IMPROVED MUCONIC ACID PRODUCTION FROM GENETICALLY ENGINEERED MICROORGANISMS
20200181658 ยท 2020-06-11
Assignee
Inventors
- Ryan Sillers (Reading, MA, US)
- Theron Hermann (Arlington, MA, US)
- Michelle Spencer (Woburn, MA, US)
- Russell Udani (Arlington, MA, US)
- R. Rogers Yocum (Lexington, MA)
Cpc classification
C12P7/46
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12Y401/01063
CHEMISTRY; METALLURGY
C12Y402/01118
CHEMISTRY; METALLURGY
International classification
C12P7/46
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The subject of this invention is improvements in the yield and titer of biological production of muconic acid by fermentation. Increased activity of one or more enzymes involved in the muconic acid pathway leads to increased production of muconic acid.
Claims
1-30. (canceled)
31. A genetically engineered microorganism that produces muconic acid from a non-aromatic carbon source comprising at least one exogenous gene encoding for 3,4-dihydroxybenzoic acid decarboxylase and at least one gene that codes for a protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase.
32. The genetically engineered microorganism of claim 31, wherein said genetically engineered microorganism produces at least 60 g/L of muconic acid in 72 hours.
33. The genetically engineered microorganism of claim 31, wherein said genetically engineered microorganism is a bacterium.
34. The genetically engineered microorganism of claim 31, wherein said genetically engineered microorganism is Escherichia coli.
35. The genetically engineered microorganism of claim 31, wherein said protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase is a KpdB protein encoded by a kpdB gene or a homolog thereof, and wherein said KpdB protein or homolog thereof has at least 25% amino acid identity to said KpdB protein.
36. The genetically engineered microorganism of claim 31, wherein said protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase is a UbiX protein encoded by a ubiX gene or a homolog thereof, and wherein said UbiX protein or homolog thereof has at least 25% amino acid identity to said UbiX protein.
37. The genetically engineered microorganism of claim 31, further comprising one or more exogenous genes selected from the group consisting of aroZ, qa-4, asbF, quiC and catAX.
38. The genetically engineered microorganism of claim 31, further comprising one or more exogenous genes selected from the group consisting of aroB, aroD, aroF, aroG, aroH, tktA, talB, rpe, and rpi, wherein said one or more exogenous genes encode one or more proteins that function in a shikimic acid pathway.
39. The genetically engineered microorganism of claim 31, further comprising at least one exogenous gene encoding a pyruvate carboxylase and a mutation of the phosphoenol pyruvate carboxylase gene.
40. A genetically engineered Escherichia coli strain that produces muconic acid from a non-aromatic carbon source comprising at least one exogenous gene encoding for 3,4-dihydroxybenzoic acid decarboxylase and at least one gene that codes for a protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase, wherein said genetically engineered Escherichia coli strain produces at least 60 g/L of muconic acid in 72 hours.
41. A genetically engineered Escherichia coli strain that produces muconic acid from a non-aromatic carbon source comprising at least one exogenous gene encoding for 3,4-dihydroxybenzoic acid decarboxylase and at least one gene that codes for a protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase, wherein said genetically engineered Escherichia coli strain produces at least 80 g/L of muconic acid in 72 hours.
42. The genetically engineered Escherichia coli strain of claim 40, wherein said protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase is a KpdB protein encoded by a kpdB gene or a homolog thereof, and wherein said KpdB protein or homolog thereof has at least 25% amino acid identity to said KpdB protein.
43. The genetically engineered Escherichia coli strain of claim 40, wherein said protein that increases the activity of said 3,4-dihydroxybenzoic acid decarboxylase is a UbiX protein encoded by a ubiX gene or a homolog thereof, and wherein said UbiX protein or homolog thereof has at least 25% amino acid identity to said UbiX protein.
44. The genetically engineered Escherichia coli strain of claim 40, further comprising one or more exogenous genes selected from the group consisting of aroZ, qa-4, asbF, quiC and catAX.
45. The genetically engineered Escherichia coli strain of claim 40, further comprising at least one exogenous gene encoding a pyruvate carboxylase and a mutation of the phosphoenol pyruvate carboxylase gene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0038] All the patents, patent applications, publications, sequences, and other published materials are incorporated herein are incorporated by reference.
[0039] As used in this patent application, the phrase for example or such as is meant to indicate that there arc more than one method, approach, solution, or composition of matter for the subject at hand, and the example given is not meant to be limiting to that example.
[0040] The term heterologous refers to a gene or protein that is not naturally or natively found in an organism, but which can be introduced into an organism by genetic engineering, such as by transformation, mating, or transduction. A heterologous gene can be integrated (inserted) into a chromosome or contained on a plasmid. The term exogenous refers to a gene or protein that has been introduced into, or altered, in an organism for the purpose of increasing, decreasing, or eliminating an activity, by genetic engineering, such as by transformation, mating, transduction, or mutagenesis. An exogenous gene or protein can be heterologous, or it can be a gene or protein that is native to the host organism, but altered by one or more methods, for example, mutation, deletion, change of promoter, change of terminator, duplication, or insertion of one or more additional copies in the chromosome or in a plasmid. Thus, for example, if a second copy of the aroB gene is inserted at a site in the chromosome that is distinct from the native site, the second copy would be exogenous.
[0041] The term microorganism as used in this present invention includes bacteria, archaea, yeast, algae and filamentous fungi that can be used for the commercial production of cis, cis-muconic acid through a fermentation process. The term genetically engineered microorganism refers to microorganisms that are not present in the Nature but generated using one or other genetic modifications as described in this patent application.
[0042] For nomenclature, a gene or coding region is usually named with lower case letters in italics, for example aroZ, while the enzyme or protein encoded by a gene can be named with the same letters, but with the first letter in upper case and without italics, for example AroZ. The enzyme or protein can also be referred to by a more descriptive name, for example, AroZ can also be referred to as 3-dehydroshikimate dehydratase. A gene or coding region that encodes one example of an enzyme that possess a particular catalytic activity can have several different names because of historically different origins, or because the gene comes from different species. For example the gene that encodes 3-dehydroshikimate dehydratase from Bacillus anthracis can be named asbF instead of aroZ, the same gene from Aspergillus nidulans can be named qutC, the same gene from Neurospora crasser can be named qa-4, and the same gene from Acinetobacter baylyi can be named quiC.
[0043] A plasmid means a circular or linear DNA molecule that is substantially smaller than a chromosome, separate from the chromosome or chromosomes of a microorganism, and that replicates separately from the chromosome or chromosomes. A plasmid can be present in about one copy per cell or in more than one copy per cell. Maintenance of a plasmid within a microbial cell in general requires an antibiotic selection, but complementation of an auxotrophy can also be used.
[0044] The term chromosome or chromosomal DNA as used in this invention in the context of a bacterial cell is a circular DNA molecule that is substantially larger than a plasmid and does not require any antibiotics selection.
[0045] The term an expression cassette or a cassette means a DNA sequence that can be part of a chromosome or plasmid that contains at least a promoter and a gene or region that codes for an enzyme or other protein, such that the coding region is expressed by the promoter, and the enzyme or protein is produced by a host cell that contains the DNA sequence. An expression cassette can be at least partly synthetic, or constructed by genetic engineering methods, so that the coding region is expressed from a promoter that is not naturally associated with the coding region. Optionally, the expression cassette can contain a transcription terminator that may or may not be a terminator that is naturally associated with the coding region. An expression cassette can have coding regions for more than one protein, in which case it can be called an operon, or a synthetic operon.
[0046] The term overexpression of a gene or coding region means causing the enzyme or protein encoded by that gene or coding region to be produced in a host microorganism at a level that is higher than the level found in the wild type version of the host microorganism under the same or similar growth conditions. This can be accomplished by, for example, one or more of the following methods: 1) installing a stronger promoter, 2) installing a stronger ribosome binding site, such as a DNA sequence of 5-AGGAGG, situated about four to ten bases upstream of the translation start codon, 3) installing a terminator or a stronger terminator, 4) improving the choice of codons at one or more sites in the coding region, 5) improving the mRNA stability, and 6) increasing the copy number of the gene, either by introducing multiple copies in the chromosome or placing the cassette on a multicopy plasmid. An enzyme or protein produced from a gene that is overexpressed is said to be overproduced. A gene that is being overexpressed or a protein that is being overproduced can be one that is native to a host microorganism, or it can be one that has been transplanted by genetic engineering methods from a different organism into a host microorganism, in which case the enzyme or protein and the gene or coding region that encodes the enzyme or protein is called foreign or heterologous. Foreign or heterologous genes and proteins are by definition overexpressed and overproduced, since they are not present in the unengineered host organism.
[0047] The term a homolog of a first gene, DNA sequence, or protein is a second gene, DNA sequence, or protein that performs a similar biological function to that of said first gene, DNA sequence or protein, and that has at least 25% sequence identity (when comparing protein sequences or comparing the protein sequence derived from gene sequences) with said first gene or protein, as determined by the BLAST computer program for sequence comparison (Altschul et al., 1990; Altschul et al., 1997), using default parameters and allowing for deletions and insertions. An example of a homolog of the E. coli aroG gene would be the aroG gene from Salmonella typhimurium.
[0048] Two enzymes or proteins that are very distantly related by homology can carry out the same biochemical function but be only relatively weakly homologous to each other. For example, the FurnA fumarase from E. coli K-12 (GenBank NP_416129) is about 26.9% homologous to a fumarase from Clostridium botulinum (GenBank GAE03909.1) over their region of overlap, and about 25.1% homologous to a fumarase beta subunit from Pyrococcus sp. ST04 (GenBank AKF23146.1) over their region of overlap. As another example, a Klebsiella AroZ and a Neurospora crassa Qa-4 enzyme that both function to convert DHS to PCA are 29.3% identical. Therefore, since for the genetic engineering of a metabolic pathway, the important feature of a heterologous enzyme or protein is the function or reaction carried out by that enzyme or protein, not the source organism or the precise amino acid sequence, we define homologous enzymes or proteins or homologs to comprise any pair of enzymes or proteins that are 25% or higher in the identity of their amino acid sequences, allowing for gaps, as shown for example by using the default parameters for alignment using the LaserGene 12 (DNAStar, Madison, Wis.) MegAlign program with the Lipman-Pearson method (Ktuple=2, Gap penalty=4, and Gap length penalty=12).
[0049] The term an analog of a first gene, DNA sequence, or protein is a second gene, DNA sequence, or protein that performs a similar biological function to that of said first gene, DNA sequence, or protein, but where there is less than 25% sequence identity (when comparing protein sequences or comparing the protein sequence derived from gene sequences) with said first gene, DNA sequence or protein, as determined by the BLAST computer program for sequence comparison (Altschul et al., 1990; Altschul et al., 1997), and allowing for deletions and insertions. An example of an analog of the Klebsiella pneumoniae AroZ protein would be the QutC protein from Aspergillus nidulans, since both proteins are enzymes that catalyze the 3-dehydroshikimate dehydratase reaction, but there is no significant sequence homology between the two enzymes or their respective genes. A scientist knowledgeable in the art will know that many enzymes and proteins that have a particular biological function, for example DAHP synthase or 3-dehydroshikimate dehydratase, can be found in many different organisms, either as homologs or analogs, and since members of such families of enzymes or proteins share the same function, although they may be slightly or substantially different in structure, different members of the same family can in many cases be used to perform the same biological function using current methods of genetic engineering. Thus, for example, the AroZ enzyme and the QutC enzyme catalyze the same reaction, DHS dehydratase, so either one will result in production of cis, cis-muconic acid in the proper context, and the choice of which one to use ultimately can be made by choosing the one that leads to a higher titer of cis, cis-muconic acid under similar fermentation conditions.
[0050] The terms a non-aromatic carbon source or a non-aromatic compound means a carbon-containing compound that can be used to feed a microorganism of the invention as a source of carbon and/or energy, in which the compound does not contain a six-membered ring related to benzene. Examples of non-aromatic carbon sources include glucose, xylose, lactose, glycerol, acetate, arabinose, galactose, mannose, maltose, or sucrose. An aromatic compound is a compound that contains one or more six-membered rings related to benzene. An example of an aromatic compound is catechol, or 1,2-dihydroxy benzene. A microorganism selected for producing muconic acid using glucose as a source of non-aromatic carbon source can further be engineered to use other types of non-aromatic carbon sources such as glycerol, sucrose and xylose using the genetic engineering techniques as provided in the patent documents U.S. Pat. No. 8,871,489 and US Patent Application Publication Nos. US2013/0337519A1 and US2014/0234923A.
[0051] The term a strong constitutive promoter means a DNA sequence that typically lies upstream (to the 5 side of a gene when depicted in the conventional 5 to 3 orientation), of a DNA sequence or a gene that is transcribed by an RNA polymerase, and that causes said DNA sequence or gene to be expressed by transcription by an RNA polymerase at a level that is easily detected directly or indirectly by any appropriate assay procedure. Examples of appropriate assay procedures include 1) quantitative reverse transcriptase plus PCR, 2) enzyme assay of an encoded enzyme, 3) Coomassie Blue-stained protein gel, or 4) measurable production of a metabolite that is produced indirectly as a result of said transcription, and such measurable transcription occurring regardless of the presence or absence of a protein that specifically regulates level of transcription, a metabolite, or inducer chemical. An example of a promoter that is nota strong constitutive promoter is the P.sub.lac promoter of E. coli, since it is repressed by a repressor in the absence of lactose or the inducer IPTG. By using well known methods in the art, a strong constitutive promoter can be used to replace a native promoter (a promoter that is otherwise naturally existing upstream from a DNA sequence or gene), resulting in an expression cassette that can be placed either in a plasmid or chromosome and that provides a level of expression of a desired DNA sequence or gene at a level that is higher than the level from the native promoter. A strong constitutive promoter can be specific for a species or genus, but often a strong constitutive promoter from a bacterium can function well in a distantly related bacterium. For example, a promoter from Bacillus subtilis or a phage that normally grows on B. subtilis can function well in E. coli. A strong constitutive promoter is substantially different from inducible promoters, such as P.sub.tac, which have been used in the prior art production of cis, cis-muconic acid and typically require an expensive chemical or other environmental change for the desired level of function (Niu et al., 2002), Examples of strong constitutive promoters are P.sub.15, P.sub.26, from Bacillus subtilis phage SP01, and coli phage lambda P.sub.R.
[0052] A mutation is any change in a DNA sequence that makes it different from a related wild type sequence. A mutation can comprise a single base change, a deletion, an insertion, a replacement, a frameshift, an inversion, a duplication, or any other type of change in a DNA sequence. Usually a mutation refers to a change that has a negative effect on function or reduce the activity of a gene or gene product, however, herein, the term mutation can also refer to a change that increases the activity of a gene or gene product. For example, a feedback resistant mutation in the aroG gene increases the activity of AroG in the presence of an inhibitor such as phenylalanine. Replacement of a promoter with a different, stronger promoter, also result in a mutation that can increase the activity of a gene or gene product. A null mutation is a mutation, such as a deletion of most or all of a gene, is a mutation that effectively eliminates the function of a gene. A mutant is a strain or isolate that comprises one or more mutations.
[0053] The biological production of cis, cis-muconic acid (herein referred to as simply muconic acid) is based on the redirection of carbon from the aromatic amino acid pathway. Native production of aromatic amino acids and vitamins requires the metabolites erythrose-4-phosphate (E4P) and phosphoenolpyruvate (PEP). The first committed step in aromatic amino acid synthesis is catalyzed by the enzyme 3-deoxy-arabino-heptulonate 7-phosphate (DAHP) synthase. In E. coli, this step can be performed by three different isozymes, AroG, AroF, or AroH. Each of these enzymes is regulated at the transcriptional level by a repressor protein TyrR, as well as at the protein level by inhibition from terminal products of the pathway, phenylalanine, tyrosine, and tryptophan, respectively. The production of muconic acid proceeds from an intermediate in the aromatic amino acid pathway, dehydroshikimic acid (DHS) and requires the expression of three heterologous enzymes, dehydroshikimate dehydratase (AroZ), 3,4-dihydrobenzoate decarboxylase (AroY), and catechol 1,2-dioxygenase (CatA). This pathway is shown in
[0054] A muconic pathway or muconic acid pathway refers to a biochemical pathway from DHS to PCA to catechol to cis, cis-muconic acid, and a muconic pathway gene is a gene that encodes an enzymes that catalyzes a step in a muconic pathway, or encodes an auxiliary function that serves to enhance the activity of one of said enzymes, for example, aroZ, aroY, catA, catX, and qutC (
[0055] The genetic manipulations used in the present inventions are centered around the common pathway for aromatic amino acid and aromatic vitamin (or vitamin-like) biosynthesis present in many microbial cells as shown in
[0056] There is a substantial volume of published work on genetic engineering of microorganisms for the production of the aromatic amino acids, phenylalanine, tyrosine, and tryptophan (U.S. Pat. Nos. 4,681,852, 4,753,883, 6,180,373, European Patent Application 86300748.0). The approaches for the production of aromatic amino acids include using various combinations of feedback resistant enzymes (AroF, AroG, PheA, TyrA), deregulation of repression of transcription (tyrR.sup.), increasing promoter strength (P.sub.tac, P.sub.lac) and increasing the copy number of one or more genes (tktA). Many specific combinations of the above mentioned genetic modifications can be followed to obtain a biocatalyst suitable for muconic acid production.
[0057] According to the disclosure in the International Patent Application Publication No. WO2013/116244, incorporated herein in its entirety by reference, the genetically engineered microorganisms do not need to contain any exogenous plasmids in order to produce muconic acid, although they have certain exogenous or heterologous genes necessary to achieve the desired phenotype. In the preferred embodiment of the present invention, the exogenous genes introduced into the microorganisms are stably integrated into the chromosomal DNA. As a result of this chromosomal DNA integration of the exogenous genes, the need for the use of antibiotics or other selective methods to maintain the plasmids carrying exogenous DNA is totally eliminated. In addition, strong promoters that do not require chemical inducers are used to express genes necessary for the operation of the pathway from carbon source, such as glucose, to cis, cis-muconic acid.
[0058] When an exogenous coding sequence is integrated into the chromosomal DNA, it is integrated at a locus, the deletion of which has been reported not to cause any adverse effects. For example, the coding region at the physical location 0039 in E. coli bacterium, also known as ydeM, is annotated as a lipoprotein and has been demonstrated to have no adverse effects upon deletion. Similarly, the coding region at the physical location 2160 in E. coli bacterium, also known as nlpA, is annotated as a radical SAM domain protein and has been demonstrated to have no adverse effects upon deletion. In the present invention, a copy of P.sub.R-catAX was inserted at the physical location 0039 in E. coli bacterium and a copy of P.sub.R-aroG.sup.FBR was inserted at the physical location 2160 in E. coil bacterium. In other examples described herein, an insertion is made in gene that is advantageous to knockout or deleted, such as a gene encoding for an unwanted function, for example a ptsI gene or a tyrR gene.
[0059] The aromatic amino acid biosynthetic pathway is well known for many microorganisms, especially for E. coil (Neidhart and Curtiss 1996). In a wild type cell, the pathway is tightly regulated by both feedback inhibition and repression of transcription. The first committed step is catalyzed by deoxy-arabino-heptulosonate 7-phosphate (DAHP) synthase, of which there are three isozymes encoded by aroF, aroG, and aroH. The three isozymes, AroF, AroG, and AroH, are feedback inhibited by the products of aromatic amino biosynthetic pathway namely by tyrosine, phenylalanine, and tryptophan. Feedback resistant mutants of AroF, AroG, and AroH are well known (Flu et al. 2003; Lutke-Eversloh and Stephanopoulos 2007). One aspect of the present invention involves use of feedback resistant alleles of aroF, aroG, and aroH genes in order to express AroF, AroG and AroH enzyme proteins that are resistant to feedback inhibition by the products of aromatic amino acid biosynthetic pathway. The AroF, AroG and AroH enzyme proteins that are resistant to feedback inhibition are referred as AroF.sup.FBR, AroG.sup.FBR, and AroH.sup.FBR.
[0060] Transcription of several of the operons involved in the aromatic pathway is regulated by either the repressor encoded by the tyrR gene or the repressor encoded by the trpR gene, or both (Neidhardt and Curtiss 1996). Of particular importance is the negative regulation of transcription of aroG and aroF by the TyrR protein when it is bound with one or more of the aromatic amino acids. One aspect of the present invention involves the removal of negative regulation by tyrR or trpR genes by means of eliminating these genes from the chromosome of the host bacterial strains.
[0061] The present invention teaches certain combinations of genetic elements in the biocatalysts suitable for muconic acid production, for example, but not limited to, various combinations of an overproduced feedback resistant AroG, an overproduced feedback resistant AroF, an overexpressed tktA, an overexpressed talA, chromosomally integrated cassettes for expressing an aroZ, aroY, and a catAX (or analogs or homologs thereof) from strong constitutive promoters, and a leaky aroE allele, which we define as a gene that encodes an AroE enzyme that confers prototrophy for the aromatic amino acids and vitamins, but without leading to significant secretion of unwanted aromatic compounds.
[0062] All specific examples of strain constructions disclosed herein are based on wild type Escherichia coli C strain (ATCC 8739), or Escherichia coli W strain (ATCC 9637). However, it should be realized at this point that the expression cassettes or appropriate analogs and homologs of the genetic elements disclosed herein can be assembled in any other suitable microorganism, such as any other suitable E. coil strains and other species of bacteria, archaea, yeast, algae, and filamentous fungi that can be used for the commercial production of muconic acid through a fermentative process.
[0063] In E. coli, the aromatic amino acid biosynthesis pathway from glucose starts with the non-oxidative branch of the pentose phosphate pathway (PPP). Four key enzymes in the non-oxidative pentose phosphate pathway are transketolase, transaldolase, ribulose-5-phosphate epimerase and ribulose-5-phosphate isomerase. These enzymes catalyze the reactions that lead to the formation of erythrose 4-phosphate (E4P) from hexose or pentose sugars. To increase the availability of E4P in E. coil, the tktA gene encoding transketolase can be overexpressed (Niu et al., 2002). Similarly, the overexpression of the transaldolase gene is also expected to increase the availability of E4P in some circumstances (Bongaerts et al., 2001). In yet another aspect of the present invention, the expression of both the transketolase and transaldolase genes are enhanced through genetic manipulations leading to an increase in the activity of transketolase and transaldolase enzymes. In yet another aspect of the invention, flux through the non-oxidative branch of the PPP is increased by overproducing ribulose-5-phosphate epimerase and ribulose-5-phosphate isomerase.
[0064] The first committed step and most tightly regulated reaction in the common aromatic amino acid pathway is the condensation of phosphoenolpyruvate (PEP) and E4P to produce deoxyarabino-heptulosonate 7-phosphate (DAHP) by DAHP synthase (encoded by aroG, aroF, and aroH), D-glucose consumed by E. coli is brought into aromatic biosynthesis partly through the PPP, and partly through glycolysis. The flow of glucose into the aromatic pathway is greatly increased when transketalose (tktA) and an isozyme of DAHP synthase (aroG) are amplified through transformation with a plasmid that increases their expression by increasing their copy number (Niu et al., 2002). In a preferred aspect of the present invention, the exogenous aroG and tktA genes are integrated into the chromosomal DNA for the purpose of amplification of activities transketolase and DAHP synthase enzymes.
[0065] In another embodiment of the present invention, the flux through PEP within the microbial cell is improved by increasing the PEP available for the synthesis of DAHP by reducing the flux of PEP to other pathways. Many genera of bacterial cells consume PEP in the transport of glucose across the cell membrane using a phosphotransferase system (PTS) in which one PEP molecule is consumed for every molecule of glucose transported across the bacterial outer membrane. By replacing or complementing the PEP-dependent PTS with a non-PEP dependent (PEP independent) glucose uptake mechanisms, it is possible to increase the pool size of the PEP available for the aromatic amino acid biosynthetic pathway within the microbial cell. For example, the PTS system for sugar uptake can be replaced or complemented by a GalP-based sugar uptake system or the sugar transporter system based on Glf/Glk proteins (Chandran et al., 2003; Yi et al., 2003). In a preferred aspect of the present invention besides deleting the PTS system for sugar uptake for the purpose of conserving PEP pool within the microbial cell, the GalP based sugar uptake system is also inactivated for the purpose of conserving ATP within the microbial cell. In a microbial cell which is defective in the functioning of both PTS system and a Gal-P based sugar uptake system (PTS/galP), the sugar uptake can be accomplished by means of introducing an exogenous gene coding for Glf (glucose facilitated diffusion protein), or exogenous genes encoding both Glf and Glk (glucokinase) proteins. As used in the present invention, the term functional glucose-facilitated diffusion protein refers to any Glf protein as well as any other protein which is functionally equivalent to Glf and functions to transport sugars into the microbial cells by facilitated diffusion. In one aspect of the present invention, the gene coding for the glucose facilitator protein Glf is introduced into the microbial cell which is PTS/galP and the glucose transported into the microbial cell is phosphorylated by endogenous glucose kinase. In another aspect of the present invention the genes coding for both Glf and Glk proteins are introduced into a microbial cell which is PTS/galP. In a preferred aspect of the present invention, the exogenous glf and glk genes introduced into the microbial cell are integrated into the host chromosomal DNA.
[0066] In another embodiment of the present invention, when the carbon source for growth and energy requires gluconeogenesis (for example if the carbon source is acetate or succinate), the PEP pool can be increased by increasing the activity of carboxylating enzymes already present within the cell, for example PEP carboxykinase, which is encoded by pck in E. coli, or by introducing an exogenous carboxylating enzyme. In a preferred embodiment, the introduced exogenous gene coding for a carboxylating enzyme is stably integrated into the host chromosome. Genes coding for the carboxylating enzyme can be derived from a variety of microbial species. The genes coding for the carboxylating enzymes can further be subjected to genetic manipulations so that the expression of the carboxylating enzyme within the biocatalyst for cis, cis-muconic acid production is significantly enhanced.
[0067] PEP is one of two major metabolites for the aromatic pathway and reduction or elimination of Ppc activity preserves PEP for the aromatic pathway and muconic acid production. Ppc catalyzes the anaplerotic reaction forming oxaloacetate, an intermediate in the TCA cycle. Ppc activity is essential for wild type E. coli and some other organisms in minimal media, but it is absent in others. Some organisms, such as yeast that lack Ppc, utilize Pyc to replenish oxaloacetate. Lowered or absent Ppc activity can be complemented with Pyc activity, by providing an alternate route to oxaloacetate from pyruvate instead of PEP, which results in increased availability of PEP for muconic acid production as well as for production of other compounds, such as aromatic compounds, that require PEP as an intermediate. In at least one example disclosed herein, substituting Pyc for Ppc can reduce flux from PEP to OAA, which in turn conserves PEP for the central aromatic pathway.
[0068] In yet another embodiment of the present invention, the PEP pool inside the microbial cell is increased by decreasing or eliminating the activity of pyruvate kinase enzymes such as PykA and PykF which use PEP as a substrate.
[0069] From DAHP, the aromatic amino acid pathway proceeds via a number of intermediates to chorismate (CHA), a branch point for the biosynthesis of three aromatic amino acids namely L-Tyrosine (L-Tyr), L-Phenylalanine (L-Phe), and L-Tryptophan (L-Trp).
[0070] In the initial stages of the common aromatic amino acid pathway, 3-dehydroquinate (DHQ) synthase (AroB) removes the phosphate group from DAHP leading to the formation of DHQ. The enzyme DHQ dehydratase (AroD) removes a water molecule from DHQ leading to the formation of 3-dehydroshikimate (DHS) which is subsequently reduced to shikimate (SHK) by shikimate dehydrogenase (AroE). Shikimate kinase I/II (AroK, AroL) phosphorylates shikimate to shikimate 3-phosphate (S3P). There is a condensation of S3P with PEP leading to the formation of 5 enolpymvoylshikimate 3-phosphate (EPSP). The formation of EPSP is mediated by EPSP synthase (AroA). A phosphate group from EPSP is removed by chorismate synthase (AroC) leading to the formation of chorismate (CHA).
[0071] As shown in the
[0072] In redirecting the aromatic amino acid pathway to the production of cis, cis-muconic acid, the mutation of the aroE gene is critical. The aroE gene can be completely inactivated leading to a total block in the biosynthesis of aromatic amino acids as was done with the WN1/pWN2.248strain of E. coil described for the muconic acid production (Niu et al., 2002). An important drawback with the WN1/pWN2.248 E. coil strain and related strains is that due to the complete inactivation of the aroE gene, this strain has become auxotrophic for the aromatic acids such as phenylalanine, tyrosine and tryptophan, and aromatic vitamins or vitamin-like compounds mentioned above. As a result, this strain during its growth for the production of cis, cis-muconic acid requires the exogenous addition of these compounds (or a common intermediate such as shikimate), thereby adding substantially to the cost of commercial production of cis, cis-muconic acid using such a strain. A novel approach to overcome this dependency on an exogenous source of aromatic amino acids is to use a strain with a leaky mutation in aroE. The leaky aroE mutant would allow a limited flow of carbon to shikimic acid while accumulating significant amounts of DHS which is then available for the conversion into PCA by the action of an AroZ enzyme. Thus the use of a leaky mutant form of aroE would eliminate the dependence on exogenous aromatic amino acids, while still diverting the flow of carbon to cis, cis muconic acid.
[0073] The genes coding for the synthesis of AroZ, AroY and CatA proteins essential for the conversion of DHS into cis, cis-muconic acid can be derived from any one of many microbial species. In one embodiment, these exogenous genes are integrated into the host chromosome of the biocatalyst being developed. In a preferred embodiment, the expression of these exogenous genes within the biocatalyst is driven by a constitutive promoter without the need for any inducers.
[0074] The enzyme 3-dehydroshikimate dehydratase (AroZ; EC 4.2.1.118) is required for biosynthesis of the intermediate protocatechuate. In this specification, AroZ shall refer to any enzyme that catalyzes the 3-dehydroshikimate dehydratase reaction. In the prior art, this enzyme is expressed from the aroZ gene of Klebsiella pneumoniae strain A170-40 (ATCC25597) (Niu et al., 2002; Draths and Frost, 1995). However, the specific activity of AroZ varies widely among organisms, from 0.1 to 261 micromoles/min/mg (Wheeler et al, 1996; Fox et al, 2008; Pfleger et al, 2008), so a significant improvement can be had by expressing an aroZ gene also known as asbF (Fox et al, 2008; Pfleger et al, 2008), qutC (Wheeler et al, 1996), qa-4 (Rutledge, 1984), and quiC, from an organism that has a higher specific activity than K pneumoniae, for example Acinteobacter baylyi, Aspergillus nidulans (Wheeler et al, 1996), now also known as Emericella nidulans, or Neurospora crassa (Rutledge, 1984; Stroman et al, 1978), or Podospora anserina, also known as Podospora pauciseta (Hansen et al, 2009).
[0075] As one particular example, the coding sequence for the qa-4 gene from N. crassa that encodes 3-dehydroshikimate dehydratase can be obtained by any of several well-known methods, for example whole gene DNA synthesis, cDNA cloning, or by a combination of genomic DNA cloning and PCR or synthetic DNA linker synthesis. Since there are no introns in the qa-4 gene, the coding region can be obtained by PCR from genomic DNA (Rutledge, 1984). The protein sequence of the qa-4 enzyme (SEQ ID No. 4) and the DNA sequence of the native gene (SEQ ID No. 5) are known.
[0076] Alternatively, an expression cassette can be constructed for the 3-dehydroshikimate dehydratase from A. nidulans. The coding sequence for the QutC enzyme from A. nidulans can be obtained by any of several well-known methods, for example whole gene DNA synthesis, cDNA cloning, or by a combination of genomic DNA cloning and PCR or synthetic DNA linker synthesis. The protein sequence of QutC (SEQ ID No. 6) and the DNA sequence of the native gene, containing no introns, are known (SEQ ID No. 7; GenBank accession number M77665.1). An expression cassette can be obtained by DNA synthesis, or by a combination of genomic cloning and PCR, so that the QutC enzyme can be produced accurately in E. coil. By expressing a coding sequence for QutC from a strong, constitutive promoter in E. coil, sufficient expression can be obtained from one or two copies of the gene integrated in the chromosome, obviating the need for maintaining more than two copies of the expression cassette on a multicopy plasmid as has been disclosed in the prior art (Niu et al., 2002), and which can lead to instability. The method described above can be used in general to obtain a DNA sequence that codes for a desired enzyme, and that coding sequence can then be used to construct an expression cassette designed to function in E. coli or another appropriate microbial host organism.
[0077] The specific activity of AroZ can also be improved by using the protein sequence from the prior art (Niu et al., 2002) by constructing an improved expression cassette, for example, in which a stronger promoter and/or ribosome binding site (RBS) has been installed in front of the coding region, as described in Example 4.
[0078] The aroZ gene encoding AroZ (3-dehydroshikimate dehydratase) from Klebsiella pneumoniae strain A170-40 can be obtained as described in the prior art. The DNA sequence of the gene and surrounding DNA can be determined by methods well known in the art. A heterologous gene of the invention such as aroZ can be built into an expression cassette using a native DNA sequence or it can be synthesized with a codon optimized sequence for the intended host organism. An aroZ gene can be cloned as described (Draths and Frost, 1995) from any other microbe that contains an active aroZ gene, for example K. pneumoniae strain 342, Acinetobacer Sp. ADP1 (Acinetobacter baylyi ADP1), Bacillus thuringiensis, Emericella nidulans, Erwinia amylovora, Pseudomonas putida W619, Neurospora crassa, Aspergillus nidulans and many others.
[0079] The enzyme protocatechuate decarboxylase (AroY; EC 4.1.1.63) is required for biosynthesis of the intermediate catechol. In this specification, AroY shall refer to any enzyme that catalyzes the protocatechuate decarboxylase reaction. In the prior art, this enzyme is expressed from the aroY gene of Klebsiella pneumoniae strain A170-40 (ATCC25597) on a multicopy plasmid (Niu et al., 2002). However, once again an improvement in the process can be gained by producing enough of the enzyme from one or two copies of an expression cassette integrated in the chromosome of the host organism. This can be accomplished by obtaining an aroY gene from an organism that naturally produces an AroY enzyme that has higher specific activity than that of the K. pneumoniae AroY enzyme of the prior art, or by increasing the level of expression of the K. pneumoniae AroY by constructing an expression cassette that, for example, uses a strong constitutive promoter and/or strong RBS as described above under Example 4. The protein sequence for AroY from K. pneumoniae strain A170-40 is given in SEQ ID No. 8. The corresponding gene, aroY, can be cloned as described above (Draths and Frost, 1995), or based on the protein sequence, it can be synthesized with optimized codons for the intended host organism.
[0080] The aroY gene can be obtained from any other microorganism that contains a homolog or analog, for example, K. pneumoniae strain NCTC418 (ATCC15380), Klebsiella pneumoniae 342, and Arxula adeninivorans (Sietmann et al, 2010). The DNA sequence of the aroY gene from Klebsiella pneumoniae 342 and surrounding DNA is given as SEQ ID No. 9.
[0081] The enzyme catechol 1,2-dioxygenase (CatA; EC 1.13.11.1) is required for the last step of cis, cis-muconic acid biosynthesis. In this specification, CatA shall refer to any enzyme that catalyzes the catechol 1,2-dioxygenase reaction. In the prior art, this enzyme is expressed from the catA gene of Acinetobacter calcoaceticus strain ADP1 on a multicopy plasmid (Niu et al., 2002). The source strain, Acinetobacter calcoaceticus strain ADP1, apparently has been renamed Acinetobacter Sp. ADP1 and Acinetobacter baylyi ADP1 (Neidle and Omston, 1986; Barbe et al, 2004; de Berardinis et al, 2008). In this prior art example, the catA gene was expressed from a P.sub.tac promoter, which requires either lactose or IPTG (isopropylthiogalactoside) as an inducer. These compounds are too expensive for use in commercial fermentations, so again, significant improvements in the process are needed, both to eliminate the need for an expensive inducer and to create a more stable strain by integrating the expression cassette in the chromosome. This can be accomplished by constructing an expression cassette for the catA gene that uses a strong constitutive promoter, strong RBS, and/or more stable mRNA as described above in the other Examples.
[0082] The DNA sequence of the catA gene and surrounding sequences from Acinetobacter baylyi ADP1 is given in SEQ ID No. 10. The protein sequence for CatA from the same strain is given in SEQ ID No. 11. In a preferred embodiment, the expression cassette for catA contains one or two additional open reading frames that exist naturally downstream from catA, in order to increase the expression level of the catA gene (Schirmer and Hillen, 1998). Many other organisms can be a source for a catA gene, for example Pseudomonas arvilla, Pseudomonas fluorescens (Nakazawa et al, 1967; Kojima et al, 1967), Streptomyces Sp. Strain 2065 (Iwagami et al, 2000), Cupriavidus necator 335T, and many others (Perez-Pantoja et al, 2008).
[0083] In order to improve the flow of carbon towards cis, cis-muconic acid, it is necessary to block certain other pathways branching out of the aromatic amino acid pathway, besides reducing the flow of carbon from DHS to shikimate (SHK) by using a leaky aroE mutant. Some bacteria, for example in the genus Acinetobacter and Pseudomonas, contain a gene named pobA, which encodes an enzyme, p-hydroxybenzoate hydroxlase, that converts DHS into gallic acid. Although a PobA homolog or analog has not been found in E. coli, strains of E. coli engineered to produce DHS secrete measurable amounts of gallic acid (Li and Frost, 1999), so it is likely that such an enzyme does exist in E. coli. In addition, the PCA derived from DHS can be converted into gallic acid by the action of p-hydroxybenzoate hydroxlase (PobA) enzyme coded by the pobA gene. The gallic acid thus produced can be subsequently converted to pyrogallol. One way to block the carbon flow to gallic acid and pyrogallol in the biocatalyst selected for an improved cis, cis-muconic acid is to block or diminish the activity of p-hydrobenzoate hydroxlase (PobA) protein through genetic manipulations. Similarly, DHQ, the precursor to DHS can also be acted upon by shikimate dehydrogenase coded by aroE leading to the production of quinnic acid. In an embodiment of the present invention, the leaky AroE mutant enzyme is additionally selected or screened for its inability or reduced ability to convert DHQ into quinnic acid.
[0084] There are several advantages in producing trans, trans-muconic acid in place of cis, cis-muconic acid. Trans, trans-muconic acid is preferred over cis, cis-muconic acid in the Diels Alder reaction with ethylene for the production of terephthalic acid. A biocatalyst with a genetically manipulated aromatic pathway produces cis, cis-muconic acid which can be converted into trans, trans-muconic acid outside the cell using chemical conversion processes. On the other hand by means of introducing a maleylacetoacetate isomerase or similar isomerase enzyme into the biocatalyst, it is possible to convert the cis, cis-muconic acid into trans, trans-muconic acid within the bacterial biocatalyst.
[0085] In one embodiment, the present invention provides a genetic approach to enhance the activity of AroY protein involved in the conversion of 3,4-dihydroxybenzoic acid (protocatechuic acid or PCA) to catechol. The activity of AroY protein has been identified as a major limitation and bottleneck in the biological conversion of glucose to muconic acid (Horwitz et al 2015; Weber et al 2012; Curran et al 2013; Sonoki et al 2014). AroY belongs to a class of non-oxidative decarboxylases that are widespread among many bacteria and utilize a wide-variety of substrates (Lupa et al 2005). Many of these genes encoding non-oxidative decarboxylases are organized into three gene operons, encoding B, C, and D type genes. C type genes encode decarboxylases like AroY, and while the specific function of the B and D type genes are not known although they are sometimes shown to be necessary for realizing full activity of the C type decarboxylase (Lupa et al 2005; Jimenez et al 2013; Lin et al 2015; Sonoki et al 2014). Weber et al (2012) cloned the B, C and D genes from Klebsiella pneumoniae or Sedimentibacter hydroxybenzoicus into a high-copy-number yeast vector pRS4K-HKT7 and performed fermentation in a medium with externally added PCA to determine the presence of PCA decarboxylase activities from these gene clusters; however, neither was any effort made to determine whether the PCA decarboxylase encoded by the C gene was dependent on the B or D gene in these gene clusters, nor was any attempt made to determine whether the expression of these gene clusters comprising B, C and D genes were able to enhance the muconic acid production using a non-aromatic carbon source such as glucose.
[0086] The gene encoding AroY that is used in specific examples disclosed herein is from Klebsiella pneumoniae, but the local gene structure of this aroY gene reveals no transcriptionally linked genes that would encode either a B or D type enzyme. Previous studies have shown that inclusion of another B type gene, kpdB, from Klebsiella pneumoniae (part of an operon from a 4-hydroxybenzoic acid decarboxylase) can increase AroY activity when producing muconic acid from lignin-related aromatic compounds (Sonoki et al 2014). However, lignin is a complex mixture of chemicals, which requires costly downstream purification processes in order to produce a pure product such as muconic acid. Johnson et al (2016) have shown that in a Pseudomonas putida strain expressing AroY (PCA decarboxylase) from Enterobacter cloaceae, co-expression of an EcdB protein from E. cloaceae having 89.3% sequence identity to KpdB increased the muconic acid production using glucose as a source of carbon from 1.44 g/L to 4.92 g/L at the end of a 54 hour fermentation; however, the muconic acid yield in this Pseudomonas putida based system was still found to be extremely (0.077 mol/mol), thus making this Pseudomonas putida based system unsuitable for commercial scale applications. Therefore there is still a need for an improved muconic production process from inexpensive, purer, non-aromatic carbon sources such as carbohydrates and other non-aromatic compounds (see above). Recent studies have shown that UbiX, a homolog of KpdB, produces a prenylated flavin mononucleotide cofactor and this cofactor supports the decarboxylation activity of UbiD in ubiquinone formation (White et al 2015; Payne et al 2015). Although previous characterizations of UbiX and its homologs refer to the proteins as either 4-hydroxy-3-polyprenylbenzoate decarboxylases, hydroxybenzoate decarboxylasse, subunit B proteins, phenolic acid decarboxylases, or phenylacrylic acid decarboxylases, these proteins are now more accurately annotated as flavin prenyltranferases.
[0087] Additional limitations in the production of muconic acid can be attributed to the limitations of the precursor metabolites PEP and E4P. Changes that eliminate or lower the consumption of these metabolites have been shown in the present invention to improve product formation. For instance, PEP availability has been improved by replacing the native glucose transport, the phosphotransferase system, (PTS) with an alternate system (Glf-Glk from Zymomonas mobilis). E coli's native use of the PTS requires the utilization of PEP for transport and phosphorylation of glucose. The Glf-Glk system utilizes a facilitated diffuser and a glucokinase plus ATP for transport and phosphorylation of glucose, respectively. Use of Glf-Glk in place of a PTS has been shown to improve the yield and titer for several aromatic products. PEP is a substrate for a variety of biological reactions. In addition to glucose transport by the PTS, PEP is a substrate for pyruvate kinase, resulting in the production of ATP and pyruvate providing half of the ATP generated in glycolysis. Inactivation of the genes encoding for pyruvate kinase (pykA or pykF) has been demonstrated to increase yield of products in the aromatic pathway (Escalante et al. 2010). PEP is also the substrate for the production of oxaloacetate by phosphoenolpyruvate carboxylase (Ppc). In E. coli, this is an essential gene (Baba et al. 2006), and strains deleted for ppc are unable to grow on minimal media. There are other organisms that do not have phosphoenolpyruvate carboxylase, but instead replenish oxaloacetate from pyruvate with pyruvate carboxylase (Pyc), e.g. S. cerevisiae. The addition of pyruvate carboxylase in E coli has been investigated, but only for the improvement of succinate production (Lin et al. 2004; Vemuri, Eiteman, and Altman 2002) not for any aromatic products.
[0088] The specification in this patent application provides several different aspects of invention related to the construction of a microbial strain for efficient production of muconic acid. A person skilled in the art can compile several different aspects of the present invention to construct a biocatalyst with very high efficiency for the production of muconic acid.
EXPERIMENTAL SECTION
General Remarks
[0089] Strain and inoculum preparations: A list of the bacterial strains used in the present invention is provided in Tables 1 and 2. A list of the plasmids used in the present invention is provided in Table 3. All specific examples of strain constructions disclosed herein are derived from a wild type E. coli C strain (ATCC 8739), or E. coil K-12 strains (YMC9 or MM294) but the genetic elements disclosed herein can be assembled in any other suitable E. coli strain, and the expression cassettes or appropriate analogs and homologs of the genetic elements disclosed herein can be assembled in any other suitable microorganism, such as other species of bacteria, archaea, yeast, algae, and filamentous fungi that can be used for the commercial production of cis, cis-muconic acid through a fermentative process.
[0090] E. coli C is capable of fermenting 10% glucose in AM1 mineral media. AM1 medium contains 2.63 g/L (NH.sub.4).sub.2HPO.sub.4, 0.87 g/L NH.sub.4H.sub.2PO.sub.4, 1.5 mM MgSO.sub.4, 1.0 mM betaine, and 1.5 ml/L trace elements. The trace elements are prepared as a 1000 stock and contained the following components: 1.6 g/L FeCl.sub.3, 0.2 g/L CoCl.sub.2.6H.sub.2O, 0.1 g/L CuCl.sub.2, 0.2 g/L ZnCl.sub.2.4H.sub.2O, 0.2 g/L NaMoO.sub.4, 0.05 g/L H.sub.3BO.sub.3, and 0.33 g/L MnCl.sub.2.4H.sub.2O. The pH of the fermentation broth is maintained at 7.0 with 1.0-10.0 M KOH or 1.0-9.0 M ammonium hydroxide.
[0091] Fermentations: Fermentations were started by streaking on a fresh NBS-2% glucose (Jantama et al., 2008a) plate from a 40% glycerol stock of E. coli strain genetically engineered and stored in a 80 C. freezer. Plasmids, if present, are retained by including the appropriate antibiotic(s) in the agar plates and liquid media. Ampicillin (sodium salt) is used at 150 mg/L, spectinomycin HCL at 100 mg/L, tetracycline HCl at 15 mg/1, and kanamycin sulfate at 50 mg/l. After 24 to 48 hours (37 C.), a single colony is picked into 25 ml of the same medium in a shake flask. After shaking at 200 rpm at 37 C. until the cells have grown to an OD.sub.600 of about 1.0, the culture is cooled on ice and an equal volume of sterile 80% glycerol is added. 2 ml aliquots are then frozen at 80 C. to be used as inocula for fermentations. The term titer means the amount of fermentation product produced per unit volume of fermentation fluid and the term yield means the ratio of fermentation product produced to carbon source consumed (g/g or mol/mol).
[0092] Cell growth: Cell mass was estimated by measuring the optical density at 550 nm (OD.sub.550) or 600 nm (OD.sub.600) using a Thermo Electronic Spectronic 20 spectrophotometer.
[0093] Analysis of intermediates in shikimic acid pathway and muconic acid pathways: Total muconic acid produced in fermentation broths, which includes cis, cis-muconic acid and cis, trans-muconic acid, and other biochemical intermediates were assayed by HPLC with a Waters Alliance instrument, and monitoring absorbance at 210 nm or refractive index at 45 C., using standards purchased from Sigma-Aldrich. The column was a BioRad Aminex HPX-87H run at 50 C. with 8 mM sulfuric acid as the mobile phase at a flow rate of 0.6 ml/min for 40 minutes. A chromatograph of purchased standards (Sigma-Aldrich) is shown in
[0094] To separate the isomers of muconic acid, the samples prepared as above were run in a second HPLC system. The instrument was an Agilent 1200 HPLC, the column was an Agilent Eclipse XDB-C18, 4.6150 mm run at 30 degrees Centigrade with a mobile phase of 50 mM KH.sub.2PO4 in 30% methanol adjusted to pH 3.0 with phosphoric acid. The flow rate was 1 ml/min for 4 minutes, with detection by absorbance at 278 nm. The cis, trans-muconic acid standard was created by dissolving cis, cis-muconic acid in water and allowing it to undergo spontaneous acid catalyzed isomerization for about 2 hours at room temperature, until the HPLC peak had completely shifted to a new position. The other standards were purchased from Sigma-Aldrich. A chromatograph showing standards is shown in
[0095] (094) Composition of muconic acid production medium for the fermentation process: Each liter of fermentation medium contains 50 ml/L of 1M KH.sub.2PO.sub.4, 10 ml of 200 g/L Citric acid+25 g/L Ferric citrate, 1.2 ml of 98% Sulfuric acid, and a drop of Antifoam 204. These components were mixed with enough water to allow room for addition of other components below. After autoclaving, the following components were added: 10, 20, 30 or 40 ml of 50% glucose (to give 5, 10, 15, or 20 g/l final), 2 ml of 1M MgSO4, 1 ml of 0.1M CaCl2, 10 ml of 1000 Trace elements (Jantama et al. 2008a), and if necessary 1, 2, 4, or 8 ml of 50 g/L Phenylalanine+50 g/L Tyrosine+50 g/L Tryptophan (to give 0.5, 0.1, 0.2, or 0.4 g/l final), 10 ml of 1 g/L p-hydroxybenzoic acid+1 g/l p-aminobenzoic acid+1 g/L 2,3-dihydroxylbenzoic acid (the last three compounds are referred to as the aromatic vitamins or vitamin-like componds, and, as necessary, 1 ml of 150 mg/ml Ampicillin (sodium salt) and/or 1 ml of 100 mg/ml Spectinomycin HCl. Aromatic amino acids and vitamins were not required and were not used for strains expressing functional AroE protein.
[0096] For shake flasks, NBS salts (Jantama et al. 2008a) plus 0.2 M MOPS buffer, pH 7.4 was substituted for the pre-autoclave mix described above, but the glucose and other additives were the same. For fed batch fermentation, the feed bottle contained 600 g/L of anhydrous glucose and, if necessary, 32 ml/L of 50 g/L phenylalanine+50 g/L tyrosine+50 g/L tryptophan. 9 M NH.sub.4OH was used as base to maintain the pH of the fermentation medium. Aromatic amino acids and vitamins were not required and were not used for strains expressing a functional AroE protein.
[0097] Fed-batch fermentations were performed in 7 L New Brunswick Scientific Fermentors with pH, DO, temperature, glucose, and feed rate controlled by either DCU controllers or Biocommand Software. The medium was 50 mM K2HPO4, 20 mM K2SO4, 3 mM MgSO4 and trace elements. The trace elements are prepared as a 50 stock and contained the following components: 1.6 g/L FeCl.sub.3, 0.1 g/L CuCl.sub.2, 0.2 g/L ZnCl.sub.2.4H.sub.2O, 0.2 g/L NaMoO.sub.4, 0.05 g/L H.sub.3BO.sub.3, and 0.55 g/L MnCl.sub.2.4H.sub.2O. The temperature was maintained at 37 C., the pH was maintained at 7.0 by 9N ammonium water. Aeration was at 0.5 vvm and the dissolved oxygen (DO) was maintained at 30% by automatically increasing the impeller's speed from 750 rpm to 1200 rpm. The initial glucose concentration in the medium was around 20 to 25 g/L. Feed glucose solution was added to the fermentor when the concentration dropped to below 5 g/L. The initial glucose feed rate was 4 g/L/hr and was ramped up to a feed rate of 7 g/L/hr by 48 hours after which it was maintained at 7 g/L/hr.
[0098] Construction of plasmids expressing muconic acid pathway genes: The three heterologous genes required for conversion of DHS to muconic acid were cloned either singly or in combination into a low-copy plasmid, pCL1921 (Lerner and Inouye, 1990). The DNA sequence of pCL1921 is given in SEQ ID No. 20 in Table 7. Briefly, the coding sequences of catAX, aroY and aroZ analogs or homologs were codon-optimized for expression in E. coli and commercially synthesized (GeneArt, Invitrogen). These sequences were then PCR amplified using a forward primer carrying a unique ribosome-binding site and a reverse primer carrying a unique terminator sequence for each gene. The resulting PCR fragment was digested with restriction enzymes and cloned downstream of a unique constitutive promoter sequence by standard molecular cloning procedures. The promoter sequences were cloned by PCR amplification from source DNA sequences previously described (United States Patent Application 20090191610; U.S. Pat. No. 7,244,593) followed by restriction digestion and standard molecular cloning. The promoter-RBS-coding sequence-terminator sequence together constituted an expression cassette. Individual expression cassettes were next combined to generate plasmids expressing one, two or all three muconic acid pathway genes.
[0099] The present invention is further illustrated using the following examples; however the examples provided herein in either alone or in any combination thereof should be construed to limit the scope or the embodiment of the invention. The claims provided at the end define the scope of the invention. A person skilled in the art can clearly understand the scope of the present invention as defined the claims. A person skilled in the art can make modifications or changes to the technical solutions provided by the invention without departing from the spirit and scope of the present invention.
EXAMPLE 1
Increasing Expression of aroG and aroF Genes
[0100] The tyrR gene of E. coli can be mutated by any one of a number of well-known methods, such as chemical or radiation mutagenesis and screening (for example by PCR and DNA sequencing) or selection for analog resistance (for example, resistance to 4-fluorotyrosine), transposon mutagenesis, bacteriophage Mu mutagenesis, or transformation. In a preferred embodiment, the mutation in tyrR gene is a null mutation (a mutation that leaves no detectable activity), and in a more preferable embodiment, at least a portion of the tyrR gene is deleted. This can be accomplished, for example, by using a two-step transformation method using linear DNA molecules (Jantama et al, 2008a; Jantama et al, 2008b). In the first step, a cam.sup.R, sacB cassette is integrated at the tyrR locus to replace most or all of tyrR open reading frame by double recombination and selecting for chloramphenicol resistance. In the second step, a linear DNA comprising a deleted version of the tyrR gene is integrated by double recombination, selecting for resistance to 5% sucrose in a rich medium such as LB. Correct deletions are identified and confirmed by diagnostic polymerase chain reaction (PCR). The purpose of deleting tyrR is to increase expression of aroG and aroF. An alternative approach that achieves a similar result is to replace the native promoter in front of aroG and/or aroF with a strong constitutive promoter and add, if necessary, a transcription terminator. More details on how this is accomplished in general are given in Example 4 below.
[0101] The latter of the two approaches described above for overcoming the repression of AroG and AroF activities by TyrR protein is preferable, since deletion of tyrR can cause unwanted overexpression of genes such as aroLM (Neidhardt and Curtiss, 1996). More detail on how this is accomplished in general is given in Example 4 below.
EXAMPLE 2
Feedback Resistant AroG and AroF
[0102] Mutations in the aroG gene that lead to a feedback resistant AroG enzyme (3-deoxy-D-arabinoheptulosonate-7-phosphate synthase or DAHPS) are well known in the art (Shumilin et al, 1999; Kikuchi et al, 1997; Shumilin et al, 2002). Also well known are methods for creating, identifying, and characterizing such mutations (Ger et at, 1994, Hu et al., 2003). A preferable mutation is one that leads to complete resistance to inhibition by phenylalanine. Any of the known published feedback resistant mutations can be introduced into an aroG gene contained in the chromosome or on a plasmid by any of a number of well known methods, one example of which is mutagenic PCR in which the desired mutation is synthesized as part of a PCR priming oligonucleotide (Hu et al., 2003). Correct installation of the mutation is confirmed by DNA sequencing. The sequence of the wild type aroG gene from E. coil C is given in SEQ ID No. 18. A preferred mutation is a point mutation that changes amino acid 150 of AroG from proline to leucine, for example by changing codon 150 from CCA to CTA (Hu et al, 2003). In a more preferred embodiment, codon 150 is changed from CCA to CTG, which is a preferred codon in E. coli. This particular allele of aroG is preferred, since the encoded DAHP synthase is completely resistant to inhibition by phenylalanine up to 3 mM, and it has a specific activity similar to the wild type enzyme (Hu et al., 2003).
[0103] Additional feedback resistant aroG alleles can be obtained by mutagenesis and selection for resistance to one or more phenylalanine analogs, such as beta-2-thienylalanine, p-fluorophenylalanine, p-chlorophenylalanine, o-fluorophenylalanine, and o-chlorophenylalanine, followed by demonstrating that the mutation causing the resistance is linked to the aroG gene (Ger et al., 1994; U.S. Pat. No. 4,681,852). Linkage to aroG can be demonstrated directly by DNA sequencing or enzyme assay in the presence and absence of phenylalanine, (Ger et al., 1994) or indirectly by phage mediated transduction and selection for a genetic marker at or near the aroG locus that can be selected, either for or against (U.S. Pat. No. 4,681,852). Such a genetic marker can be a deletion or point mutation in the aroG gene itself, or a mutation in any suitable closely linked gene such as nadA in case of E. coli. For an example in E. coli, after mutagenesis and selection for phenylalanine analog resistance, individual mutants or pools of mutants can be used as donors for P1 mediated transduction into a nave recipient that is deleted for all three DAHP synthase genes, aroG, aroF, and aroH, and selecting for growth on an appropriate minimal medium. The transductants will then be enriched for mutations in the desired gene(s). Alternatively, after mutagenesis and selection for analog resistance, individual mutants or pools of mutants can be used as donors for P1 mediated transduction into a nave recipient strain that contains a null mutation in the nadA gene, again selecting for growth on an appropriate minimal medium lacking nicotinamide. Another approach is to select for resistant mutants in a strain background that contains a transposon, for example Tn10, insertion near the aroG gene, such as in the nadA gene. P1 transduction from analog resistant mutants into a strain background that does not contain said transposon and selecting for tetracycline or other appropriate antibiotic resistance will enrich for the desired aroG mutations. In all such approaches, feedback resistance is ultimately confirmed by enzyme assay and DNA sequencing of the gene. We shall refer to alleles of aroG that are resistant to feedback inhibition as aroG*.
[0104] Strain WM191 (tyrR, aroF) was derived from YMC9 (ATCC 33927). The two step gene replacement method (Jantama et al., 2008a) was used to install clean deletions in both tyrR and aroF, to give strain WM191. Next, a nadA::Tn10 allele was transduced in from CAG12147 (CGSC 7351, Coli Genetic Stock Center, Yale University) to give strain WM189 (tyrR, aroF, nadA:: Tn10). Selection was on LB plus tetracycline HCl (15 mg/l). Strain RY890 (tyrR::kan, aroF363) was derived from MM294 (ATCC 33625) in three steps by P1 transduction. The donor strains, in order, were JW1316-1 (CGSC 9179, Coli Genetic Stock Center, Yale University), NK6024 (CGSC 6178, Coli Genetic Stock Center, Yale University), and AB3257 (CGSC 3257, Coli Genetic Stock Center, Yale University), and the three selections, in order, were LB plus kanamycin sulfate (50 mg/l), LB plus tetracycline hydrochloride (15 mg/l), and NBS minimal glucose (Jantama et al., 2008a) with thiamine HCl (5 mg/l).
[0105] WM189 was mutagenized with UV light to about 20% survival and plated on NBS minimal glucose medium (Jantama et al., 2008a) containing o-fluorophenylalanine (1 mM), thiamine (5 mg/l), and nicotinamide (1 mM). Colonies from each of several plates were collected into separate pools, and P1vir lysates were made on each pool. These lysates were used to transduce WM191 to tetracycline resistance (15 mg/l) on LB medium, and the colonies obtained were replica plated to NBS minimal glucose medium containing o-fluorophenylalanine at 1 mM, thiamine (5 mg/l), and nicotinamide (1 mM). Colony replicas that survived both tetracycline and analog were assumed to contain a feedback resistant mutation in aroG. Eight individual colonies from 5 independent pools were chosen for DNA sequencing. The aroG coding regions were amplified by polymerase chain reaction and sequenced. The results, shown in Table 4, revealed that each of the eight strains contained a point mutation in their aroG gene. Some of the alleles were identical to published alleles, but some were novel.
[0106] A Plvir lysate from one of the pools described above was used to transduce RY890 (which has an aroG wild type allele) to tetracycline resistance and resistance to o-fluorophenylalanine (0.3 mM) by replica plating as described above. Four colonies, named RY893, RY897, RY899, and RY901, were picked for DNA sequencing (Table 4), and again, two of the alleles were identical to a published allele, but two were novel. Strain RY902, which is isogenic to the latter four strains, but contains a wild type aroG gene, was constructed as a control, by transduction from CAG12147. These five strains were grown overnight in shake flasks in 25 ml NBS minimal glucose (15 g/l) plus thiamine HCl (5 mg/l) and nicotinamide (1 mM). The resulting cells were harvested by centrifugation, resuspended to be rinsed with 10 ml water, re-centrifuged, and resuspended in 0.5 ml of 50 mM potassium phosphate, pH 7.0. The suspended cells were lysed by vortexing with three drops of chloroform, and the crude lysate was assayed for DAHP synthase activity using a method similar to a method described in the literature (Hu et al., 2003), with the following modifications. The phosphate buffer was 50 mM (final concentration), pH 7.0, the final erythrose-4-phosphate concentration was 2 mM, the final phosphoenol pyruvate concentration was 5 mM, the incubation temperature was 30 C., and the reaction was stopped at 10 minutes. We define 1 mU as the activity that produced 1 nMole of DAHP per minute per milligram protein. To test for feedback resistance, each crude lysate was assayed with or without phenylalanine at a final concentration of 18 mM. The assay results are shown in Table 5. The enzymes showed varying specific activity and resistance to phenylalanine, but all of selected mutant versions that were tested were significantly more resistant than the wild type controls.
[0107] The aroG alleles from RY893, RY899, RY901, and RY902, described above, were introduced into a muconic acid producing strain background as follows. Plvir lysates from the aroG* and aroGwt donor strains were used to transduce MYR219 (E. coli C, aroE, ack::P.sub.15-aroB, pMG37) to tetracycline HCl resistance (15 mg/l), to give new strains RY903, RY909, RY911, and RY912, respectively. Each of these strains was then transduced to kanamycin sulfate resistance (50 mg/l) using a P1vir lysate of JW1316-1, to introduce the tyrR:kan allele, to give strains RY913, RY919, RY921, and RY922, respectively. Spectinomycin selection was maintained throughout to maintain the muconic plasmid. The resulting four strains were grown for 48 hours at 37 C. in shake flasks in 25 ml NBS minimal medium (Jantama et al., 2008a) containing supplements of 20 g/l glucose, 0.2 M MOPS buffer, pH 7.4, nicotimamide (1 mM), phenylalanine (100 mg/l), tyrosine (100 mg/l), tryptophan (100 mg/l), p-hydroxybenzoic acid (1 mg/l), p-aminobenzoic acid (1 mg/l), 2,3-dihydroxybenzoic acid (1 mg/l), phenol red (10 mg/l), and ammonium sulfate (1 g/l). The pH was kept close to 7 as estimated by eye from the color of the phenol red, against a pH 7.0 standard, by manual addition of 1 ml aliquots of 1.0 M KOH as called for to the shake flasks. The muconic acid produced was assayed by HPLC as described above, and the results are shown in Table 6. All three strains that contain a feedback resistant aroG* allele produced more muconic acid than the isogenic strain containing the wild type aroG allele. In a separate experiment disclosed herein, strain MYR205, containing aroG on multicopy plasmid pCP32AMP, produced 1.5 g/l muconic acid in a shake flask. Thus, the inventors have shown that the combination of tyrR and single copy chromosomal aroG* can perform well compared to an isogenic aroG plasmid containing strain to produce muconic acid in shake flasks. The inherent superior genetic stability of the chromosomal alleles compared to plasmid alleles, plus the alleviation of the need for a selective medium to hold in a plasmid, makes the novel strains described herein more suitable for large scale commercial fermentations. Furthermore, no chemical inducer was required for expression of muconic acid pathway genes. Thus, strains of the instant invention described above arc improved over those of the prior art (Niu et al., 2002), all of which contain the gene for overexpression of DAHP synthase on an undesirable multicopy plasmid.
[0108] In a similar fashion to that described above for AroG, a mutation that leads to an AroF or AroH isozyme that is resistant to feedback inhibition by tyrosine can be installed on a plasmid or in the chromosome. A preferred mutation is a point mutation that changes amino acid 148 of AroF from proline to leucine, for example by changing codon 148 from CCG to CTG (Weaver et al., 1990), to give a gene named aroF*. Other alleles of aroF* can be isolated by resistance to tyrosine analogs (for example o-fluorotyrosine, m-fluorotyrosine, p-fluorophenylalanine, etc.) in a fashion analogous to that described above for aroG* alleles. aroF* alleles can be selected, enriched for, and transduced by linkage to a transposon or a kanamycin resistance insertion, for example in a closely linked yfiR::kan as in a strain such as JW2584 (CGSC 10051, Coli Genetic Stock Center, Yale University).
EXAMPLE 3
Deletion of aroE from Chromosomal DNA and Muconic Acid Production
[0109] In this example the effect of overexpression of aroB and aroG on multicopy plasmids as well as the expression of genes coding for proteins functional in the muconic acid pathway was investigated. Strain MYR34 containing a deletion in the aroE gene coding for shikimate dehydrogenase was used as parent strain in these studies. The deletion of chromosomal copy of aroE was accomplished in a fashion similar to that described above in Example 1. When MYR34 was transformed with the plasmid pCP32AMP overexpressing the aroG gene coding for DAHP synthase protein functional in the shikimic acid pathway, there was a significant increase in the accumulation of DHS. When MYR34 was transformed with the plasmid expressing aroB from a constitutive promoter, no significant increase in the accumulation of DHS was noticed. However, when the E. coli strain MYR34 was transformed with the plasmid expressing both aroB and aroG genes, there was an increase in the accumulation of DHS than observed with MYR34 transformed with aroG alone thus suggesting aroB as a secondary bottleneck in DHS production (
[0110] In the experiments presented in
[0111]
EXAMPLE 4
Overexpression of tktA
[0112] Transketolase encoded by tktA is a key enzyme in the pentose phosphate pathway and is thought to be limiting for the production of erythrose-4-phosphate, one of the key intermediates in the production of muconic acid. Overexpression of tktA, which encodes transketolase, by installing the gene with its native promoter on a multicopy plasmid (Sprenger et al, 1995, 1995a), is known to improve flux into the aromatic pathway (Draths et al., 1992). However, such plasmids are unstable, and often require antibiotic selection for maintenance. Another approach in the prior art was to add one additional copy of the tktA gene to the chromosome of the host strain (Niu et al., 2002). However, one additional copy of tktA with its native promoter is not sufficient to saturate the aromatic pathway with erythrose-4-phosphate, since its native promoter is not very close to the ideal. As such, the process needs substantial improvement.
[0113] Improved overexpression of tktA can be obtained, for example, by substituting the native tktA promoter in the chromosome with a strong constitutive promoter, for example a P.sub.15 or P.sub.26 promoter from Bacillus subtilis phage SPO1 (SEQ ID No. 1 and SEQ ID No. 2, respectively), or the P.sub.R promoter from bacteriophage lambda (SEQ ID No. 3). This is accomplished in two steps as described in Example 1, except that the cam.sup.R, sacB cassette is used to replace the native chromosomal tktA promoter in the first step. In the second step, the strong constitutive promoter is installed by transforming with a linear DNA comprising the strong constitutive promoter, flanked by at least 50 bases of the 5 end of the tktA coding region on the downstream side and at least 50 base pairs of homology just upstream of the native tktA promoter on the upstream side of the strong constitutive promoter, and selecting for sucrose resistance. Improved expression from such an expression cassette is also accomplished by increasing the stability of the mRNA that is transcribed from the expression cassette. Improvement of the mRNA stability is accomplished by adding a stem loop structure at either the 5 end of the mRNA, the 3 end of the mRNA, or both. A stem-loop structure is often present at the end of an mRNA that is naturally terminated by a rho-independent transcription terminator, but if it is not, then a rho-independent transcription terminator can be added to the DNA sequence by well known methods of genetic engineering (ligation, PCR, etc.). Such a terminator can be comprised of an inverted repeat of between 4 and 20 bases in each repeat, separated by a loop of 3 or more bases, and followed by a region of one or more bases that is enriched for T's (deoxythymidine). The inverted repeats are rich in G's and C's (deoxyguanidine and deoxycytidine). Similarly, a stem-loop can be constructed into the 5 end of an mRNA by inserting a DNA sequence just downstream from the start point of transcription, but before the ribosome binding site, that contains a stem-loop as described above, but without the T-enriched region. An example of this is given in association with the P.sub.15 promoter (SEQ ID No. 1).
[0114] In the analysis of the effect of overexpression of the tktA gene on the flow of carbon through the shikimic acid pathway, E. coli strain MYR170 was used as a parental strain. MYR170 has a deletion in the aroE gene coding for shikimate dehydrogenase enzyme and an additional copy of the aroB gene at the ack locus.
[0115] In the experiments described in the
[0116]
[0117] MYR261 used in the experiments described in
[0118]
EXAMPLE 5
Overexpression of talA or talB
[0119] The talB gene encodes the predominant transaldolase in E. coli, but the talA gene also encodes a minor transaldolase. Overproduction of transaldolase is known to improve flux into the aromatic pathway (Lu and Liao, 1997; Sprenger, 1995; Sprenger et al, 1995b). In the prior art, this was accomplished by overexpression of the tal gene (now known to be the talB gene) on a multicopy plasmid from its native promoter (Lu et al., 1997, Sprenger et al., 1995b). However, such plasmids are unstable, and require antibiotic selection for maintenance. Thus, there is a need for an improved process. Improved expression of talB can be obtained, for example, by substituting the native talB promoter in the chromosome with a strong constitutive promoter, for example a P.sub.15 or P.sub.26 promoter from Bacillus subtilis phage SPO1 (SEQ ID No. 1 and SEQ ID No. 2, respectively), or the P.sub.R promoter from bacteriophage lambda (SEQ ID No. 3). This is accomplished in two steps as described in Example 1, except that the cam.sup.R, sacB cassette is used to replace the native chromosomal talB promoter in the first step. In the second step, the strong constitutive promoter is installed by transforming with a linear DNA comprising the strong constitutive promoter, flanked by at least 50 bases of the 5 end of the talB coding region on the downstream side and at least 50 base pairs of homology just upstream of the native talB promoter on the upstream side of the strong constitutive promoter, and selecting for sucrose resistance. The talA gene can also be overexpressed by a similar method, but it is preferred to over express the talB gene, since it encodes the predominant activity (Sprenger, 1995; Sprenger et al, 1995b). See Example 4 for more details on construction of the expression cassette designed for overexpression.
EXAMPLE 6
Expression of aroZ, aro and catAX Genes
[0120] To demonstrate conversion of endogenous DHS produced by E. coli into muconic acid, heterologous genes catAX from Acinetobacter sp. ADP1, aroY from Klebsiella pneumoniae, and quiC from Acinetobacter sp. ADP1, were cloned under strong constitutive promoters (P.sub.15, P.sub.R, and P.sub.26, respectively) in a low-copy plasmid, pCL1921 (Lerner and Inouye, 1990) to generate a muconic plasmid pMG37. MYR34 strain derivatives carrying the empty vector (pCL1921) or pMG37 were grown at 37 C. for 17 hrs. in a shake flask medium (NBS minimal medium supplemented with aromatic amino acids and vitamins) containing 2% glucose. Supernatants were collected and analyzed by HPLC. In contrast to MYR34/pCL1921 which shows accumulation of DHS, MYR34/pMG37 shows production of muconic acid (
EXAMPLE 7
Comparison of aroZ Homologs
[0121] Three different aroZ homologs and analogs were compared (
EXAMPLE 8
Chromosomal Integration of catAX, aroY and quiC
[0122] Muconic acid can be produced by strains that contain only chromosomally integrated single copies of catA-X, aroY and quiC expressed from constitutive promoters at adhE locus.
[0123] MYR170 (aroE, ack::P.sub.15-aroB), a high DHS producer, was the host strain used for integrating the muconic acid pathway genes at the adhE locus in the chromosome (SEQ ID No. 41). The resulting strain MYR352 was transformed with plasmids YEp24 (medium-copy, empty vector), pCP32AMP (medium-copy, aroG expressed from native promoter), or pCP50 (medium-copy, aroG and tktA expressed from their respective native promoters) to generate derivative strains. The latter two plasmids were used to increase DHS production. Strains were grown at 37 C. for 72 hrs. in shake flask medium containing 2% glucose as described above. Supernatants were collected at 72 hrs. and analyzed by HPLC. As expected, the aroG and aroG/tktA transformed MYR352 derivatives showed an overall increase in total product formation compared to an empty vector control (
[0124] Not all DHS that was produced in any of these MYR352 derivative strains was converted to the end product muconic acid. Instead, there was a significant amount of catechol accumulation (
[0125] The MYR352 strain derivatives were compared in parallel with analogous MYR219 strain derivatives. MYR219 strain is same as MYR170 strain but contains low-copy plasmid pMG37 expressing muconic acid pathway genes. Thus, the main difference between MYR352 and MYR219 strains is with reference to the dosage of muconic acid pathway genes (1 copy vs. about 5 copies, respectively). In contrast to MYR352 derivative strains, MYR219 derivative strains showed very little accumulation of catechol or other intermediates, and successfully produced the end product muconic acid. Together, these results indicate the need for increasing catAX activity in strains such as MYR352.
EXAMPLE 9
Expression of catAX
[0126] Accumulation of catechol and inefficient production of muconic acid in MYR352 strain is due to limiting dosage and/or activity of the catAX gene product(s). As described above, MYR352 contains aroE, ack::P.sub.15-aroB and chromosomally integrated single copies of catAX, aroY and quiC genes under strong constitutive promoters. This strain was transformed with medium-copy empty vector control (YEp24) or aroG/tktA expression plasmid (pCP50) to increase carbon flow into the aromatic amino acid synthesis pathway and produce high amounts of DHS. Growth of transformed strains at 37 C. for 72 hrs in shake flask medium supplemented with 2% glucose as described above resulted in accumulation of catechol intermediate. This result suggested that catAX activity may be insufficient in MYR352. To confirm this hypothesis, the ability of one or more muconic acid pathway genes expressed from low-copy plasmid to alleviate catechol accumulation in MYR352/pCP50 was tested (
EXAMPLE 10
Constructing a Leaky aroE Mutation
[0127] In the prior art process for producing cis, cis-muconic acid, the host strain contains a mutation in the aroE gene named aroE353, which is a null mutation. As a result, the strain requires the feeding of the aromatic amino acids (phenylalanine, tyrosine, and tryptophan) and aromatic vitamins made from the shikimate pathway (p-hydroxy benzoic acid, p-amino benzoic acid, and 2,3-dihydroxy benzoic acid). The aromatic amino acids arc too expensive to be fed in a commercially attractive process. As such, the prior art process needs a substantial improvement. This can be accomplished by installing a leaky version of the aroE gene, that we shall call aroE*. Leaky mutations are obtained by first generating a missense mutation that changes one amino acid in the aroE coding sequence that results in a null phenotype. This can be accomplished by any form of mutagenesis and screening for simultaneous auxotrophy for the six aromatic compounds listed above. A preferred method is to create a pool of mutant aroE genes by error-prone PCR mutagenesis, using Taq DNA polymerase, using wild type E. coli C genomic DNA as the template, and using PCR oligonucleotide primers that hybridize about 1000 base pairs upstream and 1000 base pairs downstream of the aroE coding region. The resulting pool of linear DNA molecules is used to transform an E. coli C derivative that produces cis, cis-muconic acid, and which contains an integrated cam.sup.R, sacB cassette that has replaced the aroE coding region (see Example 4 for a related example), and selecting for sucrose resistance. The transformants are then screened for auxotrophs that have lost chloramphenicol resistance and require the six aromatic compounds listed above. Several independent auxotrophs are picked and tested for revertability by plating about 10.sup.7, 10.sup.8, or 10.sup.9 cells (rinsed in minimal glucose medium) on a minimal glucose plate without the six aromatic compounds. Revertants that give rise to colonies on the plates are picked and tested for production of cis, cis-muconic acid, but without production of substantial levels of aromatic amino acids. Among such revertants will be strains that carry one or more mutations in the aroE gene, such that the AroE enzyme provides enough aromatic amino acids and vitamins for growth, but not a surplus of these aromatic compounds. Another method to obtain a leaky aroE mutant is to install one of the classical revertable aroE mutants, such as aroE353 and aroE24 (both available from the Coli Genetic Stock Center at Yale University, New Haven, Conn., USA), into a cis, cis-muconic acid producing strain, and select for revertants as described above.
EXAMPLE 11
Import of Glucose by Facilitated Diffusion
[0128] One of the substrates in the first committed step of the aromatic pathway is phosphoenolpyruvate (PEP). PEP is also the source of phosphate and energy for importing glucose and some other sugars by the bacterial phosphotransferase system (PTS). Thus, when a bacterium is growing on a PTS-dependent sugar, there is competition between the PTS and the aromatic pathway for PEP. As such, a significant improvement in increasing flux to the aromatic pathway can be achieved by deleting the PTS and providing an alternative pathway for sugar uptake. One solution to this problem is to replace the PTS with the E. coli GalP permease, a proton symporter that works reasonably well for glucose uptake (U.S. Pat. No. 6,692,794). However, the proton symporter still uses energy to maintain the proton gradient that is necessary to drive the permease. As such, there is a need for even further improvement in the process.
[0129] Some sugars, such as xylose, can be imported by a transporter protein that derives energy from hydrolysis of ATP (adenosine triphosphate). Once again, if the energy-dependent transporter can be replaced by a transporter that requires less energy, then an improvement can be made, since the energy inherent in the ATP can be conserved for other beneficial uses.
[0130] A significant improvement can be obtained by using a facilitated diffusion transporter, which expends no energy for the importation of the sugar (Parker et al, 1995; Snoep et al, 1994). For example, the glucose facilitator from Zymomonas mobilis, encoded by the glf gene, can be used in place of, or in addition to, the PTS in 3-dehydroshikimate (DHS) producing strains (Yi et al., 2003). However, these strains still rely at least partly on GalP for glucose import. Since GalP requires energy in the form of a proton gradient for importation of glucose, there is a need for improvements in the efficiency of glucose import for muconic producing strains.
[0131] A cassette for expression of glf plus a glucokinase gene, glk, also from Z. mobilis, can be assembled with a strong constitutive promoter, for example P.sub.26. This cassette can then be integrated into the genome of a host strain at a location that will not interfere with production of the desired compound, which in this case is cis, cis-muconic acid. An example of such a location in the E. coli chromosome is the threonine degradation operon, tdcABCDEFG. If the growth medium contains no threonine, then this operon is not needed or expressed, so an insertion of an expression cassette in that operon does not interfere with metabolism.
[0132] To achieve the above described improvement, one or more of the genes encoding a PTS function are deleted, using a method similar to that disclosed in Example 1. For example, one or more of ptsH, ptsl, crr, or ptsG can be deleted. Next galP is deleted using the process as decribed in the U.S. Pat. No. 8,871,489. The P.sub.26-glf; glk cassette can then be installed in two steps, similar to those described in Example 1. In the first step, a cam.sup.R, sacB cassette is integrated at the tdc operon, using a linear DNA derived from pAC21 (SEQ ID No. 15), and selecting for chloramphenicol (30 mg/l) resistance. In the second step, the P.sub.26-glf; glk cassette is integrated at the tdc operon, using a linear DNA derived from pAC19 (SEQ ID No. 15), selecting for sucrose resistance and screening for chloramphenicol sensitivity, and in this case, improved growth on minimal glucose medium.
[0133] To test whether facilitated diffusion of glucose could substitute for the conventional glucose import systems in E. coli, the ptsHI genes and the galP gene were deleted from MYR34 (AaroE), and then the P.sub.26-glf, glk cassette was integrated at the tdc operon, using a linear DNA derived from pAC19 (SEQ ID No. 15), to give strain MYR217. MYR217 grows reasonably well on a minimal glucose medium supplemented with the required three aromatic amino acids and three aromatic vitamin-like compounds (
[0134] To test whether facilitated diffusion is useful for producing compounds derived from the aromatic pathway, MYR34 and MYR217 were transformed with pCP54 (aroG, aroB) and pCP55 (aroG, aroB, tktA). Production of the aromatic intermediate 3-dehydroshikimate (DES) in shake flasks was compared for these two strains (
EXAMPLE 12
Overexpression of the aroB Gene
[0135] Expression of the aroB gene is reported to be rate limiting for cis, cis-muconic acid production (Niu et al., 2002). In the prior art, this was allegedly solved by integrating a second copy of the aroB gene with its native promoter. However, this is insufficient to alleviate the aroB limitation, since the native promoter and ribosome binding site of the aroB gene are far from ideal. As such, the process needs substantial improvement.
[0136] Improved overexpression of aroB can be obtained, for example, by replacing the native aroB promoter in the chromosome with a strong constitutive promoter, for example a P.sub.15 or P.sub.26 promoter from Bacillus subtilis phage SPO1 (SEQ ID No. 1 and SEQ ID No. 2, respectively), or the P.sub.R promoter from bacteriophage lambda (SEQ ID No. 3). This is accomplished in two steps as described in Example 4, except that the cam.sup.R, sacB cassette is used to replace the native chromosomal aroB promoter and/or ribosome binding site in the first step. In the second step, the strong constitutive promoter is installed by transforming with a linear DNA comprising the strong constitutive promoter, followed by a ribosome binding site and at least 50 bases from the 5 end of the aroB coding sequence, including the ATG start codon, on the downstream side, and at least 50 base pairs of homology just upstream of the native aroB promoter on the upstream side of the strong constitutive promoter, and selecting for sucrose resistance. In addition to, or instead of, installing a stronger promoter, using a similar method, a stronger ribosome binding site, for example, AGGAGG, can be installed about 4 to 10 base pairs upstream of the ATG translation start codon of aroB. A copy of such a synthetic cassette, for example, a P.sub.15-aroB cassette, can be integrated in the chromosome at a locus distinct from the native aroB locus, for example at the ack locus. Simultaneous deletion of the ack gene, as well as deleting the poxB gene as in Example 4 can help to reduce formation of unwanted acetate during fermentations.
EXAMPLE 13
Decreasing Flux through the Oxidative Branch of the Pentose Phosphate Pathway
[0137] The erythrose-4-phosphate that is needed for the first committed step in the aromatic pathway is derived from the non-oxidative portion of the pentose phosphate pathway (PPP). There are two different pathways by which carbon can enter the PPP. The first is from glucose-6-phosphate by the enzymes glucose-6-phosphate dehydrogenase (encoded by the zwf gene), 6-phosphogluconolactonase (encoded by the pgl gene), and 6-phophogluconate dehydrogenase (encoded by the gnd gene), to give ribulose-5-phosphate. In the last of these three steps, one carbon is lost as CO.sub.2. This path into the PPP is called the oxidative branch of the PPP. Ribulose-5-phosphate is then converted into a variety of other sugar phosphates by the action of isomerases, epimerases, transketolase, and transaldolase. This group of reversible reactions, starting with ribulose-5-phosphate, is called the non-oxidative branch of the PPP. The second path by which carbon can enter the PPP is through fructose-6-phosphate and glyceraldehye-3-phosphate (both of which come from the Embden-Myerhoff pathway, also known as glycolysis), which are combined and rearranged by transaldolase and transketolase to give the variety of other sugar phosphates, one of which is erythrose-4-phosphate. If carbon enters the PPP through this second route, then no CO.sub.2 is lost. In order to improve the yield of cis, cis-muconic acid from glucose, the loss of CO.sub.2 can be prevented by blocking the oxidative branch of the PPP, such that all carbon entering the PPP must come through a non-oxidative route from fructose-6-phosphate and glyceraldehye-3-phosphate. The blocking of the oxidative branch of the PPP is accomplished by deleting the zwf gene, using a two-step method similar to that disclosed in Example 1 for deleting the tyrR gene.
EXAMPLE 14
Increasing the Flux to and through PEP to the Aromatic Pathway
[0138] It is desirable to ensure that PEP is not a rate limiting intermediate on the pathway to cis, cis-muconic acid. This is accomplished, for example, by increasing the recycling of pyruvate to PEP by the enzyme PEP synthetase, which is accomplished by integrating an overexpression cassette of the pps gene as described above in other examples. Another approach is to limit the consumption of PEP by pyruvate kinase, which in E. coli is encoded by the pykA and pykF genes. In this case, the approach is to decrease the activity of the enzyme(s). This is accomplished by deleting one or more genes that encode pyruvate kinase (as described in Example 1 for tyrR and in the U.S. Pat. No. 9,017,976), or reducing the strength of expression of one or more of these genes, for example, by mutating the promoter, ribosome binding site, or coding sequence, such that the level of pyruvate kinase activity is decreased. For example, the RBS in front of the E. coli pykA gene is 5CGGAGTATTACATG. The ATG translation start codon is underlined. This sequence can be mutated to CaGAGTATTACATG, CaaAGTATTACATG, CaatGTATTACATG, CaataTATTACATG, and so on, such that the RBS sequence is made less like the consensus RBS of AGGAGG by one base change at a time. Each mutated version is then introduced into the chromosome at the pykA locus, replacing the wild type, and cis, cis-muconic acid production levels are measured for improvement.
EXAMPLE 15
Conferring Growth on Sucrose
[0139] Strains derived from E. coli C do not grow on sucrose as a sole carbon source. However, they can be genetically engineered to do so as disclosed in the International Patent Application Publication No. WO2012/082720 and US Patent Application Publication No. US2013/0337519 which are hereby incorporated by reference in its entirety. As such, a cis, cis-muconic acid producing strain can be engineered to grow on sucrose as disclosed in the above mentioned application.
EXAMPLE 16
An Improved Producer of cis, cis-muconic Acid
[0140] All of the features described in Examples 1-15 can be combined in one strain of E. coli by installing the features one after another. The resulting strain comprises an improved cis, cis-muconic acid producer. The resulting strain can then be even further improved by integrating a second copy of each overexpression cassette described above, one at a time, at a location separate from the location of the first copy. An example of a convenient and safe location is at a BsrB1 restriction site just downstream from the terminator of rrfF, which encodes a ribosomal RNA. The desired cassette is ligated as a blunt linear DNA into the unique BsrB1 site of plasmid pMH17F (SEQ ID No. 17). An example is the ligation of the catAX expression cassette to give a plasmid named pcatAX. In parallel, a cam.sup.R, sacB cassette is ligated as a blunt fragment into pMH17F to give pMH28F (SEQ ID No. 19). A linear DNA derived from pMH28 by PCR or by restriction enzyme cutting is used to deposit the cane, sacB cassette at the rrfF site. Next, a linear DNA derived from pcatAX by PCR or by restriction enzyme cutting is used to install the second copy of the catAX cassette at the rrfF locus, using selection on sucrose. The resulting strain is then compared with its grandparent strain for cis, cis-muconic acid production to determine that catAX was a limiting step. By a similar method, each cassette from Examples 2-15 is tested for a rate limiting step. If a step is found to be rate limiting, then one or more additional copies of the relevant cassette is/are integrated at yet other appropriate locations in the chromosome, leading to still further improvements in cis, cis-muconic acid production, without the need for plasmids or inducible promoters.
EXAMPLE 17
Production of cis, cis-muconic Acid by Fermentation
[0141] Cis, cis-muconic acid can be produced by genetically engineered microorganisms disclosed in the above Examples 1-15. The growth medium can vary widely and can be any medium that supports adequate growth of the microorganism. A preferred medium is a minimal medium containing mineral salts and a non-aromatic carbon source, such as glucose, xylose, lactose, glycerol, acetate, arabinose, galactose, mannose, maltose, or sucrose (see above for an example of a preferred minimal growth medium). For each combination of engineered microorganism and growth medium, appropriate conditions for producing cis, cis-muconic acid are determined by routine experiments in which fermentation parameters are systematically varied, such as temperature, pH, aeration rate, and compound or compounds used to maintain pH. As cis, cis-muconic acid is produced, one or more compounds must be fed into the fermentor to prevent pH from going too low. Preferred compounds for neutralizing the acid include alkaline salts such as oxides, hydroxides, carbonates, and bicarbonates of ammonium, sodium, potassium, calcium, magnesium, or a combination two or more of such alkaline salts.
[0142] Muconic acid production by MYR428 strain of E. coli in a 7 Liter fermentor is shown in
[0143] After fermentation is complete, cells are removed by flocculation, centrifugation, and/or filtration, and the cis, cis-muconic acid is then purified from the clarified broth by a combination of one or more subsequent steps, for example precipitation, crystallization, electrodialysis, chromatography (ion exchange, hydrophobic affinity, and/or size based), microfiltration, nanofiltration, reverse osmosis, and evaporation.
EXAMPLE 18
Improvement of 3,4-dihydroxybenzoic acid (PCA) decarboxylase (AroY) Activity
[0144] E. coil strain MYR993 with the genotype as provided in Table 2 was used a parental strain to generate strains with the deletion in either the ubiX gene or the ubiD gene. In constructing the E. coli strains with the deletion in ubiX a kanamycin resistance cassette was amplified using primers MS608 and MS609 having 45 bp of homology to each end of the ubiX gene. In constructing the E. coli strains with the deletion in ubiD, a kanaymcin resistance cassette was amplified using primers MS604 and MS605 having 45 bp of homology to each end of the ubiD gene. The PCR products were column purified (QIAquick PCR Purification Kit, Qiagen) and used to transform the E. coli strain MYR993 (Table 2) using previously developed methods (Datsenko K A, Wanner B L (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 6640-6645). to produce the E. coil stains with a deletion in either ubiX gene or ubiD gene (Table 2MYR993 AubiX and MYR993 ubiD). The deletion stains are expected to be impaired in respiration so glucose was added to LB selection plates to provide for fermentative growth.
[0145] The E. coli strains MYR993, MYR993 ubiX and MYR993 ubiD were grown as 25 ml cultures in 250 ml shake flasks at 250 rpm at 37 C. for 48 hours in a medium comprised of 5 g K.sub.2HPO.sub.4, 3.5 g KH.sub.2HPO.sub.4, 3.5 g (NH4).sub.2HPO.sub.4, 1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2, trace elements (1.6 mg FeCl.sub.3.6H.sub.2O, 0.2mg CoCl.sub.2.6H.sub.2O, 0.1 mg CuCl.sub.2.2H.sub.2O, 0.2 mg ZnCl.sub.2, 0.2 mg Na.sub.2MsO.sub.4.2H.sub.2O, 0.05 mg H.sub.3BO.sub.3, 0.55 mg MnCl.sub.2.4H.sub.2O), and 0.2 M MOPS buffer (all per liter), using glucose as a carbon source. At the end of 48 hours of growth, the culture supernatants were analyzed for muconic acid and PCA content. As the results shown in
EXAMPLE 19
Comparison of Activities of UbiX Homologs in an In Vitro Assay
[0146] An in vitro assay was followed to compare the activities of UbiX and four of its homologs. In this in vitro assay the lysate from an E. coli strain over expressing AroY protein was combined with the lysate from another E. coli strain expressing UbiX protein or it homolog and the combined lysate was assayed for its ability to consume PCA as a substrate. In the muconic acid producing E. coli strain PCA is decarboxylated by AroY protein to yield catechol which in turn is converted into muconic acid by CatA protein. The decarboxylation activity of AroY protein is expected to be enhanced by the presence of UbiX or one of tis homolog and depending on the efficiency of UbiX or its homologs, the PCA in the assay solution will be consumed at different rate.
[0147] In this in vitro assay UbiX and four of its homologs namely KpdB coded by kpdB gene of Klebsiella pnemoniae (kpdB) (SEQ ID 42), Elw coded by the elw gene of E. coli W (SEQ ID 46), Kox coded by the kox gene of Klebsiella oxytoca (kox) (SEQ ID 48) and Lpl coded by lpl gene of Lactobacillus plantarum (lpl) (SEQ ID 50). The names for the last three homologs are simply provisional names given for this disclosure. AroY, UbiX, KpdB, Elw, Kox and Lpl were expressed from the strong constitutive Lambda Phage promoter P.sub.R (SEQ ID3) on a low copy plasmid (SC101 origin of replication). The plasmids pCAT350 (SEQ ID 55) and pCP165 (SEQ ID 56) were used for gene cloning. In constructing AroY plasmid, the primers RP712 and RP714 were used to amplify the aroY gene and the primers MS461 and MS346 were used to amplify the pCAT350 plasmid backbone. The resulting PCR products were ligated to obtain a plasmid overexpressing the AroY protein. In constructing a KpdB plasmid, the primers RP731 and RP732 were used to amplify kpdB gene and the primers MS461 and MS346 were used to amplify the pCAT350 plasmid backbone. The resulting PCR products were ligated to obtain a plasmid overexpressing KpdB protein. In constructing a UbiX plasmid, the primers MS669 and MS666 were used to amplify ubiX gene and the primers MS461 and RP607 were used to amplify the pCAT350 plasmid backbone. The resulting PCR products were ligated to obtain a plasmid overexpressing UbiX protein. In constructing an Elw plasmid, the primers MS676 and MS680 were used to amplify elw gene and the primers MS461 and MS621 were used to amplify the pCP165 plasmid backbone. The resulting PCR products were ligated to obtain a plasmid overexpressing the Elw protein. In constructing a Kox plasmid, the primers MS686 and MS684 were used to amplify the kox gene and the primers MS461 and MS621 were used to amplify the pCP165 plasmid backbone. The resulting PCR products were ligated to obtain a plasmid overexpressing Kox protein. In constructing an Lpl plasmid, the primers MS692 and MS691 were used to amplify the lpl gene and the primers MS461 and MS621 were used to amplify the pCP165 plasmid backbone. The resulting PCR products were ligated to obtain a plasmid overexpressing Lpl protein. All fragments contained 20 bp of homology to enable cloning using the NEBuilder HiFi DNA Assembly Cloning Kit and cloned into NEB5 E. coli cells (New England Biolabs).
[0148] Following plasmid cloning, an in vitro enzyme assay was developed to demonstrate AroY activity. 1 mL of an overnight LB grown culture was spun down and resuspended in 200 L of Bacterial Protein Extraction Reagent (B-PER) (Thermo Fisher Scientific). After 5 minutes incubation in a rotary mixer, the cell debris was removed by centrifuging the samples at 13,000 rpm in a table top centrifuge. The clarified crude lysate supernatant was transferred to a new tube and stored on ice. 20 L of an AroY overexpression lysate was combined with 20 L of UbiX or a homolog lysate into a 150 L reaction (final volume) containing 100 mM sodium phosphate buffer pH 6.4, 25 mM MgCl.sub.2 and 1 mM protocatechuic acid (Sigma-Aldrich). The absorbance at 290 nm was read every minute for 60 minutes. The AroY activity was measured by monitoring disappearance of PCA at A290. The relative activities of the UbiX and its homologs are shown in
EXAMPLE 20
Effect of kpdB Expression Level on the Activity of AroY
[0149] Having established that that the expression of KpdB protein enhance the activity of AroY protein in the in vitro assay, efforts were made to determine if the level of expression of KpdB protein within the muconic acid producing biocatalysts would affect the level of muconic acid production. In this experiment, the muconic acid production strain MYR1305 was transformed with various plasmids that express KpdB at different levels. Transformation of MYR1305 was conducted with three different plasmids. In the experimental control, MYR1305 was transformed with the control plasmid pCP140 without any genes coding for KpdB protein. The DNA sequence of pCP140 is given in SEQ ID 57. Briefly, pCP140 was constructed to express an E. coli codon-optimized catAX under the P15 promoter, E. coli tktA under native E. coli promoter, E. coli aroB under the P15 promoter, and E. coli aroD under P26 promoter (SEQ ID 2). The second plasmid pCP169 used to transform MYR1305 is a derivative of pCP140 additionally having the kpdB gene under the P26 promoter. The third plasmid pCP170 used to transform MYR1305 is a derivative of pCP140 additionally having kpdB under the E. coli pgi promoter (SEQ ID 52). Low level expression was achieved using the P26 promoter while high expression was achieved using the E. coli pgi promoter. pCP169 and pCP170 were constructed by first amplifying the pCP140 plasmid in two fragments using two sets of primers (PCR primers RP607 and RP677 for the first fragment and the PCR primers RP671 and RP664 for the second fragment). Two smaller PCR products facilitate easier plasmid construction than a single large PCR product. In constructing the plasmid pCP169, the P26 promoter was amplified using primers RP702 and RP783 and kpdB was amplified using primers RP781 and RP780. In constructing the plasmid pCP170, the pgi promoter was amplified using primers RP700 and RP784 and kpdB was amplified using primers RP779 and RP780. All PCR products had 20 bp homology overlaps to enable cloning using the NEBuilder HiFi DNA Assembly Cloning Kit. As shown in
EXAMPLE 21
Complementation of a ppc Mutant and Effect on Muconic Formation
[0150] The increased availability of PEP for muconic acid formation was investigated using the bacterial strains with the deletion of the phosphoenolpyruvate carboxylase (ppc) gene. The E. coli strain MYR1674 was genetically engineered to use as a biocatalyst for muconioc acid production. MYR1674 is able to grow in minimal medium containing glucose as a source of carbon and energy and produce muconic acid. However, when the ppc gene is deleted from MYR1674, the resulting stain MYR1674 ppc is not able to grow in minimal medium containing glucose and is viable only on rich media such as Luria Broth (LB). The loss of the ability of MYR1674 ppc to grow on minimal medium can be regained by means of inserting the pyc gene coding for pyruvate carboxylase at the original ppc locus in the MYR1674 ppc strain of E. coli.
[0151] The pyruvate carboxylase (pyc) gene from Saccharomyces cerevisiae (SEQ ID 53) was cloned using primers MS1383 and MS1384, containing flanking homology to the E. coli ppc promoter and terminator. In order to facilitate strong growth on minimal media, the strong constitutive rightward Lambda Phage promoter P.sub.R was required. The P.sub.R promoter was amplified using primers MS1429 and MS1430 and the resulting PCR product was used to replace the endogenous ppc promoter. The final nucleotide sequence for the ppc:: P.sub.R-pyc locus is shown in SEQ ID 58. The S. cerevisiae pyc gene was chosen because it is not closely related to any E. coli gene, and the expected lower expression due to differing codon usage could be beneficial in preserving PEP for muconic acid production. There are many organisms that contain pyruvate carboxylase, and any homologs or analogs having pyruvate carboxylase activity could be used. New strain MYR1772 derived from MYR1674 by integrating ppc:: P.sub.R-pyc at the original ppc locus was viable on a minimal medium confirming the functionality of the cloned S. cerevisiae pyc gene. MYR1772 and its parent MYR1674 strains were compared in shake flask experiments for their ability to produce muconic acid. As the results shown in
EXAMPLE 22
Measuring Muconic Acid Production
[0152] The bacterial strains MYR814, MYR993, MYR1536, MYR1557, MYR1570, MYR1595, MYR1630, MYR1674 and MYR1772 were grown in shake flask cultures overnight and titer and yield for muconic acid production were determined. In addition, the growth rate was determined by measuring the absorbance at 600 nm and the relative growth of various bacterial strains are provided in Table 8. The bacterial growth represented by +++ indicates a growth similar to the growth seen in a wild type K coil strain. The bacterial growth represented by + indicates poor growth. An intermediate growth is represented by ++. When a particular strain is showing a poor growth, that strain is subjected to 5 overnight transfers to improve the growth, each transfer produces approximately 10 generations or doublings.
[0153] The bacterial strains MYR814, MYR1570, MYR1630 and MYR1674 were grown in 7 liter fermenters in a fed-batch mode and the titer and yield for muconic acid production were determined (Table 9). The bacterial strains tested for muconic acid titer and yield produced very little byproducts. For example, the bacterial strain after 72 hours of fed batch fermentation showed only 0.08 g/L of PCA and 0.07 g/L of fumarate as byproducts.
TABLE-US-00001 TABLE 1 Bacterial strains used in the present invention Bacterial strain Genotype/Description ATCC8739 Escherichia coli C wild type MYR34 ATCC8739 aroE MYR170 ATCC8739 aroE, ackA::P.sub.15aroB MYR261 ATCC8739 aroE, ackA::P.sub.15aroB, poxB::tktA MYR305 ATCC8739 aroE, ackA::P.sub.15aroB, poxB MYR31 ATCC8739 ptsHI, galP MYR217 ATCC8739 ptsHI, galP, tdc::glf-glk, aroE MYR352 ATCC8739 aroE, ackA::P.sub.15aroB, adhE:: P.sub.15-catAX, P.sub.R-aroY, P.sub.26-quiC RY903 aroE, ackA::P.sub.15aroB, pMG37, aroG*20-893 RY909 aroE, ackA::P.sub.15aroB, pMG37, aroG*20-899 RY911 aroE, ackA::P.sub.15aroB, pMG37, aroG*20-901 RY912 aroE, ackA::P.sub.15aroB, pMG37, aroGwt RY913 aroE, ackA::P.sub.15aroB, pMG37, aroG*20-893, tyrR::kan RY919 aroE, ackA::P.sub.15aroB, pMG37, aroG*20-899, tyrR::kan RY921 aroE, ackA::P.sub.15aroB, pMG37, aroG*20-901, tyrR::kan RY922 aroE, ackA::P.sub.15aroB, pMG37, aroGwt, tyrR::kan
TABLE-US-00002 TABLE 2 Bacterial used in the present invention Strain Name Genotype/Description Parent MYR802 ackA::P15-aroB adhE::P15-catAX + P.sub.R-aroY + P26-quiC pflB::P15-catAX tyrR aroG.sup.FBR poxB:tktA ptsHI tdc::P26-glf-glk galP aroE G105M MYR814 ackA::P15-aroB adhE::P15-catAX + P.sub.R-aroY + P26-quiC pflB::P15-catAX tyrR MYR802 aroG.sup.FBR poxB::tktA ptsHI tdc::P26-glf-glk galP aroE G105M [P15-catA-catX + tktA + P15-aroB + P26-aroD in pCL1921 backbone] MYR993 ackA::P15-aroB adhE::P.sub.R-aroY + P26-quiC pflB::P.sub.R-catAX tyrR aroG.sup.FBR MYR802 poxB::tktA ptsHI tdc::P26-glf-glk galP aroE G105M MYR993 ackA::P15-aroB adhE::P.sub.R-aroY + P26-quiC pflB::P.sub.R-catAX tyrR aroG.sup.FBR MYR993 ubiX poxB::tktA ptsHI tdc::P26-glf-glk galP aroE G105M ubiX::Kan.sup.R MYR993 ackA::P15-aroB adhE::P.sub.R-aroY + P26-quiC pflB::P.sub.R-catAX tyrR aroG.sup.FBR MYR993 ubiD poxB::tktA ptsHI tdc::P26-glf-glk galP aroE G105M ubiD::Kan.sup.R MYR1305 ackA::P15-aroB adhE::P15-catAX + P.sub.R-aroY + P26-quiC pflB::P15-catAX tyrR MYR802 aroG.sup.FBR poxB::tktA ptsHI tdc::P26-glf-glk galP aroE zwf MYR1305 ackA::P15-aroB adhE::P15-catAX + P.sub.R-aroY + P26-quiC pflB::P15-catAX tyrR MYR1305 pCP140 aroG.sup.FBR poxB::tktA ptsHI tdc::P26-glf-glk galP aroE zwf [P.sub.R-catA-catX + tktA + P15-aroB + P26-aroD in pCL1921 backbone] MYR1305 ackA::P15-aroB adhE::P15-catAX + P.sub.R-aroY + P26-quiC pflB::P15-catAX tyrR MYR1305 pCP169 aroG.sup.FBR poxB::tktA ptsHI tdc::P26-glf-glk galP aroE zwf [P.sub.R-catA-catX + tktA + P15-aroB + P26-aroD + P26-kpdB in pCL1921 backbone] MYR1305 ackA::P15-aroB adhE::P15-catAX + P.sub.R-aroY + P26-quiC pflB::P15-catAX tyrR MYR1305 pCP170 aroG.sup.FBR poxB::tktA ptsHI tdc::P26-glf-glk galP aroE zwf [P.sub.R-catA-catX + tktA + P15-aroB + P26-aroD + P.sub.PG1-kpdB in pCL1921 backbone] MYR1536 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR802 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI:: P.sub.R-aroY 0039:: P.sub.R-catAX MYR1557 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR1536 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI:: P.sub.R-aroY 0039:: P.sub.R-catAX (Evolved version of MYR1536 for faster growth) MYR1570 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR1536 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI:: P.sub.R-aroY 0039:: P.sub.R-catAX zwf (Evolved version of MYR1536 for faster growth) MYR1595 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR1557 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI::P.sub.R-AroY 0039:: P.sub.R-catAX zwf pykF MYR1630 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR1595 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI:: P.sub.R-aroY 0039:: P.sub.R-catAX zwf pykF 2160:: P.sub.R-aroG.sup.FBR MYR1674 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR1630 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI:: P.sub.R-aroY 0039:: P.sub.R-catAX zwf pykF 2160:: P.sub.R-aroG.sup.FBR (Evolved version of MYR1630 for faster growth) MYR1772 ackA::P.sub.acpp-aroB adhE::P15-qa4 tyrR aroG.sup.FBR poxB::P.sub.R-tktA tdc:: P26-glf-glk MYR1674 galP::P15-ubiX pflB:: P.sub.R-CatAX P.sub.acpp-aroD mgsA::P.sub.rpIU-qa4 ptsHI:: P.sub.R-aroY 0039:: P.sub.R-catAX zwf pykF 2160:: P.sub.R-aroG.sup.FBR ppc:: P.sub.R-pyc
TABLE-US-00003 TABLE 3 Plasmids used in the present invention Bacterial Plasmid Genotype/Description YEp24 2 yeast origin, URA3, Tc.sup.R, pMB1 replicon, Ap.sup.R pCP32AMP 2 yeast origin, URA3, Tc.sup.R, pMB1 replicon, Ap.sup.R, aroG pCP14 2 yeast origin, URA3, Tc.sup.R, pMB1 replicon, Ap.sup.R, P.sub.15aroB pCP54 2 yeast origin, URA3, Tc.sup.R, pMB1 replicon, Ap.sup.R, P.sub.15aroB, aroG pCP50 2 yeast origin, URA3, Tc.sup.R, pMB1 replicon, Ap.sup.R, aroG, tktA pCP55 2 yeast origin, URA3, Tc.sup.R, pMB1 replicon, Ap.sup.R, aroG, aroB, tktA pCL1921 pSC101 replicon, Spc.sup.R pMG27 pSC101 replicon, Spc.sup.R, P.sub.R-aroY pMG31 pSC101 replicon, Spc.sup.R, P.sub.15-catAX pMG33 pSC101 replicon, Spc.sup.R, P.sub.15-catAX , P.sub.R-aroY pMG37 pSC101 replicon, Spc.sup.R, P.sub.15-catA-CatX, P.sub.R-aroY, P.sub.26-quiC pMG39 pSC101 replicon, Spc.sup.R, P.sub.26-quiC pMG47 pSC101 replicon, Spc.sup.R, P.sub.15-catAX, P.sub.R-aroY, P.sub.26-asbF pMG70 pSC101 replicon, Spc.sup.R, P.sub.15-catAX, P.sub.R-aroY, P.sub.26-qa-4
TABLE-US-00004 TABLE 4 aroG*mutant alleles that lead to resistance to phenylalanine feedback inhibition Allele Nucleotide Amino acid Strain number mutation mutation RY893 aroG*20-893 C449T Pro150Leu RY897 aroG*20-897 C449T Pro150Leu RY899 aroG*20-899 T538C Ser180Pro RY901 aroG*20-901 C438T Pro150Ser MYR450 aroG*111 C55T Pro19Ser MYR451 aroG*211 G533A Gly178Glu MYR452 aroG*212 C540T Ser180Phe MYR453 aroG*311 Deletion from base Deletion of pair 36 to 44bp Glu-Ile-Lys MYR454 aroG*312 C632T Ser211Phe MYR455 aroG*411 T29A Ile10Asn MYR456 aroG*412 G533A Gly178Glu MYR457 aroG*511 C448T Pro150Ser
TABLE-US-00005 TABLE 5 AroG activity measurement in crude extract from various recombinant E. coli strains Specific activity mU (One mU = one nM product made per % of activity milligram protein per resistant to Strain aroG* allele minute) phenylalanine RY893 aroG*20-893 62 34 RY897 aroG*20-897 55 77 RY899 aroG*20-899 92 113 RY901 aroG*20-901 78 76 RY902 aroG wild type 38 6 RY890 aroG wild type 54 7
TABLE-US-00006 TABLE 6 Muconic acid production in shake flasks by strains containing feedback resistant aroG* alleles Strain Muconic acid titer g/l RY913 3.04 RY919 3.11 RY921 2.99 RY922 1.45
TABLE-US-00007 TABLE7 SequenceInformation No. Name Description 1 SEQIDNo.1 TheP.sub.15promoterfromBacillussubtilisphageSP01,withastemandloop addedjustdownstreamfromthetranscriptionstartsite. 2 SEQIDNo.2 TheP.sub.26promoterfromBacillussubtilisphageSPO1 3 SEQIDNo.3 TheP.sub.RpromoterfromEscherichiacoliphage 4 SEQIDNo.4 Proteinsequenceof3-dehydroshikimatedehydratasefromNeurosporacrassa encodedbytheqa-4gene. 5 SEQIDNo.5 GenomicDNAsequenceoftheqa-4genefromNeurosporacrassaplus surroundingsequences. 6 SEQIDNo.6 Proteinsequenceof3dehydroshikimatedehydratasefromAspergillus nidulans.encodedbythequtCgene 7 SEQIDNo.7 GenomicDNAsequenceofthequtCgenefromAspergillusnidulansplus surroundingsequences 8 SEQIDNo.8 Proteinsequenceofprotocatechuatedecarboxylase(AroY)fromKlebsiella pnemoniaeATCC25597 9 SEQIDNo.9 DNAsequenceofthearoYgeneofKlebsiellapneumoniae342plus2 kilobasesofsurroundingDNAsequences 10 SEQIDNo.10 DNAsequenceofthecatAgenefromAcinetobacterbaylyiADP1,including upstreamsequenceandtwoopenreadingframesdownstream410basesof 11 SEQIDNo.11 ProteinsequenceofCatA(catechol1,2-dioxygenase)fromAcinetobacter baylyiADP1 12 SEQIDNo.12 DNAsequenceofthequiC(3-dehydroshikimatedehydratase)genefrom Acinetobactersp.ADP1 13 SEQIDNo.13 Codon-optimizedDNAsequenceofthequiC(3-dehydroshikimate dehydratase)genefromAcinetobactersp.ADP1 14 SEQIDNo.14 ProteinsequenceofQuiC(3-dehydroshikimatedehydrogenasefrom Acinetobactersp.ADP1 15 SEQIDNo.15 DNAsequenceoftheplasmidpAC21 16 SEQIDNo.16 DNAsequenceoftheplasmidpAC19 17 SEQIDNo.17 DNAsequenceoftheplasmidpMH17F 18 SEQIDNo.18 DNAsequenceofthecodingregionofthewildtypearoGgene 19 SEQIDNo.19 DNAsequenceoftheplasmidpMH28F 20 SEQIDNo.20 DNAsequenceoftheplasmidpCL1921 21 SEQIDNo.21 DNAsequenceoftheplasmidpMG27 22 SEQIDNo.22 DNAsequenceoftheplasmidpMG31 23 SEQIDNo.23 DNAsequenceoftheplasmidpMG33 24 SEQIDNo.24 DNAsequenceoftheplasmidpMG37 25 SEQIDNo.25 DNAsequenceoftheplasmidpMG39 26 SEQIDNo.26 DNAsequenceoftheplasmidpMG47 27 SEQIDNo.27 DNAsequenceoftheplasmidpMG70 28 SEQIDNo.28 DNAsequenceoftheplasmidpCP32AMP 29 SEQIDNo.29 DNAsequenceoftheplasmidpCP14 30 SEQIDNo.30 DNAsequenceoftheplasmidpCP50 31 SEQIDNo.31 DNAsequenceoftheplasmidpCP54 32 SEQIDNo.32 DNAsequenceoftheplasmidpCP55 33 SEQIDNo.33 DNAsequenceoftheplasmidYEP24 34 SEQIDNo.34 DNAsequenceofthedeletedaroEregion 35 SEQIDNo.35 DNAsequenceoftheintegratedcassetteack::P.sub.15aroB 36 SEQIDNo.36 DNAsequenceofthepoxBregion 37 SEQIDNo.37 DNAsequenceoftheintegratedcassettepoxB::iktA 38 SEQIDNo.38 DNAsequenceoftheptsHIregion 39 SEQIDNo.9 DNAsequenceoftheintegratedcassettetdc::glf-glk 40 SEQIDNo.40 DNAsequenceofthegalPregion 41 SEQIDNo.41 MYR352adhE::P.sub.15-catAX,P.sub.R-aroY,P.sub.26-quiC 42 SEQIDNo.42 NucleotidesequenceofKlebsiellapneumoniaekpdBgene. 43 SEQIDNo.43 AminoacidsequenceofKpd13proteinofKiebsiellapneumoniae 44 SEQIDNo.44 NucleotidesequenceofEscherichiacoliubiXgene 45 SEQIDNo.45 AminoacidsequenceofUbiXproteinofEscherichiacoli. 46 SEQIDNo.46 NucleotidesequenceofEscherichiacoliWstrainelwgene 47 SEQIDNo.47 AminoacidsequenceofElwproteinofEscherichiacoliWstrain. 48 SEQIDNo.48 NucleotidesequenceofKlebsiellaoxytocakoxgene 49 SEQIDNo.49 AminoacidsequenceofKoxproteinofKlebsiellaoxytoca. 50 SEQIDNo.50 NucleotidesequenceofLactobacillusplantarumlplgene 51 SEQIDNo.51 AminoacidsequenceofLp1proteinofLactobacillusplantarum. 52 SEQIDNo.52 NucleotidesequenceofPgipromoter 53 SEQIDNo.53 NucleotidesequenceofSaccharomycescerevisiaepycgene 54 SEQIDNo.54 AminoacidsequenceofPycproteinofSaccharomycescerevisiae. 55 SEQIDNo.55 DNAsequenceoftheplasmidpCAT350 56 SEQIDNo.56 DNAsequenceoftheplasmidpCP165 57 SEQIDNo.57 DNAsequenceoftheplasmidpCP140 58 SEQIDNo.58 Nucleotidesequenceofppc::P.sub.R-pyc 59 SEQIDNo.59 NucleotidesequenceofacpPpromoter 60 SEQIDNo.60 Nuclotidesequenceofrp1Upromoter 61 MS604 AACGCCGTATAATGGGCGCAGATTAAGAGGCTACAGTGGGCTTACATGGCGATAGCTAGA 62 MS605 TGTCGGATCGATAAATAGGGCAAAACAAACGCGCATCCCGGAAAACGATTCCGAAGCCCA 63 MS608 AAAGTCTGCCTGCAAGTCTGACAGGGCAACTATTTGTGGGCTTACATGGCGATAGCTAGA 64 MS609 TTGCAAAATTGCCCTGAAACAGGGCAACAGCGGAGTCCCGGAAAACGATTCCGAAGCCCA 65 MS461 GGCTATATTCCTTATCTAGATTAGT 66 MS346 GTCTGACAGGTGCCGGATTTCATAT 67 RP712 TCTAGATAAGGAATATAGCCATGACCGCACCGATTCAGGATCTGC 68 RP714 AAATCCGGCACCTGTCAGACTTATTTTGCGCTACCCTGGTTTTTT 69 RP731 CATGTACTAATCTAGATAAGGAATATAGCCATGAAACTGATTATTGGGATGACGGGGGCC 70 RP732 GCCGGATATGAAATCCGGCACCTGTCAGACTTATTCGATCTCCTGTGCAAATTGTTCTGC 71 MS669 TCTAGATAAGGAATATAGCCATGAAACGACTCATTGTAGGCATCA 72 MS666 ACCGAACAGGCTTATGTCCAGATAGCAGGTATAGCGGTTGAATCG 73 RP607 TGGACATAAGCCTGTTCGGTTCGT 74 MS621 TTAGATTTGACTGAAATCGTACAGT 75 MS676 TCTAGATAAGGAATATAGCCATGAAACTGATCGTCGGGATGACAG 76 MS680 ACGATTTCAGTCAAATCTAATTATTCATTCTCCTGAGAAAAATTC 77 MS686 TCTAGATAAGGAATATAGCCATGACGGCACGCATCATCATTGGTA 78 MS684 ACGATTTCAGTCAAATCTAATTAATTAAAACGTAGCTCGCCTTCA 79 MS692 TCTAGATAAGGAATATAGCCATGAAACGAATTGTTGTGGGAATCA 80 MS691 ACGATTTCAGTCAAATCTAATTAATCCCCCTCCCAACGGCGATCA 81 RP677 CGACGTTGTAAAACGACGGCCAGTG 82 RP671 TTAATCGCCTTGCAGCACATCCCCC 83 RP664 ACGAACCGAACAGGCTTATGTCCA 84 RP702 GCCGTCGTTTTACAACGTCGGATCCGCCTACCTAGCTTCCAAGAA 85 RP783 CCTACAATGAGTCGTTTCATTAGGTTTTCCTCAACCCGGGAGCGT 86 RP781 CCCGGGTTGAGGAAAACCTAATGAAACGACTCATTGTAGGCATCA 87 RP780 ATGTGCTGCAAGGCGATTAAGATAGCAGGTATAGCGGTTGAATCG 88 RP700 GCCGTCGTTTTACAACGTCGAGCGGGGCGGTTGTCAACGATGGGG 89 RP784 CCTACAATGAGTCGTTTCATGGCTATATTCCTCCTCTGCATGAGA 90 RP779 TGCAGAGGAGGAATATAGCCATGAAACGACTCATTGTAGGCATCA 91 MS1383 GATGGGGTGTCTGGGGTAATATGTCGCAAAGAAAATTCGCCGGCT 92 MS1384 GGGTTTGCAGAAGAGGAAGATCATGCCTTAGTTTCAACAGGAACT 93 MS1429 ATTCCTGCTATTTATTCGTTCGTTAAATCTATCACCGCAAGGGAT 94 MS1430 GCGAATTTTCTTTGCGACATGGCTATATTCCTTATCTAGATTAGT
TABLE-US-00008 TABLE 8 Titer and yield for muconic acid production and growth of various E. coli strains in shake flask cultures Titer Yield (grams Strain (grams muconic muconic acid/ Name acid/liter) gram glucose) Growth MYR814 2 0.16 +++ MYR993 1.9 0.15 +++ MYR1536 2.7 0.22 + MYR1557 3 0.25 +++ MYR1570 4.5 0.38 ++ MYR1595 4.5 0.38 ++ MYR1630 4.8 0.4 + MYR1674 3.8 0.32 +++ MYR1772 5 0.42 +++
TABLE-US-00009 TABLE 9 Titer and yield for muconic acid production for various E. coli strains in fed batch cultures Titer Yield (grams Strain (grams muconic muconic acid/ Name acid/liter) gram glucose) Time (hours) MYR814 30.9 0.20 48 MYR1570 49.0 0.36 48 MYR1630 58.3 0.47 48 MYR1630 69.5 0.42 72 MYR1674 81.5 0.43 72
REFERENCES
[0154] All the patents, patent applications, publications, sequences, and other published materials are incorporated herein are incorporated by reference.
[0155] U.S. Pat. No. 4,480,034
[0156] U.S. Pat. No. 4,535,059
[0157] U.S. Pat. No. 4,588,688
[0158] U.S. Pat. No. 4,608,338
[0159] U.S. Pat. No. 4,681,852
[0160] U.S. Pat. No. 4,753,883
[0161] U.S. Pat. No. 4,833,078
[0162] U.S. Pat. No. 4,968,612
[0163] U.S. Pat. No. 5,168,056
[0164] U.S. Pat. No. 5,272,073
[0165] U.S. Pat. No. 5,487,987
[0166] U.S. Pat. No. 5,616,496
[0167] U.S. Pat. No. 6,600,077
[0168] U.S. Pat. No. 6,180,373
[0169] U.S. Pat. No. 6,210,937
[0170] U.S. Pat. No. 6,472,169
[0171] U.S. Pat. No. 6,613,552
[0172] U.S. Pat. No. 6,962,794
[0173] U.S. Pat. No. 7,244,593
[0174] U.S. Pat. No. 7,638,312
[0175] U.S. Pat. No. 7,790,431
[0176] U.S. Pat. No. 8,871489
[0177] U.S. Pat. No. 9,017,976
[0178] U.S. Patent Application Publication No. US 2009/0191610 A1
[0179] U.S. Patent Application Publication No. US 2010/0314243 A1
[0180] U.S. Patent Application Publication No. US 2013/0337519 A1
[0181] U.S. Patent Application Publication No. US. 2014/0234923A1
[0182] U.S. Patent Application Publication No. US 2015/0044755 A1
[0183] U.S. Patent Application Publication No. US2016/0017381 A1
[0184] European Patent Application No. 86300748.0
[0185] International Patent Application Publication No. WO 2011/017560
[0186] International Patent Application Publication No. WO 2011/085311
[0187] International Patent Application Publication No. WO 2011/123154
[0188] International Patent Application Publication No. W02013/116244
[0189] Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local alignment search tool, J Mol Biol 215, 403-410.
[0190] Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res 25, 3389-3402.
[0191] Aussel, Laurent, Fabien Pierrel, Laurent Loiseau, Murielle Lombard, Marc Fontecave, and Frdric Barras. 2014. Biosynthesis and Physiology of Coenzyme Q in Bacteria. Biochimica et Biophysica ActaBioenergetics 1837 (7): 1004-11.
[0192] Baba, Tomoya, Takeshi Ara, Mild Hasegawa, Yuki Takai, Yoshiko Okumura, Miki Baba, Kirill A Datsenko, Masaru Tomita, Barry L Wanner, and Hirotada Mori. 2006. Construction of Escherichia Coli K-12 in-Frame, Single-Gene Knockout Mutants: The Keio Collection. Molecular Systems Biology 2: 2006.0008. doi:10.1038/msb4100050.
[0193] Barbe, V., Vallenet, D., Fonknechten, N., Kreimeyer, A., Oztas, S., Labarre, L., Cruveiller, S., Robert, C., Duprat, S., Wincker, P., Ornston, L. N., Weissenbach, J., Marliere, P., Cohen, G. N., and Medigue, C. (2004) Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium, Nucleic Acids Res 32, 5766-5779.
[0194] Bird, J. A. and Cain, R. B. (1968) cis-cis-muconate, the product inducer of catechol 1,2-oxygenase in Pseudomonas aeruginosa. Biochem. J. 109, 479-481.
[0195] Bongaerts, J., Kramer, M., Muller, U., Raven, L. and Wubbolts, M. (2001) Metabollic engineering for microbial producitnof aromatic acids and derived compounds. Met. Eng. 3, 289-300.
[0196] Chandran, S. S., Yi, J., Draths, K. M., von Daeniken, R., Weber, W. and Frost, J. W. (2003) Phosphoenolpyruvate availability and the biosynthesis of shikimic acid. Biotechnol. Prog. 19, 808-814.
[0197] Chen, R., Hatzimanikatis, V., Yap, W. M. G. J., Potma, P. W. and Bailey, J. E. (1997) Metabolic consequences of phosphotransferase (PTS) mutation in a phenylalanie-producing recombinatn Escherichia coli. Biotechnol. Prog 13, 768-775.
[0198] Chen, K., Dou, J., Tang, S., Yang, Y., Wang, H., Fang, H. and Zhou, C. (2012) Deletion of the aroK gene is essential for high shikimic acid accumulation through the shikimate in E. coli. Bioresource Technol, 119, 141-147.
[0199] Choi, W. J., Lee, E. Y., Cho, M. H., and Choi, C. Y. (1997) Enhanced production of cis, cis-muconate in a cell-recycle bioreactor. J. Fermentation and Bioengineering. 84, 70-76.
[0200] Curran, Kathleen a., John M. Leavitt, Ashty S. Karim, and Hal S. Alper. 2013. Metabolic Engineering of Muconic Acid Production in Saccharomyces Cerevisiae. Metabolic Engineering 15 (1): 55-66.
[0201] de Berardinis, V., Vallenet, D., Castelli, V., Besnard, M., Pinet, A., Cruaud, C., Samair, S., Lechaplais, C., Gyapay, G., Richez, C., Durot, M., Kreimeyer, A., Le Fevre, F., Schachter, V., Pezo, V., Doring, V., Scarpelli, C., Medigue, C., Cohen, G. N., Marliere, P., Salanoubat, M., and Weissenbach, J. (2008) A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1, Mol Syst Biol 4, 174.
[0202] Draths, K. M., Pompliano, D. L., Conley, D. L., Frost, J. W., Berry, A., Disbrow, G. L., Staversky, R. J., and Lievense, J. C. (1992) Biocatalytic Synthesis of Aromatics from D-Glucosethe Role of Transketolase, Journal of the American Chemical Society 114, 3956-3962.
[0203] Draths, K. M., and Frost, J. W. (1995) Environmentally Compatible Synthesis of Catechol from D-Glucose, Journal of the American Chemical Society 117, 2395-2400.
[0204] Elsemore, D. A., and Ornston, L. N. (1995) Unusual ancestry of dehydratases associated with quinate catabolism in Acinetobacter calcoaceticus, J Bacteriol 177, 5971-5978.
[0205] Escalante, A., Calderon, R., Valdiva, A., de Anda, R., Hernandez, G., Ramirez, O. T., Gosset, G. and Boliver, F. (2010) Metabolic engineering for the production of shikimic acid in an evolved Escherichia coli strain lacking the phosphoenolpyrvate: carbohydrate phosphotransferase system. Microbial Cell Factories 9, 21-33.
[0206] Escalante, Adelfo, Rocio Calderon, Araceli Valdivia, Ramn de Anda, Georgina Hernndez, Octavio T Ramrez, Guillermo Gosset, and Francisco Bolvar. 2010. Metabolic Engineering for the Production of Shikimic Acid in an Evolved Escherichia Coli Strain Lacking the Phosphoenolpyruvate: Carbohydrate Phosphotransferasc System. Microbial Cell Factories 9 (Cern): 21. doi:10.1186/1475-2859-9-21.
[0207] Flores, N., Xiao, J., Berry, A., Bolivar, F. and Valle, F. (1996) Pathway engineering for the production of aromatic compounds in Escherichia coli. Nature Biotechn. 14, 620-623.
[0208] Fox, D. T., Hotta, K., Kim, C. Y., and Koppisch, A. T. (2008) The missing link in petrobactin biosynthesis: asbF encodes a ()-3-dehydroshikimate dehydratase, Biochemistry 47, 12251-12253.
[0209] Ger, Y., Chen, S., Chiang, H., and Shivan, D. (1994) A Single Ser-180 Mutation Desensitizes Feedback Inhibition of the Phyenylalanine-Sensitive 3-Deoxy-D-Arabino-Hepulosonate 7-Phosphate (DAHP) Synthetase in Eschericia coli, J Biochem 116, 986-990.
[0210] Grant, D. J., and Patel, J. C. (1969) The non-oxidative decarboxylation of p-hydroxybenzoic acid, gentisic acid, protocatechuic acid and gallic acid by Klebsiella aerogenes (Aerobacter aerogenes), Antonie Van Leeuwenhoek 35,325-343.
[0211] Hansen, E. H., Moller, B. L., Kock, G. R., Bunner, C. M., Kristensen, C., Jensen, O. R., Okkels, F. T., Olsen, C. E., Motawia, M. S., and Hansen, J. (2009) De novo biosynthesis of vanillin in fission yeast (Schizosaccharomyces pombe) and baker's yeast (Saccharomyces cerevisiae), Appl Environ Microbiol 75, 2765-2774.
[0212] Horwitz, Andrew A., Jessica M. Walter, Max G. Schubert, Stephanie H. Kung, Kristy Hawkins, Darren M. Platt, Aaron D. Hernday, et al. 2015. Efficient Multiplexed Integration of Synergistic Alleles and Metabolic Pathways in Yeasts via CRISPR-Cas. Cell Systems. 1(1): 88-96.
[0213] Hu, Changyun, Peihong Jiang, Jianfeng Xu, Yongqing Wu, and Weida Huang. 2003. Mutation Analysis of the Feedback Inhibition Site of Phenylalanine-Sensitive 3-Deoxy-D-Arabino-Heptulosonate 7-Phosphate Synthase of Escherichia Coli. Journal of Basic Microbiology 43 (5): 399-406.
[0214] Hu, C., Jiang, P., Xu, J., Wu, Y., and Huang, W. (2003) Mutation analysis of the feedback inhibition site of phenylalanine-sensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase of Escherichia coli, J Basic Microbiol 43, 399-406.
[0215] Iwagami, S. G., Yang, K., and Davies, J. (2000) Characterization of the protocatechuic acid catabolic gene cluster from Streptomyces sp. strain 2065, Appl Environ Microbiol 66, 1499-1508.
[0216] Jantama, K., Haupt, M. J., Svoronos, S. A., Zhang, X., Moore, J. C., Shanmugam, K. T., and Ingram, L. O. (2008a) Combining metabolic engineering and metabolic evolution to develop nonrecombinant strains of Escherichia coli C that produce succinate and malate, Biotechnol Bioeng 99,1140-1153.
[0217] Jantama, K., Zhang, X., Moore, J. C., Shanmugam, K. T., Svoronos, S. A., and Ingram, L. O. (2008b) Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C, Biotechnol Bioeng 101, 881-893.
[0218] Jimnez, Natalia, Jos Antonio Curiel, Ins Revern, Blanca de las Rivas, and Rosario Muoz. 2013. Uncovering the Lactobacillus Plantarum WCFS I Gallate Decarboxylase Involved in Tannin Degradation. Applied and Environmental Microbiology 79 (14): 4253-63.
[0219] Johnson, C. W., Salvachua, D., Khanna, P., Peterson, D. J. and Beckham, G. (2016) Enhancing muconic acid production from glucose and lignin-derived aromatic compound via increased protocatechuate decarboxylase activity. Metabolic Engineering Communication. 3: 111-119.
[0220] Kaneko, A., Ishii, Y., and Kirimura, K. (2011) High-yield production of cis, cis-muconic acid from catechol in aqueous solution by biocatalyst. Chem. Lett. 40, 381-383.
[0221] Kikuchi, Y., Tsujimoto, K., and Kurahashi, 0. (1997) Mutational analysis of the feedback sites of phenylalanine-sensitive 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase of Escherichia coli, Appl Environ Microbiol 63, 761-762.
[0222] Kojima, Y., Fujisawa, H., Nakazawa, A., Nakazawa, T., Kanetsuna, F., Taniuchi, H., Nozaki, M., and Hayaishi, O. (1967) Studies on pyrocatechase. I. Purification and spectral properties, J Biol Chem 242, 3270-3278.
[0223] Kramer, M., Bongaerts, J., Bovenberg, R., Kremer, S., Muller, U., Orf, S., Wubbolts, M. and Raeven, L. (2003) Metabolic engineering for microbial production of shikimic acid. Metabol. Eng. 5, 277-283.
[0224] Lerner, C. G., and Inouye, M. (1990) Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability, Nucleic Acids Res 18, 4631.
[0225] Li, K. and Frost, L W. (1999) Microbial synthesis of 3-dehydroshikimic acid: A comparative analysis of D-xylose, L-arabinose, and D-glucose carbon sources. Biotechnol. Prog. 15, 876-883.
[0226] Lin, H., Ravishankar V Vadali, R. V., George N Bennett, G. N. and San, K. Y. (2004) Increasing the Acetyl-CoA Pool in the Presence of Overexpressed Phosphoenolpyruvate Carboxylase or Pyruvate Carboxylase Enhances Succinate Production in Escherichia Coli. Biotechnology Progress 20 (5): 1599-1604.
[0227] Lin, Fengming, Kyle L. Ferguson, David R. Boyer, Xiaoxia Nina Lin, and E. Neil G. Marsh. 2015. Isofunctional Enzymes PADI and UbiX Catalyze Formation of a Novel Cofactor Required by Ferulic Acid Decarboxylase and 4-Hydroxy-3-Polyprcnylbenzoic Acid Decarboxylase. ACS Chemical Biology 11(4): 1137-1144.
[0228] Lu, J. L., and Liao, J. C. (1997) Metabolic engineering and control analysis for production of aromatics: Role of transaldolase, Biotechnol Bioeng 53, 132-138.
[0229] Lupa, Boguslaw, Delina Lyon, Moreland D. Gibbs, Rosalind a. Reeves, and Juergen Wiegel. 2005. Distribution of Genes Encoding the Microbial Non-Oxidative Reversible Hydroxyarylic Acid Decarboxylases/phenol Carboxylases. Genomics 86 (3): 342-51.
[0230] Lutke-Eversloh, T., and Stephanopoulos, G. (2007) L-tyrosine production by deregulated strains of Escherichia coli, Appl Microbial Biotechnol 75, 103-110.
[0231] Mizuno, S., Yoshikawa, N., Seki, M., Mikawa, T., and Imada, Y. (1988) Microbial production of cis, cis-muconic acid from benzoic acid. Appl Microbiol Biotechnol. 28, 20-25.
[0232] Nakazawa, A., Kojima, Y., and Taniuchi, H. (1967) Purification and properties of pyrocatechase from Pseudomonas fluorescens, Biochim Biophys Acta 147, 189-199.
[0233] Neidhardt, F. C., and Curtiss, R. (1996) Escherichia coli and Salmonella: cellular and molecular biology, Vol. 22nd ed., ASM Press, Washington, D.C.
[0234] Neidie, E. L., and Ornston, L. N. (1986) Cloning and expression of Acinetobacter calcoaceticus catechol 1,2-dioxygenase structural gene catA in Escherichia coli, J Bacteriol 168, 815-820.
[0235] Niu, W., Draths, K. M., and Frost, J. W. (2002) Benzene-free synthesis of adipic acid, Biotechnol Prog 18, 201-211.
[0236] Parker, C., Barnell, W. O., Snoep, J. L., Ingram, L. O., and Conway, T. (1995) Characterization of the Zymonionas mobilis glucose facilitator gene product (glf) in recombinant Escherichia coli: examination of transport mechanism, kinetics and the role of glucokinase in glucose transport, Mol Microbiol 15, 795-802.
[0237] Parsek, M. R., Shinabarger, D. L., Rithmel, R. K. and Chakrabarty, A. M. (1992) Roles of CatR and cis, cis-Muconate in activation of the catBC operson, which is involved in benzoate degradationin Pseudomonas putida. J Bacteriol. 174, 7798-7806.
[0238] Patnaik, R. and Liao, J. C. (1994) Engineering of Escherichia coli central metabolism for aromatic metabolite with near theoretical yield. App. Env. Microbiol. 60, 3903-3908.
[0239] Payne, Karl a. P., Mark D. White, Karl Fisher, Basile Khara, Samuel S. Bailey, David Parker, Nicholas J. W. Rattray, et al. 2015. New Cofactor Supports A,-Unsaturated Acid Decarboxylation via 1,3-Dipolar Cycloaddition. Nature 522 (7557): 497-501.
[0240] Pfleger, B. F., Kim, Y., Nusca, T. D., Maltseva, N., Lee, J. Y., Rath, C. M., Scaglione, J. B., Janes, B. K., Anderson, E. C., Bergman, N. H., Hanna, P. C., Joachimiak, A., and Sherman, D. H. (2008) Structural and functional analysis of AsbF: origin of the stealth 3,4-dihydroxybenzoic acid subunit for petrobactin biosynthesis, Proc Natl Acad Sci USA 105, 17133-17138.
[0241] Perez-Pantoja, D., De la Iglesia, R., Pieper, D. H., and Gonzalez, B. (2008) Metabolic reconstruction of aromatic compounds degradation from the genome of the amazing pollutant-degrading bacterium Cupriavidus necator JMP134, FEMS Microbiol Rev 32, 736-794.
[0242] Perez-Pantoja, D., Donoso, R., Agullo, L., Cordova, M., Seeger, M., Pieper, D. H., and Gonzalez, B. (2011) Genomic analysis of the potential for aromatic compounds biodegradation in Burkholderiales, Environ Microbiol. 14.5 (2012): 1091-1117.
[0243] Pittard, J. and Wallace, B. J. (1966) Distribution and function of genes concerned with aromatic biosynthesis in Escherichia coli. J. Bacteriol. 91, 1494-1508.
[0244] Polen, T., Spelberg, M. and Bott, M. (2013) Toward bitechnological produciton of adipic acid and precursors from biorenewables, J. Biotechnol. 167(2): 75-84.
[0245] Rutledge, B. J. (1984) Molecular characterization of the qa-4 gene of Neurospora crassa, Gene 32, 275-287.
[0246] Schirmer, F., and Hillen, W. (1998) The Acinctobacter calcoaceticus NCIB8250 mop operon mRNA is differentially degraded, resulting in a higher level of the 3 CatA-encoding segment than of the 5 phenolhydroxylase-encoding portion, Mol Gen Genet 257, 330-337.
[0247] Shumilin, I. A., Kretsinger, R. H., and Bauerle, R. H. (1999) Crystal structure of phenylalanine-regulated 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase from Escherichia coli, Structure 7, 865-875.
[0248] Shumilin, I. A., Zhao, C., Bauerle, R., and Kretsinger, R. H. (2002) Allosteric inhibition of 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase alters the coordination of both substrates, J Mol Biol 320, 1147-1156.
[0249] Shumilin, I. A., Bauerle, R., Wu, J., Woodard, R. W., and Kretsinger, R. H. (2004) Crystal structure of the reaction complex of 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase from Thermotoga maritima refines the catalytic mechanism and indicates a new mechanism of allosteric regulation, J Mol Biol 341, 455-466.
[0250] Shumkova, E. S., Solyanikova, I. P., Plotnikova, E. G. and Golovleva, L. A. (2009) Phenol degrdation by Rhodococcus opacus Strain 1G. App. Biocehm. Microbial. 45, 43-49.
[0251] Sietmann, R., Uebe, R., Boer, E., Bode, R., Kunze, G., and Schauer, F. (2010) Novel metabolic routes during the oxidation of hydroxylated aromatic acids by the yeast Arxula adeninivorans, J Appl Microbial 108, 789-799.
[0252] Smith, M. R. and Ratledge, C. (1989) Quantitative biotransformation of catechol to cis, cis-muconate. Biotech. Lett. 11, 105-110.
[0253] Snoep, J. L., Arfman, N., Yomano, L. P., Fliege, R. K., Conway, T., and Ingram, L. O. (1994) Reconstruction of glucose uptake and phosphorylation in a glucose-negative mutant of Escherichia coli by using Zymomonas mobilis genes encoding the glucose facilitator protein and glucokinase, J Bacterial 176, 2133-2135.
[0254] Sonoki, Tomonori, Miyuki Morooka, Kimitoshi Sakamoto, Yuichiro Otsuka, Masaya Nakamura, Jody Jellison, and Barry Goodell. 2014. Enhancement of Protocatechuate Decarboxylase Activity for the Effective Production of Muconate from Lignin-Related Aromatic Compounds. Journal of Biotechnology 192 (Part A): 71-77.
[0255] Sprenger, G. A. (1995) Genetics of pentose-phosphate pathway enzymes of Escherichia coli K-12, Arch Microbiol 164, 324-330.
[0256] Sprenger, G. A., Schorken, U., Sprenger, G., and Sahm, H. (1995a) Transketolase A of Escherichia coli K12. Purification and properties of the enzyme from recombinant strains, Eur J Biochem 230, 525-532.
[0257] Sprenger, G. A., Schorken, U., Sprenger, G., and Salim, H. (1995b) Transaldolase B of Escherichia coli K-12: cloning of its gene, talB, and characterization of the enzyme from recombinant strains, J Bacteriol 177, 5930-5936.
[0258] Stroman, P., Reinert, W. R., and Giles, N. H. (1978) Purification and characterization of 3-dehydroshikimate dehydratase, an enzyme in the inducible quinic acid catabolic pathway of Neurospora crassa, J Biol Chem 253, 4593-4598.
[0259] Tang, J., Zhu, X., Lu, J. and Liu, P. (2012) Recruiting alternative glucose utilization pathways for improving succinate production. App Microbiol Biotechnol DOI 10, 1007/s00253-012-434.1.
[0260] Tateoka, T., and Yasuda, 1. (1995) 3-Dehydroshikimate dehydratase in mung hean cultured cells, Plant Cell Reports 15, 212-217.
[0261] Vemuri, G. N., M. A. Eiteman, and E. Altman. 2002. Effects of Growth Mode and Pyruvate Carboxylase on Succinic Acid Production by Metabolically Engineered Strains of Escherichia Coli. Applied and Environmental Microbiology 68 (4): 1715-27.
[0262] Weaver, L. M., and Herrmann, K. M. (1990) Cloning of an aroF allele encoding a tyrosine-insensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, J Bacteriol 172, 6581-6584.
[0263] Weber, C., Bruckner, C., Wcinrcb, S., Lehr, C., Essl, C. and Bole, E. (2012) Biosynthesis of cis, cis-muconic acid and its aromatic precursors catechol and proteocatechuic acid, from renewable feedstocks by Saccharomyces cerevisiae, App Environ Microbiol. 78, 8421-8430.
[0264] Wheeler, K. A., Lamb, H. K., and Hawkins, A. R. (1996) Control of metabolic flux through the quinate pathway in Aspergillus nidulans, Biochem J 315 (Pt 1), 195-205.
[0265] White, Mark D., Karl A. P. Payne, Karl Fisher, Stephen A. Marshall, David Parker, Nicholas J. W. Rattray, Drupad K. Trivedi, et al. 2015. UbiX Is a Flavin Prenyltransferase Required for Bacterial Ubiquinone Biosynthesis. Nature 522 (7557): 502-6.
[0266] Wu, C-M., Wu, C-C., Su, C-C., Lee, S-N., Lee, Y-A. and Wu, J-Y. (2006) Microbial synthesis of cis,cis-muconic acid form benzoate by Sphingobacterium sp. Mutants. Biochem. Eng. J. 29, 35-40.
[0267] Xie, N., Tang, H., Feng, J., Tao, F., Ma, C. and Xu, P. (2009) Characterization of benzoate degradationby newly isolated bacterium Pseudomonas sp. XP-M2. Biochem. Eng. J. 46, 79-82.
[0268] Xie, N., Hong Liang, Ri-Bo Huang, and Ping Xu. 2014. Biotechnological Production of Muconie Acid: Current Status and Future Prospects. Biotechnology Advances 32 (3): 615-22.
[0269] Yi, J., Draths, K. M., Li, K. and Frost, J. W. (2003) Altered Glucose Transport and Shikimate Pathway Product Yields in E. coli. Biotechnol. Prog. 2003, 19, 1450-1459.
[0270] Yoshikawa, N. , Mizuno, S., Ohta, K., and Suzuki, M. (1990) Microbial production of cis, cis-muconic acid. J. Biotechno. 14, 203-210.