Microorganism with enhanced L-lysine producibility and method for producing L-lysine using the same

10676512 ยท 2020-06-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure relates to a novel modified RNA polymerase sigma factor A (SigA) polypeptide; a polynucleotide encoding the same; a microorganism containing the polypeptide; and a method for producing L-lysine using the microorganism.

Claims

1. A modified polypeptide having RNA polymerase sigma factor A activity and the amino acid sequence set forth in SEQ ID NO: 2 but with one or two amino acid substitutions, wherein at least one of the one or two amino acid substitutions is selected from the group consisting of a substitution of the 136.sup.th amino acid with glycine; a substitution of the 254.sup.th amino acid with asparagine; a substitution of the 268.sup.th amino acid with serine; a substitution of the 281.sup.st amino acid with serine; a substitution of the 381.sup.st amino acid with arginine; a substitution of the 429.sup.th amino acid with arginine; a substitution of the 447.sup.th amino acid with histidine; a substitution of the 451.sup.st amino acid with isoleucine; a substitution of the 455.sup.th amino acid with valine; a substitution of the 479.sup.th amino acid with arginine; a substitution of the 483.sup.rd amino acid with arginine; a substitution of the 488.sup.th amino acid with threonine; and a substitution of the 491.sup.st amino acid with arginine.

2. The modified polypeptide according to claim 1, wherein the modified polypeptide has an amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOS: 12 to 22.

3. A polynucleotide encoding the modified polypeptide of claim 1.

4. A host cell comprising the polynucleotide of claim 3.

5. A microorganism of the genus Corynebacterium having enhanced L-lysine producibility, comprising a modified polypeptide having RNA polymerase sigma factor A activity and the amino acid sequence set forth in SEQ ID NO: 2 but with one or two substitutions in SEQ ID NO:2, wherein at least one of the one or two substitutions is selected from the group consisting of a substitution of the 136.sup.th amino acid with glycine; a substitution of the 254.sup.th amino acid with asparagine; a substitution of the 268.sup.th amino acid with serine; a substitution of the 281.sup.st amino acid with serine; a substitution of the 381.sup.st amino acid with arginine; a substitution of the 429.sup.th amino acid with arginine; a substitution of the 447.sup.th amino acid with histidine; a substitution of the 451.sup.st amino acid with isoleucine; a substitution of the 455.sup.th amino acid with valine; a substitution of the 479.sup.th amino acid with arginine; a substitution of the 483.sup.rd amino acid with arginine; a substitution of the 488.sup.th amino acid with threonine; and a substitution of the 491.sup.st amino acid with arginine.

6. The microorganism according to claim 5, wherein the microorganism is Corynebacterium glutamicum.

7. A method for producing L-lysine, comprising: (a) culturing the microorganism according to claim 5 in a medium; and (b) recovering L-lysine from the cultured microorganism or the cultured medium.

Description

BEST MODE

(1) To achieve the above objects, in an aspect, the present disclosure provides a modified polypeptide having a novel RNA polymerase sigma factor A activity.

(2) As used herein, the term RNA polymerase sigma factor A (SigA) refers to a transcription initiation factor which acts along with RNA polymerase, and it is a protein (SigA) corresponding to one of the sigma factors. Sigma factors are involved in the regulation of transcription by interacting with upstream DNA (an UP element), which is present upstream of a particular promoter, and various transcription factors. In particular, SigA is known as a major regulator controlling most of the core genes. Information on the SigA protein can be obtained from a known database such as NCBI GenBank, e.g., a protein having the Accession No. of NP_601117. Specifically, the SigA protein may include the amino acid sequence of SEQ ID NO: 2, but the sequence is not limited thereto as long as the protein has the same activity as that of the SigA of the present disclosure.

(3) As used herein, the term a modified polypeptide refers to a polypeptide in which a part or the entirety of the amino acid sequence of a wild-type polypeptide is substituted. In the present disclosure, the modified polypeptide refers to a polypeptide having the RNA polymerase sigma factor A (SigA) activity, in which a part of the amino acid sequence of the polypeptide having the RNA polymerase sigma factor A (SigA) is substituted, thus having an amino acid sequence different from that of the wild-type amino acid sequence. That is, the present disclosure suggests a SigA-modified polypeptide, which contributes to L-lysine producibility, instead of wild-type SigA polypeptide.

(4) Specifically, the modified polypeptide may be a polypeptide having an RNA polymerase sigma factor A activity, in which at least one amino acid selected from the group consisting of the amino acids at the following positions of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid:

(5) the 136.sup.th amino acid; the 254.sup.th amino acid; the 268.sup.th amino acid; the 281.sup.st amino acid; the 381.sup.st amino acid; the 429.sup.th amino acid; and the 445.sup.th to 495.sup.th amino acids, relative to the initiating methionine designated as the first amino acid.

(6) That is, the modified polypeptide may be a polypeptide in which at least one position among the 57 amino acid positions for modification (the 136.sup.th, the 254.sup.th, the 268.sup.th, the 281.sup.st, the 381.sup.st, the 429.sup.th, and the 445.sup.th to 495.sup.th) is substituted with another amino acid.

(7) More specifically, among the 445.sup.th to 495.sup.th amino acids, at least one amino acid selected from the group consisting of the 447.sup.th amino acid, the 451.sup.st amino acid, the 455.sup.th amino acid, the 479.sup.th amino acid, the 483.sup.rd amino acid, the 488.sup.th amino acid, and the 491.sup.st amino acid may be substituted with another amino acid, but is not limited thereto.

(8) Specifically, the amino acid substitution may be a combination of at least one of the following amino acid substitutions:

(9) a substitution of the 136.sup.th amino acid with glycine (D136G); a substitution of the 254.sup.th amino acid with asparagine (I254N); a substitution of the 268.sup.th amino acid with serine (A268S); a substitution of the 281.sup.st amino acid with serine (T281S); a substitution of the 381.sup.st amino acid with arginine (L381R); a substitution of the 429.sup.th amino acid with arginine (Q429R); a substitution of the 447.sup.th amino acid with histidine (L447H); a substitution of the 451.sup.st amino acid with isoleucine (L451I); a substitution of the 455.sup.th amino acid with valine (M455V); a substitution of the 479.sup.th amino acid with arginine (K479R); a substitution of the 483.sup.th amino acid with arginine (K483R); a substitution of the 488.sup.th amino acid with threonine (S488T); and a substitution of the 491.sup.st amino acid with arginine (Q491R), relative to the initiating methionine.

(10) More specifically, the polypeptide may be a modified polypeptide, in which the 136.sup.th amino acid and the 281.sup.st amino acid are substituted with glycine and serine, respectively (D136G, T281S); the 254.sup.th amino acid with asparagine (I254N); the 268.sup.th amino acid with serine (A268S); the 381.sup.st amino acid with arginine (L381R); the 429.sup.th amino acid with arginine (Q429R); the 447.sup.th amino acid with histidine (L447H); the 451.sup.st and 491.sup.st amino acids with isoleucine and arginine, respectively (L451I, Q491R); the 455.sup.th amino acid with valine (M455V); the 479.sup.th amino acid with arginine (K479R); the 483.sup.rd amino acid with arginine (K483R); and the 488.sup.th amino acid with threonine (S488T); relative to the initiating methionine of a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, or at least one kind among the 11 amino acid substitutions above is combined.

(11) According to an exemplary embodiment of the present disclosure, the modified polypeptide may be a polypeptide having at least one amino acid sequence among the amino acid sequences of SEQ ID NOS: 12 to 22.

(12) The modified polypeptide of the present disclosure includes without limitation not only the amino acid sequences represented by SEQ ID NOS: 12 to 22 but also the amino acid sequences having a homology of 70% or higher, specifically 80% or higher, more specifically 90% or higher, and even more specifically 99%, to the above amino acid sequences, in which the proteins have contributed to the improvement of L-lysine producibility compared to that of the wild-type SigA protein. It is obvious that any amino acid sequence having a biological activity substantially the same as or corresponding to the protein having the amino acid sequence of the modified SigA protein, in addition to the above sequence homology, should also belong to the scope of the present disclosure, although the amino acid may have deletion, modification, substitution, or addition in part of the sequence.

(13) As used herein, the term homology refers to a degree of identity between two different sequences of nucleotides or amino acid residues in a particular comparison region of the nucleotide or amino acid sequences of a gene encoding a protein, after aligning both sequences to a maximal match. When the homology is sufficiently high, the expression products of the corresponding gene may have the same or similar activity. The homology may be determined using a sequence comparison program known in the art, e.g., BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign (DNASTAR Inc.), etc.

(14) Another aspect of the present disclosure includes a polynucleotide encoding the modified polypeptide or a vector including the polynucleotide.

(15) As used herein, the term polynucleotide refers to a polymer of nucleotides chain-extended lengthwise by a covalent bond of nucleotide units, i.e., a DNA or RNA strand having at least a certain length, and more specifically, it refers to a polynucleotide fragment encoding the modified polypeptide.

(16) In the present disclosure, the gene encoding the amino acid sequence of the RNA polymerase sigma factor A (SigA) is rpoD gene, and specifically, a gene derived from Corynebacterium glutamicum. Based on codon degeneracy, nucleotide sequences encoding the same amino acid and variants thereof belong to the scope of the present disclosure, and specifically, they may be represented by SEQ ID NO: 1, but are not limited thereto.

(17) Additionally, with respect to the modified polypeptide, nucleotide sequences encoding the same amino acid and variants thereof belong to the scope of the present disclosure based on codon degeneracy. Specifically, any nucleotide sequence encoding any of the amino acid sequences 12 to 22 and variants thereof may be included, but are not limited thereto.

(18) Still another aspect of the present disclosure provides a host cell including a polynucleotide encoding the modified polypeptide, and a microorganism transformed with a vector including the polynucleotide encoding the modified polypeptide. Specifically, the introduction may be achieved by transformation, but is not limited thereto.

(19) Specifically, the microorganism including the SigA-modified polypeptide can improve the ability to produce L-lysine without inhibiting the growth of a host cell and thus can obtain L-lysine in high yield compared to the microorganism including the wild-type SigA polypeptide.

(20) As used herein, the term vector refers to any carrier for cloning and/or transferring nucleotides into a host cell. A vector may be a replicon to allow for the replication of a fragment combined with another DNA fragment. The term replicon refers to any genetic unit acting as a self-replicating unit for in vivo DNA replication, i.e., random genetic units replicable by self-regulation (e.g., plasmids, phages, cosmids, chromosomes, and viruses). As used herein, the term vector may include viral and non-viral carriers for introducing nucleotides into a host cell in vitro, ex vivo, or in vivo, and it may also include a mini-spherical DNA. For example, the vector may be a plasmid without a bacterial DNA sequence. Additionally, the vector may include transposons (Annu Rev Genet. 2003; 37: 3-29) or artificial chromosomes. Specifically, the vector may include pACYC177, pACYC184, pCL1920, pECCG117, pUC19, pBR322, pDZ, and pMW118 vectors, but is not limited thereto.

(21) As used herein, the term transformation refers to a process of introducing a gene into a host cell, thereby enabling the expression of the gene in the host cell. The transformed gene can include without limitation both a gene inserted into the chromosome of a host cell and a gene located outside the chromosome, as long as they can be expressed in the host cell.

(22) Additionally, the gene may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct including all essential elements required for self-expression. The expression cassette may conventionally include a promoter operably connected to the gene, a transcription termination signal, a ribosome-binding domain, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. Additionally, the polynucleotide may be introduced into a host cell as it is or in the form of a polynucleotide construct, and may be operably connected to a sequence essential for its expression in the host cell, but is not limited thereto.

(23) The host cell or microorganism may be any host cell or microorganism which includes a polynucleotide encoding a modified polypeptide, or which is transformed with a vector including a polynucleotide encoding a modified polypeptide, thus being able to express the modified polypeptide, and for the purpose of the present disclosure, the host cell or microorganism may be any host cell or microorganism that can produce L-lysine by including the SigA-modified polypeptide. Specific examples of the microorganism may include microbial strains belonging to the genus Escherichia, the genus Serratia, the genus Erwinia, the genus Enterobacteria, the genus Salmonella, the genus Streptomyces, the genus Pseudomonas, the genus Brevibacterium, the genus Corynebacterium, etc., and specifically, a microorganism belonging to the genus Corynebacterium, and more specifically, Corynebacterium glutamicum, but is not limited thereto.

(24) In an exemplary embodiment of the present disclosure, various strains of Corynebacterium glutamicum having L-lysine producibility (KCCM11016P, KFCC10750, KCCM10770P, and CJ3P) were introduced with a modified polypeptide which includes any one amino acid sequence selected from the amino acid sequences of SEQ ID NO: 12 to 22, and their L-lysine productivities were compared. As a result, it was confirmed that all strains introduced with the modified polypeptide showed a higher amount of L-lysine production compared to the strain including the wild-type SigA polypeptide (Examples 7 to 10 and Tables 8 to 11). These results suggest that the microorganism including the modified polypeptide of the present disclosure is a strain with enhanced L-lysine producibility and the microorganism provides an economic advantage of obtaining L-lysine in high yield by culturing the microorganism.

(25) As such, the present inventors designated the strain with enhanced L-lysine producibility, KCCM1016P::SigA(L447H), as Corynebacterium glutamicum CA01-2277 and deposited it with the Korean Culture Center of Microorganisms, recognized as an international depositary authority under the Budapest Treaty, on Nov. 22, 2013, under the Accession Number KCCM11479P.

(26) Still another aspect of the present disclosure provides a method for producing L-lysine, including culturing the microorganism of the genus Corynebacterium described above and recovering L-lysine from the cultured microorganism or the cultured medium.

(27) As used herein, the term culture refers to growing a microorganism under appropriately and artificially controlled environmental conditions. The culture process of the present disclosure may be performed based on appropriate culture medium and culture conditions known in the art. Specific conditions, such as culture temperature, culture time, pH of culture medium, etc., may be determined by general knowledge by one of ordinary skill in the art or the conventional method known in the art, and appropriately adjusted accordingly. Specifically, these known culture methods are described in references in detail [Chmiel; Bioprozesstechnik 1. Einfuhrung indie Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991), and Storhas; Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)]. Additionally, the culture methods may include batch culture, continuous culture, and fed-batch culture, and specifically, the culture may be performed continuously in a fed batch or repeated fed batch process, but is not limited thereto.

(28) The medium used in the culture must appropriately satisfy the requirements for specific strains. Examples of the carbon sources to be used in the medium may include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid, but are not limited thereto. These carbon sources may be used alone or in combination, but are not limited thereto. Examples of the nitrogen sources to be used in the medium may include peptone, yeast extract, meat gravy, malt extract, corn steep liquor, soybean flour, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. These nitrogen sources may also be used alone or in combination, but are not limited thereto. Examples of the phosphorus sources to be used in the medium may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, corresponding sodium-containing salts, etc., but are not limited thereto. Additionally, metal salts such as magnesium sulfate or iron sulfate required for growth may be contained in the medium. Lastly, essential materials for growth, such as amino acids and vitamins, may also be contained in addition to the materials described above. Additionally, precursors suitable for a culture medium may be used. These sources may be added to a culture in an appropriate manner during the culture by batch culture or continuous culture, but the methods are not limited thereto.

(29) Additionally, the pH of a culture may be adjusted during the cultivation by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the culture in an appropriate manner. During the cultivation, an antifoaming agent, such as fatty acid polyglycol ester, may be added to prevent foam generation. Additionally, oxygen or an oxygen-containing gas may be injected into the culture in order to maintain an aerobic state of the culture; or nitrogen, hydrogen, or carbon dioxide gas may be injected without the injection of a gas in order to maintain an anaerobic or microaerobic state of the culture. The culture temperature may generally be in a range from 27 C. to 37 C., and specifically, from 30 C. to 35 C. The cultivation may be continued until the desired amount of useful materials is obtained, and specifically for from 10 hours to 100 hours. L-lysine may be released into the culture medium being cultured or may be contained in microorganisms.

(30) Additionally, regarding the method of producing L-lysine of the present disclosure, the method of recovering L-lysine from a cultured microorganism or a culture is widely known in the art. The methods of recovering L-lysine may include filtration, anion exchange chromatography, crystallization, HPLC, etc., but are not limited thereto.

DETAILED DESCRIPTION OF THE DISCLOSURE

(31) Hereinafter, the present disclosure will be described in more detail with reference to the following Examples. However, these Examples are for illustrative purposes only, and the disclosure is not intended to be limited by these Examples.

Example 1: Obtaining a SigA-Modified Polypeptide Using an Artificial Mutagenesis

(32) In this Example, a vector library for primary crossover-insertion within the chromosome for obtaining a modified SigA was prepared by the following method. Error-prone PCR was performed for rpoD gene (SEQ ID NO: 1) encoding Corynebacterium SigA (SEQ ID NO: 2) and thereby fragments (1497 bp) of rpoD gene variants randomly introduced with a modification of nucleotide substitution were obtained. The error-prone PCR was performed using the GenemorphII Random Mutagenesis Kit (Stratagene), using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template along with primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4). The error-prone PCR was performed so that modifications can be introduced into the amplified gene fragment at a ratio of 0 to 4.5 mutations per 1 kb of the amplified fragment. PCR was performed for a total of 30 cycles under the following conditions: denaturation at 96 C. for 30 sec, annealing at 53 C. for 30 sec, and polymerization at 72 C. for 2 min.

(33) TABLE-US-00001 TABLE1 PrimerNo NucleotideSequence SEQIDNO 1 GTGGAGAGCAGCATGGTAG 3 2 CGCAGAGGAAAACAGTGGC 4

(34) The amplified gene fragments were connected to the pCR2.1-TOPO vector (hereinafter, pCR2.1) using the pCR2.1-TOPO TA Cloning Kit (Invitrogen), transformed into E. coli DH5a, and plated on solid LB medium. Twenty of the thus-transformed colonies were selected and their nucleotide sequences were analyzed after obtaining their plasmids. As a result, it was confirmed that mutations were introduced at different locations at a frequency of 1.5 mutations/kb. Plasmids were extracted from about 20,000 transformed E. coli colonies and they were named as pCR2.1-rpoD(mt) library. Then, a plasmid including the wild-type rpoD gene to be used as a control was prepared. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template along with primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4), under the same conditions described above. For the polymerase, PfuUltra high-fidelity DNA polymerase (Stratagene) was used, and the plasmid prepared as such was named as pCR2.1-rpoD (WT).

Example 2: Preparation of a Library of SigA-Modified Strains with Enhanced L-Lysine Producibility

(35) The pCR2.1-rpoD(mt) library prepared using the KCCM11016P strain (Korean Pat. No. 10-0159812) as the parent strain was transformed by homologous chromosome recombination, plated on complex medium containing kanamycin (25 mg/L) and the components described below, and about 25,000 colonies were obtained therefrom. The colonies were named as KCCM11016P/pCR2.1-rpoD(mt)-1 to KCCM11016P/pCR2.1-rpoD(mt)-25000.

(36) Additionally, the thus-prepared pCR2.1-rpoD(WT) vector was transformed into the KCCM11016P strain to prepare the control strain, and it was named as KCCM11016P/pCR2.1-rpoD(WT).

(37) The thus-obtained transformants will have two copies of the rpoD gene on the chromosome. However, pCR2.1-rpoD(mt) library and the pCR2.1-rpoD(WT) vector are inserted with rpoD gene fragments without any promoter, and thus when they are inserted into the chromosome of a strain by homologous recombination, only one copy of the two copies of the rpoD gene is expressed thus capable of expressing a modified- or wild-type SigA protein.

(38) <Complex Medium (pH 7.0)>

(39) Glucose (10 g), Peptone (10 g), Beef Extract (5 g), Yeast Extract (5 g), Brain Heart Infusion (18.5 g), NaCl (2.5 g), Urea (2 g), Sorbitol (91 g), Agar (20 g) (based on 1 L of distilled water)

Example 3: Screening of a Library of SigA-Modified Strains with Improved L-Lysine Producibility

(40) About 25,000 colonies obtained in Example 2 were respectively inoculated into selective medium (300 L) containing the components described below and cultured in a 96-deep well plate at 32 C. at a rate of 1000 rpm for 24 hours. The amount of L-lysine production during the cultivation was analyzed by a ninhydrin method (J. Biol. Chem. 1948. 176: 367-388). Upon completion of the cultivation, 10 L of the culture supernatant and 190 L of a ninhydrin reaction solution ((63% glycerol, 27% ninhydrin reaction (7.1 g/L in 0.5 M citrate buffer, pH 5.5)) were reacted at 65 C. for 30 minutes. The absorbance at wavelength 570 nm was measured by a spectrophotometer and was compared to that of the control, i.e., KCCM11016P/pCR2.1-rpoD(WT), and about 935 modified strains showing an absorbance with an at least 10% increase were selected. Other colonies showed similar or reduced absorbance compared to that of the control.

(41) <Selective Medium (pH 8.0)>

(42) Glucose (10 g), Ammonium Sulfate (5.5 g), MgSO.sub.4.7H.sub.2O (1.2 g), KH.sub.2PO.sub.4 (0.8 g), K.sub.2HPO.sub.4 (16.4 g), Biotin (100 g), Thiamine HCl (1000 g), Calcium-Pantothenic Acid (2000 g), and Nicotinamide (2000 g) (based on 1 L of distilled water)

(43) The above method was repeatedly performed for the selected 935 strains, and the top 231 kinds of strains with an improved L-lysine producibility by 15% or higher compared to that of KCCM1016P/pCR2.1-rpoD(WT) strain.

Example 4: Analysis of L-Lysine Producibility by KCCM11016P/pCR2.1-rpoD(Mt)

(44) The 231 kinds of strains selected in Example 3 were analyzed with respect to their L-lysine productivities after culturing them by the following method.

(45) Each of the strains was inoculated into a 250 mL corner-baffle flask containing 25 mL of seed culture medium, respectively, and cultured in a shaking incubator (200 rpm) at 30 C. for 20 hours. Then, each of the 250 mL corner-baffle flasks containing 24 mL of the culture, which contained the components described below, was inoculated with 1 mL of a seed culture liquid, and cultured in a shaking incubator (200 rpm) at 30 C. for 72 hours. The concentration of L-lysine in each culture was analyzed via high performance liquid chromatography (HPLC).

(46) <Seed Culture Medium (pH 7.0)>

(47) Glucose (20 g), Peptone (10 g), Yeast Extract (5 g), Urea (1.5 g), KH.sub.2PO.sub.4 (4 g), K.sub.2HPO.sub.4 (8 g), MgSO.sub.4.7H.sub.2O (0.5 g), Biotin (100 g), Thiamine HCl (1000 g), Calcium-Pantothenic Acid (2000 g), and Nicotinamide (2000 g) (based on 1 L of distilled water)

(48) <Production Medium (pH 7.0)>

(49) Glucose (100 g), (NH.sub.4).sub.2SO.sub.4 (40 g), Soybean Protein (2.5 g), Corn Steep Solids (5 g), Urea (3 g), KH.sub.2PO.sub.4 (1 g), MgSO.sub.4.7H.sub.2O (0.5 g), Biotin (100 g), Thiamine HCl (1000 g), Calcium-Pantothenic Acid (2000 g), Nicotinamide (3000 g), and CaCO.sub.3 (30 g) (based on 1 L of distilled water)

(50) Among the selected 231 kinds of strains, 17 kinds of strains showing a reproducibly increased L-lysine concentration compared to the control were selected, and the cultivation and analysis were performed repeatedly. The analysis results of the L-lysine concentration are shown in Table 2 below.

(51) TABLE-US-00002 TABLE 2 L-lysine (g/L) Batch Batch Batch Strain 1 2 3 Mean Control KCCM11016P/pCR2.1-rpoD(WT) 41.5 42.1 41.8 41.8 1 KCCM11016P/pCR2.1-rpoD(mt)-158 45.7 45.2 48.1 46.3 2 KCCM11016P/pCR2.1-rpoD(mt)-1494 44.8 46.2 45.7 45.6 3 KCCM11016P/pCR2.1-rpoD(mt)-1846 46.8 45.9 47.1 46.6 4 KCCM11016P/pCR2.1-rpoD(mt)-2198 49.8 47.8 47.9 48.5 5 KCCM11016P/pCR2.1-rpoD(mt)-2513 45.2 47.3 45.6 46.0 6 KCCM11016P/pCR2.1-rpoD(mt)-3777 45.8 47.6 45.9 46.4 7 KCCM11016P/pCR2.1-rpoD(mt)-4065 50.7 49.8 49.5 50.0 8 KCCM11016P/pCR2.1-rpoD(mt)-5329 44.5 42.5 42.8 43.3 9 KCCM11016P/pCR2.1-rpoD(mt)-6589 41.8 42.3 41.8 42.0 10 KCCM11016P/pCR2.1-rpoD(mt)-9823 47.3 46.8 47.0 47.0 11 KCCM11016P/pCR2.1-rpoD(mt)-11267 45.5 45.3 45.1 45.3 12 KCCM11016P/pCR2.1-rpoD(mt)-13306 48.5 46.5 46.6 47.2 13 KCCM11016P/pCR2.1-rpoD(mt)-14535 48.2 49.3 47.5 48.3 14 KCCM11016P/pCR2.1-rpoD(mt)-16323 44.2 44.6 45.8 44.9 15 KCCM11016P/pCR2.1-rpoD(mt)-17935 46.5 47.2 44.5 46.1 16 KCCM11016P/pCR2.1-rpoD(mt)-18904 42.3 41.5 42.6 42.1 17 KCCM11016P/pCR2.1-rpoD(mt)-19803 47.2 45.3 46.3 46.3

(52) As a result of the analysis of the L-lysine concentration of the 17 selected strains, it was confirmed that the L-lysine producibility of 15 strains excluding the two strains, i.e., KCCM1016P/pCR2.1-rpoD(mt)-6589 and KCCM1016P/pCR2.1-rpoD(mt)-18904, was increased by 20% at maximum compared to that of the control, KCCM11016P/pCR2.1-rpoD(WT) strain.

Example 5: Confirmation of rpoD Gene Mutations in Strains Selected from a Library with Artificial Mutagenesis of SigA

(53) To confirm the mutations introduced on SigA in the 15 strains showing an improved L-lysine producibility among the 17 selected strains in Example 4, the nucleotide sequences of rpoD mutants were analyzed. For determining the nucleotide sequences, PCR was performed using primer 1 (SEQ ID NO: 3) and primer 3 (SEQ ID NO: 5).

(54) TABLE-US-00003 TABLE3 PrimerNo NucleotideSequence SEQIDNO 1 GTGGAGAGCAGCATGGTAG 3 3 AACAGCTATGACCATG 5

(55) The nucleotide sequence of the modified rpoD gene was confirmed based on the NIH Genbank by analyzing the nucleotide sequences of the fragments of the modified rpoD gene for each of the thus-obtained 15 strains, and the nucleotide sequence of the modified SigA was confirmed. The analysis results of the modified SigA amino acid sequence of the thus-obtained 15 strains are shown in Table 4 below.

(56) TABLE-US-00004 TABLE 4 Modification in Amino Strain Acid(s) of SigA KCCM11016P/pCR2.1-rpoD(mt)-158 D136G, T281S KCCM11016P/pCR2.1-rpoD(mt)-1494 L381R KCCM11016P/pCR2.1-rpoD(mt)-1846 M230T KCCM11016P/pCR2.1-rpoD(mt)-2198 M455V KCCM11016P/pCR2.1-rpoD(mt)-2513 S488T KCCM11016P/pCR2.1-rpoD(mt)-3777 R279L KCCM11016P/pCR2.1-rpoD(mt)-4065 L447H KCCM11016P/pCR2.1-rpoD(mt)-5329 A268S KCCM11016P/pCR2.1-rpoD(mt)-9823 L451I, Q491R KCCM11016P/pCR2.1-rpoD(mt)-11267 Q429R KCCM11016P/pCR2.1-rpoD(mt)-13306 K90E, K105Y, D250G, I254L KCCM11016P/pCR2.1-rpoD(mt)-14535 I254N KCCM11016P/pCR2.1-rpoD(mt)-16323 K483R KCCM11016P/pCR2.1-rpoD(mt)-17935 K479R KCCM11016P/pCR2.1-rpoD(mt)-19803 D238V, N263S, E358D

(57) As a result, it was confirmed that amino acids in a range of a minimum of one to a maximum of four were substituted. In Table 4 above, the figure represents the amino acid number of SigA; the letter in front of the figure represents an amino acid before substitution; and the letter after the figure represents a substituted amino acid.

Example 6: Preparation of a Vector for Introducing an rpoD-Modified Chromosome for the Production of a Strain Having L-Lysine Producibility in High Concentration

(58) To confirm the effect of the application of the SigA modification, which was confirmed in Example 4, a vector capable of introducing the SigA modification onto the chromosome was prepared.

(59) The primer 4 (SEQ ID NO: 6), in which an EcoRI restriction site was inserted at the 5 end, and the primer 5 (SEQ ID NO: 7), in which a SalI restriction site was inserted at the 3 end, were synthesized based on the reported nucleotide sequences. Then, PCR was performed using each of the chromosomes of the 15 selected kinds as a template using the primer pair, and thereby 15 kinds of modified rpoD(mt) gene fragments were amplified. PCR was performed under the following conditions: denaturation at 94 C. for 5 min; 30 cycles of denaturation at 94 C. for 30 sec, annealing at 56 C. for 30 sec, and polymerization at 72 C. for 2 min; and polymerization at 72 C. for 7 min.

(60) TABLE-US-00005 TABLE5 PrimerNo NucleotideSequence SEQIDNO 4 AAGAATTCGTGGAGAGCAGCATGGTAG 6 5 AAGTCGACCGCAGAGGAAAACAGTGGC 7

(61) The 15 kinds of gene fragments amplified by PCR were treated with EcoRI and SalI to obtain the respective DNA fragments, and linked the fragments to the pDZ vector (Korean Pat. No. 10-0924065) for introducing chromosome, which includes EcoRI and SalI restriction sites therein, transformed into E. coli DH5a, and spread on LB solid medium containing kanamycin (25 mg/L). The colonies transformed with a vector inserted with a target gene by PCR were selected and the plasmids were obtained by a conventionally-known plasmid extraction method. The plasmids were named as pDZ-SigA(D136G, T281S), pDZ-SigA(L381R), pDZ-SigA(M230T), pDZ-SigA(M455V), pDZ-SigA(S488T), pDZ-SigA (R279L), pDZ-SigA(I254N), pDZ-SigA(A268S), pDZ-SigA(L451I, Q491R), pDZ-SigA(Q429R), pDZ-SigA(K90E, K105Y, D250G, I254L), pDZ-SigA(L447H), pDZ-SigA(K483R), pDZ-SigA(K479R), and pDZ-SigA(D238V, N263S, E358D), respectively, according to the modification of the insertion on SigA of each plasmid. Additionally, as another control for the above variants, primers 6 to 9 (SEQ ID NOS: 8 to 11) were prepared for the construction of vectors to insert the SigA-modified A414V, which was reported to have an effect of increasing L-lysine producibility (International Publication WO 2003-054179), into the chromosome. Then, PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 along with a primer pair of primer 6 and primer 9 and a primer pair of primer 7 and primer 8, respectively. PCR was performed under the following conditions: denaturation at 94 C. for 5 min; 30 cycles of denaturation at 94 C. for 30 sec, annealing at 56 C. for 30 sec, and polymerization at 72 C. for 1 min; and polymerization at 72 C. for 7 min.

(62) TABLE-US-00006 SEQ Primer ID No NucleotideSequence NO 6 GCAGGTCGACTCTAGACTCACCCCAGCCGTCAAGCGT 8 7 CCGGGGATCCTCTAGATCAAGGCGATGTCGGAAAATG 9 8 AAGACTCCGAAGTCGTCGTCGCAGT 10 9 ACTGCGACGACGACTTCGGAGTCTT 11

(63) As a result, gene fragments with a size of about 500 bp were obtained and the amplified products were linked to the pDZ vector using the Infusion cloning kit (Invitrogen). The thus-prepared vector was named as pDZ-SigA(A414V).

Example 7: Preparation of KCCM11016P Strain Introduced with SigA-Modified Polypeptide for Strains Having L-Lysine Producibility in High Concentration and Comparison of their L-Lysine Productivities

(64) The 15 kinds of vectors introduced with novel mutations prepared in Example 6 and one kind of a vector introduced with a mutation reported previously were transformed into the Corynebacterium glutamicum KCCM11016P, which is a strain producing L-lysine, by a two-step homologous chromosome recombination. Then, the strains introduced with the SigA modifications were selected by the analysis of nucleotide sequences. The strains introduced with the SigA modifications were named as KCCM11016P::SigA(D136G, T281S), KCCM11016P::SigA(L381R), KCCM11016P::SigA(M230T), KCCM11016P::SigA(M455V), KCCM11016P::SigA(S488T), KCCM011016P::SigA(R279L), KCCM11016P::SigA(I254N), KCCM11016P::SigA(A268S), KCCM11016P::SigA(L451I, Q491R), KCCM11016P::SigA(Q429R), KCCM011016P::SigA(K90E, K105Y, D250G, I254L), KCCM11016P::SigA(L447H), KCCM11016P::SigA(K483R), KCCM011016P::SigA(K479R), KCCM11016P::SigA(D238V, N263S, E358D), and KCCM11016P::SigA(A414V), respectively.

(65) The strains were cultured in the same manner as in Example 4 and their L-lysine concentrations were analyzed. The results are shown in Table 7 below.

(66) TABLE-US-00007 TABLE 7 L-lysine (g/L) Batch Batch Batch Strain 1 2 3 Mean Control KCCM11016P 42.8 41.6 43.1 42.5 1 KCCM11016P::SigA(D136G, 46.2 45.8 45.2 45.7 T281S) 2 KCCM11016P::SigA(L381R) 45.2 45.8 46.7 45.9 3 KCCM11016P::SigA(M230T) 41.8 42.1 41.9 41.9 4 KCCM11016P::SigA(M455V) 50.1 48.1 49.2 49.1 5 KCCM11016P::SigA(S488T), 45.1 44.9 45.8 45.3 6 KCCM11016P::SigA(R279L) 42.5 43.2 40.9 42.2 7 KCCM11016P::SigA(L447H) 51.2 49.9 50.8 50.6 8 KCCM11016P::SigA(A268S) 43.2 44.1 45.5 44.3 9 KCCM11016P::SigA(L451I, 47.5 47.1 49.8 48.1 Q491R) 10 KCCM11016P::SigA(Q429R) 44.9 45.2 45.1 45.1 11 KCCM11016P::SigA(K90E, 31.5 28.6 40.5 33.5 K105Y, D250G, I254L) 12 KCCM11016P::SigA (I254N) 49.1 48.5 47.8 48.5 13 KCCM11016P::SigA(K483R) 45.1 44.1 45.6 44.9 14 KCCM11016P::SigA(K479R) 44.7 45.6 45.8 45.4 15 KCCM11016P::SigA(D238V, 21.5 22.9 19.2 21.2 N263S, E358D) Control KCCM11016P::SigA(A414V) 43.2 44 43.5 43.6

(67) As a result, two novel strains introduced with modifications (KCCM11016P::SigA(M230T) and KCCM11016P::SigA(R279L)) showed the L-lysine producibility equivalent to that of the parent strain, whereas the other two novel strains introduced with mutations (KCCM11016P::SigA(K90E, K105Y, D250G, I254L) and KCCM11016P::SigA(D238V, N263S, E358D)) showed a significantly low growth rate and a significantly reduced amount of L-lysine production. However, the remaining 11 novel mutant strains showed a maximum increase of 19% in L-lysine production compared to that of the parent strain, and also showed an increase of 16% in L-lysine production compared to that of KCCM11016P::SigA(A414V), which is a mutant strain introduced with SigA(A414V) reported previously. As such, the present inventors designated the strain with an improved L-lysine producibility, KCCM1016P::SigA(L447H), as Corynebacterium glutamicum CA01-2277 and deposited it with the Korean Culture Center of Microorganisms, recognized as an international depositary authority under the Budapest Treaty, on Nov. 22, 2013, under the Accession Number KCCM11479P.

(68) These results suggest that the 11 novel SigA-modified polypeptides have excellent L-lysine producibility.

Example 8: Preparation of KFCC10750 Strain Introduced with SigA-Modified Polypeptide for Strains Having L-Lysine Producibility in High Concentration and Comparison of their L-Lysine Productivities

(69) To confirm the effect of the introduction of the 11 kinds of SigA variants, selected in Example 7, in other strains of the genus Corynebacterium glutamicum, the strains respectively introduced with each of the 11 kinds of SigA mutations of Corynebacterium glutamicum KFCC10750 (KCCM11347P, Korean Pat. No. 10-0073610) having L-lysine producibility were prepared in the same manner as in Example 7. These strains were named as KFCC10750::SigA(D136G, T281S), KFCC10750::SigA(L381R), KFCC10750::SigA(M455V), KFCC10750::SigA(S488T), KFCC10750::SigA(I254N), KFCC10750::SigA(A268S), KFCC10750::SigA(L451I, Q491R), KFCC10750::SigA(Q429R), KFCC10750::SigA(L447H), KFCC10750::SigA(K483R), and KFCC10750::SigA(K479R), respectively. Additionally, the strain introduced with the SigA(A414V) mutation, reported previously, was prepared and named as KFCC10750::SigA(A414V).

(70) The strains were cultured in the same manner as in Example 4 and their L-lysine concentrations were analyzed. The results are shown in Table 8 below.

(71) TABLE-US-00008 TABLE 8 L-lysine (g/L) Batch Batch Batch Strain 1 2 3 Mean Control KFCC10750 38.8 38.1 37.9 38.3 1 KFCC10750::SigA(D136G, 41.1 41.2 40.9 41.1 T281S) 2 KFCC10750::SigA(L381R) 42.1 41.8 41.1 41.7 3 KFCC10750::SigA(M455V) 43.2 43.8 44.2 43.7 4 KFCC10750::SigA(S488T) 42.1 40.8 41.9 41.6 5 KFCC10750::SigA (L447H) 44.5 45.1 44.9 44.8 6 KFCC10750::SigA(A268S) 39.9 41.1 39.7 40.2 7 KFCC10750::SigA(L451I, 42.9 44.1 43.8 43.6 Q491R) 8 KFCC10750::SigA(Q429R) 40.2 41.2 42.1 41.2 9 KFCC10750::SigA(I254N) 44.9 44.5 43.8 44.4 10 KFCC10750::SigA(K483R) 40.5 41 40.9 40.8 11 KFCC10750::SigA(K479R) 39.9 41.5 41.1 40.8 Control KFCC10750::SigA(A414V) 39.6 39.1 39.5 39.4

(72) As a result, the 11 kinds of strains introduced with novel mutations showed a maximum increase of 17% in L-lysine production compared to that of the parent strain, and also showed an increase of about 14% in L-lysine production compared to that of KFCC10750::SigA(A414V), which is a strain introduced with the SigAA414V mutation reported previously.

Example 9: Preparation of KCCM10770P Strain Introduced with SigA-Modified Polypeptide for Strains Having L-Lysine Producibility in High Concentration and Comparison of their L-Lysine Productivities

(73) To confirm the effect of the introduction of the 11 kinds of SigA variants, selected in Example 7, in other strains of the genus Corynebacterium glutamicum, the strains respectively introduced with SigA modifications of Corynebacterium glutamicum KFCC10770 (KCCM11347P, Korean Pat. No. 10-0924065) having L-lysine producibility were prepared in the same manner as in Example 7. These strains were named as KCCM10770P::SigA(D136G, T281S), KCCM10770P::SigA(L381R), KCCM10770P::SigA(M455V), KCCM10770P::SigA(S488T), KCCM10770P::SigA(I254N), KCCM10770P::SigA(A268S), KCCM10770P::SigA(L451I, Q491R), KCCM10770P::SigA(Q429R), KCCM10770P::SigA(L447H), and KCCM10770P::SigA(K483R), KCCM10770P::SigA(K479R), respectively. Additionally, the strain introduced with the SigA(A414V) mutation, reported previously, was prepared and named as KFCC10770::SigA(A414V).

(74) The strains were cultured in the same manner as in Example 4 and their L-lysine concentrations were analyzed. The results are shown in Table 9 below.

(75) TABLE-US-00009 TABLE 9 L-lysine (g/L) Batch Batch Batch Strain 1 2 3 Mean Control KCCM10770P 47.5 48.1 47.9 47.8 1 KCCM10770P::SigA(D136G, 51.1 51.6 52.1 51.6 T281S) 2 KCCM10770P::SigA(L381R) 52.6 50.9 52.1 51.9 3 KCCM10770P::SigA(M455V) 55.1 54.3 54.8 54.7 4 KCCM10770P::SigA(S488T) 52.1 52.4 51.9 52.1 5 KCCM10770P::SigA(L447H) 56.9 57.6 57.1 57.2 6 KCCM10770P::SigA(A268S) 50.5 50.1 49.9 50.2 7 KCCM10770P::SigA(L451I, 55.3 54.9 54.1 54.8 Q491R) 8 KCCM10770P::SigA(Q429R) 52.4 52.3 50.9 51.9 9 KCCM10770P::SigA(I254N) 55.9 55.4 54.1 55.1 10 KCCM10770P::SigA(K483R) 51.9 51.3 51.5 51.6 11 KCCM10770P::SigA(K479R) 51 51.7 52.1 51.6 Control KCCM10770P::SigA(A414V) 48.9 49.5 50.1 49.5

(76) As a result, the 11 kinds of strains introduced with novel mutations showed a maximum increase of 20% in L-lysine production compared to that of the parent strain, and also showed an increase of about 16% in L-lysine production compared to that of KFCC10770::SigA(A414V), which is a strain introduced with the SigAA414V mutation reported previously.

Example 10: Preparation of CJ3P Strain Introduced with SigA-Modified Polypeptide for Strains Having L-Lysine Producibility in High Concentration and Comparison of their L-Lysine Productivities

(77) To confirm the effect in other strains of the genus Corynebacterium glutamicum, the strains in which SigA modifications were respectively introduced to Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012, 13: R40) having L-lysine producibility were prepared in the same manner as in Example 7. These strains were named as CJ3P::SigA(D136G, T281S), CJ3P::SigA(L381R), CJ3P::SigA(M455V), CJ3P::SigA(S488T), CJ3P::SigA(I254N), CJ3P::SigA(A268S), CJ3P::SigA(L451I, Q491R), CJ3P::SigA(Q429R), CJ3P::SigA(L447H), CJ3P::SigA(K483R), and CJ3P::SigA(K479R), respectively. Additionally, the strain introduced with the SigA(A414V) mutation, reported previously, was prepared and named as CJ3P::SigA(A414V). CJ3P is a Corynebacterium glutamicum strain, which has L-lysine producibility by the introduction of 3 kinds of mutations to the wild-type of the microorganism based on the known technology.

(78) The strains were cultured in the same manner as in Example 4 and their L-lysine concentrations were analyzed. The results are shown in Table 10 below.

(79) TABLE-US-00010 TABLE 10 L-lysine (g/L) Batch Batch Batch Strain 1 2 3 Mean Control CJ3P 8.2 8.3 8.0 8.2 1 CJ3P::SigA(D136G, 9.0 8.8 8.9 8.9 T281S) 2 CJ3P::SigA(L381R) 8.7 8.9 8.5 8.7 3 CJ3P::SigA(M455V) 9.3 9.5 9.1 9.3 4 CJ3P::SigA(S488T) 9.0 9.1 8.8 9.0 5 CJ3P::SigA(L447H) 9.8 10.1 9.5 9.8 6 CJ3P::SigA(A268S) 8.5 8.7 8.9 8.7 7 CJ3P::SigA(L451I, 9.1 9.0 8.8 9.0 Q491R) 8 CJ3P::SigA(Q429R) 8.9 8.8 9.0 8.9 9 CJ3P::SigA (I254N) 9.1 9.7 9.5 9.4 10 CJ3P::SigA(K483R) 8.8 9.1 8.5 8.8 11 CJ3P::SigA(K479R) 8.6 8.9 8.8 8.8 Control CJ3P::SigA(A414V) 8.5 8.4 8.6 8.5

(80) As a result, the 11 kinds of strains introduced with novel mutations showed a maximum increase of 20% in L-lysine production compared to that of the parent strain, and also showed an increase of about 15% in L-lysine production compared to that of CJ3P::SigA(A414V), which is a strain introduced with the SigAA414V mutation reported previously.

(81) Summarizing the above results, the 11 novel modified polypeptides having SigA activity obtained in the present disclosure (i.e., SigA(D136G, T281S), SigA(L381R), SigA(M455V), SigA(S488T), SigA(I254N), SigA(A268S), SigA(L451I, Q491R), SigA(Q429R), SigA(L447H), SigA(K483R), and SigA(K479R)) were shown to have an excellent effect on the improvement of L-lysine production, respectively, in various microorganisms of the genus Corynebacterium, and these results suggest that the modified polypeptides have an excellent effect on the improvement of L-lysine production compared to the modified SigA(A414V), which was reported previously.

(82) From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.