COMPOSITION FOR ATOPY OR PSORIASIS TREATMENT COMPRISING LIQUID TYPE PLASMA

20200179709 ยท 2020-06-11

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a composition for atopy or psoriasis treatment including a liquid type plasma. More particularly, provided is a method for producing a liquid type plasma for preventing or treating atopic dermatitis or psoriasis, a pharmaceutical composition for preventing or treating atopic dermatitis or psoriasis using a liquid type plasma produced according to the method, and a method for preventing or treating atopic dermatitis or psoriasis using the liquid type plasma.

    Claims

    1. A method of producing liquid type plasma for preventing or treating an allergic disease, the method comprising: (a) filling a plasma generator with a carrier gas; (b) supplying a voltage of 1 kV to 13 kV and a frequency of 15 kHz to 30 kHz to the plasma generator to generate plasma; and (c) treating a liquid material with the generated plasma.

    2. The method of claim 1, wherein, in process (a), the carrier gas comprises any one or more selected from the group consisting of nitrogen, helium, argon, and oxygen.

    3. The method of claim 1, wherein the treating of process (c) is performed at a distance of 0.1 cm to 15 cm from a surface of the liquid material for 5 minutes to 30 minutes.

    4. The method of claim 1, wherein the liquid material of process (c) is water, saline, a buffer, or a medium.

    5. The method of claim 1, wherein the allergic disease is allergic rhinitis, asthma, a food allergy, or atopic dermatitis.

    6.-9. (canceled)

    10. A method of preventing or treating an allergic disease, the method comprising administering the pharmaceutical composition for preventing or treating an allergic disease, the pharmaceutical composition comprising, as an active ingredient, liquid type plasma produced using the method of claim 1.

    11. The method of claim 10, wherein the allergic disease is allergic rhinitis, asthma, a food allergy, or atopic dermatitis.

    12. (canceled)

    13. (canceled)

    14. A method of producing liquid type plasma for preventing or treating a T lymphocyte-mediated skin disease, the method comprising: (a) filling a plasma generator with a carrier gas; (b) supplying a voltage of 5 kV to 20 kV and a frequency of 10 kHz to 30 kHz to the plasma generator to generate plasma; and (c) treating a liquid material with the generated plasma.

    15. The method of claim 14, wherein, in process (a), the carrier gas comprises any one or more selected from the group consisting of nitrogen, helium, argon, and oxygen.

    16. The method of claim 14, wherein the treating of process (c) is performed at a distance of 0.1 cm to 15 cm from a surface of the liquid material for 5 minutes to 120 minutes.

    17. The method of claim 14, wherein the liquid material of process (c) is water, saline, a buffer, or a medium.

    18. The method of claim 14, wherein the T lymphocyte-mediated skin disease comprises any one or more selected from the group consisting of systemic lupus erythematosus, cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis.

    19.-22. (canceled)

    23. A method of preventing or treating a T lymphocyte-mediated skin disease, the method including administering the pharmaceutical composition for preventing or treating a T lymphocyte-mediated skin disease, the pharmaceutical composition comprising, as an active ingredient, liquid type plasma produced using the method of claim 14.

    24. The method of claim 23, wherein the T lymphocyte-mediated skin disease comprises any one or more selected from the group consisting of systemic lupus erythematosus, cutaneous lupus erythematosus, scleroderma, psoriasis, dermatomyositis, and chronic dermatitis.

    25. (canceled)

    26. (canceled)

    Description

    DESCRIPTION OF DRAWINGS

    [0041] FIG. 1 is a graph showing H & E staining results of skin tissues of NC/Nga mice treated with an atopic dermatitis-inducing factor and/or plasma, according to an embodiment of the present invention.

    [0042] FIG. 2 is a graph showing toluidine blue staining results of skin tissues of NC/Nga mice treated with an atopic dermatitis-inducing factor and/or plasma, according to an embodiment of the present invention.

    [0043] FIG. 3 is a graph showing EPX staining results of skin tissues of NC/Nga mice treated with an atopic dermatitis-inducing factor and/or plasma, according to an embodiment of the present invention.

    [0044] FIG. 4 is a graph showing the results of confirming an expression amount of p-STAT6 in HaCaT cells stimulated with IL-4 and treated with liquid type plasma, according to an embodiment of the present invention.

    [0045] FIG. 5 is a graph showing the results of confirming an expression level of IL-6 in mast cells stimulated with PMA and A23187 and treated with liquid type plasma, according to an embodiment of the present invention.

    [0046] FIG. 6 is a graph showing the results of confirming an expression level of TNF- in mast cells stimulated with PMA and A23187 and treated with liquid type plasma, according to an embodiment of the present invention.

    [0047] FIG. 7 is a graph showing the results of confirming the inhibition of NF-kB activity in mast cells stimulated with PMA and A23187 and treated with liquid type plasma, according to an embodiment of the present invention.

    [0048] FIG. 8 illustrates a time frame for IMQ and/or NTP treatment to verify an effect of plasma on treating psoriasis, according to an embodiment of the present invention.

    [0049] FIG. 9 is a graph showing changes in stratum corneum formation of the skin of mice treated with IMQ and/or NTP, according to an embodiment of the present invention.

    [0050] FIG. 10 is a graph showing that an IMQ vehicle cream and/or nitrogen gas did not significantly affect the stratum corneum formation of mouse skin, according to an embodiment of the present invention.

    [0051] FIGS. 11A to 11E are graphs showing that NTP treatment did not significantly affect the inflammatory response factors of mouse skins, according to one embodiment of the present invention.

    [0052] FIGS. 12A to 12D are graphs showing changes in infiltration amounts of CD4+ T cells, CD11c+ cells, CD11b+ cells, and Gr-1+ cells by IMQ stimulation and NTP treatment, according to one embodiment of the present invention.

    [0053] FIGS. 13A to 13E are graphs showing changes in the expression amounts of inflammatory response factors (IL-6, IL-17, IL-22, CXCL1, and CCL20) by IMQ stimulation and NTP treatment, according to an embodiment of the present.

    [0054] FIG. 14 is a graph showing the degree of suppression of Th17 cell differentiation by IMQ stimulation and NTP treatment, according to an embodiment of the present invention.

    [0055] FIGS. 15A and 15B are schematic diagrams illustrating a comparison between a method of producing LTP and a method of producing NTP, according to an embodiment of the present invention.

    [0056] FIG. 16 is a graph showing a degree of inhibition of Th17 cell differentiation upon treatment with No LTP, LTP 30, or LTP 60, according to an embodiment of the present invention.

    [0057] FIG. 17 is a graph showing a degree of inhibition of Th1 cell differentiation upon treatment with No LTP, LTP 30, or LTP 60, according to an embodiment of the present invention.

    [0058] FIG. 18 is a graph showing the expression of CD80, CD86, and MHC II as a degree of inhibition of BMDC activity by LTP treatment, according to an embodiment of the present invention.

    [0059] FIGS. 19A to 19E are graphs showing decreases in the expression of inflammatory cytokines by LTP treatment in BMDC treated with TNF-, according to an embodiment of the present invention.

    [0060] FIGS. 20A to 20E are graphs showing decreases in the expression of inflammatory cytokines by LTP treatment in BMDC treated with lipopolysaccharides (LPS), according to an embodiment of the present invention.

    [0061] FIGS. 21A to 21E are graphs showing changes in gene expression of interleukins and cytokines by LTP treatment in HaCaT cells activated with TNF- and IFN-, according to an embodiment of the present invention.

    [0062] FIGS. 22A to 22G are graphs showing changes in gene expression of interleukins and cytokines by LTP treatment in LPS-stimulated HaCaT cells, according to an embodiment of the present invention.

    [0063] FIGS. 23A and 23B are graphs showing changes in STAT3 activation (pSTAT3) by LTP treatment in HaCaT cells stimulated with IL-6, according to an embodiment of the present invention.

    [0064] FIGS. 24A to 24C are graphs showing changes in PD-L1 expression by LTP treatment in HaCaT cells stimulated with TNF-, IFN-, or LPS, according to an embodiment of the present invention.

    BEST MODE

    [0065] To confirm the effect of liquid type plasma treatment on atopic dermatitis, western blotting was carried out using a human keratinocyte cell line (HaCaT) and mast cells to confirm protein expression amounts of p-STAT6 (Abcam) and STAT6 (Cell Signaling Technology). IL-4 is a hypersensitive activity factor and is known to promote allergic responses. As an experimental result, phosphorylation of a transcriptional activator (p-STAT6) was significantly reduced in the group treated with IL-4 and liquid type plasma (LTP) as compared with the group treated with IL-4 alone. This means that the liquid type plasma treatment can remarkably alleviate immune hypersensitivity reactions.

    [0066] In addition, to confirm an inflammatory inhibitory effect of liquid type plasma on psoriasis-like skin, it was examined whether liquid type plasma affected STAT3 activation in HaCaT cells. STAT3 activation is known to play an important role in Th17 cell differentiation and the onset of psoriasis. As an experimental result, it was confirmed that liquid type plasma treatment inhibited STAT3 activation (pSTAT3) in IL-6-stimulated HaCaT cells. These results suggest that liquid type plasma may inhibit the STAT3 signaling pathway and result in suppression of psoriasis in mice.

    MODE OF THE INVENTION

    [0067] Hereinafter, the present invention will be described in further detail with reference to the following examples. It will be obvious to those of ordinary skill in the art that these examples are provided only to more particularly describe the present invention and are not intended to limit the scope of the present invention in accordance with the essence of the present invention.

    Example 1. Confirmation of Treatment Effect of Liquid Type Plasma on Atopic Dermatitis

    Example 1-1. Confirmation of Plasma Treatment Effect on Atopic Dermatitis

    [0068] To confirm the effect of plasma treatment on atopic dermatitis, NC/Nga mice (6 weeks old, male, Orient Bio, Korea) were randomly selected and treated as shown in Table 1.

    TABLE-US-00001 TABLE 1 Group Remarks Negative control Non-treatment Positive control Treatment with biostir (Biostir only) Plasma control Treatment with plasma (NTP) (NTP only) Plasma experimental After treatment with Biostir, plasma (NTP) group is treated (Biostir + NTP)

    [0069] Specifically, the dorsal hairs of the mice were completely removed, 200 l of 4% SDS solution was applied to destroy the skin barrier, and biostir (house dust mite), which is an atopic dermatitis inducer, was treated every 4 days for a total of 3 weeks. For the plasma treatment group, plasma generated by maintaining a gas flow rate of 10 L/min, a voltage of 15 kVp-p, and a frequency of 15 kHz was irradiated using a plasma generator using nitrogen (N.sub.2) gas as a source of a non-thermal atmospheric pressure plasma.

    [0070] The skin tissue of each mouse was obtained after the last treatment day for histological analysis. The obtained dorsal skin tissue was fixed in 4% paraformaldehyde for 24 hours, paraffin-embedded and cut to a thickness of 4.5 m, and the morphology of the skin tissue was observed by hematoxylin and eosin (H & E) staining, the infiltration of mast cells into the skin tissue was examined by toluidine blue staining, and the influx of eosinophils into the tissue was observed by eosinophil peroxidase (EPX) antibody (Santa Cruz Biotechnology) staining. The results thereof were quantified and shown in FIGS. 1 to 3.

    [0071] As a result of the experiment, it was confirmed that the epidermal morphology was not significantly different in the plasma control as compared with the negative control, but, in the positive control, the epidermis became very thick and the influx of mast cell or eosinophils into the tissue was significantly increased. In contrast, it was confirmed that the thickness of the epidermis was significantly decreased in the plasma experimental group as compared to the positive control, and the influx of mast cells or eosinophils into the tissue was maintained at a low level as compared to that of the negative control. This means that the plasma treatment can remarkably alleviate the symptoms of atopic dermatitis.

    Example 1-2. Confirmation of Treatment Effect of Liquid Type Plasma on Atopic Dermatitis

    [0072] To confirm the treatment effect of liquid type plasma on atopic dermatitis, experiments were conducted using a human keratinocyte cell line (HaCaT) and mast cells. HaCaT cells were obtained from the Korean Cell Line Bank and mast cells were obtained by culturing bone marrow cells of C57BL/6 mice in an RPMI 1640 medium supplemented with mIL-3 (10 ng/ml) and mSCF (50 ng/ml) at 37 C. and 5% CO.sub.2 for 8 weeks, and then selecting the degree of differentiation of the cells by flow cytometry. Liquid type plasma was produced by irradiating a culture medium (RPMI 1640 or DMEM) with the plasma generated under the conditions of Example 1-1, for 60 seconds per ml.

    [0073] First, the HaCaT cells were cultured after medium exchange with the culture medium treated with the liquid type plasma, and after 1 hour of culturing, the HaCaT cells were stimulated with 30 ng/ml of interleukin-4 (IL-4), the cells were obtained after 15 minutes, and protein expression amounts of p-STAT6 (Abcam) and STAT6 (Cell Signaling Technology) were confirmed by western blotting. IL-4 is a hypersensitive activity factor and is known to promote inflammatory cytokines. As an experimental result, phosphorylation of a transcriptional activator (p-STAT6) was significantly reduced in the group treated with IL-4 and liquid type plasma (LTP), as compared with the group treated only with IL-4. This means that the liquid type plasma treatment can remarkably alleviate immune hypersensitivity reactions. The results thereof are shown in FIG. 4.

    [0074] Next, after pre-treatment with liquid type plasma for 1 hour, the mast cells were stimulated with 50 nM protease kinase C activator (PMA) capable of activating mast cells and 1 mM calcimycin (A23187), and further incubated for 6 hours, and qPCR was used to confirm the gene expression amounts of interleukin-6 (IL-6) and TNF-. The qPCR was carried out by the same method as that used in Example 1-1. As a result of the experiment, both IL-6 and TNF- showed a significant decrease in gene expression amount in the group treated with the inflammatory inducers and the liquid type plasma (LTP), as compared with the group treated only with PMA/A23187. The results thereof are shown in FIGS. 5 and 6.

    [0075] Lastly, the mast cells were pre-treated with a culture medium treated with liquid type plasma for 1 hour, and then stimulated with a mast cell activating factor in the same manner as described above, and then further cultured for 30 minutes, and the activity of NF-kB was confirmed by western blotting. As a result of the experiment, the phosphorylation of NF-kB (p-NF-kB) was significantly reduced in the group treated with the inflammatory inducers and the liquid type plasma (LTP), as compared to the group treated only with the inflammatory inducers. The results thereof are shown in FIG. 7.

    Example 1-3. Comparison Between Effects of Plasma Direct Treatment and Liquid Type Plasma Treatment on Atopic Dermatitis

    [0076] The effect of the liquid type plasma of the present invention on cells was compared with that of plasma direct treatment on cells. The plasma direct treatment was performed using the same plasma generator as that used in the production of the liquid type plasma, wherein plasma was generated under the same conditions, and a culture dish where epidermal cells were cultured was directly exposed to plasma.

    [0077] As a result of comparing the cells directly treated with the liquid type plasma or plasma, it was analyzed that surfaces of the cells directly treated with plasma were dried. When considering that moisturizing is very important in atopy, it is determined that the usefulness of liquid type plasma that may be provided in the form of a liquid material such as a moisturizing agent is significant.

    Example 2. Confirmation of Psoriasis Treatment Effect of Liquid Type Plasma

    Example 2-1. Confirmation of Psoriasis Treatment Effect of Non-Thermal Atmospheric Pressure Plasma (NTP)

    Example 2-1-1. Psoriasis Treatment Effect of Non-Thermal Atmospheric Pressure Plasma (NTP) in Animal Model

    [0078] To verify the therapeutic effect of non-thermal plasma on psoriasis treatment, an animal model with psoriasis induced by applying imiquimod (IMQ) on the dorsal skin of each of hair-removed C57/BL6 mice was used. The dorsal hairs of 8-week-old C57/BL6 mice were removed, and then 62.5 mg/day of an IMQ cream (Sigma, U.S.A.) was applied on each mouse to induce psoriasis-like skin, and on day 3 and day 4, each mouse was treated with non-thermal plasma for 60 seconds at a distance of 2 cm from the epidermis of each mouse, using a plasma generator supplied with a voltage of 15 kV and a frequency of 15 kHz and using nitrogen gas as a carrier gas, and the mice were then sacrificed on day 5, followed by analysis of the skin tissue by immunohistochemical staining. A time frame for the imiquimod and plasma treatment is illustrated in FIG. 8.

    [0079] Experimental results showed that the thickness of the stratum corneum was significantly increased in IMQ-treated mice, but the mice treated with IMQ and NTP showed a 50% or more reduction in the thickness of the stratum corneum, as compared to the IMQ-treated mice. The results thereof are illustrated in FIG. 9. An experiment proving that the above result is an effect of plasma is shown in FIG. 10. Plasma treatment on normal mouse skin did not affect skin tissue, and mice treated with only a vehicle cream of IMQ or mice treated with the vehicle cream and nitrogen gas did not develop skin inflammation. In addition, the result that plasma treatment did not induce side effects in normal skin tissue was confirmed by a comparison in expression amount between various inflammatory response factors (IL-6, IL-17, IL-22, CXCL1, and CCL20). The results thereof are illustrated in FIGS. 11A to 11E.

    Example 2-1-2. Inhibition of Immune Cell Infiltration in Animal Model by Non-Thermal Atmospheric Pressure Plasma (NTP)

    [0080] To confirm whether non-thermal plasma can inhibit immune cell infiltration in psoriasis-like skin inflammation induced by IMQ, single cell suspensions of the skin of mice were analyzed by flow cytometry (FACS), and the results thereof are shown in FIGS. 12A to 12D. The experimental results showed that the infiltration of CD4+ T cells, CD11c+ cells, CD11b+ cells, and Gr-1+ cells was increased in IMQ-treated mouse skin, and immunocytic infiltration was suppressed in IMQ- and plasma-treated skin.

    [0081] In addition, the expression amounts of the inflammatory response factors (IL-6, IL-17, IL-22, CXCL1, and CCL20) were also compared, and the results thereof are illustrated in FIGS. 13A to 13E. From the results of Example 2-1-1, it was confirmed that the plasma treatment on normal skin did not cause inflammatory reaction factor changes. However, as a result of the experiment, the expression of cytokines and chemokines increased more than two fold in the IMQ-treated skin as compared to the negative control or the group treated only with plasma, whereas the expression of cytokines and chemokines was significantly reduced in the IMQ- and plasma-treated skin.

    [0082] From the results of FIGS. 12 and 13, it can be seen that the non-thermal plasma treatment can effectively alleviate psoriasis-like skin inflammation through inhibition of the gene expression of inflammatory cytokines and chemokines.

    Example 2-1-3. Inhibition of Th17 Cell Differentiation in Animal Model by Non-Thermal Atmospheric Pressure Plasma (NTP)

    [0083] It was observed whether the non-thermal plasma according to the present invention inhibited the differentiation of Th17 cells induced by IMQ in drainage lymph nodes of C57/BL6 mice. Th17 cells are known to be important for the pathogenesis of psoriasis. The degree of differentiation of Th17 cells was analyzed by flow cytometry (FACS) in the same manner as in Example 2-1-1.

    [0084] The experimental results showed that, when mice were treated with IMQ, the number of Th17 cells was increased in drainage lymph nodes, but this was effectively inhibited by plasma treatment. The result thereof is shown in FIG. 14.

    Example 2-2. Confirmation of Effect of Liquid Type Plasma (LTP) on Psoriasis Treatment

    Example 2-2-1. Production of Liquid Type Plasma (LTP)

    [0085] Liquid type plasma was produced by irradiating a culture medium (RPMI 1640 or DMEM) with the plasma generated under the conditions of Example 2-1-1 for 0 second (No LTP), 30 seconds (LTP 30), or 60 seconds (LTP 60), per ml. Schematic diagrams of treatment with non-thermal atmospheric pressure plasma (NTP) and liquid type plasma (LTP) of Example 2-1 are illustrated in FIGS. 15A and 15B.

    Example 2-2-2. Inhibition of Th17 Cell Differentiation by Liquid Type Plasma (LTP)

    [0086] To observe whether the differentiation of Th17 cells was inhibited by liquid type plasma as in the non-thermal atmospheric pressure plasma of Example 2-1, CD4+ T cells of normal C57/BL6 mice were isolated and the isolated cells were differentiated into Th17 cells in an RPMI1640 culture solution including 10 ng/ml of anti-CD3, 5 ng/ml of anti-CD28, 10 ng/ml of IL-6, 5 ng/ml of TGF-, an IFN- antibody, and an IL-4 antibody. At this time, No LTP, LTP 30, or LTP 60 was used as the culture solution. The degree of differentiation of Th17 cells in each culture solution was observed through flow cytometry (FACS), and the results thereof are shown in FIG. 16. As a result of the experiment, it was confirmed that, while the differentiation of IL-17-expressing Th17 was exhibited in the culture solution not treated with plasma (No LTP), the differentiation of Th17 was significantly inhibited in the culture solutions treated with plasma (LTP30 and LTP60).

    Example 2-2-3. Effect of Liquid Type Plasma (LTP) on Inhibiting the Differentiation of Th1 Cells

    [0087] To observe whether the differentiation of Th1 cells was inhibited by liquid type plasma, the CD4+ T cells isolated from mice in Example 2-2-2 were differentiated into Th1 cells in an RPMI1640 culture solution containing 10 ng/ml of anti-CD3, 5 ng/ml of anti-CD28, and 10 ng/ml of IL-12. At this time, No LTP, LTP 30, or LTP 60 was used as the culture solution. The degree of differentiation of Th1 cells in each culture solution was observed through flow cytometry (FACS), and the results thereof are shown in FIG. 17. As a result of the experiment, Th1 cell differentiation was induced in the culture solution not treated with plasma (No LTP), but the Th1 cell differentiation was significantly inhibited in the culture solutions treated with plasma, i.e., LTP 30 and LTP 60. In particular, it was confirmed that almost no differentiation into Th1 cells occurred in the culture solution LTP 60.

    Example 2-2-4. Effect of Liquid Type Plasma (LTP) on Inhibition of BMDC Cell Activity

    [0088] To observe whether the activity of bone marrow-derived dendritic cells (BMDCs) was inhibited by the liquid type plasma according to the present invention, bone marrow cells of normal C57/BL6 mice were isolated, and the isolated bone marrow cells were activated with TNF- (20 g/ml) in the same culture solution as that of Example 2-2-2, and then the expression of CD80 and CD86, which are activation marker factors of dendritic cells, and MHC II was measured. TNF- is known to be involved in the pathogenesis of psoriasis. As a result of the experiment, TNF- stimulation enhanced the expression of CD80, CD86, and MHCII in BMDCs, while the expression of CD80, CD86, and MHC II and TNF- production were significantly reduced in the culture solutions treated with plasma, i.e., LTP 30 and LTP 60. The results thereof are shown in FIG. 18.

    [0089] In addition, the expression of inflammatory cytokines was confirmed in BMDCs treated with TNF- or lipopolysaccharides (LPS). Among the interleukins and cytokines used in the present invention, primer sets of mouse IL-6, IL-17, TNF-, CXCL1, CCL20, PD-L1, and GAPDH were purchased and used (Qiagen, Hilden, Germany), and primer sets of human IL-1, IL-8, IL-10, IFN-, and TGF-1 were synthesized to have sequences listed in Table 2 below. GAPDH was used as a negative control.

    TABLE-US-00002 TABLE2 hIL-1 Forward 5ACAGATGAAGTGCTCCTTCCA3 Reverse 5GTCGGAGATTCGTAGCTGGAT3 hIL-8 Forward 5ATGACTTCCAAGCTGGCCGTGGCT3 Reverse 5TCTCAGCCCTCTTCAAAAACTTCT3 hIL-10 Forward 5CATCGATTTCTTCCCTGTGAA3 Reverse 5TCTTGGAGCTTATTAAAGGCATTC3 hIFN- Forward 5CTAATTATTCGGTAACTGACTTGA3 Reverse 5ACAGTTCAGCCATCACTTGGA3 hTGF-1 Forward 5CCCAGCATCTGCAAAGCTC3 Reverse 5GTCAATGTACAGCTGCCGCA3

    [0090] The experimental results showed that the expression of inflammatory cytokines was increased in BMDCs treated with TNF- or lipopolysaccharides (LPS), and the expression of inflammatory cytokines was decreased by liquid type plasma. These results suggest that plasma may negatively regulate DC activation that inhibits the activation and differentiation of T cells. The results thereof are shown in FIGS. 19A to 19E and FIGS. 20A to 20E.

    Example 2-2-5. Anti-Inflammatory Effect of Liquid Type Plasma (LTP) on Activated HaCaT (Epithelial Cell) Cell

    [0091] To confirm the anti-inflammatory effect of liquid type plasma on psoriasis-like skin, the expression of inflammatory factors in HaCaT cells was analyzed. To this end, first, HaCaT cells were activated with TNF- and IFN-, treated with liquid type plasma, and gene expression of cytokines involved in psoriasis was measured by real-time PCR. The results thereof are shown in FIGS. 21A to 21E. The experimental results showed that liquid type plasma had an anti-inflammatory effect on HaCaT cells stimulated by TNF- and IFN-.

    [0092] The effect of liquid type plasma on the gene expression of IL-1, IL-6, IL-8, IL-10, IFN-, TGF-1, and VEGFA in LPS-stimulated HaCaT cells was also confirmed. The experimental results showed that expression amounts of IL-1, IL-6, IL-8, and IFN- increased by LPS stimulation were reduced by treatment with liquid type plasma, expression amounts of IL-10 and VEGFA were further increased by treatment with liquid type plasma, and the case of TGF-1 did not show any significant change. The results thereof are shown in FIGS. 22A to 22G.

    [0093] In addition, it was confirmed whether liquid type plasma affected STAT3 activation in HaCaT cells. STAT3 activation is known to play an important role in Th17 cell differentiation and psoriasis pathogenesis. The results thereof are shown in FIGS. 23A and 23B. The experimental results showed that liquid type plasma treatment inhibited STAT3 activation (pSTAT3) in IL-6 stimulated HaCaT cells. These results suggest that liquid type plasma may induce the inhibition of psoriasis in mice by inhibiting the STAT3 signaling pathway.

    Example 2-2-6. Confirmation of Increase in PD-L1 Expression in Activated HaCaT and BMDC Cells by Liquid Type Plasma (LTP)

    [0094] It was confirmed whether the expression of PD-L1 was increased in HaCaT and BMDC cells activated by the liquid type plasma according to the present invention, and the results thereof are shown in FIGS. 24A to 24C. It has been reported that PD-L1 expression in DC inhibits T cell activation through PD-1/PD-L1 binding. Thus, it has been proposed that overexpression or high expression of PD-L1 can induce T cell inactivation and help in the treatment of autoimmune diseases in which CD4+ T cells are abnormally activated. Recently, it has been reported that administration of recombinant PD-L1 has improved skin inflammation induced by IMQ in mice.

    [0095] The experimental results showed that liquid type plasma treatment induces PD-L1 expression in HaCaT cells. In addition, the level of PD-L1 RNA was increased in TNF-/IFN--stimulated or LPS-stimulated HaCaT cells, and liquid type plasma treatment in stimulated cells further enhanced PD-L1 expression. These results suggest that liquid type plasma treatment may alleviate psoriasis-like skin inflammation through modulation of PD-L1 gene expression.

    Examples 2-3. Comparison Between Psoriasis Treatment Effects of Non-Thermal Atmospheric Pressure Plasma (NTP) and Liquid Type Plasma (LTP)

    [0096] The effect of the liquid type plasma of the present invention on cells was compared with that of plasma direct treatment on cells. The plasma direct treatment was performed using the same plasma generator as that used in the production of the liquid type plasma, wherein plasma was generated under the same conditions, and a culture dish where the TNF-/IFN--stimulated HaCaT cells were cultured was directly exposed to plasma.

    [0097] As a result of comparing the cells directly treated with the liquid type plasma or plasma, it was analyzed that surfaces of the cells directly treated with plasma were dried. When considering that moisturizing is very important in atopy, it is determined that the usefulness of liquid type plasma that may be provided in the form of a liquid material such as a moisturizing agent is significant.

    [0098] From the results of Example 1, it can be seen that the liquid type plasma of the present invention is remarkably effective in alleviating the symptoms of atopic dermatitis. From the results of Example 2, it can be seen that the liquid type plasma of the present invention is remarkably effective in preventing and treating skin inflammatory diseases including psoriasis.

    INDUSTRIAL APPLICABILITY

    [0099] Liquid type plasma of the present invention has a significant effect of inhibiting immune hypersensitivity reactions and has an effect of inhibiting the induction and progress of psoriasis, and thus is expected to be greatly utilized in preventing and treating immune hypersensitivity reactions including atopic dermatitis or psoriasis.