E. coli and P. putida.

(138) Confirming the results from microplate assays (FIG. 11), proteinase K treatment of P. putida cells expressing EstA at the surface completely removed all esterase activity, as judged by the disappearance of the esterase band after SDS-PAGE (FIG. 14). In contrast, protease treatment gave only a partial decrease in the intensity of the esterase band from E. coli. This strongly supports the results from microplate assays (FIG. 11), where only a proportion of the E. coli esterase activity was susceptible to external protease treatment (FIG. 11). Overall, this strongly suggests that a proportion of the esterase molecules in E. coli were intracellular, and therefore inaccessible to the protease. This hypothesis is supported by the undesired 38 kDa and 60 kDa esterase fragments seen in the analysis of E. coli whole cells. These fragments cannot be located at the cell surface, because they are not visible in the analysis of outer membrane proteins (FIG. 14).

(139) In comparison to E. coli, the vast majority of esterase activity in P. putida pMATE-SI010 was protease accessible. This could suggest that P. putida has unexpected advantages for use with surface display. Another surprising benefit within P. putida was the absence of of the undesired intracellular fragments, which may indicate a small amount of the fusion protein is improperly folded in E. coli. These factors suggest that P. putida is highly suitable to screening of surface displayed enzymes or fluorescent molecules where intracellular activity is detrimental.

(140) When we directly compared the surface-exposed (i.e. protease accessible) esterase activity of E. coli and P. putida, the overall activity in E. coli was higher (FIG. 15). Nevertheless, P. putida clearly showed some advantages over E. coli for surface displaynot only is the strain chemical resistant and compatible with industrial processes, but a higher proportion of the passenger was found at the surface. This highlights the advantage of the MATE system, whereby the surface display of recombinant proteins can be rapidly tested in a broad range of bacterial hosts.

EXAMPLE 9

(141) Functional Surface Display of B. gladioli Esterase EstA Catalytic Domain in Zymomonas mobilis with the MATE System

(142) Introduction

(143) Zymomonas mobilis is of big interest for the commercial production of biomass-derived ethanol as it produces ethanol with high yields and has a higher growth rate than the presently used Sacharomyces cerevisiae. The exposure of recombinant proteins on the surface of Z. mobilis offers considerable advantages in the industrial application of this organism. For instance, the surface display of cellulose degrading enzymes (cellulases) on Z. mobilis cells can provide a whole-cell catalytic system which is able to breakdown cellulose and ferment the formed monomeric sugars to ethanol in a single step. As cellulose cannot penetrate the cell membrane, elaborate and expensive enzyme purification steps become necessary when the cellulases are expressed intracellularly. Surface exposed cellulases could circumvent these difficulties as they have direct access to their substrates and do not have to be extracted from the cells prior to their use. A further benefit of a whole-cell catalyst is given by its reusability, since bacterial cells can easily be separated from a reaction mixture by centrifugation.

(144) To our knowledge no surface display system for Z. mobilis has been established so far. This example presents the functional expression of B. gladioli esterase EstA catalytic domain on the surface of Z. mobilis using the new MATE system.

(145) Materials and Methods

(146) Construction of Plasmid pMATE-SI012 and Transfer to Z. mobilis

(147) For the construction of pMATE-SI012 (FIG. 23, SEQ ID NO:11) genes encoding the estA catalytic domain were excised from plasmid pMATE-SI010 via Xhol/Kpnl restriction endonucleases and ligated into plasmid pMATE-SI009 (FIG. 21). This plasmid contains a mob gene which is necessary for plasmid replication in Z. mobilis. pMATE-SI012 was transferred to cells of Z. mobilis ATCC 29191 using a standard electroporation procedure. The fusion protein is described in SEQ ID NO:12).

(148) Cultivation of Z. mobilis and Induction of Protein Expression

(149) 200 mL of ZM Medium (10 g/L bacto peptone, 10 g/L yeast extract, 20 g/L glucose; Roth, Germany, when needed kanamycine 150 mg/mL; Sigma Aldrich, USA) were inoculated with an overnight-culture of Z. mobilis (1:1000 dilution) and incubated at 30 C., 60 rpm until the cultures reached an OD578 of 0.6. Induction of protein expression was performed by incubation with 0.2% (w/v) L-arabinose (Roth, Germany) in ZM Medium for two hours at 30 C., 60 rpm.

(150) Trypsin Digestion

(151) Z. mobilis cells were harvested by centrifugation and resuspended in 0.2 mol/L Tris-HCl pH 8.0. Porcine pancreatic trypsin was added to a final concentration of 2.5% and incubated for one hour at 37 C., 200 rpm. Digestion was stopped by washing three times with 10% fetal calf serum (FCS) in 0.2 mol/L Tris-HCl pH 8.0.

(152) Outer Membrane Protein Isolation

(153) Outer membrane protein isolation was carried out according to a modified protocol of Hantke (Hantke 1981, Jose and von Schwichow, 2004).

(154) Protein Separation

(155) Proteins were heated for 40 min at 95 C. in two-fold sample buffer (100 mM Tris-HCl, pH 6.8 containing 4% sodium dodecyl sulfate, 0.2% bromophenole blue, 20% glycerol and 30 mg dithiothreitol) and separated by means of sodium-dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) in a 10% resolving gel (Laemmli 1970). Proteins were then stained either with Coomassie Brilliant Blue or esterase activity stain (see below). Pictures were taken using an Intas Gel iX Imager (Intas, Germany).

(156) Western Blot

(157) Standard blotting techniques were used to transfer proteins from polyacrylamide-gels to nitrocellulose membranes (Mini-trans blot, Bio-Rad, USA). The membranes were blocked with 3% bovine serum albumine (BSA) in phosphate-buffered saline (PBS, pH 7.4) and incubated with mouse anti-6His mAb IgG1 (Dianova, Germany) in PBS (1:1000 dilution). Subsequently the membranes were washed three times with PBS and incubated with horseradish peroxidase-conjugated anti-mouse IgG (Antibodies-online, USA) in PBS (1:5000 dilution). The membranes were then washed twice with PBS and treated with Pierce enhanced chemiluminescent (ECL) western blotting substrate (Thermo Scientific, USA). Pictures were taken using an Intas ChemoCam Imager (Intas, Germany).

(158) Esterase Activity Staining

(159) Esterase activity staining was carried out using a modified protocol of Schultheiss et al. (Schultheiss 2002). For the renaturation of the esterase SDS was removed by incubation of the polyacrylamide gels in 10 mmol/L Tris-HCl, pH 7.5 containing 2.5% Triton-X100 (AppliChem, Germany) for three hours. The gels were then stained for esterase activity with 10 mmol/L

(160) Tris-HCl, pH 7.5 containing 0.1% (w/v) FastBlueRR (Sigma Aldrich, USA) and 2% (v/v) -naphtyl-acetate-solution (1% w/v in 50% v/v acetone; Sigma Aldrich, USA).

(161) Results

(162) SDS-PAGE Coomassie Staining

(163) Outer membrane proteins of Z. mobilis cells without plasmid pMATE-SI012, cells with plasmid and cells with plasmid and aforegoing trypsin treatment were isolated and separated by SDS-PAGE. Coomassie staining of proteins isolated from cells with plasmid did not show any additional bands assignable to the EstA-autotransporter fusion protein. This is attributed to the small proportion of fusion protein in relation to the total outer membrane protein amount. Coomassie staining of proteins isolated from cells that were treated with trypsin prior to the outer membrane protein isolation revealed the disappearing of most protein bands except of four bands, which are visible at apparent molecular weights of <25 kDa (a), 25-35 kDa (b) and 35-40 kDa (c and d) (see FIG. 16A). The proteins within these bands seem to be resistant to Trypsin degradation. We excised the bands from the gel and analysed them by LC-MS/MS in order to identify the proteins within each band. 15 to 17 different Z. mobilis proteins were identified in each band. It is not possible to obtain quantitative information, however, OmpA/MotB domain containing proteins (Uniprot accession number: I6YFM2) could be shown to be present in bands b, c and d. Both OmpA and MotB are known to be integral membrane components. As Trypsin is too large to penetrate the outer membrane and therefore digests only proteins that are located on the cell surface, this is good evidence that the outer membrane remained undamaged by trypsin treatment and that only exterior proteins were degraded.

(164) Western Blot

(165) Western Blot analysis of outer membrane protein isolates with anti-6His antibodies showed the presence of the EstA-autotransporter fusion protein at an apparent molecular weight of about 105 kDa, which is slightly higher than expected from the primary sequence (91.2 kDa). This is not unusual for beta-barrel containing proteins as they are not completely denatured under normal SDS-PAGE conditions. Neither in the outer membrane protein isolates of Z. mobilis cells without plasmid nor in the protein isolates of cells with plasmid but without L-arabinose induction a band was visible. Protein isolates of cells which were treated with trypsin prior to protein isolation also did not show any band. The absence of the fusion protein in the outer membrane proteins of trypsin-digested cells confirms the actual exposure of the esterase on the surface of the Z. mobilis cells (see FIG. 16B).

(166) Esterase Activity Stain

(167) In-gel esterase activity staining revealed an activity band at about 105 kDa in outer membrane proteins of arabinose treated Z. mobilis cells with plasmid. This is consistent with the presented Western Blot results, which identified this band as the EstA-autotransporter fusion protein. Besides this band, three other esterase activity bands between 55 and 100 kDa were visible in the same protein isolate. It is believed that these activity bands are unspecific degradation products. Esterase activity bands could neither be detected in protein isolates of cells without plasmid nor in protein isolates of cells with plasmid but without arabinose induction. Outer membrane proteins of cells that were trypsin digested also showed no esterase activity at all (see FIG. 17). This strongly supports the assumption that EstA is functionally active on the surface of Z. mobilis cells

(168) Conclusion

(169) Besides the successful establishment of the MATE system in P. putida and S. enterica, these experiments confirm the proper functionining of the MATE system in a third Zymomonas mobilis, a natural ethanol producer.

EXAMPLE 10

(170) Surface Display of an Active Endoglucanase Obtained from Bacillus subtilis on the Ethanologenic Bacteria Zymobacter palmae and Zymomonas mobilis using Maximized Autotransporter Expression (MATE) System

(171) Introduction

(172) The biocatalytic conversion of cellulose to ethanol as a doorway to alternative fuel production is to date limited by the absence of a catalytic system applicable to economic large scale processes. The biocatalyst of choice combines the ability to break down cellulose and simultaneously ferment the released sugars to ethanol. The high growth and ethanol production rates of the Gram-negative bacteria Zymobacter palmae and Zymomonas mobilis make them promising host organisms for such an approach. Since they cannot degrade cellulose naturally, it is necessary to add extracellular (i.e. secreted or cell-bound) endoglucanase, exoglucanase and beta-glucosidase functionalities to these organisms. In this example we describe the expression of a recombinant fusion protein consisting of an endoglucanase obtained from Bacillus subtilis and the maximized autotransporter expression (MATE) translocation unit in Z. palmae and Z. mobilis, resulting in the exposure of functional active endoglucanase on the cell surface of of both species.

(173) Construction of Plasmid pMATE-PT004

(174) The plasmid pMATE-PT004 was constructed based on the previously described pMATE-SI010 (SEQ ID NO:9). Plasmid pMATE-SI010 encodes a fusion protein consisting of an N-terminal CtxB signal peptide, Burkholderia gladioli esterase EstA catalytic domain and the C-terminal EhaA autotransporter domain. The expression of the fusion protein is controlled by an arabinose inducible promoter (araBAD). For detection and purification purposes, 6His and PEYFK-epitopes are incorporated N- and C-terminal of the esterase domain, respectively. The plasmid encodes a Kanamycin resistance gene for transformant selection (FIG. 22).

(175) The esterase EstA catalytic domain of pMATE-SI010 was removed by restriction enzyme digestion with Xhol and Kpnl, while the endoglucanase domain was obtained by an identical restriction enzyme digestion of pMATE-endoglucanase and inserted into pMATE-SI010 to generate pMATE-PT004. Furthermore, a mob gene was inserted into pMATE-PT004 using ligation independent cloning methods (In-Fusion Cloning Kit HD, Clontech, USA) to enable plasmid replication in Z. mobilis and Z. palmae (FIG. 26).

(176) Cultivation and Transformation of used Bacterial Strains

(177) Z. mobilis (DSM No. 3580) was cultured at 30 C., 80 rpm in culture medium containing 10 g/L bacto peptone, 10 g/L yeast extract and 20 g/L D-glucose. Z. palmae (DSM No. 10491) was cultured at 30 C., 200 rpm in growth medium containing 10 g/L yeast extract, 2 g/L potassium dihydrogen phosphate and 5 g/L sodium chloride, adjusted to pH=6.0. Insertion of plasmids was conducted according to standard electroporation procedure, electroporated cells were regenerated in culture medium for 6 h (Z. mobilis) and 2 h (Z. palmae), before transferring them to Kanamycin selection plates.

(178) Sodiumdodecylsulfate Polyacrylamide Gel Electrophoresis (SDS PAGE)

(179) Overnight cultures of Z. mobilis/Z. palmae containing pMATE-PT004 were used to inoculate 100 ml of the respective culture medium (1:100 dilution), and were incubated until the cultures reached OD.sub.578 of 0.5. Protein expression was induced by the addition of 0.2% L-arabinose, and the cells harvested one hour after induction. Outer membrane proteins were prepared according to the rapid isolation protocol of Hantke (Hantke 1981) with modifications as described previously (Jose and von Schwichow, 2004).

(180) Proteins were separated with 12.5% sodium-dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Laemmli 1970). Proteins were stained with Coomassie Brilliant Blue R250.

(181) Fluorescence-Activated Cell Sorting (FACS)

(182) Cells were cultivated as described above and adjusted to an OD.sub.578 of 0.4. After washing three times with cold, particle-free PBS, cells were resuspended in PBS containing 1 antibody against 6His (THE HisTag, mouse, GenScript, USA) in a dilution of 1:500. After 30 min incubation at 4 C., cells were washed three times with PBS and incubated 30 min with 2 antibody (goat anti-mouse IgG (H+L), Dylight 633 conjugated, Thermo Scientific Pierce Antibodies, Germany) at room temperature in the dark. Cells were washed again three times and cell fluorescence measured by FACS Aria III flow cytometer (BD Biosciences, USA) using a red laser for excitation at 633 nm and a 660/20 bandpass filter for detection.

(183) Whole Cell CMC Hydrolysis Activity Assay

(184) For the whole cell endoglucanase activity assay cells were cultivated as described above and adjusted to an OD of 25. Cells were incubated 10 min with 1% Carboxymethylcellulose (CMC) in sodium-citrate buffer, pH 6 at temperatures between 30 C. and 80 C. After cell removal, released reducing sugars were determined photometrically (absorption at 540 nm) using a modified 3,5-dinitrosalicylic (DNS) assay protocol of King et al. (2008). The absorption values of blank samples (buffer and substrate) were subtracted from the measured absorption values of the cell samples.

(185) Expression of Fusion Protein

(186) To confirm the expression of the endoglucanase fusion protein, outer membrane proteins of Z. palmae were isolated and separated by SDS-PAGE (FIG. 27). While in the outer membrane isolates of Z. palmae wildtype (lane 2) and non-induced Z. palmae pMATE-PT004 (lane 3) no band between 100 kDa and 130 kDa is visible, a strong band can be seen in the outer membrane isolate of induced Z. palmae pMATE-PT004 (lane 4) between 100 kDa and 130 kDa, which is consistent with the expected molecular weight of the endoglucanase fusion protein. To further check the localization of the protein on the cell surface, induced Z. palmae pMATE-PT004 cells were treated with trypsin prior to the outer membrane isolation (lane 5). Since trypsin is too large to penetrate the outer cell membrane, it can exclusively degrade surface-exposed proteins. The disappearance of the band assigned to the fusion protein in lane 5 suggests that the expressed protein is accessible to trypsin and therefore located on the cell surface.

(187) Whole Cell CMC Hydrolysis Activity Assay

(188) Z. palmae wildtype cells, Z. palmae cells with pMATE-esterase (negative controls) and cells with pMATE-PT004 were analysed in terms of their CMC hydrolysis activity. Induced Z. palmae cells containing the pMATE-PT004 plasmid show high CMC hydrolysis activity compared to negative controls.

(189) CMC hydrolysis activity could be observed within a temperature range of 30 C. to 80 C. Non-induced cells with pMATE-PT004 show slightly higher activity than the negative controls, explained by the known effect of low basal protein expression level when using an arabinose promoter (FIG. 28).

(190) Whole cell CMC hydrolysis activity assay was also performed with Z. mobilis wildtype and Z. mobilis pMATE-PT004 cells. Z. mobilis pMATE-PT004 cells showed high activity in a temperature range of 30 C. to 80 C. compared to Z. mobilis wild type cells (FIG. 29). Although an expression of the protein could not be confirmed by SDS-PAGE, the determined activity proves the existence of the enzyme on the cell surface.

(191) Since CMC is a large polymer which is not able to pass the cell wall, neither by diffusion nor by active transport, the observed hydrolysis of CMC represents strong evidence for the localisation of the enzyme on the cell surface.

(192) FACS

(193) FACS-histogram of Z. palmae pMATE-PT004 cells expressing the endoglucanase fusion protein (FIG. 31) shows a total increase of cell fluorescence compared to Z. palmae wildtype cells (FIG. 30). As antibodies cannot penetrate the cell membrane and thus only bind to surface exposed epitopes, this experiment gives strong evidence that the endoglucanase is located on the surface of Z. palmae cells expressing the endoglucanase fusion protein. This supports the results of the described SDS-PAGE and activity assays.

(194) Conclusion

(195) We could successfully apply the MATE system to express a surface-displayed, active endoglucanase in the ethanologenic bacteria Zymomonas mobilis and Zymobacter palmae. This example illustrates the broad applicability of our invention to bacterial strains with prospective industrial use, in particular in combination with cellulose-degrading enzymes and ethanol-producing bacteria, forming a whole-cell biocatalyst for the production of second generation biofuels.

EXAMPLE 11

(196) Functional Display of Bacterial Cellulases on the Surface of Pseudomonas putida with the pMATE System

(197) In this example an endoglucanase obtained from Bacillus subtilis, an exoglucanase obtained from Clostridium thermocellum and a 3-glucosidase obtained from Clostridium thermocellum were functionally expressed on the surface of P. putida using the new pMATE system. Plasmids used for transformation of P. putida are described in FIGS. 38, 39 and 40.

(198) SEQ ID NO:20 describes the nucleotide sequence of the autotransporter fusion gene encoded by pMATE-exoglucanase, for the surface display of an exoglucanase using the pMATE system.

(199) SEQ ID NO:21 describes the polypeptide sequence of the autotransporter fusion protein encoded by pMATE-exoglucanase, for the surface display of an exoglucanase using the pMATE system.

(200) SEQ ID NO:22 describes the nucleotide sequence of the autotransporter fusion gene encoded by pMATE-endoglucanase, for the surface display of an endoglucanase using the pMATE system.

(201) SEQ ID NO:23 describes the polypeptide sequence of the autotransporter fusion protein encoded by pMATE-endoglucanase, for the surface display of an endoglucanase using the pMATE system.

(202) SEQ ID NO:24 describes the nucleotide sequence of the autotransporter fusion gene encoded by pMATE--glucosidase, for the surface display of a -glucosidase using the pMATE system.

(203) SEQ ID NO:25 describes the polypeptide sequence of the autotransporter fusion protein encoded by pMATE--glucosidase, for the surface display of a -glucosidase using the pMATE system.

(204) The expression was tested by isolation of the outer membrane proteins and following separation by 10% SDS-PAGE (FIG. 32). Proteins were visualized with Coomassie Brilliant Blue R250. For this purpose cells were cultivated at 30 C. in LB medium until they reached an OD.sub.578 of 0.5. Protein expression was induced with 0.2% (w/v) L-arabinose for 4 h at 30 C. P. putida without the pMATE-plasmid served as control. The exo- and endoglucanase fusion proteins were visible as a single band at the predicted size (ca. 147 kDa and 110 kDa, respectively after cleavage of the N-terminal signal peptide). As expected the fusion proteins were not visible from cells without induction of protein expression or control cells without plasmid. In case of the -glucosidase, a very weak expression of the fusion protein was detected at the predicted size (ca. 109 kDa).

(205) For activity assays cells were cultivated as described above. The exoglucanase activity was measured at pH 6 and 55 C. using 5 mM p-nitrophenyl-3-D-cellobioside as substrate. OD.sub.578 were adjusted to 0.5. After different incubation times cells were removed by centrifugation and the liberated p-nitrophenol in the supernatant was detected colorimetrically at 400 nm in order to determine the hydrolysis rate. In comparison to control cells, P. putida cells, expressing the exoglucanase, show continuous p-nitrophenol release within 4 min (FIG. 33).

(206) The endoglucanase activity was measured by determining reducing sugars released of enzyme reaction with 1% carboxymethylcellulose (CMC) at pH 6 and 55. OD.sub.578 were adjusted to 20. After cell removal reducing sugars were detected in the supernatant colorimetrically at 540 nm using the 3,5-dinitrosalicylic acid (DNS) assay, modified by King et al (2008). In comparison to control cells, endoglucanase expressing P. putida cells show CMC-hydrolysis (FIG. 34).

(207) The -glucosidase activity was measured at pH 6 and 55 C. using 5 mM p-nitrophenyl--D-glucopyranoside as substrate. OD.sub.578 were adjusted to 20.

(208) After different incubation times cells were removed by centrifugation and the liberated p-nitrophenol in the supernatant was detected colorimetrically at 400 nm in order to determine the hydrolysis rate. In comparison to control cells, P. putida cells, expressing the -glucosidase, show p-nitrophenol within 10 min (FIG. 35).

(209) These examples show that the pMATE system can be used for functional display of cellulases on the surface of P. putida.

(210) The most common total cellulase activity assay is the filter paper assay

(211) (FPA) using Whatman No 1 filter paper as the substrate, which was established and published by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose 1987). To measure total pMATE-cellulase activity, exoglucanase, endoglucanase and -glucosidase were mixed in equal parts. OD.sub.578 of total cells were adjusted to 50. The FPA was performed at pH 6 and 55 C., modified by Xiao et al (2004). Reducing sugars, released by degradation of filter paper were detected in the supernatant colorimetrically at 540 nm using the 3,5-dinitrosalicylic acid (DNS) assay, modified by King et al (2008). In comparison to control cells, the mix of cellulase expressing P. putida cells show filter paper hydrolysis. Using glucose as standard the amount of released sugar equivalents (RSE) from filter paper after 4 days is 0.2 mg/ml (FIG. 36).

(212) To determine the hydrolysis of a real lignocellulosic substrate by pMATE-cellulases, pretreated empty fruit punches (EFP) were used as substrate (2.5% dry weight). Exoglucanase, endoglucanase and -glucosidase expressing cells were mixed in equal parts. OD.sub.578 of total cells were adjusted to 20. The reaction was performed at pH 6 and 55 C. for 4 days. Reducing sugars (in particular glucose, cellubiose or/and cellulose-polysaccharide chains of variable length), released by EFB hydrolysis were detected in the supernatant colorimetrically at 540 nm using the 3,5-dinitrosalicylic acid (DNS) assay, modified by King et al (2008). In comparison to control cells, the mix of cellulase expressing P. putida cells show EFB degradation. Using glucose as standard the amount of released sugar equivalents (RSE) from from EFB after 4 days is 6.4 mg/ml (FIG. 37).

REFERENCES

(213) Grodberg J, Dunn J J (1988) ompT encodes the Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification. J Bacteriol 170:1245-1253 Ghose T K (1987) Measurement of cellulase activities. Pure Appl Chem 59: 257-68. Hantke K (1981) Regulation of ferric iron transport in Escherichia coli K12: Isolation of a constitutive mutant. Mol Gen Genet 182:288-292 Jong W S P, Ten Hagen-Jongman C M, Ruijter E, Orru R V A, Genevaux P, Luirink J (2010) YidC is involved in the biogenesis of the secreted autotransporter hemfoglobin protease. J Biol Chem 285:39682-39690 Jose J, Von Schwichow S (2004) Autodisplay of active sorbitol dehydrogenase (SDH) yields a whole cell biocatalyst for the synthesis of rare sugars. ChemBioChem 5:491-499 King B C et al (2009) An optimized microplate assay system for quantitative evaluation of plant cell wall-degrading enzyme activity of fungal culture extracts. Biotechnol Bioeng 102(4): 1033-1044. Klauser T, Pohlner J, Meyer T F (1990) Extracellular transport of cholera toxin B subunit using Neisseria IgA protease -domain: Conformation-dependent outer membrane translocation. EMBO J 9:1991-1999 Klauser T, Pohlner J, Meyer T F (1992) Selective extracellular release of cholera toxin B subunit by Escherichia coli: Dissection of Neisseria Iga()-mediated outer membrane transport. EMBO J 11:2327-2335 Ko H J et al. (2012) Functional cell surface display and controlled secretion of diverse Agarolytic enzymes by Escherichia coli with a novel ligation-independent cloning vector based on the autotransporter YfaL. Appl Environ Microbiol 78:3051-3058 Kovach M E et al. (1995) Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175-176 Laemmli U K (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. Mangel, W. F., D. L. Toledo, et al. (1994). Omptin: an Escherichia coli outer membrane proteinase that activates plasminogen. Methods Enzymol 244: 384-399. Maurer J, Jose J, Meyer T F (1997) Autodisplay: One-component system for efficient surface display and release of soluble recombinant proteins from Escherichia coli. J Bacteriol 179:794-804 Schultheiss E, Paar C, Schwab H, Jose J (2002) Functional esterase surface display by the autotransporter pathway in Escherichia coli. Journal of Molecular Catalysis B: Enzymatic 18:89-97 Sevastsyanovich Y R et al. (2012) A generalised module for the selective extracellular accumulation of recombinant proteins. Microb Cell Fact 11(1): 69. Van Gerven N, Sleutel M, Deboeck F, De Greve H, Hernalsteens J P (2009)

(214) Surface display of the receptor-binding domain of the F17a-G fimbrial adhesin through the autotransporter AIDA-I leads to permeability of bacterial cells. Microbiology 155:468-476 Welch M et al. (2009) Design parameters to control synthetic gene expression in Escherichia coli. PLoS ONE 4:e7002 Wells T J et al. (2008) EhaA is a novel autotransporter protein of enterohemorrhagic Escherichia coli O157:H7 that contributes to adhesion and biofilm formation. Environmental Microbiology 10:589-604 Spohn et al. (1992) B-cell epitopes of the Nef protein. Research in Virology 143:70-81. Jose J, Bernhardt R, Hannemann F (2002) Cellular surface display of dimeric Adx and whole cell P450-mediated steroid synthesis on E. coli. J Biotechnol, 95: 257-268. Jose J, Meyer T F (2007) Microbiol Mol Biol 71, 600-619. Xiao Z et al (2004) Microplate-based filter paper assay to measure total cellulase activity. Biotechnol Bioeng 88(7): 832-837.