METHOD FOR SCREENING ANTIMICROBIAL AGENT

Abstract

A method for screening an antimicrobial agent which is capable of controlling microorganisms causing offensive odor in an air-conditioning system and a method for removing offensive odor in an air-conditioning system are provided. The method for screening an antimicrobial agent and the method for removing offensive odor in an air-conditioning system may be used for various purposes of industrial application. For example, they may be used to develop a novel antimicrobial agent capable of inhibiting the growth of the microorganisms or to develop an air freshener for removing offensive odor by elucidating the chemical properties of the metabolites of the microorganisms. In addition, they may be used to fundamentally remove the cause of offensive odor by providing an air-conditioning system with an environment where the microorganisms may not live.

Claims

1.-31. (canceled)

32. A method for inhibiting a growth of microorganisms causing offensive odor in an air-conditioning system, which comprises coating or spraying an antimicrobial agent in an air-conditioning system, wherein the microorganisms comprises one or more selected from the group consisting of Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P) and Staphylococcus warneri HKMC-110 (accession number: KCCM11393P).

33. The method according to claim 32, wherein the air-conditioning system is an air conditioner.

34. The method according to claim 32, wherein the microorganism causes offensive odor by forming a biofilm on an evaporator core in the air-conditioning system.

35. The method according to claim 34, wherein the evaporator core is made of aluminum, an aluminum alloy, copper or a copper alloy.

36. The method according to claim 32, wherein the antimicrobial agent is obtained by followings: (a) preparing one or more microorganisms selected from the group consisting of Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P) and Staphylococcus warneri HKMC-110 (accession number: KCCM11393P); (b) contacting a sample to be analyzed with the microorganism; (c) measuring an inhibition of the growth of the microorganism; and (d) determining that the sample has antimicrobial activity against the microorganism if the growth of the microorganism is inhibited.

37. A method for removing offensive odor in an air-conditioning system, comprising coating or spraying an antimicrobial agent to the air-conditioning system wherein the offensive in the air-conditioning system is caused by microorganisms which comprises one or more selected from the group consisting of Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P) and Staphylococcus warneri HKMC-110 (accession number: KCCM11393P).

38. A method for removing offensive odor in an air-conditioning system, which comprises separating or killing one or more microorganisms causing offensive odor in an air-conditioning system, which is selected from the group consisting of Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P) and Staphylococcus warneri HKMC-110 (accession number: KCCM11393P).

39. A method for removing offensive odor in an air-conditioning system, which comprises inhibiting a growth of one or more microorganisms causing offensive odor in an air-conditioning system, which is selected from the group consisting of Microbacterium trichothecenolyticum HKMC-112 (accession number: KCCM11395P), Microbacterium flavescens HKMC-104 (accession number: KCCM11387P), Methylobacterium dankookense HKMC-101 (accession number: KCCM11384P), Methylobacterium phyllosphaerae HKMC-102 (accession number: KCCM11385P), Methylobacterium tardum HKMC-103 (accession number: KCCM11386P), Methylobacterium radiotolerans HKMC-111 (accession number: KCCM11394P), Sphingomonas dokdonensis HKMC-105 (accession number: KCCM11388P), Sphingomonas ginsenosidimutans HKMC-106 (accession number: KCCM11389P), Sphingomonas humi HKMC-107 (accession number: KCCM11390P), Sphingomonas melonis HKMC-108 (accession number: KCCM11391P), Staphylococcus hominis subsp. hominis HKMC-109 (accession number: KCCM11392P) and Staphylococcus warneri HKMC-110 (accession number: KCCM11393P).

Description

BRIEF DESCRIPTION OF DRAWINGS

[0064] FIG. 1 shows a sample taken from an evaporator core of a used vehicle giving off offensive odor.

[0065] FIG. 2 shows a method of testing antimicrobial activity according to the present invention.

[0066] FIG. 3 shows a combination of dominant odorless microorganisms cultured on an aluminum fin, in which the aluminum is a material of an evaporator core.

DETAILED DESCRIPTION

[0067] The present invention will be described in more detail through examples. The following examples are for illustrative purposes only and it will be apparent to those of ordinary skill in the art that the scope of this invention is not limited by the examples.

EXAMPLES

Example 1: Screening of Dominant Microorganisms Causing Offensive Odor

[0068] 1. Preparation of Used Vehicle Giving Off Offensive Odor and Separation of Air-Conditioning System

[0069] In order to identify the cause of offensive odor generated in an airtight environment such as inside of a vehicle, air-conditioning systems were separated from 10 used vehicles giving off offensive odor in different seasons (winter: February-March, summer: June-July). Then, samples were taken from evaporator cores which were expected to have biofilms formed thereon by microorganisms causing offensive odor in the air-conditioning systems (Table 1).

TABLE-US-00001 TABLE 1 No. Mileage Season 1 89,000 km Winter (February-March) 2 70,000 km 3 10,300 km 4 37,100 km 5 149,970 km 6 35,000 km Summer (June-July) 7 28,000 km 8 42,000 km 9 110,000 km 10 90,000 km

[0070] 2. Preparation of Evaporator Core Sample

[0071] The evaporator cores separated from the used vehicles 1-10 giving off offensive odor were stored at a temperature of 4 C. before the evaporator core samples were used and was sealed in polyethylene bags. In order to isolate and culture microorganisms, 5 g of a sample was taken from random parts of each evaporator core, including front and rear surfaces, using sterilized long-nose pliers (FIG. 1).

[0072] 3. Isolation of Microorganisms

[0073] Microorganisms were isolated from the sample taken from the evaporator core as follows:

[0074] 1) The sample taken from the evaporator core was mixed and put in a mixer.

[0075] 2) 200 mL of sterilized 1 phosphate buffed saline (PBS) was added to the mixer.

[0076] 3) The mixed sample and the PBS were mixed for 30 seconds.

[0077] 4) The mixer was left on ice for 1 minute.

[0078] 5) The steps 3) and 4) were repeated two more times.

[0079] 6) The resulting suspension was centrifuged at a temperature of 4 C. for 3 minutes at 13000 rpm.

[0080] 7) Only the supernatant was taken and transferred to a fresh tube.

[0081] 8) The surface of the evaporator core from which the sample was taken was wiped several times with a sterilized cotton swab soaked with the supernatant.

[0082] 9) The head of the cotton swab was put in the supernatant and then vortexed.

[0083] 10) The precipitate obtained in the step 6) and the mixture obtained in the step 9) were mixed and used as an inoculation solution.

[0084] Microorganisms were physically isolated from the evaporator cores of the vehicles 1-10 through the steps 1)-10).

[0085] 4. Isolation of Microorganisms Causing Offensive Odor and Screening of Dominant Species

[0086] Aerobic heterotrophic bacteria usually called normal bacteria were isolated from the air conditioner by culturing on a heterotrophic plate. The normal bacteria were isolated by culturing at a temperature of 28-30 C. for 14 days using PTYG agar medium and R2A agar medium as complex nutrient media. The PTYG agar medium was prepared by adding 0.25 g of peptone (Difco), 0.25 g of triptone (Difco), 0.5 g of yeast extract (Difco), 0.5 g of glucose (Difco), 30 mg of MgSO.sub.4 (Sigma), 3 mg of CaCl.sub.2 (Sigma) and 15 g of Bacto agar (Difco) to 980 mL of distilled water and sterilizing at a temperature of 121 C. for 15 minutes under high pressure after adjusting pH to 7.0. The R2A agar medium was prepared by adding 0.5 g of yeast extract (Difco), 0.5 g of proteose peptone No. 3 (Difco), 0.5 g of casamino acids (Difco), 0.5 g of dextrose (Difco), 0.5 g of soluble starch (Difco), 0.3 g of sodium pyruvate (Difco), 0.3 g of dipotassium sulfate (Difco), 0.05 g of magnesium sulfate (Difco) and 15 g of Bacto agar (Difco) to 980 mL of distilled water and sterilizing at a temperature of 121 C. for 15 minutes under high pressure after adjusting pH to 7.2. For isolation of non-dominant bacteria, antibiotic media were prepared by inoculating kanamycin, ampicillin or chloramphenicol at a temperature of 50 C. after filter-sterilizing the media to a concentration of 100 ppm.

[0087] Dominant strains were isolated and cultured based on dilution ratios or morphological characteristics such as the color, size, shape, and the like of the colonies as follows.

[0088] 1) Molds and bacteria were separated from an isolated-culture media.

[0089] 2) The bacteria exhibiting different morphologies were separated by inoculating to complex media using a loop.

[0090] 3) From the inoculated media, the bacterial culture showing the best growth state was selected and subcultured.

[0091] 4) The molds were inoculated to complex media after removing the hypha end portions using a scalpel.

[0092] 5) From the inoculated media, the mold culture showing the best growth state was selected and subcultured.

[0093] 5. Identification of Dominant Microorganisms

[0094] For accurate identification of the isolated microorganisms, 16s rRNA analysis was performed as follows.

[0095] a) Fingerprinting Based on REP-PCR Pattern Analysis

[0096] REP-PCR is a molecular biological fingerprinting technique for structural analysis of bacterial chromosomes, which allows distinction of each bacterial strain. Genetic characteristics were analyzed by REP-PCR as follows.

[0097] (1) Cell Lysis

[0098] 1) 2.5 L of a Lyse-N-Go PCR reagent (Thermo) was added to a PCR tube.

[0099] 2) A colony was pipetted onto the tube on a clean bench. During the pipetting, caution was made such that the resulting solution did not become turbid.

[0100] 3) Culturing was performed on a PCR machine according to the manufacturer's instructions.

[0101] (2) PCR Reaction

[0102] Using a PCR reagent prepared as described in Table 2, PCR amplification was carried out by conducting pre-denaturation at a temperature of 93 C. for 7 minutes and repeating 33 cycles of denaturation at a temperature of 92 C. for 1 minute, annealing at a temperature of 51.5 C. for 1 minute and extension at a temperature of 65 C. for 8 minutes, as described in Table 3.

TABLE-US-00002 TABLE2 {circle around (1)} dNTP(2.5mMeach) 12.5L {circle around (2)} Gitschierbuffer 5.0L {circle around (3)} DMSO(100%) 2.5L {circle around (4)} Autoclaved3D.W. 0.3L {circle around (5)} BOXA1Rprimer(50pmole/L) 1.0L 5CTACGGCAAGGCGACGCTGACG {circle around (6)} BSA(10mg/mL) 0.4L {circle around (7)} BacterialDNA 2.5L {circle around (8)} Taqpolymerase(Roche)(5U/L) 0.8L

TABLE-US-00003 TABLE 3 Step 1 93 C. 7 min Step 2 92 C. 1 min Step 3 51.5 C. 1 min Step 4 65 C. 8 min Step 5 Steps 2, 3 & 4: additional 33 cycles Step 6 65 C. 16 min Step 7 4 C.

[0103] (3) Gel Electrophoresis

[0104] The PCR-amplified DNA fragments were loaded onto 1.2-1.5% agarose gel supplemented with EtBr after mixing a 6 dye with the sample at a ratio of 1:5. Since most PCR products were in the range of 100-1000 bp, they were loaded tougher with 100 bp ladders. Then, electrophoresis was carried out as slowly as possible (50 V) such that bromophenol blue and xylene cyanol dyes moved halfway of the entire gel. The strains exhibiting the same DNA pattern on the gel were regarded as the same strains.

[0105] b) Identification of Dominant Bacteria from Air Conditioner Based on 16S rRNA Gene Analysis

[0106] The 16S ribosomal ribonucleic acid (rRNA) gene is used for genetic identification of bacteria. The bacteria differentiated by REP-PCR can be identified in the levels of genus and species.

[0107] (1) Cell Lysis

[0108] 1) 5 L of a Lyse-N-Go PCR reagent (Thermo) was added to a PCR tube.

[0109] 2) A colony was pipetted onto the tube on a clean bench. The pipetting was performed such that the resulting solution became slightly turbid.

[0110] 3) Cell lysis was performed on a PCR machine according to the manufacturer's instructions (Table 4).

TABLE-US-00004 TABLE 4 Lysis program Cycle Temperature ( C.) Time (seconds) 1 65 30 2 8 30 3 65 90 4 97 180 5 8 60 6 65 180

[0111] (2) 16S rRNA PCR

[0112] A mixture (44.5 L) of the solutions described in the following Table 5 below, except for DNA and Taq, was added to the lysis solution described above (total volume of 50 L in Table 5). Subsequently, PCR amplification was carried out by conducting pre-denaturation at a temperature of 94 C. for 5 minutes and repeating 29 cycles of denaturation at a temperature of 94 C. for 1 minute, annealing at a temperature of 55 C. for 1 minute and extension at a temperature of 72 C. for 1 minute and 30 seconds, as described in Table 6.

TABLE-US-00005 TABLE 5 Autoclaved 3 D.W. 22 L 10x buffer (Roche) 5 L dNTP (Roche, 2.5 mM) 5 L DMSO 5 L BSA (10 mg/mL) 2.5 L 27mf (20 pmole/L) 2.5 L 1492r (20 pmole/L) 2.5 L DNA 5 L Taq (Roche) 0.5 L

TABLE-US-00006 TABLE 6 Step 1 94 C. 5 min Step 2 94 C. 1 min Step 3 55 C. 1 min Step 4 72 C. 1 min 30 sec Step 5 Go to step 2: additional 29 cycles Step 6 72 C. 10 min Step 7 4 C. hold

[0113] (3) PCR Purification

[0114] The 16S rRNA PCR products were purified using a QIAquick PCR purification kit as follows.

[0115] 1) The PCR products were added to a 5 PB buffer.

[0116] 2) The resulting solution was transferred to a QIAquick column.

[0117] 3) For DNA binding, the solution was centrifuged for 1 minute, and then filtered solution was removed.

[0118] 4) For washing, 750 L of PE buffer was added to the QIAquick column and centrifugation was performed for 1 minute, and then filtered solution was removed.

[0119] 5) Centrifugation was performed for 1 minute.

[0120] 6) The QIAquick column was transferred to a new tube.

[0121] 7) For DNA extraction, 30 L of EB buffer was added and the resulting solution was allowed to stand for 1 minute.

[0122] 8) After performing centrifugation for 1 minute, the DNA dissolved in EB was collected in a tube.

[0123] In order to observe whether the isolated microorganisms give off offensive odor, sensory evaluation was performed as follows.

[0124] 1) The isolated microorganisms were inoculated to a liquid nutrient medium.

[0125] 2) Culturing was performed at a temperature of 28 C. for 5-7 days.

[0126] 3) 100 L of the microorganisms cultured in the liquid medium were inoculated to a solid nutrient medium.

[0127] 4) The inoculated microorganisms were spread uniformly using a spreader.

[0128] 5) The microorganisms were cultured on a sealed Petri dish at a temperature of 28 C. for 10 days.

[0129] The dominant microorganisms causing offensive odor were screened based on the average of the sensory evaluation by 7 panelists on a 5-point scale. A total of 12 dominant species were identified through the 16S rRNA analysis, as shown in the following Table 7, and they were deposited in the Korean Culture Center of Microorganisms on Feb. 26, 2013.

TABLE-US-00007 TABLE 7 Accession numbers of 12 dominant microorganisms causing offensive odor No. Identification No. Name Accession No. 1 HKMC-101 Methylobacterium KCCM11384P dankookense 2 HKMC-102 Methylobacterium KCCM11385P phyllosphaerae 3 HKMC-103 Methylobacterium tardum KCCM11386P 4 HKMC-104 Microbacterium flavescens KCCM11387P 5 HKMC-105 Sphingomonas dokdonensis KCCM11388P 6 HKMC-106 Sphingomonas KCCM11389P ginsenosidimutans 7 HKMC-107 Sphingomonas humi KCCM11390P 8 HKMC-108 Sphingomonas melonis KCCM11391P 9 HKMC-109 Staphylococcus hominis KCCM11392P subsp. hominis 10 HKMC-110 Staphylococcus warneri KCCM11393P 11 HKMC-111 Methylobacterium KCCM11394P radiotolerans 12 HKMC-112 Microbacterium KCCM11395P trichothecenolyticum

Example 2: Evaluation of Antimicrobial Activity of Antimicrobial Agent Against Screened Microorganisms Causing Offensive Odor

[0130] 1. Experimental Procedure

[0131] The antimicrobial activity of various commercially available antimicrobial agents against the dominant microorganisms screened in Example 1 was evaluated. The tested antimicrobial agents are as follows:

[0132] Antimicrobial agent A: fabric deodorizer purchased from P&G Korea.

[0133] Antimicrobial agent B: hand sanitizer purchased from Pam Corporation.

[0134] Antimicrobial agent C: mass-produced antimicrobial agent containing 45-50% methyl alcohol, 1-5% chromium sulfate (CAS 10101-53-8), 1-5% bromine and water.

[0135] Antimicrobial agent D: cationic antimicrobial agent (Parkerizing, Japan).

[0136] Antimicrobial agent E: isothiazolinone-based antimicrobial agent containing methylisothiazolinone (CAS 26172-55-4), bronopol (CAS 52-51-7), and the like. (Parkerizing, Japan).

[0137] The antimicrobial activity was evaluated as follows:

[0138] 1) Sterilized filter paper was prepared.

[0139] 2) Five antimicrobial agents were prepared (control group: not treated with an antimicrobial agent, test groups: treated with antimicrobial agent A, antimicrobial agent B, antimicrobial agent C, antimicrobial agent D and antimicrobial agent E).

[0140] 3) Each antimicrobial agent was added to the filter paper.

[0141] 4) Each microorganism causing offensive odor was coated on a nutrient medium.

[0142] 5) The filter paper to which the antimicrobial agent was added was placed on the nutrient medium on which the microorganism causing offensive odor was coated.

[0143] 6) The microorganism was cultured at a temperature of 28-30 C. for 5 days.

[0144] 7) The growth inhibition zone was measured.

[0145] The diameter of the growth inhibition zone was measured using a vernier caliper as shown in FIG. 2.

[0146] 2. Experimental Result

[0147] The result of measuring the diameter of the growth inhibition zone for the 12 species of microorganisms causing offensive odor is shown in Table 8.

TABLE-US-00008 TABLE 8 Diameter of growth inhibition zone (unit: mm) Antimicrobial agent No. Microorganism (Deposition Name) None A B C D E 1 Methylobacterium dankookense HKMC-101 0 18.3 22.3 27.3 29.5 36.1 2 Methylobacterium phyllosphaerae HKMC-102 0 18.3 11.6 35.3 47.3 45.3 3 Methylobacterium tardum HKMC-103 0 0 0 0 43 38.3 4 Microbacterium flavescens HKMC-104 0 19.6 14 28 19.1 33.9 5 Sphingomonas dokdonensis HKMC-105 0 15 11.6 21.7 16.2 39.1 6 Sphingomonas ginsenosidimutans HKMC-106 0 0 11.3 17.6 21.8 31.1 7 Sphingomonas humi HKMC-107 0 11.6 14.3 22.5 19.1 36.1 8 Sphingomonas melonis HKMC-108 0 17 11 31.6 22.6 37.3 9 Staphylococcus hominis subsp. hominis HKMC-109 0 0 0 25.6 28.6 54 10 Staphylococcus warneri HKMC-110 0 0 0 33.3 17 38.6 11 Methylobacterium radiotolerans HKMC-111 0 17.6 0 23.3 28.1 31 12 Microbacterium trichothecenolyticum HKMC-112 0 19 18.3 20.6 18.5 32.3

[0148] The antimicrobial activity of the cationic antimicrobial agent (antimicrobial agent D) and the isothiazolinone-based antimicrobial agent (antimicrobial agent E) were compared with that of the mass-produced antimicrobial agent (antimicrobial agent C), and the results are shown in Table 9 below.

TABLE-US-00009 TABLE 9 Antimicrobial activity of cationic antimicrobial agent and isothiazolinone-based antimicrobial agent compared with that of mass-produced antimicrobial agent Antimicrobial agent No. Microorganism (Deposition Name) D E 1 Methylobacterium dankookense 8.1% 32.2% HKMC-101 2 Methylobacterium phyllosphaerae 34% 28.3% HKMC-102 3 Methylobacterium tardum HKMC-103 43% 38.3% 4 Microbacterium flavescens HKMC-104 31.8% 21% 5 Sphingomonas dokdonensis HKMC-105 25.3% 80.1% 6 Sphingomonas ginsenosidimutans 23.8% 76.7% HKMC-106 7 Sphingomonas humi HKMC-107 15.1% 60.4% 8 Sphingomonas melonis HKMC-108 28.5% 18% 9 Staphylococcus hominis subsp. hominis 11.7% 110.9% HKMC-109 10 Staphylococcus warneri HKMC-110 48.9% 15.9% 11 Methylobacterium radiotolerans 20.6% 33% HKMC-111 12 Microbacterium trichothecenolyticum 10.2% 56.8% HKMC-112

[0149] As shown in the above Tables 8 and 9, the antimicrobial agent A exhibited no antimicrobial activity against Methylobacterium tardum, Sphingomonas ginsenosidimutans, Staphylococcus hominis subsp. hominis and Staphylococcus warneri at all. Although the antimicrobial agent B showed antimicrobial activity against Sphingomonas ginsenosidimutans unlike the antimicrobial agent A, it showed no antimicrobial activity against Methylobacterium radiotolerans.

[0150] In addition, the antimicrobial agent C showed no antimicrobial activity against Methylobacterium tardum. In contrast, the antimicrobial agents D and E showed antimicrobial activity against all the 12 species of microorganisms. However, the antimicrobial agent D showed lower antimicrobial activity against Microbacterium flavescens, Sphingomonas dokdonensis, Sphingomonas humi, Sphingomonas melonis, Staphylococcus warneri and Microbacterium trichothecenolyticum as compared to that of the antimicrobial agent C. For the microorganisms belonging to the same genus Methylobacterium, the antimicrobial agent E showed more specific antimicrobial activity against Methylobacterium dankookense and Methylobacterium radiotolerans as compared to the antimicrobial agent D, and the antimicrobial agent D showed more specific antimicrobial activity against Methylobacterium phyllosphaerae and Methylobacterium tardum as compared to the antimicrobial agent E. That is to say, the antimicrobial agents showed different antimicrobial activity against different microorganisms belonging to the same genus.

Example 3: Evaluation of Odor of Evaporator Core with Microorganism Causing Offensive Odor Removed

[0151] In order to prepare an evaporator core from which microorganisms causing offensive odor were removed or separated, combinations of odorless microorganisms excluding the microorganisms causing offensive odor of Example 1 from the dominant microorganisms inhabiting the evaporator core were cultured on an aluminum fin, in which the aluminum was a material of an evaporator core (Table 10, FIG. 3).

[0152] The dominant species which formed colonies on the evaporator core but did not cause offensive odor were selected as the odorless microorganisms and cultured as follows.

[0153] 1) The isolated odorless microorganisms were inoculated to a liquid R2A medium.

[0154] 2) The microorganisms were cultured at a temperature of 28 C. for 5-7 days.

[0155] 3) An aluminum fin sterilized at a temperature of 121 C. for 20 minutes under high pressure was prepared.

[0156] 4) The surface of the aluminum fin was uniformly coated with each antimicrobial agent.

[0157] 5) The coated aluminum fin was placed on a Petri dish.

[0158] 6) 1 mL of the odorless microorganism culture was centrifuged and the supernatant was discarded.

[0159] 7) After adding 1 mL of sterilized 1PBS, the mixture was centrifuged again.

[0160] 8) The step 7) was repeated two times.

[0161] 9) 100 L of the odorless microorganism culture washed with PBS was dropped onto the center of the aluminum fin.

[0162] 10) The aluminum fin was dried at room temperature.

[0163] 11) After sealing the Petri dish, the odorless microorganisms were cultured at a temperature of 28 C. for 1 month.

[0164] As a result, all the combinations described in the following Table 10 were found not to cause offensive odor.

TABLE-US-00010 TABLE 10 Odor of microorganisms inhabiting evaporator core having microorganisms causing offensive odor removed Combi- Odor after nation culturing for No. Microorganisms 1 month 1 Methylobacterium brachiatum Odorless 2 Methylobacterium platani Odorless 3 Methylobacterium aquaticum + Odorless Methylobacterium platani 4 Methylobacterium platani + Odorless Methylobacterium brachiatum 5 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum 6 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Acinetobacter johnsonii 7 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Bacillus vietnamensis 8 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Brevibacillus invocatus 9 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Deinococcus ficus 10 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Leifsonia soli 11 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Methylobacterium komagatae 12 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Pseudomonas nitroreducens 13 Methylobacterium aquaticum + Odorless Methylobacterium platani + Methylobacterium brachiatum + Sphingomonas aquatilis 14 Sphingomonas aquatilis + Odorless Brevibacillus invocatus 15 Leifsonia soli + Methylobacterium Odorless komagatae 16 Acinetobacter johnsonii + Sphingomonas Odorless aquatilis + Methylobacterium komagatae 17 Pseudomonas nitroreducens Odorless 18 Acinetobacter johnsonii + Pseudomonas Odorless nitroreducens 19 Brevibacillus invocatus + Acinetobacter Odorless johnsonii + Pseudomonas nitroreducens 20 Leifsonia soli + Pseudomonas nitroreducens Odorless 21 Brevibacillus invocatus + Sphingomonas Odorless aquatilis + Pseudomonas nitroreducens 22 Acinetobacter johnsonii + Sphingomonas Odorless aquatilis + Pseudomonas nitroreducens 23 Methylobacterium aquaticum + Odorless Methylobacterium komagatae + Bacillus vietnamensis + Deinococcus ficus 24 Methylobacterium aquaticum + Odorless Methylobacterium komagatae + Curto- bacterium flaccumfaciens + Deinococcus apachensis + Bacillus subtilis subsp. subtilis 25 Methylobacterium aquaticum + Odorless Methylobacterium komagatae + Spirosoma linguale + Sphingomonas dokdonensis + Leifsonia soli

[0165] From Table 10, it can be seen that the offensive odor generated from an air-conditioning system can be significantly removed by chemically or physically removing the microorganisms causing offensive odor from the microorganisms inhabiting the air-conditioning system and providing combinations of microorganisms not causing offensive odor.

[0166] The present invention has been described in detail with reference to specific embodiments thereof. However, it will be appreciated by those skilled in the art that various changes and modifications may be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

[0167] The microorganism causing offensive odor in an air-conditioning system of the present invention is industrially applicable for various purposes. For example, they may be used to develop a novel antimicrobial agent capable of inhibiting the growth of the microorganisms or to develop an air freshener for removing offensive odor by elucidating the chemical properties of the metabolites of the microorganisms. In addition, they may be used to fundamentally remove the cause of offensive odor by providing an air-conditioning system with an environment where the microorganisms may not live.