MALIGNANT GLIOMA CAR-T THERAPEUTIC VECTOR BASED ON OCTS TECHNOLOGY, AND CONSTRUCTION METHOD AND APPLICATION THEREOF

Abstract

An OCTS-based CAR-T vector for treating malignant glioma includes lentiviral skeleton plasmid, human EF1 promoter (SEQ ID NO.14), OCTS chimeric receptor structural domain, and PDL1 single-chain antibody; the OCTS chimeric receptor structural domain consists of CD8 leader chimeric receptor signal peptide (SEQ ID NO.15), PDL1 single-chain antibody light chain VL (SEQ ID NO.16), PDL1 single-chain antibody heavy chain VH (SEQ ID NO.17), EGFRvIII single-chain antibody light chain VL (SEQ ID NO.18), EGFRvIII single-chain antibody heavy chain VH (SEQ ID NO.19), antibody Inner-Linker (SEQ ID NO.20), single-chain antibody Inter-Linker (SEQ ID NO.21), CD8 Hinge chimeric receptor linker (SEQ ID NO.22), CD8 Transmembrane chimeric receptor transmembrane domain (SEQ ID NO.23), TCR chimeric receptor T cell activation domain (SEQ ID NO.26) and chimeric receptor co-stimulator domain.

Claims

1. An OCTS-based CAR-T vector for treating malignant glioma, comprising: a lentiviral skeleton plasmid, a human EF1 promoter, OCTS chimeric receptor structural domain, and PDL1 single-chain antibody; wherein the lentiviral skeleton plasmid comprises: an AmpR sequence containing an ampicillin resistance gene for a vast expansion of a target bacterial strain, as shown in SEQ ID NO:1; a prokaryotic replicon pUC Ori sequence for plasmid replication, as shown in SEQ ID NO:2; a viral replicator SV40 Ori sequence for enhancing replication in eukaryotic cells, as shown in SEQ ID NO:3; a lentiviral packaging cis-element for lentiviral packaging; ZsGreen1 green fluorescent protein, as shown in SEQ ID NO:11; IRES ribosome binding sequence, as shown in SEQ ID NO:12; and an eWPRE enhanced marmot hepatitis B virus post-transcriptional controlling element for enhancing transgenic expression efficiency, as shown in SEQ ID NO:13; a sequence of the human EF1 promoter is shown in SEQ ID NO:14; the OCTS chimeric receptor structural domain comprises: a CD8 leader chimeric receptor signal peptide, as shown in SEQ ID NO:35, a PDL1 single-chain antibody light chain VL, as show in SEQ ID NO:16, a PDL1 single-chain antibody heavy chain VH, as show in SEQ ID NO:17, a EGFRvIII single-chain antibody light chain VL, as show in SEQ ID NO:18, a EGFRvIII single-chain antibody heavy chain VH, as show in SEQ ID NO:19, an antibody Inner-Linker, as shown in SEQ ID NO:20, a single-chain antibody Inter-Linker, as shown in SEQ ID NO:21, a CD8 hinge chimeric receptor linker, as shown in SEQ ID NO:22, a CD8 transmembrane chimeric receptor transmembrane domain, as shown in SEQ ID NO:23, a chimeric receptor T cell activation domain of TCR, as shown in SEQ ID NO:26, and a chimeric receptor co-stimulator domain wherein, the chimeric receptor co-stimulator domain is a combination of CD 28 chimeric receptor co-stimulator as shown in SEQ ID NO:24 and CD134 chimeric receptor co-stimulator as shown in SEQ ID NO:25.

2. The OCTS-based CAR-T vector of claim 1, wherein, lentiviral packaging cis-element employs a second-generation lentiviral vector or a third-generation lentiviral vector; the second-generation lentiviral vector comprises: a lentiviral 5 terminal LTR, as shown in SEQ ID NO:5, a lentiviral 3 terminal Self-Inactivating LTR, as shown in SEQ ID NO:6, a Gag cis-element, as shown in SEQ ID NO:7, a RRE cis-element, as shown in SEQ ID NO:8, an env cis-element, as shown in SEQ ID NO:9, and a cPPT cis-element as shown in SEQ ID NO:10; the third-generation lentiviral vector comprises: a lentiviral 5 terminal LTR, as shown in SEQ ID NO:5, a lentiviral 3 terminal self-Inactivating LTR, as shown in SEQ ID NO:6, a Gag cis-element, as shown in SEQ ID NO:7, a RRE cis-element, as shown in SEQ ID NO:8, an env cis-element, as shown in SEQ ID NO:9, a cPPT cis-element, as shown in SEQ ID NO:10, and a RSV promoter, as shown in SEQ ID NO:4.

3. The OCTS-based CAR-T vector of claim 1, wherein, the PDL1 single-chain antibody light chain VL, as show in SEQ ID NO:16, the PDL1 single-chain antibody heavy chain VH, as show in SEQ ID NO:17, the EGFRvIII single-chain antibody light chain VL, as show in SEQ ID NO:18, the EGFRvIII single-chain antibody heavy chain VH, as show in SEQ ID NO:19, the antibody Inner-Linker, as shown in SEQ ID NO:20, and the single-chain antibody Inter-Linker, as shown in SEQ ID NO:21, are connected in a sequence way or in a turned way, PDL1 single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody light chain VL through the single-chain antibody Inter-Linker and is connected to the PDL1 single-chain antibody heavy chain VH through the antibody Inner-Linker, and the EGFRvIII single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the antibody Inner-Linker; and in the turned way, the EGFRvIII single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the antibody Inner-Linker, the PDL1 single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the single-chain antibody Inter-Linker, and the PDL1 single-chain antibody heavy chain VH is connected to the EGFRvIII single-chain antibody light chain VL through the antibody Inter-Linker.

4. The OCTS-based CAR-T vector of claim 1, wherein, a sequence of the PDL1 single-chain antibody is shown in SEQ ID NO:27.

5. The OCTS-based CAR-T vector of claim 1, wherein, the eWPRE enhanced marmot hepatitis B virus post-transcriptional controlling element has six enhanced nucleotide mutations including: g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, and g.411A>T.

6. The OCTS-based CAR-T vector of claim 1, wherein, the whole OCTS structural gene expression is started by the human EF1 promoter, and the CD8 leader chimeric receptor signal peptide on a N terminal of OCTS coding sequence is configured to guide a location of OCTS protein on cytomembrane; the said two groups of single-chain antibodies PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody heavy chain VH, the EGFRvIII single-chain antibody light chain VL and the EGFRvIII single-chain antibody heavy chain VH are combined into double antigen recognition domain and used to recognize corresponding target antigens; the CD8 hinge chimeric receptor linker is configured to anchor scFv on outside of the cytomembrane; the CD8 transmembrane chimeric receptor transmembrane domain is configured to fix entire chimeric receptors on the cytomembrane; the CD28 chimeric receptor co-stimulator is configured to stimulate in-vitro T lymphocyte activation and killing effect on in-vivo tumor cells; the CD134 chimeric receptor co-stimulator is configured to facilitate T lymphocyte proliferation and factor secretion and enhance tumor immunity, contributing to a long-term survival of memory T cells; the TCR chimeric receptor T cell activation domain is configured to activate an expression of downstream signals; the PDL1 single-chain antibody efficiently closes PDL1, blocks negative control signals and clinically suppresses tumor immune evasion, thus improving a curative effect of CAR-T in cellular immunotherapy; when the double antigen recognition domain is bound to the target antigens, signals are transmitted into cells through chimeric receptors, thereby creating a series of biological effects such as T cell proliferation, increased cell factor secretion, increased antiapoptosis secretion, delayed cell death and target cell lysis.

7. The OCTS-based CAR-T vector of claim 1, wherein, the PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody heavy chain VH, the EGFRvIII single-chain antibody light chain VL, the second EGFRvIII single-chain antibody heavy chain VH and the PDL1 single-chain antibody are humanized.

8. A method for preparing the OCTS-based CAR-T vector for malignant glioma according to claim 1, comprising the following steps: (1) storing on lentiviral skeleton plasmid the AmpR sequence containing ampicillin resistance gene as shown in SEQ ID NO:1, the prokaryotic replicon pUC Ori sequence as shown in SEQ ID NO:2, the virus replicon SV40 Ori sequence as shown in SEQ ID NO:3, the lentiviral packaging cis-element for lentiviral packaging, the ZsGreen1 green fluorescent protein as shown in SEQ ID NO:11, the IRES ribosome binding sequence as shown in SEQ ID NO:12, and the eWPRE enhanced post-transcriptional regulatory element of Groundhog hepatitis B virus as shown in SEQ ID NO:13; (2) combining the human EF1 promoter as shown in SEQ ID NO:14, the OCTS chimeric receptor structural domain and the PDL1 single-chain antibody as shown in SEQ ID NO:27 into a design scheme for OCTS chimeric receptor, and cloning the design scheme into the lentiviral skeleton plasmid by digestion, ligation and recombination to obtain recombinant lentiviral plasmids pOCTS-PEvIIIs and pOCTS-PEvIIIt designed by a third-generation OCTS; (3) transfecting HEK293T/17 cells by the pOCTS-PEvIIIs and pOCTS-PEvIIIt with lentiviral packaging plasmids pPac-GP and pPac-R and membrane protein pEnv-G respectively after the recombinant lentiviral plasmid is transcripted and expressed in the HEK293T/17 cells, the recombinant lentiviral vector plasmids packaged successfully is released into cell culture supernatants, and then collecting supernatants containing the recombinant lentiviral plasmids; and (4) purifying the supernatants by column purification of filtration, adsorption and elution to obtain the recombinant lentiviral plasmids lvOCTS-PEvIIIs and lvOCTS-PEvIIIt respectively.

9. The method of claim 8, wherein, in the step (4), the filtration is performed by controlling a volume of each of the supernatants from 200 ml to 2000 ml, with a vacuum degree from 0.5 MPA to 0.9 MPA to prevent a loss of the recombinant lentiviral plasmids caused by blockage; the adsorption is performed by controlling a PH value of a solution from 6 to 8 to prevent the recombinant lentiviral plasmids from inactivating due to a change of PH, and the elution is performed by controlling an ionic strength of an eluent from 0.5M to 1.0M to prevent a change of the ionic strength leading to incomplete elution or inactivation of the recombinant lentiviral plasmids.

10. Application of the vector described in claim 1 in a preparation of drugs for treating malignant glioma.

11. The method of claim 8, wherein, the lentiviral packaging cis-element employs a second-generation lentiviral vector or a third-generation lentiviral vector; the second-generation lentiviral vector comprises: a lentiviral 5 terminal LTR, as shown in SEQ ID NO:5, a lentiviral 3 terminal Self-Inactivating LTR, as shown in SEQ ID NO:6, a Gag cis-element, as shown in SEQ ID NO:7, a RRE cis-element, as shown in SEQ ID NO:8, an env cis-element, as shown in SEQ ID NO:9, and a cPPT cis-element as shown in SEQ ID NO:10; the third-generation lentiviral vector comprises: a lentiviral 5 terminal LTR, as shown in SEQ ID NO:5, a lentiviral 3 terminal self-Inactivating LTR, as shown in SEQ ID NO:6, a Gag cis-element, as shown in SEQ ID NO:7, a RRE cis-element, as shown in SEQ ID NO:8, an env cis-element, as shown in SEQ ID NO:9, a cPPT cis-element, as shown in SEQ ID NO:10, and a RSV promoter, as shown in SEQ ID NO:4.

12. The method of claim 8, wherein, the PDL1 single-chain antibody light chain VL, as show in SEQ ID NO:16, the PDL1 single-chain antibody heavy chain VH, as show in SEQ ID NO:17, the EGFRvIII single-chain antibody light chain VL, as show in SEQ ID NO:18, the EGFRvIII single-chain antibody heavy chain VH, as show in SEQ ID NO:19, the antibody Inner-Linker, as shown in SEQ ID NO:20, and the single-chain antibody Inter-Linker, as shown in SEQ ID NO:21, are connected in-a sequence way or in a turned way, PDL1 single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody light chain VL through the single-chain antibody Inter-Linker and is connected to the PDL1 single-chain antibody heavy chain VH through the antibody Inner-Linker, and the EGFRvIII single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the antibody Inner-Linker; and in the turned way, the EGFRvIII single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the antibody Inner-Linker, the PDL1 single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the single-chain antibody Inter-Linker, and the PDL1 single-chain antibody heavy chain VH is connected to the EGFRvIII single-chain antibody light chain VL through the antibody Inter-Linker.

13. The method of claim 8, wherein, a sequence of the PDL1 single-chain antibody is shown in SEQ ID NO:27.

14. The method of claim 8, wherein, the eWPRE enhanced marmot hepatitis B virus post-transcriptional controlling element has six enhanced nucleotide mutations including: g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, and g.411A>T.

15. The method of claim 8, wherein, the whole OCTS structural gene expression is started by the human EF1 promoter, and the CD8 leader chimeric receptor signal peptide on a N terminal of OCTS coding sequence is configured to guide a location of OCTS protein on cytomembrane; the said two groups of single-chain antibodies PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody heavy chain VH, the EGFRvIII single-chain antibody light chain VL and the EGFRvIII single-chain antibody heavy chain VH are combined into double antigen recognition domain and used to recognize corresponding target antigens; the CD8 hinge chimeric receptor linker is configured to anchor scFv on outside of the cytomembrane; the CD8 transmembrane chimeric receptor transmembrane domain is configured to fix entire chimeric receptors on the cytomembrane; the CD28 chimeric receptor co-stimulator is configured to stimulate in-vitro T lymphocyte activation and killing effect on in-vivo tumor cells; the CD134 chimeric receptor co-stimulator is configured to facilitate T lymphocyte proliferation and factor secretion and enhance tumor immunity, contributing to a long-term survival of memory T cells; the TCR chimeric receptor T cell activation domain is configured to activate an expression of downstream signals; the PDL1 single-chain antibody efficiently closes PDL1, blocks negative control signals and clinically suppresses tumor immune evasion, thus improving a curative effect of CAR-T in cellular immunotherapy; when the double antigen recognition domain is bound to the target antigens, signals are transmitted into cells through chimeric receptors, thereby creating a series of biological effects such as T cell proliferation, increased cell factor secretion, increased antiapoptosis secretion, delayed cell death and target cell lysis.

16. The method of claim 8, wherein, the PDL1 single-chain antibody light chain VL, the PDL1 single-chain antibody heavy chain VH, the EGFRvIII single-chain antibody light chain VL, the second EGFRvIII single-chain antibody heavy chain VH and the PDL1 single-chain antibody are humanized.

17. The application of claim 10, wherein, the lentiviral packaging cis-element employs a second-generation lentiviral vector or a third-generation lentiviral vector; the second-generation lentiviral vector comprises: a lentiviral 5 terminal LTR, as shown in SEQ ID NO:5, a lentiviral 3 terminal Self-Inactivating LTR, as shown in SEQ ID NO:6, a Gag cis-element, as shown in SEQ ID NO:7, a RRE cis-element, as shown in SEQ ID NO:8, an env cis-element, as shown in SEQ ID NO:9, and a cPPT cis-element as shown in SEQ ID NO:10; the third-generation lentiviral vector comprises: a lentiviral 5 terminal LTR, as shown in SEQ ID NO:5, a lentiviral 3 terminal self-Inactivating LTR, as shown in SEQ ID NO:6, a Gag cis-element, as shown in SEQ ID NO:7, a RRE cis-element, as shown in SEQ ID NO:8, an env cis-element, as shown in SEQ ID NO:9, a cPPT cis-element, as shown in SEQ ID NO:10, and a RSV promoter, as shown in SEQ ID NO:4.

18. The application of claim 10, wherein, the PDL1 single-chain antibody light chain VL, as show in SEQ ID NO:16, the PDL1 single-chain antibody heavy chain VH, as show in SEQ ID NO:17, the EGFRvIII single-chain antibody light chain VL, as show in SEQ ID NO:18, the EGFRvIII single-chain antibody heavy chain VH, as show in SEQ ID NO:19, the antibody Inner-Linker, as shown in SEQ ID NO:20, and the single-chain antibody Inter-Linker, as shown in SEQ ID NO:21, are connected in-a sequence way or in a turned way, PDL1 single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody light chain VL through the single-chain antibody Inter-Linker and is connected to the PDL1 single-chain antibody heavy chain VH through the antibody Inner-Linker, and the EGFRvIII single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the antibody Inner-Linker; and in the turned way, the EGFRvIII single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the antibody Inner-Linker, the PDL1 single-chain antibody light chain VL is connected to the EGFRvIII single-chain antibody heavy chain VH through the single-chain antibody Inter-Linker, and the PDL1 single-chain antibody heavy chain VH is connected to the EGFRvIII single-chain antibody light chain VL through the antibody Inter-Linker.

19. The application of claim 10, wherein, a sequence of the PDL1 single-chain antibody is shown in SEQ ID NO:27.

20. The application of claim 10, wherein, the eWPRE enhanced marmot hepatitis B virus post-transcriptional controlling element has six enhanced nucleotide mutations including: g.396G>A, g.397C>T, g.398T>C, g.399G>A, g.400A>T, and g.411A>T.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG. 1 is a schematic diagram of the OCTS chimeric receptor said in the invention, consisting of the schematic diagram of Series OCTS and Turn OCTS;

[0039] FIGS. 2A-2B are schematic diagrams of the structure of the lentiviral vector said in the invention; wherein, FIG. 2A is a schematic diagram of the structure of the third-generation lentiviral vector employed by the invention, and FIG. 2B is a schematic diagram of the structure comparison of the second and third-generation lentiviral vectors;

[0040] FIG. 3 is a flow chart for preparing the recombinant lentiviral vector in embodiment 1 of the invention; wherein, (A) is a schematic diagram of the structure of the lentiviral skeleton plasmid pLenti-3G basic; (B) is a schematic diagram of 2 OCTS plasmids; (C) is a schematic diagram of the structure of pPac-GP plasmid; (D) is a schematic diagram of the structure of pPac-R plasmid; (E) is a schematic diagram of the structure of pEnv-G packaging plasmid;

[0041] FIGS. 4A-4C are schematic diagrams of the element order of OCTS structure in embodiment 1 of the invention; wherein, FIG. 4A is a schematic diagram of the structure of Series OCTS; FIG. 4B is a schematic diagram of the structure of Turn OCTS; FIG. 4C is a schematic diagram of the list of OCTS Symbols of OCTS structure;

[0042] FIGS. 5A-5D is an enzyme digestion prediction and enzyme digestion agarose gel electrophoresis diagram of recombinant lentiviral plasmids pOCTS-PEvIIIs and pOCTS-PEvIIIt in embodiment 1 of the invention; wherein, FIG. 5A is a schematic diagram of the enzyme digestion prediction of pOCTS-PEvIIIs, and FIG. 5B is an enzyme digestion agarose gel electrophoresis diagram of pOCTS-PEvIIIs; FIG. 5C is a schematic diagram of the enzyme digestion prediction of pOCTS-PEvIIIt, and FIG. 5D is an enzyme digestion agarose gel electrophoresis diagram of pOCTS-PEvIIIt; in FIG. 5A, lane1 is 1 kb DNA ladder Marker: the bands from top to bottom are 10 kb, 8 kb, 6 kb, 5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp; in FIG. 5A, lane2 is the Pst I enzyme digestion prediction of pOCTS-PEvIIIs: the bands from top to bottom are 11021 bp and 1148 bp; in FIG. 5B, lane1 is the electrophoretic results of 1 kb DNA ladder Marker; in FIG. 5B, lane2 is the Pst I enzyme digestion electrophoretic results of pOCTS-PEvIIIs; in FIG. 5C, lane1 is 1 kb DNA ladder Marker: the bands from top to bottom are 10 kb, 8 kb, 6 kb, 5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 750 bp, 500 bp, 250 bp; in FIG. 5C, lane2 is ApaL I enzyme digestion prediction of pOCTS-PEvIIIt: the bands from top to bottom are 4195 bp, 3160 bp, 1726 bp, 1507 bp, 1246 bp, 497 bp; in FIG. 5D, lane1 is the electrophoretic results of 1 kb DNA ladder Marker; in FIG. 5D, lane2 is the enzyme digestion electrophoretic results of pOCTS-PEvIIIt;

[0043] FIG. 6 is a schematic diagram of titer detection results of recombinant lentiviral vectors in embodiment 1 of the invention;

[0044] FIG. 7 is the flow diagram of the steps of preparing OCTS-CAR-T cells said in embodiment 1 of the invention, involving isolated culture, activation, gene transduction, OCTS-CAR-T cell identification and other stages;

[0045] FIG. 8 is a schematic diagram of mycoplasma detection results of OCTS-CAR-T cells in embodiment 2 of the invention, where lane1 is DL2000 marker, and the bands from top to bottom are 2 kb, 1 kb, 750 bp, 500 bp, 250 bp and 100 bp; lane2 is a positive control; lane3 is a negative control; lane4 is PBS; lane5 is lysate; lane6 is OCTS-PEvIIIs-CAR-T cell; lane 7 is OCTS-PEvIIIt-CAR-T cell;

[0046] FIGS. 9A-9D are schematic diagrams of the results of flow cytometry of transduction efficiency and immunophenotyping of OCTS-CAR-T cell; wherein, FIG. 9A shows the results of transduction efficiency of OCTS-PEvIIIs-CAR-T cell; FIG. 9B shows the results of immunophenotyping of OCTS-PEvIlls-CAR-T cell; FIG. 9C shows the results of transduction efficiency of OCTS-PEvIIIt-CAR-T cell; FIG. 9D shows the results of immunophenotyping of OCTS-PEvIIIt-CAR-T cell;

[0047] FIG. 10 is a schematic diagram of the comparison in terms of killing effect on different target cells between OCTS-PEvIIIs-CAR-T cell and OCTS-PEvIIIt-CAR-T cell on different multiplicity of infection conditions in embodiment 3 of the invention.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0048] The invention is further described below in connection with specific implementation methods. It should be understood that the specific implementation methods described herein are expressed by way of examples and are not constrained by the invention.

[0049] Without departing from the scope of the invention, the main features of the invention can be used in various implementation methods.

Materials

[0050] 1. Lentiviral skeleton plasmid pLenti-3G basic, lentiviral packaging plasmids pPac-GP and pPac-R and membrane protein plasmid pEnv-G HEK293T/17 cells, homologous recombinase, Oligo Annealing Buffer, MycoAlert Mycoplasma Detection Kit, endotoxin detection kit, PDL1.sup.+K562, EGFRvIII.sup.+K562, PDL1.sup.+EGFRvIII.sup.+K562 and K562 cells were bought from Shiao (Shanghai) Biomedical Technology Co., Ltd.; specific preparation method of lentiviral skeleton plasmid pLenti-3G basic has been disclosed in the patent application No. 201610008360.5 for an invention titled A CAR-T Transgenic Vector Based on Replication-Competent Defective Recombinant Lentivirus as Well as Preparation Method and Application Thereof;

[0051] 2. Fresh human peripheral blood provided by healthy donors;

[0052] 3. Combination of OCTS-PEvIIIs and OCTS-PEvIIIt DNA sequences designed by Shanghai Unicar (see FIG. 4C), synthesized by Shanghai Generay Biotech Co., Ltd. and kept in the form of dry powder of oligonucleotides or plasmid;

[0053] 4. Tool enzymes Pst I, ApaL I, Cla I, EcoR I and T4 DNA ligase purchased from NEB;

[0054] 5. 0.22 m-0.8 m PES filter purchased from millipore;

[0055] 6. D-PBS (), 0.4% trypan blue, screen mesh, various cell-culture dishes, culture bags, and culture plates bought from corning;

[0056] 7. Opti-MEM, Pen-Srep, Hepes, FBS, AIM-V, RPMI 1640, DMEM, lipofectamine 3000 bought from invitrogen;

[0057] 8. Biotinylated protein L bought from GeneScript;

[0058] 9. LDH detection kits bought from promega;

[0059] 10. Ficoll lymphocyte separation medium bought from GE;

[0060] 11. 20% human albumin solution bought from CSL Behring;

[0061] 12. CryoPremium freezing medium and sorting buffer solution bought from Shanghai Unicar;

[0062] 13. rIL-2, rIL-7, rIL-15, rIL-21 purchased from peprotech;

[0063] 14. CD3 monoclonal antibody, CD28 monoclonal antibody, CD3/CD28 magnetic bead, CD4/CD8 magnetic bead bought from a German company Miltenyi;

[0064] 15. Refrigerated centrifuge bought from an American company ThermoScientific;

[0065] 16. FACS bought from Thermo;

[0066] 17. Fluorescence inversion microscope system bought from Olympus;

[0067] 18. CD4-FITC and CD8-APCbought from BioLegend;

[0068] 19. 0.9% saline solution bought from Jinmai;

[0069] 20. ProteinL Magnetic Beads bought from BioVision;

[0070] 21. PrimeSTAR and RetroNectin bought from Takara;

[0071] 22. phycoerythrin(PE)-conjugated streptavidin bought from BD Bioscience;

[0072] 23. Plasmid extraction kits and agarose gel recovery kits purchased from MN;

[0073] 24. TOP 10 competent cells purchased from tiangen;

[0074] 25. NaCl, KCl, Na.sub.2HPO.sub.4.12H.sub.2O, KH.sub.2PO.sub.4, Trypsin, EDTA, CaCl.sub.2, NaOH, PEG6000 purchased from Shanghai Sangon Biotech;

[0075] 26. DNeasy kits purchased from Shanghai Generay;

[0076] 27. SA-HRP purchased from Shanghai Yeasen;

[0077] 28. Primers: Primers required for amplifying DNA fragments and target sites, designed by primer design principle and synthesized by a shanghai-based biotechnology company specifically as follows:

[0078] EF1-F: 5-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3 (SEQ ID NO.28)

[0079] EF1-R: 5-TCACGACACCTGAAATGGAAGA-3 (SEQ ID NO.29)

[0080] OCTS-F: CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC (SEQ ID NO.30)

[0081] OCTS-R: GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG (SEQ ID NO.31)

[0082] IRES-F: GCCCCTCTCCCTCCCCC (SEQ ID NO.32)

[0083] IRES-R: ATTATCATCGTGTTTTTCAAAGGAA (SEQ ID NO.33)

[0084] PDL1scab-F: AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG (SEQ ID NO.34)

[0085] PDL1scab-R:

[0086] AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCAG (SEQ ID NO.35)

[0087] WPRE-QPCR-F: 5-CCTTTCCGGGACTTTCGCTTT-3(SEQ ID NO.36)

[0088] WPRE-QPCR-R: 5-GCAGAATCCAGGTGGCAACA-3(SEQ ID NO.37)

[0089] Actin-QPCR-F: 5-CATGTACGTTGCTATCCAGGC-3(SEQ ID NO.38)

[0090] Actin-QPCR-R: 5-CTCCTTAATGTCACGCACGAT-3(SEQ ID NO.39)

[0091] 29. In the invention, the said DNA fragments shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 were synthesized by Shanghai Generay Biotech Co., Ltd. in line with sequences provided by the inventor thereof.

Embodiment 1 Preparation of OCTS-CAR-T Cells

I. Methods of Preparation, Purification and Detection of Recombinant Lentiviral Vectors lvOCTS-PEvIIIs and lvOCTS-PEvIIIt

[0092] The preparation method of recombinant lentiviral vectors described in the invention is as follows (see FIG. 3):

[0093] 1. Combine into a design scheme for OCTS chimeric receptor the human EF1 promoter (SEQ ID NO.14), OCTS structures [OCTS-PEvIIIs and OCTS-PEvIIIt], CD8 leader chimeric receptor signal peptide (SEQ ID NO.15), PDL1 single-chain antibody light chain VL (SEQ ID NO.16), PDL1 single-chain antibody heavy chain VH (SEQ ID NO.17), EGFRvIII single-chain antibody light chain VL (SEQ ID NO.18), EGFRvIII single-chain antibody heavy chain VH (SEQ ID NO.19), antibody Inner-Linker (SEQ ID NO.20), single-chain antibody Inter-Linker (SEQ ID NO.21), CD8 Hinge chimeric receptor linker (SEQ ID NO.22), CD8 Transmembrane chimeric receptor transmembrane domain (SEQ ID NO.23), CD28 chimeric receptor co-stimulator (SEQ ID NO.24), CD134 chimeric receptor co-stimulator (SEQ ID NO.25), TCR chimeric receptor T cell activation domain (SEQ ID NO.26), PDL1 single-chain antibody (SEQ ID NO.27), and clone the scheme into the lentiviral skeleton plasmid pLenti-3G basic by digestion, ligation and recombination to obtain recombinant lentiviral plasmids pOCTS-PEvIIIs and pOCTS-PEvIIIt respectively (see FIG. 4 for element order and No.).

[0094] (1) Conduct double digestion of the lentiviral skeleton plasmid pLenti-3G basic with Cla I and EcoR I restriction enzymes, electrophorese the product thereof on a 1.5% agarose gel to confirm the 5823bp fragment V1, and then recover and place such gel in an Eppendorf tube, and recover corresponding fragments with the agarose gel recovery kit of MN (see Table 1) and determine the purity and concentration of the product thereof;

TABLE-US-00001 TABLE 1 Procedures for the recovery of agarose gel 1. Sol Add the sol solution in a ratio of 200 l NTI/100 mg gel, and place it in a 50 C. water bath for 5-10 minutes. 7. Bind to Centrifuge at 11,000 g for 30 seconds, and discard the DNA filtrate. 8. Wash Add 7000 l NT3, centrifuge at 11,000 g for 30 seconds, membrane and discard the filtrate 9. Wash Repeat step 3 once membrane 10. Dry Centrifuge at 11,000 g for 1 minute, replace with a new collection tube, and leave it at room temperature for 1 minute. 11. Elute Add 15-30 l NE, leave it at room temperature for 1 minute, DNA centrifuge at 11,000 g for 1 minute, and then collect the . filtrate

[0095] (2) Use the primers EF1-F and EF1-R with the synthesized human EF1 promoter (SEQ ID NO.14) as a template, apply the system in Table 2 on the PCR circulation conditions: 98 C. 3 min, (98 C. 10 sec, 55 C. 15 sec, 72 C. 2 min)*35 cycle, 72 C. 10 min, electrophorese the product thereof on a 1.5% agarose gel to confirm the 1208 bp fragment a, and then recover and place such gel in an Eppendorf tube, and recover corresponding fragments with the agarose gel recovery kit of MN (see Table 1) and determine the purity and concentration of the product thereof;

TABLE-US-00002 TABLE 2 50 l PCR reaction system Reagent Volume (l) H.sub.2O 32.5 5 Buffer (with Mg2+) 10 dNTP (2.5 mM each) 4 Primer1 (+)(10 M) 1 Primer2 ()(10 M) 1 Template 1 PrimeSTAR 0.5

[0096] (3) Use the primers OCTS-F and OCTS-R with the synthesized OCTS-PEvIIIs as a template, apply the system in Table 2 on the PCR circulation conditions: 98 C. 3 min, (98 C. 10 sec, 55 C. 15 sec, 72 C. 30 sec)*35 cycle, 72 C. 5 min, electrophorese the product thereof on a 1.5% agarose gel to confirm the 2392 bp fragment b, and then recover and place such gel in an Eppendorf tube, and recover corresponding fragments with the agarose gel recovery kit of MN (see Table 1) and determine the purity and concentration of the product thereof;

[0097] (4) Use the primers OCTS-F and OCTS-R with the synthesized OCTS-PEvIIIt as a template, apply the system in Table 2 on the PCR circulation conditions: 98 C. 3 min, (98 C. 10 sec, 55 C. 15 sec, 72 C. 30 sec)*35 cycle, 72 C. 5 min, electrophorese the product thereof on a 1.5% agarose gel to confirm the 2355 bp fragment c, and then recover and place such gel in an Eppendorf tube, and recover corresponding fragments with the agarose gel recovery kit of MN (see Table 1) and determine the purity and concentration of the product thereof;

[0098] (5) Use the primers IRES-F and IRES-R with the synthesized IRES ribosome binding sequence (SEQ ID NO.12) as a template, apply the system in Table 2 on the PCR circulation conditions: 98 C. 3 min, (98 C. 10 sec, 55 C. 15 sec, 72 C. 30 sec)*35 cycle, 72 C. 5 min, electrophorese the product thereof on a 1.5% agarose gel to confirm the 575 bp fragment d, and then recover and place such gel in an Eppendorf tube, and recover corresponding fragments with the agarose gel recovery kit of MN (see Table 1) and determine the purity and concentration of the product thereof;

[0099] (6) Use the primers PDL1scab-F and PDL1scab-R with the synthesized PDL1 single-chain antibody (SEQ ID NO. 27) as a template, apply the system in Table 2 on the PCR circulation conditions: 98 C. 3 min, (98 C. 10 sec, 55 C. 15 sec, 72 C. 30 sec)*35 cycle, 72 C. 5 min, electrophorese the product thereof on a 1.5% agarose gel to confirm the 2355 bp fragment c, and then recover and place such gel in an Eppendorf tube, and recover corresponding fragments with the agarose gel recovery kit of MN (see Table 1) and determine the purity and concentration of the product thereof;

[0100] (7) Add combinations of recombinant lentiviral plasmid DNA fragments into the Eppendorf tubes with a total volume of 5 l and at a molar ratio of 1:1:1; add 15 l homologous recombinant enzyme reaction solution into the tubes, mix and incubate them at 42 C. for 30 minutes, and put the tubes on ice for 2-3 minutes; add the reaction solution into 50 l TOP10, rotate the tubes gently to mix the contents, place the tubes in ice for 30 minutes, put the tubes in a constant temperature water bath pot preheated to 42 C. for 90-second heat shock, quickly transfer the tubes to the ice bath, and cool the cells for 2-3 minutes; add 900 l LB culture medium into each tube, transfer the tubes to a shaking bed at 37 C., and incubate the tubes for 1 hour to resuscitate the bacteria; take 1000 transformed bacteria solution, coat it on the Amp LB agar plate, invert the flat dish, and put it in a constant temperature incubator at 37 C. for 16-hour cultivation.

TABLE-US-00003 TABLE 3 Combination of recombinant lentiviral plasmid DNA fragments Recombinant lentiviral Combination of plasmid fragments pOCTS-PEvIIIs a, b, d, e pOCTS-PEvIIIt a, c, d, e

[0101] Select clones for colony PCR identification, among which those identified as correct are exactly recombinant lentiviral plasmids pOCTS-PEvIIIs and pOCTS-PEvIIIt, conduct enzyme digestion identification of correct clones (see FIGS. 5A-5D), and send the sequencing review results.

2. Packaging of Recombinant Lentiviral Vectors lvOCTS-PEvIIIs and lvOCTS-PEvIIIt

[0102] (1) Complete medium: take out the pre-heated fresh medium, add 10% FBS+5 ml Pen-Srep, and mix them upside down;

[0103] (2) 1XPBS solution: weigh 8 g of NaCl, 0.2 g of KCl, 3.58 g of Na.sub.2HPO.sub.4.12H.sub.2O, 0.24 g of KH.sub.2PO4, and put them in a 1000 ml beaker, and add 900 ml of Milli-Q grade ultrapure water to dissolve. After completion of the dissolution, the volume was adjusted to 1000 ml using a 1000 ml measuring cylinder, and the mixture was sterilized by heat sterilization at 121 C. for 20 minutes;

[0104] (3) 0.25% Trypsin solution: weigh 2.5 g of Trypsin, 0.19729 g EDTA, and put them in a 1000 ml beaker, and add 900 ml of 1XPBS solution to dissolve. After completion of the dissolution, the volume was adjusted to 1000 ml using a 1000 ml measuring cylinder, and the mixture was sterilized via 0.22 M filter. It could be saved in the refrigerator at 20 C. for long-term use;

[0105] (4) 0.5M CaCl2 solution: weigh 36.75 g of CaCl.sub.2, and dissolve it with 400 ml of Milli-Q grade ultrapure water; The volume was adjusted to 500 ml with Milli-Q grade ultrapure water, and mixed; The mixture was sterilized via 0.22 M filter, and stored in 50 ml centrifuge tubes with about 45 ml in each tube at 4 C.;

[0106] (5) 2XHBS solution: weigh 4.09 g of NaCl, 0.269 g of Na.sub.2HPO4, 5.96 g of Hepes, and dissolve them with 400 ml Milli-Q grade ultrapure water; After calibrating the PH meter, the PH of the HBS solution was adjusted to 7.05 with 2M NaOH solution. It was about 3 ml of 2M NaOH to consume to adjust the PH of each bottle of HBS;

[0107] (6) The frozen HEK293T/17 cells were removed from the liquid nitrogen container and rapidly transferred to a 37 C. water bath for 1-2 minutes, and then put them on a super clean bench. Aseptically transfer all the liquid in the freezing tube to a 10 cm.sup.2 petri dish, and make up DMEM containing 10% FBS to 8 mL/10 cm.sup.2 dish, and observe the cells under microscope after 24 hours. Passage was performed with the degree of cell confluence greater than 80%;

[0108] (7) HEK293T/17 cells with good cell status and no pollution were selected, and each 2-6 petri dishes were used as a group. After trypsinizing the cells, 4-12 ml of complete medium was pipetted with an electric pipette to add 2 ml to each digested dish to avoid drying the dish; All cells were isolated into single cell suspensions using a 1 ml pipette and transferred to medium bottles;

[0109] (8) The remaining cells in the above 2-6 petri dishes were transferred to the medium bottles, and the petri dishes were rinsed with the medium again;

[0110] (9) Close the cap of the medium bottles and turn them upside down for about 10 times to fully mixed the cell suspension. Transfer the cells to 8-24 10 cm.sup.2 petri dishes. For each dish, there shall be about 410.sup.6 cells/10 ml complete medium. If the cell density is significantly different from the expected, the number of cells is required to be counted, and then the cells will be inoculated according to the quantity of 410.sup.6per dish;

[0111] (10) Arrange each of the 6 petri dishes into a pile, and keep the fit between the upper and lower dishes. Shake the petri dishes left and right, back and forth several times to make cells fully spread out, and then put them into an incubator with 5% CO.sub.2. The remaining cells were treated as the same;

[0112] (11) Upon Checking the passage cells, the cells shall be at 70-80% confluence, with full contour, good attachment and even distribution in petri dishes;

[0113] (12) For changing the solution, the medium was replaced with fresh complete medium with 9 ml per dish. The CO.sub.2 concentration of incubator was increased to 8%;

[0114] (13) To prepare DNA/CaCl.sub.2 according to N+0.5. The amount of HEK293T/17 cell transfection plasmid per dish was used in the following ratios: recombinant lentiviral plasmid (20 g), pPac-GP (15 g), pPac-R (10 g), pEnv-G (7.5 g). Take a new 5 ml centrifuge tube, add 0.5M CaCl2: 0.25 ml, recombinant lentiviral plasmid 20 g: pPac-GP 15 g: pPac-R 10 g: pEnv-G 7.5 g, supplement ultrapure water to 0.5 ml, and cover the cap to mix them fully;

[0115] (14) Take another 5 ml centrifuge tube and add 0.5 ml DNA/CaCl2 solution. Open a vortex mixer, hold the upper end of the 5 ml centrifuge tube with one hand, and make the bottom of the tube contact the oscillation chamber, so that the liquid could spread on the tube wall. Take a 1 ml pipette with anther hand to suck 0.5 mL 2HBS solution, add it into the centrifuge tube slowly and control the flow velocity. It was advisable to complete the drip in half a minute. After 2HBS was added, it should be oscillated for another 5 seconds, and then stop oscillating. It could be directly added into the cells that need transfection;

[0116] (15) Take a dish of cells and drop 1 mL calcium transfection solution in the centrifuge tube in the dish to distribute the calcium transfection solution throughout the petri dish as much as possible;

[0117] (16) After the calcium transfection solution was added, the petri dish was marked on the cover, and put back in another incubator with 5% CO.sub.2. Make sure that the petri dish was placed horizontally, and that there were no more than 6 petri dishes in each pile. These dishes were placed in the incubator with 5% CO.sub.2 for 6-8 h;

[0118] (17) The CO.sub.2 concentration of the first incubator was adjusted at 5%;

[0119] (18) The cells status was check 24 hours later. The cell confluence should be around 80-85% and in good condition. Aspirate the medium and replace 10 ml of fresh DMEM complete medium;

[0120] (19) The transfection efficiency was observed 48 hours later. Most cells were still adherent. It could be seen that more than 95% of the cells would have green fluorescence. The supernatant of the same virus packaging was collected together, and 10 mL of fresh medium was added to the petri dish;

[0121] (20) The same virus supernatant was collected again 72 hours later. The two collections were put together, and the petri dishes were discarded; the supernatant collected at this time contained the recombinant lentiviral vectors lvOCTS-PEvIIIs and lvOCTS-PEvIIIt.

3. Purification of Recombinant Lentiviral Vectors by Ion Exchange Chromatography

[0122] (1) The collected supernatant was filtered through a 0.22 m-0.8 m PES filter using a Thermo vacuum pump to remove impurities;

[0123] (2) 1.5M NaCl 250 mM Tris-HCl (PH6-8) was added to the supernatant at a ratio of 1:1 to 1:10

[0124] (3) Two ion exchange columns were placed in series, and they were passed through sequentially by 4 ml 1M NaOH, 4 ml 1M NaCl, 5 ml 0.15M NaCl 25 mM Tris-HCl (pH 6-8) solution;

[0125] (4) The solution obtained in step 2 was pumped into the ion exchange column with a peristaltic pump at a rate of 1-10 ml/min;

[0126] (5) After all the supernatant was passed through the column, it was washed with 10 ml of 0.15M NaCl 25 mM Tris-HCl (pH 6-8) solution;

[0127] (6) According to the sample size, 1-5 ml of 1.5M NaCl 25 mM Tris-HCl (pH 6-8) was used for elution and the eluate was collected; and

[0128] (7) The eluate was divided into tubes about 25 to 50 l each, and stored in a refrigerator with 80 C. for long-term storage.

[0129] 4. Titer determination of recombinant lentiviral vectors

[0130] (1) 293T cells were inoculated with 24-well plates. The number of cells in each well was 510.sup.4, and the volume of medium added was 500 ul. As the growth rate of different types of cells was different, the rate of cell fusion during viral infection was 40%-60%;

[0131] (2) Three sterile EP tubes were prepared, and 90 ul fresh complete medium (high glucose DMEM+10% FBS) was added into each tube to inoculate the cells. 24 hours later, the cells in the two pores were taken and counted with a hemocytometer to determine the actual number of cells at the time of infection, denoted as N;

[0132] (3) 10 ul of the virus stock to be determined was added to the first tube. After gently mixing, 10 ul of the virus stock was added to the second tube, and then sequentially operated until the last tube; 410 ul complete medium (high glucose DMEM+10% FBS) was added into each tube, and the final volume was 500 ul;

[0133] (4) 20 hours after the infection, the cultural supernatant was removed and replaced with 5000 complete medium (high glucose DMEM+10% FBS). The cells was continuously cultured for 48 hours in 5% CO.sub.2;

[0134] (5) After 72 hours, the fluorescence expression was observed. Under normal circumstances, the number of fluorescence cells decreased with the increase of dilution ratio. At the same time, photos were taken;

[0135] (6) The cells were digested with 0.2 ml 0.25% trypsin-EDTA solution, and then they were placed at 37 C. for 1 minute. The whole cellular surface were purged with medium, and the cells were collected by centrifugation. Genomic DNA was extracted according to the instructions of DNeasy kit. 200 l of eluent were added to each sample tube to remove DNA, and then they were quantified;

[0136] (7) The DNA detection qPCRmix manifold I was prepared (QPCR primer sequences were SEQ ID NO. 36SEQ ID NO. 37):

TABLE-US-00004 2 TaqMan Master Mix 25 l n Forward primer 0.1 l n (100 pmol ml 1) Reverse primer 0.1 l n (100 pmol ml 1) Probe (100 pmol ml 1) 0.1 l n H.sub.2O 19.7 l n
n=number of reactions. For example, the total n were 40. 1 ml of 2 TaqMan Universal PCR Master Mix, 4 l of forward primer, 4 l of reverse primer, 4 l of probe and 788 l of H.sub.2O were mixed and Placed on ice after being shaken;

[0137] (8) The reference DNA detection qPCRmix manifold II were prepared (QPCR primer sequences were SEQ ID NO. 38-SEQ ID NO. 39):

TABLE-US-00005 2 TaqMan Master Mix 25 l n 10 RNaseP primer/probe mix 2.5 l n H.sub.2O 17.5 l n
n=number of reactions. For example, the total n were 40. 1 ml of 2 TaqMan Universal PCR Master Mix, 100 l pf 10RNaseP primer/probe mix and 700 l of H.sub.2O were mixed and placed on ice after being shaken;

[0138] (9) The PCR system was established on a pre-cooled 96-well PCR plate. Take 45 l from each tube of manifold I to add to the wells of each row of A-D. Take 45 l from each tube of manifold II to add to the wells of each row of E-G

[0139] (10) 5 l of the standard plasmid and the genomic DNA from the samples to be tested were taken respectively to add to the A-D row, and each sample was repeated once. 1 well was left to add 5 l of water as no-template control.

[0140] (11) 5l of the genomic standards and the genomic DNA from the samples to be tested were taken respectively to add to the E-G row, and each sample was repeated once. 1 well was left to add 5 l of water as no-template control.

[0141] (12) The quantitative PCR instrument used was the ABI PRISM 7500 quantitative system. The cyclic conditions were set to: 50 C. 2 min, 95 C. 10 min, (95 C. 15 sec, 60 C. 1 min)40 cycle.

[0142] Data analysis: the copy number of lentiviral vectors integrated in the measured DNA samples was calibrated with the number of genomes to obtain the copy number of viruses integrated in each genome.

[0143] The calculation formula of integration units per ml (IU ml.sup.1) was as follows:

IU ml.sup.1=(CND1000)/N

[0144] wherein: [0145] C=the average virus copy number per genome integration [0146] N=number of cells at the time of infection (approximately 110.sup.5) [0147] D=dilution of the viral vector [0148] V=the volume of diluted virus added

[0149] (13) Titer results of recombinant lentiviral vectors lvOCTS-PEvIIIs and lvOCTS-PEvIIIt (see FIG. 6).

II. Preparation of OCTS-CAR-T Cell

[0150] Preparation method of the OCTS-CAR-T cell described in the invention is as below (see FIG. 7):

1. PBMC Separation

[0151] (1) Draw 50 ml fresh peripheral blood from healthy donors;

[0152] (2) Spray ethyl alcohol onto the blood collecting bag twice and wipe it off;

[0153] (3) Draw blood cells out of the bag with a 50 ml injector and transfer them to a new 50 ml tube;

[0154] (4) Centrifuge the tube at 400 g, 20 C. for 10 min;

[0155] (5) Transfer upper blood plasma into a new 50 ml centrifuge tube, inactivate the blood plasma at 56 C. for 30 min, centrifuge the tube at indoor temperature, 2000 g for 30 min, and take and put the supernatant into a 50 ml centrifuge tube for later use;

[0156] (6) Add D-PBS() into the tube until the volume of the solution in it reaches 50 ml, tighten up the cap, and overturn the tube for mixing the solution in it;

[0157] (7) Take 2 new 50 ml centrifuge tubes, and add 15 ml Ficoll into each of them;

[0158] (8) Carefully add 25 ml blood cell diluent into the Ficoll in each tube, and centrifuge the tubes at 800 g, 20 C. for 20 min;

[0159] (9) There are four layers of liquid in the centrifuge tubes, which from top to bottom are yellow blood plasma layer (recovered for later use), albuginea, water white Ficoll, red and black mixed cells;

[0160] (10) Carefully draw the albuginea into a new 50 ml centrifuge tube, add D-PBS() into the tube until the volume of the solution in it reaches 50 ml , overturn the tube for mixing the solution in it, and centrifuge the tube at 500 g, 20 C. for 10 min;

[0161] (11) Add 25 ml 5% human serum albumin, resuspend cells, and centrifuge the tube at 400 g, 20 C. for 10 min;

[0162] (12) Remove the supernatant, add 25 ml 5% human serum albumin, resuspend cells until they are precipitated, and count after getting them through the 70 um screen mesh; and

[0163] (13) Take a portion of cell suspension containing 1.2510.sup.8 cells for activation, centrifuge the remaining cell suspension at 400 g, 20 C. for 10 min, add CryoPremium into and freeze it.

2. CD4/CD8 Positive T Cell Sorting

[0164] (1) Count obtained PBMCs, add sorting buffer solution in the ratio of 80 ul/10.sup.7 cells, and resuspend cells until they are precipitated;

[0165] (2) Add CD4/CD8 magnetic beads in the ratio of 20 ul/10.sup.7 cells, and incubate the solution at 4 C. for 15 min after blowing and mixing it;

[0166] (3) Take magnetic beads out of the cell mixture, add sorting buffer solution into it in the ratio of 2 ml/10.sup.7cells, overturn and mix it, and centrifuge it at 250 g, 4 C. for 10 min;

[0167] (4) Add sorting buffer solution in the ratio of 500 ul/10.sup.8 cells, and resuspend cells until they are precipitated;

[0168] (5) Clamp the LS separation column onto the magnetic shelf with tweezers;

[0169] (6) Prepare 2 15 ml centrifuge tubes at the same time, and mark them CD4-/CD8-cell sap (tube A) and CD4+/CD8+ cell sap (tube B) respectively;

[0170] (7) Rinse LS with 3 ml separation buffer solution, and use tube A to collect the buffer solution;

[0171] (8) Add the cell-magnetic bead mixture, and then 3 ml buffer solution to wash the column three times (new liquid is added when there is no liquid residue), and collect obtained CD4/CD8-cells;

[0172] (9) Separate the LS separation column from the magnetic shelf, use tube B to collect cell suspension, add 5 ml buffer solution, wash the column together with the inner plunger thereof a little harder, collect CD4+/CD8+ cells, take samples from them and count the samples; and

[0173] (10) Resuspend cells until they are precipitated with AIM-V medium according to the cell density of 110.sup.6/ml -410.sup.6/ml, and add 210.sup.5110.sup.6U/L IFN- factors.

3. Activation of T Cells

[0174] (1) Add into a 24-pore plate one day in advance the 110.sup.3 ug/L110.sup.4 ug/L CD3 monoclonal antibody and 110.sup.3 ug/L110.sup.4 ug/L CD28 monoclonal antibody, seal it with sealing film, and coat it overnight at 4 C.; and

[0175] (2) Take out the coated T75 bottle, discard the coating buffer, and wash it with D-PBS() once; inject the cell suspension obtained by sorting into a T75 bottle, share it up, and put it in an incubator at 37 C., 5% CO.sub.2 for culture;

4. CAR Gene Transduction and OCTS-CAR-T Cell Induction Culture

[0176] (1) Cost 110.sup.3 ug/L110.sup.4 ug/L RetroNectin in a 24-pore plate one day in advance, seal it with sealing film, and coat it overnight at 4 C.; and

[0177] (2) Add lentiviral transgenic vectors lvOCTS-PEvIIIs and lvOCTS-PEvIIIt into the 24-pore plate according to 510.sup.5 cells for each pore and MOI=520 along with AIM-V medium containing 210.sup.5510.sup.5 U/L rIL-2, 510.sup.3ng/L110.sup.4 ng/L rIL-7, 510.sup.3 ng/L110.sup.4 ng/L rIL-15, 510.sup.3 ng/L110.sup.4 ng/L rIL-21 and 10% autoserum for continuous culture at 37 C., 5% CO.sub.2.

5. In-Vitro Expansion of OCTS-CAR-T Cells

[0178] (1) Add the same amount of AIM-V medium containing 210.sup.5-510.sup.5 U/L rIL-2, 510.sup.3 ng/L110.sup.4 ng/L rIL-7, 510.sup.3 ng/L110.sup.4 ng/L rIL-15, 510.sup.3 ng/L110.sup.4 ng/L rIL-21 and 10% autoserum every 2 days, keep PH within 6.57.5 and cell density within 510.sup.5210.sup.6/ml, and continue to culture it at 37 C., 5% CO.sub.2 for 10-14 days; and

[0179] (2) Use the frozen and cultured OCTS-CAR-T cells for subsequent detection on the 7.sup.th day or so.

Embodiment 2 OCTS-CAR-T Cell Pathogen Detection and Expression Detection

I. Endotoxin Determination

[0180] (1) The working standard of endotoxin was 15 EU per dose;

[0181] (2) Sensitivity of Tachypiens Amebocyte Lysate (TAL) =0.25 EU/ml, 0.5 ml/tube

[0182] (3) Dilution of endotoxin standard: take one endotoxin standard, dilute it into 4 and 2 solution with BET water, seal with sealing film and vortex for 15 min; During dilution, each dilution step should be mixed on the vertex mixer for 30 s;

[0183] (4) Adding samples: Several TAL were taken, each was dissolved in 0.5 ml of BET water, and then divided into several endotoxin-free tubes (0.1 ml each tube). Two of them were negative control which were added 0.1 ml of BET water to each of them;

[0184] Two tubes were used for positive control which were added 0.1 ml endotoxin working standard solution with concentration of 2 to each of them;

[0185] Two tubes were used for positive control of sample which were added 0.1 ml sample solution contained 2 endotoxin standard (1 ml of 20 dilution of sample to be tested+1 ml of solution contained 4 endotoxin standard=2 ml of 40 dilution of sample contained 2 endotoxin standard).

[0186] 0.1 ml sample was added into the sample tube at the dilution rate shown in Table 4 and with 371 C. water bath (or incubator) and heat preservation for 601min;

TABLE-US-00006 TABLE 4 Dilution ratio of endotoxin and corresponding endotoxin content Original Dilution Multiple Fluid 5 10 20 40 80 160 Corresponding 0.25 1.25 2.5 5 10 20 40 EU/ml Results

[0187] (5) According to the endotoxin detection results of OCTS-CAR-T cells (as shown in Table 5), the content of endotoxin in all cells was less than 2.5 EU/ml, meeting the standard in the Pharmacopoeia of the People's Republic of China, which is less than 10 EU/ml;

TABLE-US-00007 TABLE 5 Original Multiple Dilution Fluid 5 10 20 40 80 160 Corresponding 0.25 1.25 2.5 5 10 20 40 EU/ml OCTS-PEvIIIs-CAR- T (+) () () () () () () OCTS-PEvIIIt-CAR- T (+) (+) () () () () ()

II. Detection of Mycoplasma

[0188] (1) Three days before the experiment, the cell samples were cultured in antibiotic-free medium;

[0189] (2) 1 ml cell suspension (more than 1*105 cells) was collected and placed in a 1.5 ml centrifugal tube;

[0190] (3) Centrifuge at 13000 g for 1 min, collect sediment and discard culture medium;

[0191] (4) Add 500 ul PBS, blowing or whirlpool oscillation with the gun head, and resuspend sediment. Centrifuge for 5 min at 13000 g;

[0192] (5) Repeat step (4) once;

[0193] (6) Add 50 l Cell Lysis Buffer, blow and suck with gun-head, mix well, and incubate in water bath at 55 C. for 20 minutes;

[0194] (7) The samples were heated at 95 C. for 5 minutes;

[0195] (8) After centrifugation at 13000 g for 5 min, 5 l supernatant was used as template. The 25 l PCR reaction system was ddH20 6.5l, Myco Mix 1 l, 2x Taq Plus Mix Master (Dye Plus) 12.5 l and template 55 l. The cycle conditions of PCR were 95 C. 30 sec, (95 C. 30 sec, 56 C. 30 sec, 72 C. 30 sec)*30cycle and 72 C. 5 min; and

[0196] (9) According to the mycoplasma detection results (as shown in FIG. 8), the OCTS-CAR-T cells contained no mycoplasma.

III. OCTS Gene Transduction Efficiency Detection and Immunophenotyping Detection

[0197] (1) Collect T cells transduced by virus, resuspend cells with D-PBS() solution containing 1-4% human serum albumin, and adjust the ratio to 110.sup.6/ml;

[0198] (2) Add D-PBS() solution containing 14% human serum albumin into a centrifuge tube, mix it, centrifuge it at 350 g for 5 min, and discard the supernatant;

[0199] (3) Repeat step (2) once;

[0200] (4) Resuspend cells with 0.2 ml D-PBS() solution containing 14% human serum albumin, add into the centrifuge tube 1 ul 1 mg/ul protein L, 5 ul CD4-FITC and 5 ul CD8-APC, mix it, and incubate it at 4 C. for 45 min;

[0201] (5) Add into the centrifuge tube 1 ml D-PBS() solution containing 14% human serum albumin, mix it, centrifuge at 350 g for 5 min and discard the supernatant;

[0202] (6) Repeat step (5) twice;

[0203] (7) Resuspend cells with 0.2 ml D-PBS() solution containing 14% human serum albumin, add 0.2 ul PE-SA into the centrifuge tube, mix it, and incubate it at 37 C. in dark for 15 min;

[0204] (8) Add into the centrifuge tube 1 ml D-PBS() solution containing 14% human serum albumin, mix it, centrifuge at 350 g for 5 min and discard the supernatant;

[0205] (9) Resuspend cells with 1 ml D-PBS() solution until they are precipitated, centrifuge at 350 g for 5 min and discard the supernatant;

[0206] (10) Repeat step (9) twice;

[0207] (11) Resuspend cells with 0.4 ml D-PBS() solution until they are precipitated, and detect the cells with FACS; and

[0208] (12) According to the results of OCTS gene transduction efficiency detection and immunophenotyping detection shown in FIGS. 9A-9D, the efficiency of infection of most prepared OCTS-CAR-T cells were within 90% , and the ratio of CD4 positive cells to CD8 positive cells was within 1:33:1, meaning subsequent function detection can be carried out.

Embodiment 3 Functional Detection of OCTS-CAR-T Cell

I. Evaluation of Killing Effect on Target Cells

[0209] (1) Respectively culture target cells [PDL1.sup.+K562, EGFRvIII.sup.+K562, PDL1.sup.+EGFRvIII.sup.+K562, K562 cells] and effector cells [OCTS-CAR-T cells];

[0210] (2) Collect target cells 410.sup.5 cells and OCTS-CAR-T cells 2.810.sup.6 cells, centrifuge them at 800 g for 6 min, and discard the supernatant;

[0211] (3) Respectively resuspend target cells and effector cells with 1 ml D-PBS(), centrifuge them at 800 g for 6 min, and discard the supernatant;

[0212] (4) Repeat step (3) once;

[0213] (5) Resuspend effector cells with 700 ul medium (AIM-V medium+110% FBS), and target cells with 2 ml medium (AIM-V medium+110% FBS);

[0214] (6) Set up the experimental pores with the multiplicity of infection of 1:1, 5:1 and 10:1, and control groups (K562 cells) with 3 compound pores each. Grouping of co-incubation of effector cells respectively with single target cells and double target cells is shown in Table 6:

TABLE-US-00008 TABLE 6 Effector Cell Target Cell 1 Target Cell 2 Target Cell 3 OCTS-PEvIIIs-CAR-T PDL1.sup.+K562 EGFRvIIII.sup.+K562 PDL1.sup.+EGFRvIIII.sup.+K562 OCTS-PEvIIIt-CAR-T PDL1.sup.+K562 EGFRvIIII.sup.+K562 PDL1.sup.+EGFRvIIII.sup.+K562

[0215] (7) Plate centrifugation at 250 g for 5 min;

[0216] (8) Culture it in an incubator at 37 C., 5% CO2 for 4 hours;

[0217] (9) Plate centrifugation at 250 g for 5 min;

[0218] (10) Take 50 ul supernatant from each pore to a new 96-pore plate, and add 50 ul substrate solution to each pore (in dark);

[0219] (11) Incubate it in dark for 25 min;

[0220] (12) Add 50 ul stop buffer into each pore;

[0221] (13) Detect 490 nm absorbance with microplate reader;

[0222] (14) Average the three compound pores; reduce the light absorption value of all experimental pores, target cell pores and effector cell pores by the average light absorption value under the background of medium; reduce the maximum light absorption value of target cells by the average volume correction control light absorption value;

[0223] (15) Bring the corrected values obtained in step (14) into the following formula to calculate the percentage of cytotoxicity produced by each multiplicity of infection. According to the results shown in FIG. 10, OCTS-CAR-T cells have better killing effect on their own single target cells and double target cells, and the killing efficiency of CAR-T cells with Turn OCTS structure is lightly higher than that of CAR-T cells with Series OCTS structure;

Killing efficiency=(Experimental poreEffector cell poreTarget cell pore)/(Maximum target cell poreTarget cell pore)100%

[0224] (16) Such experimental results show that OCTS structure formed by modifying the antigen recognition domain in traditional CAR structure can significantly improve the scope of recognition and killing target cells of OCTS-CAR-T cells, and thus OCTS-CAR-T cells will play a huge role in future cellular therapy of malignant glioma and other EGFRvIII positive/PDL1positive/both EGFRvIII and PDL1 positive malignant tumors.