FUCOSYLTRANSFERASES AND THEIR USE IN PRODUCING FUCOSYLATED OLIGOSACCHARIDES

20200181665 ยท 2020-06-11

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed are novel fucosyltransferases being capable of transferring a fucose residue from a donor substrate to a lactotetraose, methods for producing fucosylated oligosaccharides utilizing said fucosyltransferases, and the use of the thus produced fucosylated oligosaccharides for manufacturing nutritional compositions.

    Claims

    1. A method for producing a fucosylated oligosaccharide, the method comprising: a) providing at least one genetically engineered cell that has been genetically engineered to express a heterologous fucosyltransferase, wherein said heterologous fucosyltransferase is capable of transferring a fucose residue from a donor substrate to an acceptor molecule, said acceptor molecule being a lactotetraose; b) cultivating the at least one genetically engineered cell in the presence of at least one carbon source, and under conditions suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate to the acceptor molecule; and c) optionally recovering the fucosylated oligosaccharide.

    2. The method according to claim 1, wherein the acceptor molecule is selected from the group consisting of LNT and LNnT.

    3. The method according to claim 1, wherein the heterologous fucosyltransferase is selected from the group consisting of polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional variants of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30.

    4. The method according to claim 1, wherein the heterologous fucosyltransferase is encoded by a nucleic acid molecule comprising i) a nucleotide sequence as represented by any one of SEQ ID NOs: 1 to 15; ii) a nucleotide sequence having a sequence identity of at least 80% to one of the nucleotides sequences as represented by any one of SEQ ID NOs: 1 to 15, optionally across the entire length of the sequence; iii) a nucleotide sequence which encodes a polypeptide having an amino acid sequence as represented by any one of SEQ ID NOs: 16 to 30; iv) a nucleotide sequence which encodes a polypeptide having an amino acid sequence which has at least 80% identity to any one of the amino acid sequences as represented by any one of SEQ ID NOs: 16 to 30; v) a nucleotide sequence encoding a functional fragment of any one of the polypeptides according to iii) and iv); or vi) wherein the nucleic acid molecule hybridizes to a complementary strand of a nucleic acid molecule according to i), ii), iii), iv) or v) under stringent conditions.

    5. A genetically engineered cell for producing a fucosylated oligosaccharide/for use in the method according to claim 1, wherein said cell has been genetically engineered to express a heterologous fucosyltransferase, wherein said heterologous fucosyltransferase is capable of transferring a fucose residue from a donor substrate to an acceptor molecule, said acceptor molecule being a lactotetraose.

    6. The genetically engineered cell according to claim 5, wherein the heterologous fucosyltransferase is selected from the group consisting of polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional variants of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30.

    7. The genetically engineered cell according to claim 6, wherein the heterologous fucosyltransferase is encoded by a nucleic acid molecule comprising i) a nucleotide sequence as represented by any one of SEQ ID NOs: 1 to 15; ii) a nucleotide sequence having a sequence identity of at least 80% to one of the nucleotides sequences as represented by any one of SEQ ID NOs: 1 to 15, optionally across the entire length of the sequence; iii) a nucleotide sequence which encodes a polypeptide having an amino acid sequence as represented by any one of SEQ ID NOs: 16 to 30; iv) a nucleotide sequence which encodes a polypeptide having an amino acid sequence which has at least 80% identity to any one of the amino acid sequences as represented by any one of SEQ ID NOs: 16 to 30; v) a nucleotide sequence encoding a functional fragment of any one of the polypeptides according to iii) and iv); or vi) wherein the nucleic acid molecule hybridizes to a complementary strand of a nucleic acid molecule according to i), ii), iii), iv) or v) under stringent conditions.

    8. The genetically engineered cell according to claim 6, wherein the cell has been genetically engineered to comprise an increased intracellular GDP-fucose production capability as compared to the cell prior to being genetically engineered, optionally in that the cell has been genetically engineered i) to express a gene encoding a bifunctional fucosekinase/L-fucose-1-phosphate-guanyltransferase catalysing the formation of GDP-fucose from L-fucose, or ii) to overexpress at least one of the genes encoding phosphomannomutase, mannose-1-phosphate guanosyltransferase, GDP-mannose-4,6-dehydratase, and GDP-L-fucose synthase.

    9. The genetically engineered cell according to claim 6, wherein the cell has been genetically engineered to possess an increased import of exogenous L-fucose across its cell membrane, optionally in that the cell has also been genetically engineered to express or overexpressas compared to the progenitor cell before being genetically engineeredone nucleotide sequence selected from the group consisting of nucleotide sequences encoding the major facilitator transporter FucP from E. coli, nucleotide sequences encoding functional variants of the major facilitator transporter FucP from E. coli, nucleotide sequences encoding functional fragments of the major facilitator transporter FucP from E. coli, and nucleotide sequences encoding functional variants of the functional fragments of the major facilitator transporter FucP from E. coli.

    10. The genetically engineered cell according to claim 6, wherein the cell has also been genetically engineered to prevent depletion of the cell's intracellular GDP-fucose pool, optionally in the expression of the cell's gene encoding WcaJ, which catalyses the first step in colonic acid synthesis, is impaired or inactivated, or in that the nucleotide sequence of the gene encoding WcaJ has been altered such that an enzymatically inactive polypeptide is encoded by the altered WcaJ gene.

    11. The genetically engineered cell according to claim 6, wherein the cell has also been genetically engineered in that the genes fucI and/or fucK, encoding the L-fucose isomerase and the L-fuculose kinase respectively, are deleted, the nucleotide sequence of fucI and/or fucK is altered to irreversibly inactivate the enzymatic activity of corresponding polypeptide(s), or in that the expression of fucI and/or fucK is impaired.

    12. The genetically engineered cell according to claim 6, wherein the cell has also been genetically engineered to possess an increased capability of synthesizing one or more of CMP-N-acetylneuraminic acid, UDP-N-acetylglucosamine and UDP-galactose, as compared to the cell prior to being genetically engineered, wherein optionally said increased UDP-N-acetylglucosamine, UDP-galactose and more optionally, CMP-N-acetylneuraminic acid production capability comprises overexpression of one or more genes encoding for proteins comprising the following activities for a: L-glutamine: D-fructose-6-phosphate aminotransferase, N-acetyl glucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyl transferase, phosphoglucosamine mutase, UDP-galactose-4-epimerase, phosphoglucomutase, glucose-1-phosphate uridylyltransferase, glucosamine-6-phosphate acetyltransferase, N-acetylglucosamine 2-epimerase, UDP-N-acetylglucosamine-2-epimerase, phosphoenolpyruvate synthetase, sialic acid synthase, sialic acid permease, CMP-sialic acid synthetase.

    13. The genetically engineered cell according to claim 6, wherein the cell comprises (i) optionally a -1,3-N-acetylglucosaminyltransferase, (ii) a -1,3-galactosyltransferase or a -1,4-galactosyltransferase; and (iii) an -1,2- and/or -1,3-fucosyltransferase as glycosyltransferase.

    14. A method for producing a fucosylated oligosaccharide, the method comprising: a) providing a fucosyltransferase in a reaction mixture, the fucosyltransferase being capable of transferring a fucose residue from a donor substrate to an acceptor molecule, said acceptor molecule being a lactotetraose; and b) contacting said fucosyltransferase with a donor substrate comprising a fucose residue and an acceptor molecule, wherein said acceptor molecule is a lactotetraose.

    15. A product comprising a fucosylated oligosaccharide produced by a method according to claim 1 for manufacturing a nutritional composition, optionally an infant formula.

    16. A nutritional composition comprising at least one fucosylated oligosaccharide, wherein said at least one fucosylated oligosaccharide has been produced by the method according to claim 1.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0024] FIG. 1 is a schematic representation showing the plasmid map of expression vector pINT-malE-fucT-zeo which was used for heterologous expression of nucleotide sequences encoding putative fucosyltransferases in E. coli.

    [0025] FIG. 2 shows chromatograms of LC/MS analyses of fucosylated type 1 (core structure: Gal(1,3)GlcNAc) and type 2 (core structure: Gal(1,4)GlcNAc) products.

    [0026] FIG. 2a shows chromatograms of fucosylated derivatives of LNT and LNnT.

    [0027] FIG. 2b shows chromatograms of a mixture of LNFP-III and LNnFP-V as synthesized in in-vitro reactions using cell extracts containing a heterologously expressed fucosyltransferase from B. fragilis, i.e. FucT109 (upper panel) compared to chromatograms of sugar standards.

    [0028] FIG. 3 is a schematic representation of metabolic pathways for the production of fucosylated oligosaccharides based on Lacto-N-tetraose and Lacto-N-neotetraose in E. coli.

    [0029] FIG. 4 depicts a TLC analyses of culture supernatants of lacto-N-fucopentaose producing E. coli strains containing pINT-malE-fucT109-zeo.

    [0030] FIG. 5 shows a bar graph which demonstrates production of extracellular LNFP-I by E. coli (strain #993) after chromosomal integration of different fucT genes.

    [0031] FIG. 6 shows a bar graph which demonstrates production of LNFP-I by E. coli (strain #1772) in a 1 L-fermentation using glucose as carbon source.

    [0032] FIG. 7 shows a graph illustrating degradation of LNT-2 and lactose by hydrolases expressed in E. coli strain #1886.

    [0033] FIG. 8 shows an image of a thin layer chromatography illustrating time dependent LNT degradation by the -1,3-galactosidase Bga42A.

    DETAILED DESCRIPTION

    [0034] According to the first aspect, provided is a method for producing fucosylated oligosaccharides, the method comprising the steps of: [0035] a) providing at least one genetically engineered cell that has been genetically engineered to express a heterologous fucosyltransferase, wherein said heterologous fucosyltransferase is capable of transferring a fucose residue from a donor substrate to an acceptor molecule, said acceptor molecule being a lactotetraose; [0036] b) cultivating the at least one genetically engineered cell in the presence of at least one carbon source and under conditions suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate to the acceptor molecule; and [0037] c) optionally, recovering the fucosylated oligosaccharide.

    [0038] In the method according to the first aspect, a genetically engineered cell is provided. The term genetically engineered as used herein refers to the modification of the cell's genetic make-up using molecular biological methods. The modification of the cell's genetic make-up may include the transfer of genes within and (or across species boundaries, inserting, deleting, replacing and/or modifying nucleotides, triplets, genes, open reading frames, promoters, enhancers, terminators and other nucleotide sequences mediating and/or controlling gene expression. The modification of the cell's genetic make-up aims to generate a genetically modified organism possessing particular, desired properties. Genetically engineered cells can contain one or more genes that are not present in the native (not genetically engineered) form of the cell. Techniques for introducing exogenous nucleic acid molecules and/or inserting exogenous nucleic acid molecules (recombinant, heterologous) into a cell's hereditary information for inserting, deleting or altering the nucleotide sequence of a cell's genetic information are known to the skilled artisan. Genetically engineered cells can contain one or more genes that are present in the native form of the cell, wherein said genes are modified and re-introduced into the cell by artificial means. The term genetically engineered also encompass cells that contain a nucleic acid molecule being endogenous to the cell, and that has been modified without removing the nucleic acid molecule from the cell. Such modifications include those obtained by gene replacement, site-specific mutations, and related techniques.

    [0039] The genetically enginieered cell is a prokaryotic cell or a eukaryotic cell. Appropriate cells include yeast cells, bacteria, archaebacteria, fungal cells, insect cells, plant cells and animal cells, including mammalian cells (such as human cells and cell lines).

    [0040] In an additional and/or alternative embodiment, the prokaryotic cell is a bacterial cell, preferably selected from the genus selected from the group consisting of Bacillus, Lactobacillus, Lactococcus, Enterococcus, Bifidobacterium, Sporolactobacillus spp., Micromonospora spp., Micrococcus spp., Rhodococcus spp., and Pseudomonas. Suitable bacterial species are Bacillus subtilis, Bacillus licheniformis, Bacillus coagulans, Bacillus thermophilus, Bacillus laterosporus, Bacillus megaterium, Bacillus mycoides, Bacillus pumilus, Bacillus lentus, Bacillus cereus, Bacillus circulans, Bifidobacterium longum, Bifidobacterium infantis, Bifidobacterium bifidum, Citrobacter freundii, Clostridium cellulolyticum, Clostridium ljungdahlii, Clostridium autoethanogenum, Clostridium acetobutylicum, Corynebacterium glutamicum, Enterococcus faecium, Enterococcus thermophiles, Escherichia coli, Erwinia herbicola (Pantoea agglomerans), Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus jensenii, Lactococcus lactis, Pantoea citrea, Pectobacterium carotovorum, Proprionibacterium freudenreichii, Pseudomonas fluorescens, Pseudomonas aeruginosa, Streptococcus thermophiles and Xanthomonas campestris.

    [0041] In an additional and/or alternative embodiment, the eukaryotic cell is a yeast cell, an insect cell, a plant cell or a mammalian cell. The yeast cell is preferably selected from the group consisting of Saccharomyces sp., in particular Saccharomyces cerevisiae, Saccharomycopsis sp., Pichia sp., in particular Pichia pastoris, Hansenula sp., Kluyveromyces sp., Yarrowia sp., Rhodotorula sp., and Schizosaccharomyces sp.

    [0042] The genetically engineered cell has been genetically engineered to express a heterologous fucosyltransferase. The term heterologous as used herein refers to a nucleotide sequence, nucleic acid molecule or polypeptide that is foreign to a cell or organism, i.e. to a nucleotide sequence, nucleic acid molecule or polypeptide that does not naturally occurs is said cell or organism. A heterologous sequence or a heterologous nucleic acid or heterologous polypeptide, as used herein, is one that originates from a source foreign to the particular host cell (e.g. from a different species), or, if from the same source, is modified from its original form. Thus, a heterologous nucleic acid operably linked to a promoter is from a source different from that from which the promoter was derived, or, if from the same source, is modified from its original form. The heterologous sequence may be stably introduced, e.g. by transfection, transformation, conjugation or transduction, into the genome of the host microbial host cell, thus representing a genetically modified host cell. Techniques may be applied which will depend on the host cell the sequence is to be introduced. Various techniques are known to a person skilled in the art and are, e.g., disclosed in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Accordingly, a heterologous polypeptide is a polypeptide that does not naturally occur in the cell, and a heterologous fucosyltransferase is a fucosyltransferase that does not naturally occur in the cell.

    [0043] The term fucosyltransferase as used herein, refers to polypeptides which are capable of catalyzing the transfer of a fucose residue from a donor substrate to an acceptor molecule. The donor substrate for the transfer of a fucose residue to an acceptor molecule is typically guanosine-diphosphate L-fucose (GDP-L-fucose). Suitable acceptor molecule for fucose residues include oligosaccharides, glycopeptides, glycoproteins, and glycolipids. Typically, the fucose residue is transferred to e.g. an N-acetylglucosamine residue, N-acetylgalactosamine residue, galactose residue, fucose residue, sialic acid residue, or glucose residue of the oligosaccharide or a saccharide moiety of the glycoprotein or glycolipid. The term fucosyltransferase as used herein is also understood to encompass functional variants of said novel fucosyltransferase, functional fragments of said fucosyltransferases and functional fragments of said functional variants. The term functional indicates that said variants and fragments are also capable of catalysing the transfer of a fucose residue from a donor substrate to an acceptor molecule, i.e. they can possess fucosyltransferase activity.

    [0044] The term functional fragment as used herein refers to a truncated polypeptide as compared to the naturally occurring fucosyltransferase, and which fragment is capable of possessing the same fucosyltransferase activity as the naturally occurring polypeptide said fragment originates from.

    [0045] The term functional variant as used herein refers to a polypeptide which is capable of possessing the same fucosyltransferase activity as the naturally occurring polypeptide said derivative originates from, but which has an altered amino acid sequence as compared to the naturally occurring polypeptide.

    [0046] The heterologous fucosyltransferase is capable of transferring a fucose residue from a donor substrate to an acceptor molecule. The term capable of with respect to the heterologous fucosyltransferase refers to the fucosyltransferase activity of the heterologous fucosyltransferase and the provision that suitable reaction conditions are required for the heterologous fucosyltransferase to possess its enzymatic activity. In the absence of suitable reaction conditions, the heterologous fucosyltransferase does not possess its enzymatic activity, but retains its enzymatic activity and possesses its enzymatic activity when suitable reaction conditions are restored. Suitable reaction conditions include the presence of a suitable donor substrate, the presence of suitable acceptor molecules, the presence of essential cofactors such asfor examplemonovalent or divalent ions, a pH value in an appropriate range, a suitable temperature and the like. It is not necessary that the optimum values for each and every factor effecting the enzymatic reaction of the heterologous fucosyltransferase is met, but the reaction conditions have to be such that the heterologous fucosyltransferase performs its enzymatic activity. Accordingly, the term capable of excludes any conditions upon which the enzymatic activity of the heterologous fucosyltransferase has been irreversibly impaired, and also excluded exposure of the heterologous fucosyltransferase to any such condition. Instead, capable of means that the fucosyltransferase is enzymatically active, i.e. possesses its fucosyltransferase activity, if suitable reactions conditions (where all requirements being necessary for the fucosyltransferase to perform its enzymatic activity) are provided.

    [0047] Fucosyltransferases can form -1,2-, -1,3-, -1,4-, or -1,6-glycosidic linkages between fucose and the saccharide moiety of the acceptor molecule. Accordingly, the term alpha-1,2-fucosyltransferase refers to a glycosyltransferase that catalyzes the transfer of fucose from a donor substrate to an acceptor molecule forming an alpha-1,2-linkage of the fucose residue and a saccharide residue of the acceptor molecule. The term alpha-1,3-fucosyltranferase refers to a glycosyltransferase that catalyses the transfer of fucose from a donor substrate to an acceptor molecule in an alpha-1,3-linkage of the fucose residue and a saccharide residue of the acceptor molecule. The term alpha-1,4-fucosyltranferase refers to a glycosyltransferase that catalyses the transfer of fucose from a donor substrate to an acceptor molecule in an alpha-1,4-linkage of the fucose residue and a saccharide residue of the acceptor molecule; and the term alpha-1,6-fucosyltranferase refers to a glycosyltransferase that catalyses the transfer of fucose from a donor substrate to an acceptor molecule in an alpha-1,6-linkage of the fucose residue and a saccharide residue of the acceptor molecule.

    [0048] The term donor substrate with respect to transferring a fucose residue from the donor substrate to an acceptor molecule refers to a molecule comprising a fucose residue, said molecule being utilized by the heterologous fucosyltransferase a source of fucose which is to be transferred to a specific acceptor molecule. Typically, the donor substrate is GDP-fucose.

    [0049] The term acceptor molecule as used herein refers to a molecule which receives the fucose residue from the donor substrate by the enzymatic activity of the heterologous fucosyltransferase. As used herein, the term acceptor molecule more specifically refers to a molecule consisting of or comprising a saccharide moiety. Unless otherwise stated, the term acceptor molecule as used herein refers to a lactotetraose.

    [0050] The heterologous fucosyltransferase is capable of transferring a fucose residue to a lactotetraose as an acceptor molecule. The term lactotetraose as used herein refers to a tetrasaccharide, i.e. an oligosaccharide consisting of 4 monosaccharide residues, wherein the tetrasaccharide comprises a lactose motif (Gal(1,4)Glc) at its reducing end.

    [0051] In an embodiment, the lactotetraose is selected from the group consisting of Lacto-N-tetraose (LNT; Gal(1,3)GlcNAc(1,3)Gal(1,4)Glc) and Lacto-N-neotetraose (LNnT; Gal(1,3)GlcNAc(1,4)Gal(1,4)Glc). The enzymatic activity of the heterologous fucosyltransferase leads to a fucosylated oligosaccharide, more specifically to a fucosylated lactotetraose, i.e. a lactofucopentaose. Said lactofucopentaose is a pentasaccharide preferably selected from the group consisting of lacto-N-fucopentaose I (LNFP-I), lacto-N-neofucopentaose I (LNnFP-I), lacto-N-fucopentaose II (LNFP II), lacto-N-neofucopentaose III (LNnFP-III), lacto-N-fucopentaose V (LNFP-V) and lacto-N-neofucopentaose V (LNnFP-V).

    [0052] Polypeptides which were identified in the genome of various bacterial species and which are capable of possessing fucosyltransferase activity for transferring a fucose residue from a donor substrate to a lactotetraose are shown in Table 1.

    TABLE-US-00001 TABLE 1 Fucosyltransferases being capable of transferring a fucose residue from a donor substrate to a lactotetraose. The amino acid sequences (aa) of the fucosyltransferases used in the examples and the nucleotide sequences (nt) encoding said amino acid sequences and being used for expressing the fucosyltransferases according to the examples are indicated in the last two columns of the table by identifying their SEQ ID NOs. Genbank SEQ ID NOs: accession nucleic amino Species/source number acid acid Helicobacter hepaticus ATCC 51449 (HH_0072) AAP76669 1 16 Brachyspira pilosicoli WesB (WESB_1374) CCG56842 2 17 Yersinia sp. A125 KOH2 (WbcH-like) CAI39173 3 18 Gramella forsetii KT0803 WP_011708479 4 19 Francisella philomiragia ssp. philomiragia ATCC EET21243 5 20 25015 (FTPG_00102) Pseudogulbenkiania ferrooxidans 2002 EEG10438 6 21 (FuraDRAFT_0420) Sideroxydans lithotrophicus ES-11 (Slit_2889) ADE13114 7 22 Providencia alcalifaciens (WdcS) AFH02807 8 23 Pseudoalteromonas haloplanktis ANT/505 EGI74693 9 24 (PH505_ae00940) Roseovarius nubinhibens ISM (ISM_09170) EAP78457 10 25 Thalassospira profundimaris WP0211 EKF09232.1 11 26 (TH2_05058) Desulfovibrio alaskensis G20 (Dde_2877) ABB39672 12 27 Thermosynechococcus elongates BP-1 BAC08546 13 28 (t110994) Bacteroides fragilis strain ATCC 25285 CAH09151 14 29 (BF9343_3370) Escherichia coli O126 (WbgL) ABE98421 15 30

    [0053] Thus, in an additional and/or alternative embodiment, the heterologous fucosyltransferase is selected from the group consisting of polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional variants of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30. Thus, the heterologous fucosyltransferase is selected from the group of polypeptides as represented by any one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, functional fragments of the polypeptides as represented by any one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, functional variants of the polypeptides as represented by any one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

    [0054] In an additional and/or alternative embodiment, the heterologous fucosyltransferase is encoded by a nucleic acid molecule comprising [0055] i) a nucleotide sequence as represented by any one of SEQ ID NOs: 1 to 15; [0056] ii) a nucleotide sequence having a sequence identity of at least 80% to one of the nucleotides sequences as represented by any one of SEQ ID NOs: 1 to 15, preferably across the entire length of the sequence; [0057] iii) a nucleotide sequence which encodes a polypeptide having an amino acid sequence as represented by any one of SEQ ID NOs: 16 to 30; [0058] iv) a nucleotide sequence which encodes a polypeptide having an amino acid sequence which has at least 80% identity to any one of the amino acid sequences as represented by any one of SEQ ID NOs: 16 to 30; [0059] v) a nucleotide sequence encoding a functional fragment of any one of the polypeptides according to iii) and iv); or [0060] vi) wherein the nucleic acid molecule hybridizes to a complementary strand of a nucleic acid molecule according to i), ii), iii), iv) or v) under stringent conditions.

    [0061] The expression SEQ ID NOs: 1 to 15 refers to the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15.

    [0062] Hybridizing under stringent conditions refersfor exampleto: hybridizing in 4SSC at 65 C. and subsequent multiple washings in 0.1SSC at 65 C. forin totalabout 1 hour. Less stringent hybridization conditions are for example: hybridizing in 4SSC at 37 C. and subsequent multiple washing in 1SSC at room temperature. Stringent hybridization conditions can also mean: hybridizing at 68 C. in 0.25 M sodium phosphate, pH 7.2, 7% (w/v) SDS, 1 mM EDTA and 1% (w/v) BSA for 16 hours and subsequent washing, two times with 2SSC and 0.1% (w/v) SDS at 68 C.

    [0063] The nucleotide sequence encoding the heterologous fucosyltransferase may be present on a linear nucleic acid molecule or on a circular nucleic acid molecule. Additionally and/or alternatively, the nucleotide sequence encoding the heterologous fucosyltransferase may be present on an extrachromosomal nucleic acid molecule or be integrated into the or at least one of the cell's chromosomal nucleic acid molecule(s), wherein said chromosomal nucleic acid molecule may be a linear or a circular (bacterial chromosome) nucleic acid molecule.

    [0064] The at least one genetically engineered cell is cultivated in the presence of at least one carbon source.

    [0065] As used herein, the term cultivating means growing a cell in a fermentation broth and under conditions permissive and suitable for the production of the desired fucosylated oligosaccharide(s). A couple of suitable fermentation broths and conditions for cell cultivation will be readily available for one skilled in the art upon reading the disclosure of this invention in connection with the skilled person's technical and expert background.

    [0066] In an additional and/or alternative embodiment, the at least one carbon source is selected from the group consisting glycerol, sucrose, glucose, galactose, fructose, molasses, lactose, xylose, cellulose, pyruvate, succinate, syngas carbon monoxide and any other source of carbon and energy that can be metabolized be the genetically engineered cell to produce the desired fucosylated oligosaccharide. In this context, it is to be understood that any otherpreferably low-costfermentation substrates can be employed as carbon source, and the person skilled in the art will readily able to employ a carbon source suitable within the present invention in order to grow the microorganism to produce the desired monosaccharide in a large scale. In a preferred embodiment of the production of fucosylated oligosaccharides, lactose is supplied to the fermentation broth, in particular if the genetically engineered cell is not capable of synthesizing lactose itself. In an additional and/or alternative embodiment of the production of fucosylated oligosaccharides, fucose is supplied to the fermentation broth, in particular if the genetically engineered cell is not capable of synthesizing fucose itself. Supplementing the fermentation broth with fucose may enhance intracellular synthesis of GDP-fucose using a fucose salvage pathway or fucose salvage system.

    [0067] The at least one genetically engineered cell is cultivated under conditions that are suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate of the heterologous fucosyltransferase to the acceptor molecule. For producing the fucosylated oligosaccharide, the at least one genetically engineered cell is cultivated in a fermentation broth which provides sufficient amounts of nutrients for the at least one cell to be metabolically active such that the heterologous fucosyltransferase is expressed and such that the cell provides sufficient amounts of donor substrate and acceptor molecules for the heterologous fucosyltransferase to be enzymatically active. For the conditions to be suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate to the acceptor molecule by means of the activity of its heterologous fucosyltransferase, the fermentation broth hasamong othersa suitable temperature, a suitable pH value, a suitable amount of oxygen dissolved in the fermentation broth, as well as a suitable osmolarity. The suitable values may vary and are depend on the type of cell that is cultivated. Suitable values can easily be determined by the skilled artisan.

    [0068] In an additional and/or alternative embodiment, cultivating of the at least one genetically engineered cell under conditions suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate of the heterologous fucosyltransferase to the acceptor molecule comprises the step of supplying exogenous lactose to the fermentation broth while cultivating the at least one genetically engineered cell. This enables the at least one genetically engineered cell to take-up said exogenously supplied lactose for endogenous synthesis of a lactotetraose. Said endogenously synthesized lactotetraose can then serve as acceptor substrate for the heterologous fucosyltransferase.

    [0069] In an additional and/or alternative embodiment, cultivating of the at least one genetically engineered cell under conditions suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate of the heterologous fucosyltransferase to the acceptor molecule comprises an endogenous synthesis of lactose by the at least one genetically engineered cell. In an embodiment, the endogenous synthesis of lactose may occur due to the natural competence of the genetically engineered cell to synthesize lactose. Additionally and/or alternatively, the endogenous synthesis of lactose occurs by overexpressing a heterologous -1,4-galactosyltransferase in the genetically engineered cell. Thus, the genetically engineered cell has also been genetically engineered to overexpress, as compared to the genetically not engineered progenitor cell, said heterologous -1,4-galactosylatransferase gene. Said heterologous -1,4-galactosylatransferase gene encodes a -1,4-galactosylatransferase which catalyses the formation of lactose from galactose and glucose. Examples of suitable -1,4-galactosylatransferases are selected from the group consisting of Pm1141 from Pasteurella multocida (accession no. AEC04686) and Lex1 from Aggregatibacter aphrophilus NJ8700 (accession no. AK965832).

    [0070] In an additional and/or alternative embodiment, cultivating of the at least one genetically engineered cell under conditions suitable for the at least one genetically engineered cell to transfer the fucose residue from the donor substrate of the heterologous fucosyltransferase to the acceptor molecule comprises the step of supplying lacto-N-triose-2 (LNT-2) to the fermentation broth while cultivating the at least one genetically engineered cell, wherein said at least one genetically engineered cell comprises (i) a -1,3-galactosyltransferase or a -1,4-galactosyltransferase, and (ii) an -1,2- and/or -1,3-fucosyltransferase as glycosyltransferase. LNT-2 is a trisaccharide which can be produced fairly efficient. Supplementing the fermentation broth with LNT-2 enables the at least one genetically engineered cell to take-up said exogenously supplied LNT-2 as precursor for endogenous synthesis of LNT or LNnT, which can in turn serve as acceptor molecules for the heterologous fucosyltransferase.

    [0071] According to an additional and/or alternative embodiment of the method for producing a fucosylated oligosaccharide, the method comprising the step of cultivating at least one genetically engineered cell is a continuous fermentation process or a batch fermentation process, preferably a fed batch fermentation process.

    [0072] Thus, according to the embodiment wherein the cultivation is a continuous fermentation process, i.e. a process wherein the at least one carbon source is constantly added to the fermentation broth during the cultivating step of the genetically engineered cell, and wherein fermentation broth is continuously recovered from the fermentation process. By constantly adding the carbon source during the cultivation step, a constant and effective production of the oligosaccharide is accomplished.

    [0073] According to the embodiment wherein the cultivation is a batch fermentation process, a closed culture system is used with a specific nutrient composition at the beginning of the fermentation, and specific temperature, pressure, aeration and other environmental conditions to optimize growth. Neither nutrients are added to, nor waste products are removed from the fermentation process during cultivation of the cells.

    [0074] Fed-batch fermentation is understood to be an operational technique where one or more nutrients (substrates) are fed (supplied) to the bioreactor during cultivation and in which the product(s) remain in the bioreactor until the end of the run or in which at least one portion of the fermentation broth including cells and product(s) is removed from the bioreactor during the fermentation process. Portions of the fermentation broth can be removed from the bioreactor multiple times and/or at different intervals during the fermentation process.

    [0075] In an additional and/or alternative embodiment, the method for producing a fucosylated oligosaccharide comprises a recovery of the desired fucosylated oligosaccharide from the culture of the producing cell. As used herein, the term recovering means isolating, harvesting, purifying, collecting or otherwise separating from the host microorganism culture the oligosaccharide produced by the host microorganism according to the invention. The term purifying as used herein refers to the removal of at least a significant amount of impurities and undesired compound. Said impurities and undesired compounds (undesired side-products) comprise cells, ions and salts, other saccharides that the desired lactofucopentaose, for example monosaccharides, disaccharides, trisaccharides, tetrasaccharides, especially lactotetraoses, and other pentsaccharides than the desired lactofucopentaose.

    [0076] In an additional and/or alternative embodiment, the recovering and/or purifying of the fucosylated oligosaccharide comprises a step selected from the group consisting of (i) crystallizing the fucosylated oligosaccharide from a solution of said fucosylated oligosaccharide, and (ii) spray-drying the fucosylated oligosaccharide. These steps provide a fucosylated oligosaccharide in crystallized of amorphous form.

    [0077] In an additional and/or alternative embodiment of the recovery or purification of the desired fucosylated oligosaccharides, at least one glycosidase is applied, wherein the at least one glycosidase is used for degrading hindering and/or undesired impurities or side-products, unused starting substrates and intermediate products generated during the production of the desired oligosaccharide. By means of using the at least one glycosidase it is achieved that, e.g. other (oligo-)saccharides than the desired fucosylated oligosaccharidewhich other (oligo-)saccharides are produced in or by the at least one genetically engineered cell during the synthesis of the desired fucosylated oligosaccharide, and which other oligosaccharides interfere with the purification step of the desired oligosaccharide, can be metabolised.

    [0078] The at least one glycosidase can be either be externally added to the fermentation broth at the end of the fermentation process or endogenously synthesized by the at least one genetically engineered cell.

    [0079] Adding the at least one glycosidase to the fermentation broth is advantageous, if the genetically engineered cell does not synthesize one or more glycosidases, for example because endogenous genes of the genetically engineered cell encoding said one or more glycosidases have been deleted or expression of endogenous genes encoding said one or more glycosidases has been impaired.

    [0080] In an embodiment, wherein the at least one glycosidase is added to the fermentation broth, the at least one glycosidase is produced by at least one other cell than the genetically engineered cell for producing the fucosylated oligosaccharide, and said at least one other cell is additionally added to the fermentation broth for expressing the gene(s) encoding the at least one glycosidase.

    [0081] In this embodiment, the at least one glycosidase being expressed by the at least one other cell is either a naturally occurring glycosidase of said one other cell or a heterologous glycosidase, wherein said other cell has been stably transformed to express the heterologous glycosidase, and wherein the expression of the heterologous glycosidase in the other cell is inducible. Preferably the heterologous glycosidase is encoded by a nucleotide sequence that has been stably integrated into the genome of the at least one other cell.

    [0082] This embodiment is particularly suitable in a continuous fermentation process for the production of the fucosylated oligosaccharide, where, e.g., two separate fermentation vessels or containers are provided, whereas one vessel/container is used for the oligosaccharide synthesis reaction and the second vessel/container is essentially employed for cultivating the cells which express the heterologous glycosidase.

    [0083] In an additional and/or alternative embodiment, the at least one glycosidase being expressed by the at least one other cell is an intracellular glycosidase. Thus, the at least one glycosidase being expressed be the at least one cell resides within said at least one cell. Said at least one other cell therefore ingests the undesired impurities, side-products, the unsused starting substrates and/or intermediate products generated during the production of the desired oligosaccharide such that the internalized compounds are degraded by the at least one intracellular glycosidase.

    [0084] In an alternative embodiment, the at least one glycosidase being expressed by the at least one other cell is secreted from the at least one other cell into the fermentation broth. Then, the undesired impurities, side-products, the unsused starting substrates and/or intermediate products generated during the production of the desired oligosaccharide is degraded in the fermentation broth. This embodiment is advantageous in that the at least one other cell does not have to be capable of internalizing the undesired impurities, side-products, the unsused starting substrates and/or intermediate products generated during the production of the desired oligosaccharide.

    [0085] In a preferred embodiment, the glycosidase degrades lactose. A suitable glycosidase for degrading lactose is the 1,4-galactosidase LacZ of E. coli. A suitable glycosidase for hydrolyzing LNT-2, an intermediate product, is the 3-N-acetylhexosaminidase Bbhl from Bifidobacterium bifidum JCM1254. A suitable glycosidase for hydrolysing the intermediate product LNT, is the -1,3-galactosidases Bga42A from Bifidobacterium longum subsp. infantis.

    [0086] In an additional and/or alternative embodiment, the genetically engineered cell, which also produces the at least one glycosidase or the at least one other cell producing the at least one glycosidase expresses the at least one glycosidase upon external induc-tion, e.g. via temperature-induced expression or via substrate-induced expression. This means that expression of the at least one glycosidase is downregulated during synthesis of the desired fucosylated oligosaccharide, and may be induced, e.g. by temperature or addition of an inductor such as IPTG, at the end of the fermentation process. The expression of the glycosidase will be induced after sufficient and/or essentially maximum amount of oligosaccharide has been produced during cultivation of the genetically engineered cell. Subsequently, the glycosidases being expressed will degrade undesired saccharide intermediates, substrates, etc., rendering the medium essentially free of the saccharide intermediates or substrates that would otherwise hinder or complicate the purification of the desired oligosaccharide. A couple of suitable inducible expression tools are known in the prior art (see, e.g. Sambrook et. al, 1989, supra), and one skilled will be able to apply a respectively suitable one for the desired oligosaccharide.

    [0087] Regulated within the present context with reference to a gene is generally understood as a gene, whose transcription can be regulated in a controlled fashion, e.g. down- or up-regulated, i.e. the quantity of the synthesised protein encoded by the regulated gene is different, e.g. de-/downregulated or upregulated, from the otherwise unregulated gene.

    [0088] In an additional embodiment, monosaccharides resulting from the degradation of the undesired saccharide intermediates, substrates, etc. can be metabolized by the genetically engineered cell.

    [0089] According to the second aspect, provided is a genetically engineered cell for producing or for use in a method for producing a fucosylated oligosaccharide. Said genetically engineered cell has been genetically engineered to express a heterologous fucosyltransferase which is capable of transferring a fucose residue from a donor substrate to an acceptor molecule, wherein said acceptor molecule is a lactotetraose.

    [0090] The term genetically engineered as used herein with reference to a host cell indicates that the host cell replicates a heterologous or recombinant nucleic acid molecule, and/or expresses a peptide or protein encoded by a heterologous nucleotide sequence (i.e., a nucleotide sequence foreign to said cell). Genetically engineered cells can contain genes that are not found within the native (non-recombinant) form of the cell. Genetically engineered cells can also contain genes found in the native form of the cell wherein the genes are modified and re-introduced into the cell by artificial means. The term also encompasses cells that contain a nucleic acid molecule endogenous to the cell that has been modified without removing the nucleic acid from the cell; such modifications include those obtained by gene replacement, site-specific mutation, and related techniques. Accordingly, a recombinant polypeptide is one which has been produced by a genetically engineered cell.

    [0091] Accordingly, a genetically engineered cell is understood as a cell which has been transformed or transfected.

    [0092] Thus, the nucleotide sequences as used in the present invention, may, e.g., be comprised in a vector which is to be stably transformed/transfected or otherwise introduced into host microorganism cells.

    [0093] Methods for generating recombinant DNA, including isolation, synthesis, purification and amplification of genetic material, for use in transforming or transfecting selected host cells are known to the skilled artisan. Thus, it is common knowledge to transform cells with hybrid viral or circular plasmid DNA which includes selected exogenous (i.e. foreign or heterologous) nucleotide sequences. These procedures known in the art involve generating a transformation vector by enzymatically cleaving circular viral or plasmid DNA to form linear DNA strands. Selected foreign DNA strands usually including sequences coding for desired protein product are prepared in linear form through use of the same/similar enzymes. The linear viral or plasmid DNA is incubated with the foreign DNA in the presence of ligating enzymes capable of effecting a restoration process and forming hybrid vectors which include the selected exogenous DNA segment spliced into the viral or circular DNA plasmid.

    [0094] The genetically enginieered cell is a prokaryotic cell or a eukaryotic dell. Appropriate cells include yeast, bacteria, archaebacteria, fungi, insect cells, plant cells and animal cells, including mammalian cells (such as human cells and cell lines).

    [0095] In an additional and/or alternative embodiment, the prokaryotic cell is a bacterial cell, preferably selected from the genus selected from the group consisting of Bacillus, Lactobacillus, Lactococcus, Enterococcus, Bifidobacterium, Sporolactobacillus spp., Micromonospora spp., Micrococcus spp., Rhodococcus spp., and Pseudomonas. Suitable bacterial species are Bacillus subtilis, Bacillus licheniformis, Bacillus coagulans, Bacillus thermophilus, Bacillus laterosporus, Bacillus megaterium, Bacillus mycoides, Bacillus pumilus, Bacillus lentus, Bacillus cereus, Bacillus circulans, Bifidobacterium longum, Bifidobacterium infantis, Bifidobacterium bifidum, Citrobacter freundii, Clostridium cellulolyticum, Clostridium ljungdahlii, Clostridium autoethanogenum, Clostridium acetobutylicum, Corynebacterium glutamicum, Enterococcus faecium, Enterococcus thermophiles, Escherichia coli, Erwinia herbicola (Pantoea agglomerans), Lactobacillus acidophilus, Lactobacillus salivarius, Lactobacillus plantarum, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus jensenii, Lactococcus lactis, Pantoea citrea, Pectobacterium carotovorum, Proprionibacterium freudenreichii, Pseudomonas fluorescens, Pseudomonas aeruginosa, Streptococcus thermophiles and Xanthomonas campestris.

    [0096] In an additional and/or alternative embodiment, the eukaryotic cell is a yeast cell, an insect cell, a plant cell or a mammalian cell. The yeast cell is preferably selected from the group consisting of Saccharomyces sp., in particular Saccharomyces cerevisiae, Saccharomycopsis sp., Pichia sp., in particular Pichia pastoris, Hansenula sp., Kluyveromyces sp., Yarrowia sp., Rhodotorula sp., and Schizosaccharomyces sp.

    [0097] The genetically engineered cell has been genetically engineered to express a heterologous fucosyltransferase being capable of transferring a fucose residue from a donor substrate to an acceptor molecule being a lactotetraose. In an additional and/or alternative embodiment, the heterologous fucosyltransferase is selected from the group consisting of polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional variants of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30.

    [0098] In an additional and/or alternative embodiment, the heterologous fucosyltransferase is encoded by a nucleic acid molecule comprising [0099] i) a nucleotide sequence as represented by any one of SEQ ID NOs: 1 to 15; [0100] ii) a nucleotide sequence having a sequence identity of at least 80% to one of the nucleotides sequences as represented by any one of SEQ ID NOs: 1 to 15, preferably across the entire length of the sequence; [0101] iii) a nucleotide sequence which encodes a polypeptide having an amino acid sequence as represented by any one of SEQ ID NOs: 16 to 30; [0102] iv) a nucleotide sequence which encodes a polypeptide having an amino acid sequence which has at least 80% identity to any one of the amino acid sequences as represented by any one of SEQ ID NOs: 16 to 30; [0103] v) a nucleotide sequence encoding a functional fragment of any one of the polypeptides according to iii) and iv); or [0104] vi) wherein the nucleic acid molecule hybridizes to a complementary strand of a nucleic acid molecule according to i), ii), iii), iv) or v) under stringent conditions.

    [0105] The nucleotide sequence encoding the heterologous fucosyltransferase may be present on a linear or circular extrachromosomal nucleic acid molecule within the genetically engineered cell or be integrated into the cell's chromosomal nucleic acid molecule, wherein said chromosomal nucleic acid molecule may be a linear or circular (bacterial chromosome) nucleic acid molecule.

    [0106] The genetically engineered cell is capable of synthesizing GDP-fucose which is necessary for the reaction to be catalyzed by the heterologous polypeptide capable of possessing fucosyltransferase activity for transferring a fucose residue from a donor substrate to a lactotetraose to produce the desired fucosylated oligosaccharide, because GDP-fucose serves as donor substrate for the fucose residue to be transferred to a lactotetraose by the heterologous fucosyltransferase. Thus, in an embodiment, the genetically engineered cell has also been genetically engineered to comprise an increased intracellular GDP-fucose production capability as compared to the cell prior to being genetically engineered.

    [0107] In an additional and/or alternative embodiment, providing an intracellular pool of GDP-fucose for producing fucosylated oligosaccharides is achieved that the genetically engineered cell has also been genetically engineered such that a gene encoding a bifunctional fucosekinase/L-fucose-1-phosphate-guanyltransferase (Fkp), preferably a gene encoding the bifunctional fucosekinase/L-fucose-1-phosphate-guanyltransferase (Fkp) from Bacteroides fragilis (acc. no. AY849806), which is capable of converting L-fucose into GDP-fucose, is expressed or overexpressed by said cell. Preferably, L-fucose is fed to the genetically engineered cell during fermentation of the cells for producing the desired fucosylated oligosaccharide.

    [0108] In an additional and/or alternative embodiment, GDP-fucose for synthesis of the desired fucosylated oligosaccharide can be taken from the cell's own GDP-fucose metabolism using the de novo pathway. To increase the intracellular GDP-fucose pool via the de novo pathway, the genetically engineered cell has also been genetically engineered to express or overexpressas compared to the cell prior to being genetically engineeredat least one of the genes encoding phosphomannomutase, mannose-1-phosphate guanosyltransferase, GDP-mannose-4,6-dehydratase, and GDP-L-fucose synthase. In a preferred embodiment, the cell is genetically modified to overexpress all four of said genes.

    [0109] In an additional and/or alternative embodiment, the genetically engineered cell has also been genetically engineered to possess an increased import of exogenous L-fucose across its cell membrane. Preferably, the genetically engineered cell has also been genetically engineered to express or overexpressas compared to the progenitor cell before being genetically engineeredone nucleotide sequence selected from the group consisting of nucleotide sequences encoding the major facilitator transporter FucP from E. coli. MG1655 (acc. no. AIZ90162), nucleotide sequences encoding functional variants of the major facilitator transporter FucP from E. coli, nucleotide sequences encoding functional fragments of the major facilitator transporter FucP from E. coli, and nucleotide sequences encoding functional variants of the functional fragments of the major facilitator transporter FucP from E. coli. Expression or overexpression of the major facilitator transporter FucP, is functional variants and/or the functional fragments thereof in the genetically engineered cell increases the cell's uptake of exogenous L-fucose across its cell membrane.

    [0110] In an additional and/or alternative embodiment, the genetically engineered cell has also been genetically engineered to prevent depletion of the cell's intracellular GDP-fucose pool. In an embodiment, the cell is genetically engineered in that expression of the gene encoding WcaJ, which catalyses the first step in colonic acid synthesis, is impaired or inactivated, preferably in that the WcaJ gene has been at least partially deleted from the cell's genetic information, or in that the nucleotide sequence of the WcaJ gene has been altered such that transcription of the gene encoding WcaJ is impossible. In an additional and/or alternative approach, the nucleotide sequence of the gene encoding WcaJ has been altered such that an enzymatically inactive polypeptide is encoded by the altered WcaJ gene, for example in that a stop codon is introduced into the open reading frame leading to a truncated variant of WcaJ, which represents an non-functional fragment, is expressed, or in that the nucleotides sequence of the WcaJ gene is altered such that the polypeptide encoded by said altered WcaJ gene differs from the wild type WcaJ in one or more amino acid residues rendering the resulting polypeptide enzymatically inactive.

    [0111] In an additional and/or alternative embodiment, the genetically engineered cell has also been genetically engineered in that the genes fucI and/or fucK, encoding the L-fucose isomerase and the L-fuculose kinase respectively, are deleted, the nucleotide sequence of fucI and/or fucK is altered to irreversibly inactivate the enzymatic activity of the corresponding polypeptide(s), or in that the expression of fucI and/or fucK is impaired. Abolishing intracellular synthesis of Fucl and/or fucK abolishes fucose catabolism in the corresponding cell, thereby increasing the amount of fucose that is available for generating GDP-fucose.

    [0112] In an additional embodiment, the genetically engineered cell has also been genetically engineered such that the cell (i) does not to express one or more polypeptides which intracellularly degrade one or more precursors of the desired fucosylated oligosaccharide to be produced, or (ii) expresses one or more polypeptides having an altered amino acid sequence and/or lengthas compared to its naturally occurring homologto impair the activity of such an enzyme intracellularly degrading one or more precursors of the desired fucosylated oligosaccharide to be produced.

    [0113] The term precursor as used herein with respect to the desired fucosylated oligosaccharides refers to compounds which are intermediates in the biosynthetic pathway of the desired fucosylated oligosaccharide to be produced. These intermediates include endogenous compounds, i.e. compounds which are produced and may be naturally present in the host cell, even when their synthesis in the bacterial host cell is enhanced by genetic modification of the host.

    [0114] In an additional and/or alternative embodiment, the genetically engineered cell has also been genetically engineered to not comprise an enzymatically active -galactosidase.

    [0115] In an additional and/or alternative embodiment, the genetically engineered cell has also been genetically modified to lack a functional LacZ or to comprise a functional LacZ gene whose expression is tightly regulated and which is not expressed during the fermentation process for producing the fucosylated oligosaccharide.

    [0116] Additionally and/or alternatively, the genetically engineered cell has also been genetically engineered such that the cell does not comprise or express polypeptides possessing an enzymatic activity which hydrolyzes another precursor of the desired fucosylated oligosaccharide than lactose, e.g. LNT-2, LNT or LNnT, or larger derivatives of LNT and LNnT. To this end, the genetically engineered cell has also been genetically engineered such that the genome of the cell does not contain a nucleotide sequence encoding a polypeptide being capable of hydrolyzing said another precursor of the desired fucosylated oligosaccharide, or such that expression of the genes encoding such proteins are regulated in that way that they are not expressed during the fermentation process for producing the fucosylated oligosaccharide.

    [0117] In an additional and/or alternative embodiment, the genetically engineered cell comprises at least one nucleotide sequence encoding a polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity. The genetically engineered cell of this embodiment is capable of expressing the polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity. Preferably, the genetically engineered cell expresses said polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity. More preferably, said genetically engineered cell comprises the polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity. Preferably, said at least one nucleotide sequence encoding a polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity is a heterologous nucleic acid sequence, i.e. is a nucleotide sequence not naturally occurring in a non-genetically engineered ancestor of the genetically engineered cell.

    [0118] By expressing a polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity, the host cell is able to ligate N-acetylglucosamine to the acceptor substrate lactose when said polypeptide possesses its -1,3-N-acetylglucosaminyltransferase activity, thereby generating LNT-2 intracellularly.

    [0119] In an additional and/or alternative embodiment, the polypeptide being capable of exhibiting -1,3-N-acetylglucosaminyltransferase activity for a transfer of N-acetyl-glucosamine to lactose is a -1,3-N-acetylglucosaminyltransferase that can be selected from the group consisting of LgtA from Neisseria meningitidis MC58 (acc. no. NP_274923) and the -1,3-N-acetylglucosaminyltransferase from Pasteurella multocida subsp. multocida str. HNO6 (acc. no. PMCN06_0022).

    [0120] In an additional and/or alternative embodiment, the genetically engineered cell comprises at least one nucleotide sequence encoding a polypeptide being capable of exhibiting -1,3-galactosyltransferase activity or -1,4-galactosyltransferase activity. The genetically engineered cell of this embodiment is capable of expressing the polypeptide being capable of exhibiting -1,3-galactosyltransferase activity or -1,4-galactosyltransferase activity. Preferably, the genetically engineered cell expresses said polypeptide being capable of exhibiting -1,3-galactosyltransferase activity or -1,4-galactosyltransferase activity. More preferably, said genetically engineered cell comprises the polypeptide being capable of exhibiting -1,3-galactosyltransferase activity or -1,4-galactosyltransferase activity. Preferably, said at least one nucleotide sequence encoding a polypeptide being capable of exhibiting -1,3-galactosyltransferase activity or -1,4-galactosyltransferase activity. is a heterologous nucleic acid sequence, i.e. is a nucleotide sequence not naturally occurring in a non-genetically engineered ancestor of the genetically engineered cell. By expressing a polypeptide being capable of exhibiting -1,3-galactosyltransferase activity or -1,4-galactosyltransferase activity, the genetically engineered cell is capable of galactosylating LNT-2 to intracellularly generate LNT or LNnT, respectively.

    [0121] In an additional and/or alternative embodiment, the polypeptide being capable of exhibiting -1,3-galactosyltransferase activity for the galactosylation of LNT-2 to produce LNT is a -1,3-galactosyltransferase selected from the group consisting of the -1,3-galactosyltransferase WbdO derived from Salmonella enterica (acc. no. AY730594) and the -1,3-galactosyltransferase being encoded by a gene selected from the group consisting of wbgO from E. coli O55:H7 (acc. No. BAG11838), furA from Lutiella nitroferrum (FuraDRAFT_0419), and functional fragments of said -1,3-galactosyltransferases.

    [0122] In an additional and/or alternative embodiment, the polypeptide being capable of exhibiting -1,4-galactosyltransferase activity for the galactosylation of LNT-2 to produce LNnT is a -1,4-galactosyltransferase selected from the group consisting of LgtB from Neisseria meningitides (acc. no. AAF42257), Lex1 from Aggregatibacter aphrophilus NJ8700 (acc. no. YP_003008647), GalT from Kingella denitrificans ATCC 33394 (acc. no. HMPREF9098_2407), GatD from Pasteurella multocida M1404 (acc. no. GQ444331), GalT from Bacterioidis fragilis NCTC9343 (acc. no. BF9343_0585), IsgD from Haemophilus influenza (acc. no. AAA24981), GaIT from Helicobacter pylori (acc. no. AB035971), and functional fragments of said -1,4-galactosyltransferases.

    [0123] UDP-galactose and UDP-N-acetylglucosamine are required for intracellular synthesis of LNT or LNnT, or larger derivatives thereof, in the genetically engineered cell.

    [0124] Intracellular UDP-galactose in the genetically engineered cell can be provided by feeding galactose to the genetically engineered cell in that the cells are cultivated in a fermentation broth that contains galactose. The galactose is taken up by the cell, phosphorylated to galactose-1-phosphate and then converted to UDP-galactose. Genes encoding polypeptides bearing the enzymatic activities that are required for these reactions are well known.

    [0125] In an additional and/or alternative embodiment, the intracellular supply of UDP-galactose can also be obtained from the cell's own metabolism, and the cell's own metabolism can be improved by genetic modification of the cell such that, for example, the cell overexpresses UDP-galactose-4-epimerase, or overexpresses the UDP-galactose-4-epimerase in combination with the glucose-1-phosphate-1-uridinyl-transferase.

    [0126] Intracellular UDP-N-acetylglucosamine in the genetically engineered cell can be also obtained from the cell's own UDP-N-acetylglucosamine metabolism. To increase the intracellular UDP-N-acetylglucosamine pool in the genetically engineered cell, the cell can be genetically modified such that one or more of the genes encoding L-glutamine: D-fuctose-6-phosphate aminotransferase, phosphoglucosamine mutase, phosphoglucomutase, and N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase are overexpressed.

    [0127] In an additional and/or alternative embodiment, the cell is genetically modified such that the N-acetylglucosamine catabolism within the genetically engineered has been inactivated. Inactivation of the cell's N-acetylglucosamine catabolism improves the intracellular level of UDP-N-acetylglucosamine being available for the intracellular synthesis of N-acetylglucosamine.

    [0128] In an additional and/or alternative embodiment, the genetically modified cell for use in the synthesis of complex fucosylated HMOs is capable of incorporating lactose across its cell membrane to accumulate lactose as starting material for the production of the desired fucosylated oligosaccharide. Therefore, the cell can express its endogenous gene encoding a lactose permease. In an additional and/or alternative embodiment, the cell is genetically modified to contain and express a heterologous lactose permease gene, in particular if the cell does not naturally comprise and expresses a gene encoding a lactose permease.

    [0129] In an additional and/or alternative embodiment, the lactose for producing the desired fucosylated oligosaccharide is provided by means of intracellular synthesis of lactose by the cell. Preferably, this is achieved in that the cell expresses an endogenous or recombinant gene encoding a 1-4-galactosyltransefrase, said 1-4-galactosyltransferase being capable of transferring the galactose moiety of UDP-galactose to a glucose molecule. This 1-4-galactosyltransefrase can be selected from Pm1141 from Pasteurella multocida (acc. no.: AEC04686) or Lex1 from Aggregatibacter aphrophilus NJ8700 (acc. no. YP_003008647).

    [0130] Thus, in an additional and/or alternative embodiment, the genetically engineered cell comprises [0131] (i) a -1,3-N-acetylglucosaminyltransferase, [0132] (ii) a -1,3-galactosyltransferase or a -1,4-galactosyltransferase; and [0133] (iii) an -1,2- and/or -1,3-fucosyltransferase.

    [0134] In another embodiment, wherein the genetically engineered cell is cultivated for producing a fucosylated oligosaccharide in that LNT-2 is added to the fermentation broth as a precursor of the acceptor molecule, the genetically engineered cell comprises [0135] (i) a -1,3-galactosyltransferase or a -1,4-galactosyltransferase; and [0136] (ii) an -1,2- and/or -1,3-fucosyltransferase as glycosyltransferase.

    [0137] According to the third aspect, provided are recombinant nucleic acid molecules for expressing a heterologous fucosyltransferase in a genetically engineered cell. The term nucleic acid molecule refers to a single- or double-stranded deoxyribonucleotide macromolecule or ribonucleotide macromolecule and comprises stranded deoxyribonucleotide macromolecule or ribonucleotide macromolecule comprising one or more known analogues or naturally or synthetically produced nucleotides.

    [0138] The recombinant nucleic acid molecule comprises a nucleotide sequence encoding for a fucosyltransferase that is selected from the group consisting of polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional variants of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30.

    [0139] In an additional and/or alternative embodiment, the nucleotide sequence encoding the fucosyltransferase is selected from the group consisting of: [0140] i) a nucleotide sequence as represented by any one of SEQ ID NOs: 1 to 15; [0141] ii) a nucleotide sequence having a sequence identity of at least 80% to one of the nucleotides sequences as represented by any one of SEQ ID Nos: 1 to 15, preferably across the entire length of the sequence; [0142] iii) a nucleotide sequence which encodes a polypeptide having an amino acid sequence as represented by any one of SEQ ID NOs: 16 to 30; [0143] iv) a nucleotide sequence which encodes a polypeptide having an amino acid sequence which has at least 80% identity to any one of the amino acid sequences as represented by any one of SEQ ID NOs: 16 to 30; [0144] v) a nucleotide sequence encoding a functional fragment of any one of the polypeptides according to iii) and iv); and [0145] vi) a nucleic acid molecule that hybridizes to a complementary strand of a nucleic acid molecule according to i), ii), iii), iv) or v) under stringent conditions.

    [0146] Within the scope of the present invention, also nucleic acid/polynucleotide and polypeptide polymorphic variants, alleles, mutants, and interspecies homologs are comprised by those terms, that have an amino acid sequence that has greater than about 60% amino acid sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, or more amino acids, to a polypeptide resembling one of the amino acid sequences from SEQ ID NOs. 16 to 30.

    [0147] Variant(s) as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains the essential (enzymatic) properties of the reference polynucleotide or polypeptide. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques, by direct synthesis, and by other recombinant methods known to the persons skilled in the art.

    [0148] In the recombinant nucleic acid molecule, the nucleotide sequence encoding the fucosyltransferase, the functional variant thereof, the functional fragment of the fucosyltransferase or the functional variant of the functional fragment is operably linked to at least one nucleotide sequence which mediates and/or controls expression of the fucosyltransferase, variant or fragment thereof, provided that the recombinant nucleic acid molecule is present in the cell.

    [0149] The term operably linked as used herein, refers to a functional linkage between a nucleic acid expression control sequence (such as promoter, operator, enhancer, regulator, array of transcription factor binding sites, transcriptional terminator, ribosome binding site) and a second nucleotide sequence, wherein the expression control sequence affects transcription and/or translation of the nucleic acid corresponding to the second nucleotide sequence. Accordingly, the term promoter designates DNA sequences which usually precede a gene in a DNA polymer and provide a site for initiation of the transcription into mRNA. Regulator DNA sequences, also usually upstream of (i.e., preceding) a gene in a given DNA polymer, bind proteins that determine the frequency (or rate) of transcriptional initiation. Collectively referred to as promoter/regulator or control DNA sequence, these sequences which precede a selected gene (or series of genes) in a functional DNA polymer cooperate to determine whether the transcription (and eventual expression) of a gene will occur. DNA sequences which follow a gene in a DNA polymer and provide a signal for termination of the transcription into mRNA are referred to as transcription terminator sequences.

    [0150] A great variety of expression systems can be used to produce the polypeptides of the invention. Such systems include, among others, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression system constructs may contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides and to synthesize a polypeptide in a host may be used for expression in this regard. The appropriate DNA sequence may be inserted into the expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., supra. Accordingly, the nucleic acid molecule for expressing a heterologous fucosyltransferase in a genetically engineered cell is selected from the group consisting of plasmids, phagemids, cosmids, bacterial artificial chromosomes (BACs) and yeast artificial chromosomes (YACs).

    [0151] According to the fourth aspect, provided are fucosyltransferases being capable of transferring a fucose residue from a donor substrate to an acceptor molecule, wherein said acceptor molecule is a lactotetraose.

    [0152] The fucosyltransferases are of bacterial origin. The fucosyltransferases can be used to synthesize fucosylated oligosaccharides, preferably complex fucosylated HMOs based on lactose, LNT and/or LNnT or other oligosaccharides. The fucosylated oligosaccharide is a lactofucopentaose.

    [0153] The fucosyltransferases are capable of transferring a fucose residue from a donor substrate, preferably GDP-fucose, to an acceptor molecule. In a preferred embodiment, the acceptor molecule is a lactotetraose, preferably LNT and/or LNnT.

    [0154] In an additional and/or alternative embodiment, the fucosyltransferase is selected from the group consisting of polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional variants of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30, and functional variants of the functional fragments of the polypeptides as represented by any one of SEQ ID NOs: 16 to 30.

    [0155] The fucosyltransferases as represented by any one of SEQ ID NOs: 16 to 30 were not described to be fucosyltransferases which are capable of transferring a fucose residue from a donor substrate to a lactotetraose as acceptor substrate. The novel fucosyltransferases as represented by any one of SEQ ID NOs: 16 to 27 have previously not even been described as fucosyltransferases as such, i.e. regardless of their acceptor molecule.

    [0156] The fucosyltransferases described herein before can be used for producing complex fucosylated oligosaccharides, either by a whole cell fermentation process, for example as described herein before, or by means of in-vitro biocatalysis. Hence, according to the fifth aspect, the use of at least one of the fucosyltransferases being capable of transferring a fucose residue from a donor substrate to an acceptor molecule, wherein said acceptor molecule is a lactotetraose for producing a fucosylated oligosaccharide is provided.

    [0157] In an additional and/or alternative embodiment, the fucosyltransferases described herein before are used to synthesize complex fucosylated HMOs by in-vitro biocatalysis.

    [0158] Using at least one of the novel fucosyltransferases in an in-vitro biocatalysis process comprises adding a suitable donor substrate containing a fucose residue, preferably GDP-fucose, and a suitable acceptor molecule to at least one of the novel fucosyltransferases in a solvent and under conditions appropriate for the fucosyltransferase to transfer the fucose residue from the donor substrate to the acceptor molecule, thereby synthesizing a fucosylated oligosaccharide. Preferably, the suitable acceptor molecule is a lactotetraose, more preferably LNT or LNnT. Using a lactotetraose as acceptor molecule, the reaction product of the fucosyltransferase in the in-vitro biocatalytic reaction is a lactofucopentaose. Said lactofucopentaose is preferably one pentasaccharide selected from the group consisting of lacto-N-fucopentaose I, lacto-N-neofucopentaose I, lacto-N-neofucopentaose III, lacto-N-fucopentaose V and lacto-N-neofucopentaose V.

    [0159] According to the sixth aspect, provided is a method for producing fucosylated oligosaccharides, preferably fucosylated human milk oligosaccharides, more preferably complex human milk oligosaccharides, most preferably a lactofucopentaose, by in vitro biocatalysis, wherein a fucosyltransferase is used, said fucosyltransferase being capable of transferring a fucose residue from a donor substrate to an acceptor molecule.

    [0160] In an embodiment of the in vitro biocatalysis, the method comprises the steps of [0161] a) providing the fucosyltransferase being capable of transferring a fucose residue from a donor substrate to an acceptor molecule in a reaction mixture; [0162] b) contacting said fucosyltransferase with a donor substrate comprising a fucose residue and an acceptor molecule, wherein said acceptor molecule is a lactotetraose, for synthesizing the fucosylated oligosaccharide.

    [0163] This embodiment comprises providing in a reaction mixture a fucosyltransferase. The term fucosyltransferase as used herein also comprises functional variants, functional fragments of said fucosyltransferase and functional variant of fragments of the fucosyltransferase, wherein functional denotes that said variants and fragments are capable of possessing a fucosyltransferase activity as described herein before.

    [0164] The method according to this embodiment further comprises reacting the mixture under conditions appropriate for having the fucose residue transferred from the donor substrate, preferably GDP-fucose, to an acceptor moiety of the acceptor molecule, said acceptor molecule preferably being a lactotetraose.

    [0165] In an additional embodiment, the method of in-vitro biocatalysis further comprises subsequent purifying and/or isolating the fucosylated acceptor molecule from the reaction mixture.

    [0166] According to the seventh aspect, provided are fucosylated oligosaccharides being produced by a whole cell fermentation approach or an in-vitro biocatalysis as described herein before.

    [0167] In an embodiment, the fucosylated oligosaccharide is a human milk oligosaccharide. Selected human milk oligosaccharides are 2-fucosyllactose, 3-fucosyllactose, 2,3-difucosyllactose, 3-fucosyl-3-sialyllactose, 3-fucosyl-6-sialyllactose, lacto-N-fucopentaose I, lacto-N-neofucopentaose III, lacto-N-fucopentaose V, lacto-N-neofucopentaose I, lacto-N-neofucopentaose V, lacto-N-difucosylhexaose I, lacto-N-difucosylhexaose II, fucosyl-lacto-N-sialylpentaose b, fucosyl-lacto-N-sialylpentaose c, lacto-N-neodifucohexaose I, Disialyl-lacto-N-fucopentaose V, and fucosyl-para-lacto-N-hexaose IV. The structures of selected human milk oligosaccharides are displayed in Table 2.

    [0168] In an embodiment, the fucosylated oligosaccharide that can be produced by utilizing a fucosyltransferase as described herein before is selected from the group consisting of pentasaccharides, preferably selected from the group consisting of lacto-N-fucopentaose I, lacto-N-neofucopentaose I, lacto-N-neofucopentaose III, lacto-N-fucopentaose V, lacto-N-neofucopentaose V.

    [0169] Notwithstanding that the lactofucopentaoses named in the previous paragraph constitute direct reaction products of the enzymatic activities of the fucosyltransferase described herein before, said lactofucopentaoses may be further processed. For example, said lactofucopentaoses can be provided as acceptor molecules to further glycosyltransferases such that the resulting hexaoses, for example those in Table 2, and heptaoses can also be considered as fucosylated oligosaccharides that can be produced by utilizing the fucosyltransferases as disclosed herein. Moreover, it can be envisaged that the fucosyltransferases can also be employed in producing trisaccharides and/or tetrasaccharides such as those identified in Table 2.

    TABLE-US-00002 TABLE 2 Structures of exemplary HMOs. Name Abbreviation Structure 2-Fucosyllactose 2-FL Fuc(1-2)Gal(1-4)Gluc 3-Fucosyllactose 3-FL Gal(1-4)[Fuc(1-3)]Gluc 2,3-Difucosyllactose DF-L Fuc(1-2)Gal(1-4)[Fuc(1-3)]Gluc Lacto-N-fucopentaose I LNFP I Fuc(1-2)Gal(1-3)GlcNAc(1-3)Gal(1-4)Gluc Lacto-N-neofucopentaose I LNnFP I Fuc(1-2)Gal(1-4)GlcNAc(1-3)Gal(1-4)Gluc Lacto-N-neofucopentaose III LNFP III Gal(1-4)[Fuc(1-3)]GlcNAc(1-3)Gal(1-4)Gluc Lacto-N-fucopentaose V LNFP V Gal(1-3)GlcNAc(1-3)Gal(1-4)[Fuc(1-3)]Gluc Lacto-N-neofucopentaose V LNnFP V Gal(1-4)GlcNAc(1-3)Gal(1-4)[Fuc(1-3)]Gluc Lacto-N-difucohexaose I LNDH I Fuc(1-2)Gal(1-3)[Fuc(1-4)]GlcNAc(1- 3)Gal(1-4)Gluc Lacto-N-difucohexaose II LND Gal(1-3)[Fuc(1-4)]GlcNAc(1-3)Gal(1- 4)[Fuc(1-3)]Gluc para-Lacto-N-fucohexaose paraLNT Gal(1-3)GlcNAc(1-3)Gal(1-4)[Fuc(1- 3)]GlcNAc(1-3)Gal(1-4)Gluc Fucosyl-lacto-N-sialylpentaose b F-LST-b Fuc(1-2)Gal(1-3) [Neu5Ac(2-6)]GlcNAc(1- 3)Gal(1-4)Gluc Fucosyl-lacto-N-sialylpentaose c F-LST-c Neu5Ac(2-3)Gal(1-3)GlcNAc(1-3)Gal(1- 4)[Fuc(1-3)]Gluc Disialyl-lacto-N-fucopentaose DS-LNFP V Neu5Ac(2-3)Gal(1-4)[Neu5Ac(2- 6)]GlcNAc(1-3)Gal(1-4)[Fuc(1-3)]Gluc 3-Fucosyl-3-sialyllactose 3F-3-SL Neu5Ac(2-3)Gal(1-4)[Fuc(1-3)]Gluc 3-Fucosyl-6-sialyllactose 3F-6-SL Neu5Ac(2-6)Gal(1-4)[Fuc(1-3)]Gluc Lacto-N-neodifucohexaose I LNnDFH I Gal(1-4)[Fuc(1-3)]GalNAc(1-3)Gal(1- 4)[Fuc(1-3)]Gluc

    [0170] According to the eighth aspect, provided is the use of a fucosylated oligosaccharide being produced by a whole cell fermentation approach or an in vitro biocatalysis as described herein before for manufacturing a nutritional composition. Said nutritional composition contains at least one fucosylated oligosaccharide which has been produced by a method as disclosed herein before.

    [0171] Thus, according to the ninth aspect, provided is a nutritional composition containing at least one fucosylated oligosaccharide which has been produced by a method as disclosed herein before. The at least one fucosylated oligosaccharide is a lactofucopentaose. The at least one lactofucopentaose in the nutritional composition is selected from the group consisting of lacto-N-fucopentaose I, lacto-N-neofucopentaose I, lacto-N-neofucopentaose III, lacto-N-fucopentaose V and lacto-N-neofucopentaose V.

    [0172] In an additional embodiment, the nutritional composition is selected from the group consisting of medicinal formulations, infant formulations and dietary supplements.

    [0173] The nutritional composition may be present in liquid form or in solid form including, but not limited to, powders, granules, flakes and pellets.

    [0174] The present invention will be described with respect to particular embodiments and with reference to drawings, but the invention is not limited thereto but only by the claims. Furthermore, the terms first, second and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequence, either temporally, spatially, in ranking or in any other manner. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

    [0175] It is to be noticed that the term comprising, used in the claims, should not be interpreted as being restricted to the means listed thereafter; it does not exclude other elements or steps. It is thus to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more other features, integers, steps or components, or groups thereof. Thus, the scope of the expression a device comprising means A and B should not be limited to devices consisting only of components A and B. It means that with respect to the present invention, the only relevant components of the device are A and B.

    [0176] Reference throughout this specification to one embodiment or an embodiment means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases in one embodiment or in an embodiment in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to one of ordinary skill in the art from this disclosure, in one or more embodiments.

    [0177] Similarly, it should be appreciated that in the description of exemplary embodiments of the invention, various features of the invention are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects. This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. Thus, the claims following the detailed description are hereby expressly incorporated into this detailed description, with each claim standing on its own as a separate embodiment of this invention.

    [0178] Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the following claims, any of the claimed embodiments can be used in any combination.

    [0179] Furthermore, some of the embodiments are described herein as a method or combination of elements of a method that can be implemented by a processor of a computer system or by other means of carrying out the function. Thus, a processor with the necessary instructions for carrying out such a method or element of a method forms a means for carrying out the method or element of a method. Furthermore, an element described herein of an apparatus embodiment is an example of a means for carrying out the function performed by the element for the purpose of carrying out the invention.

    [0180] In the description and drawings provided herein, numerous specific details are set forth. However, it is understood that embodiments of the invention may be practiced without these specific details. In other instances, well-known methods, structures and techniques have not been shown in detail in order not to obscure an understanding of this description.

    [0181] The invention will now be described by a detailed description of several embodiments of the invention. It is clear that other embodiments of the invention can be configured according to the knowledge of persons skilled in the art without departing from the true spirit or technical teaching of the invention, the invention being limited only by the terms of the appended claims.

    Example 1: Identification of Fucosyltransferases Fucosylating Lacto-N-Tetraose and Lacto-N-Neotetraose

    [0182] The GenBank database was reviewed for putative fucosyltransferases encoded in the genome of various bacterial species. One hundred twentyfive putative fucosyltransferases which were not annotated as fucosyltransferase before were revealed by this approach.

    [0183] The genes encoding the putative fucosyltransferases (fucTs) were codon optimized for expression in E. coli and purchased from GenScript Cooperation (Piscataway, USA).

    [0184] The fucosyltransferase genes were subcloned by sequence and ligation-independent cloning (SLIC) in vector pINT-malE-zeo downstream of the malE gene which encodes the maltose-binding protein (MBP) and allows the synthesis of a MBP-fusion protein (FIG. 1), using primers 2700, and 2702 for amplification of the fucT-genes and primers 2701 and 2703 for amplification of pINT-malE-zeo (oligonucleotide primers used are listed in Table 3).

    [0185] The fucT-genes were expressed in E. coli ER 2508 (New England Biolabs, Ipswich, USA). The genes encoding the alpha-1,2-fucosyltransferases wbgL from E. coli 0126 and fucT2Hp from Helicobacter pylori were also codon optimized for expression in E. coli, also purchased from GenScript Cooperation, and cloned into the Ncol and BamHI sites of vector pACYC (Novagen, Merck, Darmstadt, Germany) under transcriptional control of the T7 promoter. WbgL and fucT2Hp were amplified with oligonucleotides 141 and 142, and 143 and 144, respectively. The vector as well the PCR amplification products were digested with restriction endonucleases Ncol and BamHI and ligated. E. coli transformants were selected on chloramphenicol. WbgL and fucT2HP were expressed in E. coli BL21(DE3) AlacZ (bacterial strains used in this work are listed in Table 4).

    TABLE-US-00003 TABLE3 Oligonucleotidesusedforpolymerase chainreactions SEQ primer Sequence(5-3) IDNO: 2700 AACGCCGCCAGCGGTCGTCAGACTGTCG 44 2702 TAAGCAGAAGGCCATCCTGACGGATGGC 45 2701 GCGGCCGCGTCGACACGCAAAAAGG 46 2703 AGTCTGCGCGTCTTTCAGGGCTTCATCG 47 141 GATCCCATGGAAGTTAAAATCATTGGTGGTC 48 142 GCGCGGATCCTTACAGTTTCACCCAAGATTCCG 49 143 TATACCATGGCTTTTAAGGTGGTGCAAATTTGCGG 50 144 AATTCGGATCCTTAAGCGTTATACTTTTGGGATTTCA 51 CC 1119 CTGTCTCTTATACACATCTCCTGAAATTGGCCAGATG 52 ATTAATTCCTAATTTTTGTTG 1120 CTGTCTCTTATACACATCTCAGCATTACACGTCTTGA 53 GCGATTGTGTAGG 2194 CTGTCTCTTATACACATCTGGGAATTGATTCTGGTAC 54 CAAATGAGTC 2235 CTGTCTCTTATACACATCTCCCCAGGCTTTACACTTT 55 ATGCTTCC 6473 CTGTCTCTTATACACATCTTTACTCAGCAATAAACTG 56 ATATTCCGTCAGGCTGG 6474 CTGTCTCTTATACACATCTTTCCGTTAACGTCGGTAG 57 TGCTGACCTTGCCGGAGG

    TABLE-US-00004 TABLE 4 Bacterial strains used Strain Genotype Reference E. coli BL21(DE3) F ompT hsdSB(rB, mB) gal dcm (DE3) Merck KGaA, Darmstadt, Germany E. coli ER 2508 F.sup. ara-14 leuB6 fhuA2 (argF-lac)U169 New England lacY1 Ion::miniTn10(Tet.sup.R) glnV44 galK2 Biolabs, Ipswich, rpsL20(Str.sup.R) xyl-5 mtl-5 (malB) USA zjc::Tn5(Kan.sup.R) (mcrC-mrr).sub.HB101 E. coli BL21(DE3) E. coli BL21(DE3) lacZ This study lacZ E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study 534 fucIK nagAB harbouring genomic integrations of: galETKM, lacY E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ Patent #724 fucIK nagAB harbouring genomic WO integrations of: galETKM, lacY, lgtA-galT- 2015/15032811 kanR, glmUM-glmS-dhfr E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #753 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #993 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat, fkp-aacC1 E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #1046 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, lgtB-tetA, galE- cat E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #1076 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, lgtB-tetA, galE- cat, fkp-aacC1 E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #1197 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat, fkp-aacC1, malE-fucT61-zeoR E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ EP 2 845 905 (A1) #1369 fucIK nagAB harbouring genomic integrations of: galETKM, lacYHis-aad1, bbhl-zeoR, lacZ-aacC1 E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ #1445 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat, manC-manB-gmd-wcaG E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #1772 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, lgtA-galT- kanR, glmUM-glmS-dhfr, wbdO-galE-cat, fkp-aacC1, malE-fucT61-zeoR, fucP-aad1 E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #1796 fucIK nagAB harbouring genomic integrations of: galETKM, lacY, fkp, setA- tetA, malE-fucT109-zeoR E. coli BL21(DE3) E. coli BL21(DE3) lacZ ara wcaJ This study #1886 fucIK nagAB harbouring genomic integrations of: galETKM, lacYHis-aad1, bbhl-zeoR, lacZ-aacC1, bga42A-cat

    [0186] E. coli ER 2508 containing pINT-malE-fucT-zeo plasmids were grown in 2YT broth (Sambrook et. al, 1989, supra) containing ampicillin 100 g/ml and zeocin 40 g/ml to an OD600 nm of 0.3 before expression of the malE-fucT genes was induced by adding 200 g/ml anhydrotetracycline. E. coli BL21(DE3) lacZ harbouring pACYC-wbgL or pACYC-fucT2Hp was grown in 2YT broth containing 34 g/ml chloramphenicol. When an OD600 nm of 0.3 was reached, expression was induced with 0.3 mM IPTG. After 16 h incubation at 30 C. cells were harvested by centrifugation.

    [0187] Cells were disrupted mechanically using glass beats. Cell free extracts of the expression clones containing equal protein concentrations were incubated in 100 l fucosyltransferase activity assays for 22 h at 37 C. The assays contained 5 mM GDP-L-fucose, 5 mM LNT or LNnT and 1 mM ATP in 20 mM Tris/HCl, pH 7.4 with 200 mM NaCl.

    [0188] Formation of fucosylated LNT or LNnT was determined by thin layer chromography (TLC) using silica gel TCL plates (Silica Gel 60 F254 (Merck KGaA, Darmstadt, Germany)). A mixture of butanol:acetone:acetic acid:H.sub.2O (35/35/7/23 (v/v/v/v)) was used as mobile phase. For detection of the separated substances the TCL was soaked with Thymol reagent (0.5 g Thymol solved in 95 ml ethanol, 5 ml sulfuric acid added) and heated.

    [0189] Product formation and identification was additionally determined by mass spectrometry. Mass spectrometry analysis was performed by MRM (multiple reaction monitoring) using a LC Triple-Quadrupole MS detection system (Shimadzu LC-MS 8050) (Shimadzu Corporation, Kyoto, Japan). Precursor ions are selected and analyzed in quadrupole 1, fragmentation takes place in the collision cell using argon as CID gas, selection of fragment ions is performed in quadrupole 3. Selected transitions and collision energies (CE) for intermediates and end-product metabolites are listed in Table 5. Chromatographic separation of lactose, LNT-II, LNT and LNFP variants after dilution of culture supernatant, particle-free biocatalysis-reaction or crude extract, respectively, 1:50 or 1:100 with H.sub.2O (LC/MS Grade), was performed on a XBridge Amide HPLC column (3.5 m, 2.150 mm (Waters, USA). Before applying to the LC/MS analyses samples were prepared by filtering (0.22 m pore size) and clearing by solid phase extraction on an ion exchange matrix (Strata ABW, Phenomenex). The HPLC system consists of a Shimadzu Nexera X2 SIL-30ACmp Autosampler run at 8 C., a Shimadzu LC-20AD Pump, and a Shimadzu CTO-20AC column oven that was run at 35 C. (Shimadzu Corporation, Kyoto, Japan). The mobile phase was composed of acetonitrile:H.sub.2O with 0.1% (v/v) ammonium hydroxide. A 1 l sample was injected into the instrument; the run was performed for 5.00 min with a flow rate of 300 l/min. All metabolites were analyzed by MRM in ESI negative ionization mode. The mass spectrometer was operated at unit resolution. Collision energy, Q1 and Q3 Pre Bias were optimized for each analyte individually. Quantification methods were established using commercially available standards (Carbosynth, Compton, U K and Elicityl, Crolles, France).

    [0190] LNFP variants based on the fucosylation of the intermediate Lacto-N-tetraose (LNT) can be identified by chromatographic separation (LNFP-I2.4 min; and LNFP-V2.5 min). The slightly different retention times are caused by the difference in the type of fucosylation of LNT (alpha-1,2-fucosylation on galactose for LNFP-I; alpha-1,4-fucosylation on N-acetyl-glucosamine for LNFP-II and alpha-1,3-fucosylation on glucose for LNFP-V). In addition, they can be identified by their transition pattern (see Table 5) due to specific fragmentation patterns related to the position of the fucosylation.

    [0191] LNnFP variants based on the difference in position of the fucosylation (alpha-1,2-fucosylation on galactose for LNnFP-I and alpha-1,3-fucosylation on N-acetylglucosamine for LNnFPIII and on glucose for LNnFP-V) of the intermediate Lacto-N-neotetraose (LNnT) can be identified by chromatographic separation (FIG. 2a). In addition, they can be identified by their transition pattern (see Table 5) due to specific fragmentation patterns related to the position of the fucosylation.

    [0192] LNnFP-III and LNnFP-V have only a slight difference in retention time by 0.1 min. Analysis of in vitro enzyme reactions using the -1,3-fucosyltransferase FucT109 showed a mixture of LNnFP-III and LNnFP-V (see FIG. 2b).

    [0193] Table 6 summarizes the fucosyltransferases tested for fucopentaose production and the detected products from the biocatalytic reactions when using LNT, and LNnT as glycan substrate, respectively.

    TABLE-US-00005 TABLE 5 List of transitions for metabolites analyzed for identification and quantification of intermediates and end-products. Transition 1 Transition 2 Transition 3 Metabolite [m/z Q1 > Q3] CE [m/z Q1 > Q3] CE [m/z Q1 > Q3] CE Lactose [M H] 341.00 > 161.15 9 341.00 > 101.05 15 341.00 > 179.15 7 LNT-II [M H] 544.20 > 161.00 16 544.20 > 382.10 11 544.20 > 112.90 28 LNT [M H] 706.20 > 202.10 22 706.20 > 142.00 31 706.20 > 382.10 17 LNnT [M H] 706.10 > 179.20 29 706.10 > 263.25 21 706.10 > 382.30 17 LNFP-I [M H] 852.10 > 690.20 16 852.10 > 325.10 23 852.10 > 205.20 40 LNnFP-I [M H] 852.30 > 409.20 29 852.30 > 427.20 22 852.30 > 205.15 49 LNFP-II [M H] 852.30 > 348.20 23 852.30 > 163.05 40 852.30 > 288.20 29 LNnFP-III [M H] 852.30 > 364.10 21 852.30 > 179.10 35 852.30 > 161.15 30 LNFP-V [M H] 852.30 > 544.20 15 852.30 > 202.15 29 852.30 > 142.15 44 LNnFP-V [M H] 852.30 > 544.20 13 852.30 > 179.15 38 852.30 > 281.15 24

    Example 2: Development of an E. coli Lacto-N-Triose II Production Strain

    [0194] Escherichia coli BL21(DE3) was used to construct a lacto-N-triose II (LNT-2) producing strain. Metabolic engineering included mutagenesis and deletions of specific genes, respectively, and genomic integrations of heterologous genes. The genes lacZ and araA were inactivated by mutagenesis using mismatch-oligonucleotides.

    [0195] Genomic deletions were performed according to the method of Datsenko and Wanner. To prevent intracellular degradation of N-acetylglucosamine, genes encoding N-acetyl-glucosamine-6-phosphate deacetylase (nagA) and glucosamine-6-phosphate deaminase (nagB) were deleted from the genome of the E. coli strain BL21 (DE3) strain. Also genes wzxC-wcaJ were deleted. WcaJ encodes an UDP-glucose:unde-caprenyl phosphate glucose-1-phosphate transferase catalysing the first step in colanic acid synthesis. In addition, the genes fucI and fucK, coding for L-fucose isomerase and L-fuculose kinase, respectively, were removed.

    [0196] Genomic integration of heterologous genes was performed by transposition. Either the EZ-Tn5 transposase (Epicentre, USA) was used to integrate linear DNA-fragments or the hyperactive C9-mutant of the mariner transposase Himar1 was employed for transposition. To produce EZ-Tn5 transposomes the gene of interest together with a FRT-site flanked antibiotic resistance marker was amplified with primers 1119 and 1120; the resulting PCR-product carried on both sites the 19-bp Mosaic End recognition sites for the EZ-Tn5 transposase. For integration using Himar1 transposase expression constructs (operons) of interest were similarly cloned together with a FRT-site flanked antibiotic resistance marker into the pEcomar vector. The pEcomar vector encodes the hyperactive C9-mutant of the mariner transposase Himar1 under the control of the arabinose inducible promoter P.sub.araB. The expression fragment <P.sub.tet-lacY-FRT-aadA-FRT> (SEQ ID NO: 31) was integrated by using the EZ-Tn5 transposase. After successful integration of the gene for the lactose importer LacY from E. coli K12 TG1 (acc. no. ABN72583) the resistance gene was eliminated from streptomycin resistant clones by the FLP recombinase encoded on plasmid. The strain obtained by that modifications was strain #534. The N-acetylglucosamine glycosyltransferase gene IgtA from Neisseria meningitidis MC58 (acc. no. NP_274923) was codon-optimized for expression in E. coli and prepared synthetically by gene synthesis. Together with the gene galT, encoding a galactose-1-phosphate uridylyltransferase from E. coli K-12 substr. MG1655 (acc. no. NP_415279) that was similarly obtained by gene synthesis, IgtA was inserted by transposition (SEQ ID NO: 32) using plasmid pEcomar-IgtA-galT. To enhance de novo synthesis of UDP-N-acetylglucosamine, genes encoding L-glutamine:D-fuctose-6-phosphate aminotransferase (glmS), phosphoglucosamine mutase from E. coli K-12 substr. MG1655 (glmM) and N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase (glmU) from E. coli K-12 substr. MG1655 (acc. no. NP_418185, NP_417643, NP_418186, respectively) were codon-optimized and obtained by gene synthesis. The operon glmUM was cloned under the control of constitutive tetracycline promoter P.sub.tet while glmS was cloned under the constitutive PT5 promoter. The transposon cassette <P.sub.tet-glmUM-P.sub.T5-glmS-FRT-dhfr-FRT> (SEQ ID NO: 33), flanked by the inverted terminal repeats specifically recognized by the mariner-like element Himar1 transposase was inserted from pEcomar-glmUM-glmS revealing a lacto-N-triose 2 production strain (#724). The strain E. coli BL21(DE3) was used as initial host strain for the development of the E. coli production strain.

    Example 3: Engineering of an E. coli Strain to Screen Fucosyltransferases In Vivo for Producing Fucosylated LNT

    [0197] The 1,3-galactosyltransferase gene wbdO from Salmonella salamae (acc. no. AAV34525) was codon-optimized for expression in E. coli and prepared synthetically by GenScript cooperation. The galE gene was amplified from genomic DNA of E. coli K12. Both genes were inserted as <P.sub.tet-wbdOco-P.sub.T5-galE-FRT-cat-FRT> (SEQ ID NO: 34) transposon into the strain #724 by transposition using plasmid pEcomar-wbdO-galE. The resulting strain is #753. To enhance the supply of GDP-fucose, the bifunctional fucosekinase/L-Fucose-1-phosphate-guanyltransferase (tkp) from Bacteroides fragilis (accession no. AY849806) converting L-fucose into GDP-fucose was overexpressed in the E. coli BL21 (DE3) strain. The fkp gene (originally amplified from genomic DNA of Bacteroides fragilis (ATCC 25285D)) together with a preceding promoter P.sub.tet was fused to the lox-site flanked gentamycin resistance gene using splicing by overlap extension PCR (SOE-PCR) and primers 1119 and 1120; the resulting EZ-Tn5<P.sub.tet-fkp-lox-aacC1-lox> (SEQ ID NO: 35) transposon was integrated in the E. coli BL21(DE3) strain mediated by the EZ-Tn5 transposase, obtaining strain #993. Alternatively, for the de novo synthesis of GDP-L-fucose genes encoding phosphomannomutase (manB), mannose-1-phosphate guanosyltransferase (manC), GDP-mannose-4,6-dehydratase (gmd), and GDP-L-fucose synthase (wcaG) from E. coli K12 DH5a were overexpressed in the E. coli BL21(DE3) strain; the operon manCB was set under control of the constitutive promoter P.sub.tet, the operon gmd, wcaG is transcribed from the also constitutive PT5 promoter. The transposon cassette <P.sub.tet-manCB-P.sub.T5-gmd, wcaG-FRT-aacC1-FRT> (SEQ ID NO: 36), including the gene aacC1 conferring a gentamycin resistance to the bacterial host was flanked by the inverted terminal repeats specifically recognized by the mariner-like element Himar1 transposase. It was inserted into the genome of strain #753 from pEcomar C9-manCB-gmd, wcaG-aacC1, yielding strain #1445.

    Example 4: Engineering of an E. coli Strain to Screen Fucosyltransferases In Vivo for Producing Fucosylated LNnT

    [0198] The -1,4-galactosyltransferase genes IgtB from Neisseria meningitides (acc. no. AAF42257) was optimized for expression in E. coli and prepared synthetically by GenScript cooperation. Together with a FRT-site flanked tetracycline resistance gene it was inserted as <P.sub.T5-IgtB-FRT-tetA-FRT> (SEQ ID NO: 37) transposon into the strain #724 by transposition using plasmid pEcomar-IgtB. The galE gene was amplified from genomic DNA of E. coli K12 and fused by SOE-PCR with the promoter P.sub.tet and a chloramphenicol resistance gene. Using primers that generate 19-bp Mosaic End recognition sites for the EZ-Tn5 transposase (primer 2194 and 2235) the EZ-transposon <P.sub.tet-galE-FRT-cat-FRT> was constructed to be integrated into the E. coli BL21(DE3) strain to obtain strain #1046. Alternatively, the -1,4-galactosyltransferase gene lex1 from Aggregatibacter aphrophilus NJ8700 (acc. no. YP_003008647), synthetically synthesised and codon optimized for E. coli, was integrated into strain #724. The lex1 gene was fused to the malE gene, encoding the maltose binding protein (MBP), obtaining a N-terminal fusion of MBP to Lex1. The malE-lex1 fusion was integrated concomitantly with galE (SEQ ID NO: 38), under transcriptional control of the Ret promoter, by transposition using pEcomar-malE-lex1-galE-cat. Using EZ-fragment EZ-Tn5<P.sub.tet-fkp-FRT-aacC1-FRT> (see Example 3) the gene encoding the fucosekinase/L-Fucose-1-phosphate-guanyltransferase (fkp) from Bacteroides fragilis was chromosomally integrated in strain #1046, yielding strain #1076.

    Example 5: In Vivo Screening of Fucosyltransferases Fucosylating LNT, and LNnT

    [0199] The mineral salts (MS) medium used for cultivation of strains for the synthesis of fucopentaoses contained 7 g/L NH.sub.4H.sub.2PO.sub.4, 7 g/L K.sub.2HPO.sub.4, 2 g/L KOH, 0.3 g/L citric acid, 2 g/L MgSO.sub.47H.sub.2O, and 0.015 g/L CaCl.sub.26H.sub.2O, supplemented with 1 mL/L trace element solution (54.4 g/L ammonium ferric citrate, 9.8 g/L MnCl.sub.24H.sub.2O, 1.6 g/L CoCl.sub.26H.sub.2O, 1 g/L CuCl.sub.22H.sub.2O, 1.9 g/L H.sub.3BO.sub.3, 9 g/L ZnSO.sub.47H.sub.2O, 1.1 g/L Na.sub.2MoO.sub.42H.sub.2O, 1.5 g/L Na.sub.2SeO.sub.3, 1.5 g/L NiSO.sub.46H.sub.2O).

    [0200] Using strains #993 or #1445 for LNT, and #1076 for LNnT as FucT substrates, respectively, plasmids pINT-malE-fucT-zeo were used to produce fucosylated pentasaccharides in vivo. The plasmid containing strains were grown in 20 ml mineral salt (MS) medium with 2% glucose as carbon source, 200 ng/ml anhydrotetracycline as inducer for gene expression and the antibiotics ampicillin 100 g/ml, and zeocin 20 g/ml. The bacteria were cultivated at 30 C. in baffled shaking flasks to an OD600 nm of 0.3 before 3 mM lactose and 2 mM L-fucose for derivatives of strain #993, and #1076, and 3 mM lactose for derivatives of strain #1445 were added.

    [0201] After 24 h to 72 h of cultivation cells were harvested by centrifugation, washed once in saline (0.9% (w/v) NaCl), resuspended in 150 l to 200 l saline (depending on the pellet size), and disrupted mechanically using glass-beats. Clear supernatant was achieved by palletising the cell debris. The formation of fucosylated LNT was detected by analysing the intracellular metabolites by TLC, the results are summarized in Table 6. In order to analyse the formation of LNFP-V by FucT109 from Bacteroides fragilis NTCT 9343 that is secreted in the culture supernatant, intact cells were centrifuged and the supernatant was applied to a TLC analysis (FIG. 4). FIG. 4 depicts a TLC analyses of culture supernatants of lacto-N-fucopentaose producing E. coli strains, containing pINT-malE-fucT109-zeo. LNFP-V is detected in the supernatant of strains expressing the malE-fucT109 fusion gene by comparing the migration rate to purified a standard sugar. Reference sugars: lane 1: lactose; lane 2: LNT-2, lane 3: LNT+LNFP-V, lane 4: LNT; lane 5: supernatant sample from strain #993, lane 6: supernatant sample from strain #993 pINT-malE-fucT109-zeo, lane 7: supernatant sample from strain #1445, lane 8: supernatant sample from strain #1445 pINT-malE-fucT109-zeo.

    Example 6: Synthesis of LNFP-I in a Fermentative Process

    [0202] Integration of fucT Genes in E. coli BL21(DE3) Derivatives

    [0203] Using strain #993 as host, the genes encoding fucosyltransferases fucT41 (Gramella forsetii KT0803, acc. No. WP_011708479), FucT 48 (Francisella philomiragia ssp. philomiragia ATCC 25015, acc. No. EET21243.1), FucT49 (Pseudogulbenkiania ferrooxidans, acc. No. EEG10438.1), FucT54 (Sideroxydans lithotrophicus ES-11, acc. No. ADE13114.1), FucT61 (Pseudoalteromonas haloplanktis ANT/505, acc. No. EG174693.1), FucT66 (Roseovarius nubinhibens ISM, acc. No. EAP78457.1), and FucT69 (Thalassospira profundimaris WP0211, acc. No. EKF09232.1), were chromosomally integrated. The malE-fucT fusion gene together with the preceding promoter P.sub.tet and the zeocine resistance gene was amplified with primers 1119 and 1120 using pINT-malE-fucT-zeo plasmids as templates; the transposon cassette EZ-Tn5<P.sub.tet-malE-fucT-zeo> was inserted in the E. coli BL21(DE3) strain using the EZ-Tn5 transposase.

    [0204] The strains harboring the malE-fucT integration were grown at 30 C. in 96-well pates in 200 l MS medium containing 2% glucose, and 20 g/ml zeocin with shaking. After 24 h cultivation, 50 l of the cultures were transferred into 400 l fresh MS-medium with 2% glucose, 20 g/ml zeocin, 3 mM lactose and 2 mM L-fucose. After 48 h of cultivation the supernatants of the cultures were analyzed by LC/MS. Results for different FucT genes are shown in FIG. 5, wherein error bars display standard deviation of five separate cultures of the same strain. The fucT61 expressing strain (#1197) achieved the highest LNFP-I titer compared to the other integrants (FIG. 5).

    Engineering of the Fucose Import for the Production of LNFP-I

    [0205] Enhanced LNFP-I production by strain 1197 was achieved by integration of the major facilitator transporter FucP of E. coli MG1655 (acc. no. AIZ90162). FucP together with a preceding P.sub.tet promoter and a streptomycin resistance gene was amplified with primer 1119 and 1120 (<P.sub.tet-fucP-FRT-aad1-FRT>, SEQ ID NO: 39) and chromosomally integrated by transposition using the EZ Tn5 transposase. The strain with fucT61 and fucP was named as strain #1772.

    [0206] Growing strains #1197 and #1772 in 96-well plates in MS medium with 2% glucose as carbon source in the presents of 3 mM lactose and 2 mM L-fucose, the LNFP-I concentration detected in the supernatant of strain #1772 was twice of that found in the supernatant of strain #1197.

    Production of LNFP-I by Fermentation

    [0207] Pilot fermentation of strain #1772 was conducted at 30 C. in a 3 L-fermentor containing 1 L MS-medium. 2% glucose and 2.5 g/L NH.sub.4Cl were added to the medium prior to inoculation; the fermentation was carried out without the addition of antibiotics. The pH was held constantly at 7.0 by titrating with 10% ammonia. The fermenter was seeded with cultures from shake flasks to an OD600 nm of 0.1. At an OD600 nm of about 10 1 mM lactose and 1 mM L-fucose were added; the two substrates were fed in 1-2 mM doses repeatedly according to grows and production rates. When the glucose batch of 2% was depleted, glucose was fed continuously from a 50% glucose stock. After 87 h of cultivation the culture reached an OD600 nm of 185. A LNFP-I concentration of 4.3 g/L was determined in the culture supernatant by LC/MS analysis. Lactose, LNT-2, and LNT were found as sugar by-products in the supernatant (FIG. 6). The graphic of FIG. 6 demonstrates the production of LNFP-I by E. coli (strain #1772) in a 1 L-fermentation using glucose as carbon source. The product concentrations were measured in the culture supernatant after 87 h of fermentation. Besides LNFP-I (4.3 g/L), lactose (13.11 g/L), LNT-2 (4.6 g/L), and LNT (1.1 g/L) were detected in the supernatant.

    TABLE-US-00006 TABLE 6 Fucosyltransferases analysed in this study. Fucosyltransferase activities were determined using LNT and LNnT as glycan substrates. Formation of fucopentaoses was determined as well in vitro, as in vivo, using whole cell transformation. Identification of the fucopentaose was performed by LC/MS. In vivo In vitro In vitro fucosylation of fucosylation fucosylation FucT source acc. No. predicted function LNT LNnT of LNT product of LNnT product fucT2 Helicobacter AAP76669 -(1,3)- + + LNFP-III hepaticus fucosyltransferase ATCC 51449 fucT22 Brachyspira CCG56842 -(1,2)- n.t. + + LNFP-I pilosicoli WesB fucosyltransferase fucT32 Yersinia sp. CAI39173 -(1,2)- + + LNFP-I A125 KOH2 fucosyltransferase fucT41 Gramella forsetii WP_011708479 putative -(1,2)- + + LNFP-I KT0803 fucosyltransferase fucT48 Francisella EET21243.1 putative -(1,2)- + + + LNFP-I philomiragia fucosyltransferase ssp. philomiragia ATCC 25015 fucT49 Pseudogulbenkiania EEG10438.1 putative -(1,2)- + + LNFP-I ferrooxidans fucosyltransferase fucT54 Sideroxydans ADE13114.1 putative -(1,2)- + + LNFP-I lithotrophicus fucosyltransferase ES-11 fucT55 Providencia AFH02807.1 putative -(1,2)- + LNFP-I alcalifaciens fucosyltransferase fucT61 Pseudoalteromonas EGI74693.1 -(1,2)- + haloplanktis fucosyltransferase ANT/505 fucT66 Roseovarius EAP78457.1 putative -(1,2)- + + LNFP-I nubinhibens fucosyltransferase ISM fucT69 Thalassospira EKF09232.1 glycosyl transferase + + profundimaris family 11 WP0211 fucT73 Desulfovibrio ABB39672.1 glycosyl transferase n.t. + + LNFP-I alaskensis family 11 (strain G20) fucT92 Thermosynechococcus BAC08546.1 -1,2- n.t. + + LNFP-I elongatus (strain fucosyltransferase BP-1) fucT109 Bacteroides CAH09151.1 putative LPS bio- + + + LNFP-V + LNFP-III/ fragilis (strain synthesis related LNnFP-V ATCC 25285/ glycosyltransferase NCTC 9343) wbgL Escherichia coli ABE98421 -(1,2)- n.t. n.t. + LNFP-I + LNnFPI O126 fucosyltransferase fucT2 Helicobacter AAD29863 -(1,2)- n.t. n.t. + LNFP-I + LNnFPI pylori fucosyltransferase + designates the detection of a reaction product, designates no activity, n.t. means not tested.
    Degradation of by-Products

    [0208] To facilitate separation of the desired product LNFP-I from the by-products lactose, LNT-2, and LNT, these sugars can be enzymatically digested, and the resulting degradation products are metabolized by E. coli strains.

    [0209] -1,4-galactosidases, e.g. LacZ of E. coli efficiently degrades lactose to D-glucose and d D-galactose. These two monosaccharides are metabolized by E. coli strains expressing a functional gal-operon.

    [0210] The -N-acetylhexosaminidase Bbhl from Bifidobacterium bifidum JCM1254 hydrolyses LNT-2 highly specific and efficient to N-acetylglucosamine and lactose.

    [0211] The -1,3-galactosidases Bga42A from Bifidobacterium longum subsp. infantis hydrolyses LNT specifically to galactose and LNT-2.

    Engineering of an E. coli Strain for Degradation of by-Products

    [0212] Escherichia coli BL21(DE3) #534 was used to construct a degradation strain in order to recover LNFP-I after fermentative production from the supernatant without sugar by-products.

    [0213] A functional galETKM operon together with its natural promoter was amplified from genomic DNA of E. coli K12 using oligonucleotides 6473 and 6474, producing a fragment with 5 19-bp Mosaic End recognition sites for the EZ-Tn5 transposase. The fragment <galETKM> (SEQ ID NO: 40) was integrated into the genome of the E. coli strain mediated by the EZ-Tn5 transposase. Clones with correct integrations were selected on MacConcey agar (Difco, Sparks, USA) containing 1% galactose, they appeared as red colonies after 36 h incubation at 37 C.

    [0214] The gene encoding the -N-acetylhexosaminidase Bbhl from Bifidobacterium bifidum JCM1254 was synthesized synthetically and codon optimizes for the expression in E. coli. Bbhl under transcriptional control of the P.sub.tet promoter and a gene conferring to the host a zeocin resistance (<P.sub.tet-bbhl-zeo> (SEQ ID NO: 41) was integrated from plasmid pEcomar-bbhl-zeo mediated by the Himar1 transposase.

    [0215] To ensure full -1,4-galactosidases activity, lacZ from E. coli BL21(DE3) (acc. No. AM946981) was cloned under the transcriptional control of the constitutive promoter P.sub.tet. Together with the gentamycin resistance gen aacC1 the fragment <P.sub.tet-lacZ-FRT-aacC1-FRT> (SEQ ID NO: 42) was amplified with primers 1119 and 1120 and integrated by EZ Tn5 transposition, obtaining strain #1369.

    [0216] The -1,3-galactosidases Bga42A from Bifidobacterium longum subsp. infantis was codon optimized for E. coli and synthesised synthetically. Bga42A under transcriptional control of the P.sub.tet promoter and the cat gene conferring to the host a chloramphenicol resistance (<P.sub.tet-bga42A-cat> (SEQ ID NO: 43) was integrated using the EZTn5 transposase. The strain expressing all three hydrolase genes is designated as strain #1886.

    [0217] Degradation of lactose and LNT-2 was achieved efficiently by adding a culture of strain #1886 to a LNFP-I producing culture of strain #1772. To demonstrate the degradation of LNT-2 and lactose by LacZ and Bbhl, a culture of strain #1886, grown in MS medium with glucose as carbon source was added in a volume ratio of 1:40 to a culture of strain #1772, grown in MS medium with glucose in the presence of lactose and L-fucose for the production of LNFP-I.

    [0218] FIG. 7 demonstrates degradation of lactose and LNT-2 by hydrolases being expressed in E. coli strain #1886. A growing culture of E. coli strain #1886 was added to a culture of E. coli strain #1772 that produced LNFP-I as main product and LNT, and LNT-2 as by-products. LNT-2 and lactose were nearly completely depleted in the culture supernatant within 10 h of incubation. Metabolites are marked as, circles: lactose, squares: LNT-2, triangles: LNFP-I, crosses: LNT. Within 10 h LNT-2 and lactose were degraded to near complete depletion, while LNFP-I and LNT were not degraded by the #1886 cells. Since strain #1886 contains an active galETKM-operon the monosaccharides glucose and galactose resulting from lactose hydrolyses are completely metabolized.

    [0219] The hydrolase Bga42A is not active extracellularly. However, when cells of strain #1886, grown on MS medium with glucose as carbon source, were disrupted mechanically, hydrolytic activity of Bga42A towards LNT was demonstrated as shown in FIG. 8 displaying an image of a thin layer chromatogram. Samples containing cell lysate from E. coli strain #1886 (lane 1: no enzyme, lanes 2 to 6: 100 g protein) and 5 mM LNT in a 20 mM sodium-phosphate buffer pH 7 were incubated over a time period of up to 120 minutes (lane 1: 120 min, lane 2: 0 min, lane 3: 15 min, lane 4: 30 min, lane 5: 60 min, lane 6: 120 min) at 30 C. and before the enzyme was inactivated by heating at 95 C. for 5 minutes.

    [0220] In FIG. 8 hydrolyses of LNT and the resulting degradation products LNT-2 and lactose in cell free extract of strain #1886 is shown.