Mutated acetohydroxyacid synthase genes in euphorbiaceae and plant material comprising such genes
10676755 ยท 2020-06-09
Assignee
Inventors
Cpc classification
International classification
Abstract
Provided are mutated acetohydroxyacid synthase (AHAS) nucleic acids and the proteins encoded by the mutated nucleic acids. Also provided are cassava plants, cells, and seeds comprising the mutated genes.
Claims
1. An isolated nucleic acid encoding a Cassava acetohydroxyacid synthase (AHAS) protein comprising a tryptophan to serine mutation at position 562 of SEQ ID NO: 1.
2. An expression vector comprising a nucleic acid encoding a Cassava acetohydroxyacid synthase (AHAS) protein comprising a mutation at one or more amino acid positions, one of which corresponds to a tryptophan to serine mutation at position 562 of SEQ ID NO: 1.
3. A plant, or a plant seed, comprising a Cassava acetohydroxyacid synthase (AHAS) gene, wherein said gene encodes a Cassava acetohydroxyacid synthase (AHAS) protein comprising a tryptophan to serine mutation at position 562 of SEQ ID NO: 1.
4. The plant or plant seed of claim 3, wherein said plant is resistant to inhibition by an AHAS-inhibiting herbicide, wherein said AHAS-inhibiting herbicide is optionally selected from the group consisting of herbicides of: imidazolinone, sulfonylurea, triazolopyrimidine, pyrimidinylthiobenzoate, sulfonylamino-carbonyltriazolinone, and mixtures thereof.
5. The plant or plant seed of claim 3, wherein said plant is resistant to inhibition by each of an imidazolinone herbicide and a triazolopyrimidine herbicide.
6. A plant comprising a nucleic acid encoding a Cassava acetohydroxyacid synthase (AHAS) protein comprising a tryptophan to serine mutation at position 562 of SEQ ID NO: 1, wherein said plant is resistant to inhibition by each of an imidazolinone herbicide and a triazolopyrimidine herbicide, or a seed obtained therefrom.
7. A method for producing an herbicide-resistant Cassava plant, said method comprising: introducing into a Cassava plant cell a gene repair oligonucleobase (GRON) with a targeted mutation in an acetohydroxyacid synthase (AHAS) gene to produce a Cassava plant cell with a Cassava AHAS gene that expresses a protein comprising a mutation at one or more amino acid positions, one of which corresponds to a tryptophan to serine mutation at position 562 of SEQ ID NO: 1; identifying a Cassava plant cell having substantially normal growth and catalytic activity as compared to a corresponding wild-type plant cell in the presence of an AHAS-inhibiting herbicide; and regenerating a non-transgenic herbicide-resistant plant having a mutated Cassava AHAS gene from said plant cell.
8. A method for increasing the herbicide-resistance of a Cassava plant comprising crossing a first Cassava plant to a second Cassava plant, wherein said first plant comprises a Cassava acetohydroxyacid synthase (AHAS) gene, wherein said gene encodes a Cassava acetohydroxyacid synthase (AHAS) protein comprising a mutation at one or more amino acid positions, one of which corresponds to a tryptophan to serine mutation at position 562 of SEQ ID NO: 1; screening a population resulting from the cross for increased AHAS herbicide-resistance; selecting a member resulting from the cross having increased AHAS herbicide-resistance; and producing seeds resulting from the cross.
9. An isolated nucleic acid encoding a Cassava acetohydroxyacid synthase (AHAS) protein comprising an aspartic acid to alanine mutation at position 364 of SEQ ID NO: 1.
10. An expression vector comprising a nucleic acid encoding a Euphorbiaceae acetohydroxyacid synthase (AHAS) protein comprising a mutation at one or more amino acid positions, one of which corresponds to an aspartic acid to alanine mutation at position 364 of SEQ ID NO: 1.
11. A plant, or a plant seed, comprising a Cassava acetohydroxyacid synthase (AHAS) gene, wherein said gene encodes a Cassava acetohydroxyacid synthase (AHAS) protein comprising an aspartic acid to alanine mutation at position 364 of SEQ ID NO: 1.
12. The plant or plant seed of claim 11, wherein said plant is resistant to inhibition by an AHAS-inhibiting herbicide, wherein said AHAS-inhibiting herbicide is optionally selected from the group consisting of herbicides of: imidazolinone, sulfonylurea, triazolopyrimidine, pyrimidinylthiobenzoate, sulfonylamino-carbonyltriazolinone, and mixtures thereof.
13. The plant or plant seed of claim 11, wherein said plant is resistant to inhibition by each of an imidazolinone herbicide and a triazolopyrimidine herbicide.
14. A method for producing an herbicide-resistant Cassava plant, said method comprising: introducing into a Cassava plant cell a gene repair oligonucleobase (GRON) with a targeted mutation in an acetohydroxyacid synthase (AHAS) gene to produce a Cassava plant cell with a Cassava AHAS gene that expresses a protein comprising a mutation at one or more amino acid positions, one of which corresponds to an aspartic acid to alanine mutation at position 364 of SEQ ID NO: 1; identifying a Cassava plant cell having substantially normal growth and catalytic activity as compared to a corresponding wild-type plant cell in the presence of an AHAS-inhibiting herbicide; and regenerating a non-transgenic herbicide-resistant plant having a mutated Cassava AHAS gene from said plant cell.
15. A method for increasing the herbicide-resistance of a Cassava plant comprising crossing a first Cassava plant to a second Cassava plant, wherein said first plant comprises a Cassava acetohydroxyacid synthase (AHAS) gene, wherein said gene encodes a Cassava acetohydroxyacid synthase (AHAS) protein comprising a mutation at one or more amino acid positions, one of which corresponds to an aspartic acid to alanine mutation at position 364 of SEQ ID NO: 1; screening a population resulting from the cross for increased AHAS herbicide-resistance; selecting a member resulting from the cross having increased AHAS herbicide-resistance; and producing seeds resulting from the cross.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION OF THE INVENTION
(14) Provided are compositions and methods related in part to the successful targeting of acetohydroxyacid synthase (AHAS) genes in Euphorbiaceae using, for example, the Rapid Trait Development System (RTDS) technology developed by Cibus. In combination or alone, plants containing any of the mutations disclosed herein can form the basis of new herbicide-resistant products. Also provided are seeds produced from the mutated plants in which the AHAS genes are either homozygous or heterozygous for the mutations. The mutations disclosed herein can be in combination with any other mutation known or with mutations discovered in the future.
(15) RTDS is based on altering a targeted gene by utilizing the cell's own gene repair system to specifically modify the gene sequence in situ and not insert foreign DNA and gene expression control sequences. This procedure effects a precise change in the genetic sequence while the rest of the genome is left unaltered. In contrast to conventional transgenic GMOs, there is no integration of foreign genetic material, nor is any foreign genetic material left in the plant. The changes in the genetic sequence introduced by RTDS are not randomly inserted. Since affected genes remain in their native location, no random, uncontrolled or adverse pattern of expression occurs.
(16) The RTDS that effects this change is a chemically synthesized oligonucleotide which may be composed of both DNA and modified RNA bases as well as other chemical moieties, and is designed to hybridize at the targeted gene location to create a mismatched base-pair(s). This mismatched base-pair acts as a signal to attract the cell's own natural gene repair system to that site and correct (replace, insert or delete) the designated nucleotide(s) within the gene. Once the correction process is complete the RTDS molecule is degraded and the now-modified or repaired gene is expressed under that gene's normal endogenous control mechanisms.
(17) The introduction of exogenous mutant genes into plants is well documented. For example, U.S. Pat. No. 4,545,060 relates to increasing a plant's resistance to glyphosate by introducing into the plant's genome a gene coding for an EPSPS variant having at least one mutation that renders the enzyme more resistant to its competitive inhibitor, i.e., glyphosate.
(18) Examples of some of the mutations in AHAS genes are known. See e.g. U.S. Pat. No. 7,094,606.
(19) Through chemical mutagenesis, a mutation was found in the lower expressed AHAS I gene. This mutation is known as PM-1 (a mutation at an equivalent position known as 653 based on the acetolactate synthase (ALS) amino acid sequence of Arabidopsis, a serine to asparagine amino acid change, respectively encoded as followsAGT to AAT). Another mutation was found in the higher expressed gene AHAS III, known as PM-2 (a mutation at an equivalent position known as 574, a tryptophan to leucine amino acid change, respectively encoded as followsTGG to TTG). These two mutations, PM-1 and PM-2, are combined in a commercial variety of Canola known as Clearfield Canola (Tan et al., 2005).
(20) For exemplary purposes, the subject mutations are depicted in Cassava (Manihot esculenta). The compositions and methods also encompass mutant AHAS genes of other Euphorbiaceae species (paralogs). However, due to variations in the AHAS genes of different species, the number of the amino acid residue to be changed in one species may be different in another species. Nevertheless, the analogous position is readily identified by one of skill in the art by sequence homology.
(21) The compositions and methods relate in part to mutations in an AHAS gene that render a plant resistant or tolerant to an herbicide of the AHAS-inhibiting or ALS-inhibiting family of herbicides. The compositions and methods also relate to the use of a gene repair oligonucleobase to make a desired mutation in the chromosomal or episomal sequences of a plant in the gene encoding for an AHAS protein. The mutated protein, which substantially maintains the catalytic activity of the wild-type protein, allows for increased resistance or tolerance of the plant to an herbicide of the AHAS-inhibiting family, and allows for the substantially normal growth or development of the plant, its organs, tissues, or cells as compared to the wild-type plant irrespective of the presence or absence of the herbicide. The compositions and methods also relate to a non-transgenic plant cell in which an AHAS gene has been mutated, a non-transgenic plant regenerated therefrom, as well as a plant resulting from a cross using a regenerated non-transgenic plant to a plant having a mutation in a different AHAS gene or to a plant having a mutated EPSPS gene, for example.
(22) Imidazolinones are among the five chemical families of AHAS-inhibiting herbicides. The other four families are sulfonylureas, triazolopyrimidines, pyrimidinylthiobenzoates and sulfonylamino-carbonyltriazolinones (Tan et al., 2005).
(23) Also provided is a transgenic or non-transgenic plant or plant cell having one or more mutations in the AHAS gene, for example, such as disclosed herein. In certain embodiments, the plant or plant cell having one or more mutations in the AHAS gene has increased resistance or tolerance to a member of the AHAS-inhibiting. In certain embodiments, the plant or plant cell having one or more mutations in the AHAS gene may exhibit substantially normal growth or development of the plant, its organs, tissues or cells, as compared to the corresponding wild-type plant or cell. In particular aspects and embodiments provided are non-transgenic plants having a mutation in an AHAS gene, for example, such as disclosed herein, which in certain embodiments has increased resistance or tolerance to a member of the AHAS-inhibiting herbicide family and may exhibit substantially normal growth or development of the plant, its organs, tissues or cells, as compared to the corresponding wild-type plant or cell, i.e., in the presence of one or more herbicide such as for example, an imidazolinone and/or sulfonylurea, the mutated AHAS protein has substantially the same catalytic activity as compared to the wild-type AHAS protein.
(24) Further provided are methods for producing a plant having a mutated AHAS gene, for example, having one or more mutations as described herein; preferably the plant substantially maintains the catalytic activity of the wild-type protein irrespective of the presence or absence of a relevant herbicide. In certain embodiments, the methods include introducing into a plant cell a gene repair oligonucleobase with one or more targeted mutations in the AHAS gene (for example, such as disclosed herein) and identifying a cell, seed, or plant having a mutated AHAS gene.
(25) The gene repair oligonucleobase can be introduced into a plant cell using any method commonly used in the art, including but not limited to, microcarriers (biolistic delivery), microfibers, polyethylene glycol (PEG)-mediated uptake, electroporation, and microinjection.
(26) Also provided are methods and compositions related to the culture of cells mutated according to methods as disclosed herein in order to obtain a plant that produces seeds, henceforth a fertile plant, and the production of seeds and additional plants from such a fertile plant.
(27) Also provided are methods of selectively controlling weeds in a field, the field comprising plants with the disclosed AHAS gene alterations and weeds, the method comprising application to the field of an herbicide to which the plants have been rendered resistant.
(28) Also provided are mutations in the AHAS gene that confer resistance or tolerance to a member of the relevant herbicide to a plant or wherein the mutated AHAS gene has substantially the same enzymatic activity as compared to wild-type AHAS.
(29) Gene Repair Oligonucleobases
(30) The methods and compositions disclosed herein can be practiced or made with gene repair oligonucleobases having the conformations and chemistries as described in detail below. The gene repair oligonucleobases as contemplated herein have also been described in published scientific and patent literature using other names including recombinagenic oligonucleobases; RNA/DNA chimeric oligonucleotides; chimeric oligonucleotides; mixed duplex oligonucleotides (MDONs); RNA DNA oligonucleotides (RDOs); gene targeting oligonucleotides; genoplasts; single stranded modified oligonucleotides; Single stranded oligodeoxynucleotide mutational vectors (SSOMVs); duplex mutational vectors; and heteroduplex mutational vectors.
(31) Oligonucleobases having the conformations and chemistries described in U.S. Pat. No. 5,565,350 by Kmiec (Kmiec I) and U.S. Pat. No. 5,731,181 by Kmiec (Kmiec II), hereby incorporated by reference, are suitable for use as gene repair oligonucleobases of the invention. The gene repair oligonucleobases in Kmiec I and/or Kmiec II contain two complementary strands, one of which contains at least one segment of RNA-type nucleotides (an RNA segment) that are base paired to DNA-type nucleotides of the other strand.
(32) Kmiec II discloses that purine and pyrimidine base-containing non-nucleotides can be substituted for nucleotides. Additional gene repair molecules that can be used for the present invention are described in U.S. Pat. Nos. 5,756,325; 5,871,984; 5,760,012; 5,888,983; 5,795,972; 5,780,296; 5,945,339; 6,004,804; and 6,010,907 and in International Patent No. PCT/US00/23457; and in International Patent Publication Nos. WO 98/49350; WO 99/07865; WO 99/58723; WO 99/58702; and WO 99/40789, which are each hereby incorporated in their entirety.
(33) In one embodiment, the gene repair oligonucleobase is a mixed duplex oligonucleotides (MDON) in which the RNA-type nucleotides of the mixed duplex oligonucleotide are made RNase resistant by replacing the 2-hydroxyl with a fluoro, chloro or bromo functionality or by placing a substituent on the 2-O. Suitable substituents include the substituents taught by the Kmiec II. Alternative substituents include the substituents taught by U.S. Pat. No. 5,334,711 (Sproat) and the substituents taught by patent publications EP 629 387 and EP 679 657 (collectively, the Martin Applications), which are hereby incorporated by reference. As used herein, a 2-fluoro, chloro or bromo derivative of a ribonucleotide or a ribonucleotide having a 2-OH substituted with a substituent described in the Martin Applications or Sproat is termed a 2-Substituted Ribonucleotide. As used herein the term RNA-type nucleotide means a 2-hydroxyl or 2-Substituted Nucleotide that is linked to other nucleotides of a mixed duplex oligonucleotide by an unsubstituted phosphodiester linkage or any of the non-natural linkages taught by Kmiec I or Kmiec II. As used herein the term deoxyribo-type nucleotide means a nucleotide having a 2-H, which can be linked to other nucleotides of a gene repair oligonucleobase by an unsubstituted phosphodiester linkage or any of the non-natural linkages taught by Kmiec I or Kmiec II.
(34) In a particular embodiment of the present invention, the gene repair oligonucleobase is a mixed duplex oligonucleotides (MDON) that is linked solely by unsubstituted phosphodiester bonds. In alternative embodiments, the linkage is by substituted phosphodiesters, phosphodiester derivatives and non-phosphorus-based linkages as taught by Kmiec II. In yet another embodiment, each RNA-type nucleotide in the mixed duplex oligonucleotide is a 2-Substituted Nucleotide. Particular preferred embodiments of 2-Substituted Ribonucleotides are 2-fluoro, 2-methoxy, 2-propyloxy, 2-allyloxy, 2-hydroxylethyloxy, 2-methoxyethyloxy, 2-fluoropropyloxy and 2-trifluoropropyloxy substituted ribonucleotides. More preferred embodiments of 2-Substituted Ribonucleotides are 2-fluoro, 2-methoxy, 2-methoxyethyloxy, and 2-allyloxy substituted nucleotides. In another embodiment the mixed duplex oligonucleotide is linked by unsubstituted phosphodiester bonds.
(35) Although mixed duplex oligonucleotides (MDONs) having only a single type of 2-substituted RNA-type nucleotide are more conveniently synthesized, the methods of the invention can be practiced with mixed duplex oligonucleotides having two or more types of RNA-type nucleotides. The function of an RNA segment may not be affected by an interruption caused by the introduction of a deoxynucleotide between two RNA-type trinucleotides, accordingly, the term RNA segment encompasses terms such as interrupted RNA segment. An uninterrupted RNA segment is termed a contiguous RNA segment. In an alternative embodiment an RNA segment can contain alternating RNase-resistant and unsubstituted 2-OH nucleotides. The mixed duplex oligonucleotides preferably have fewer than 100 nucleotides and more preferably fewer than 85 nucleotides, but more than 50 nucleotides. The first and second strands are Watson-Crick base paired. In one embodiment the strands of the mixed duplex oligonucleotide are covalently bonded by a linker, such as a single stranded hexa, penta or tetranucleotide so that the first and second strands are segments of a single oligonucleotide chain having a single 3 and a single 5 end. The 3 and 5 ends can be protected by the addition of a hairpin cap whereby the 3 and 5 terminal nucleotides are Watson-Crick paired to adjacent nucleotides. A second hairpin cap can, additionally, be placed at the junction between the first and second strands distant from the 3 and 5 ends, so that the Watson-Crick pairing between the first and second strands is stabilized.
(36) The first and second strands contain two regions that are homologous with two fragments of the target gene, i.e., have the same sequence as the target gene. A homologous region contains the nucleotides of an RNA segment and may contain one or more DNA-type nucleotides of connecting DNA segment and may also contain DNA-type nucleotides that are not within the intervening DNA segment. The two regions of homology are separated by, and each is adjacent to, a region having a sequence that differs from the sequence of the target gene, termed a heterologous region. The heterologous region can contain one, two or three mismatched nucleotides. The mismatched nucleotides can be contiguous or alternatively can be separated by one or two nucleotides that are homologous with the target gene. Alternatively, the heterologous region can also contain an insertion or one, two, three or of five or fewer nucleotides. Alternatively, the sequence of the mixed duplex oligonucleotide may differ from the sequence of the target gene only by the deletion of one, two, three, or five or fewer nucleotides from the mixed duplex oligonucleotide. The length and position of the heterologous region is, in this case, deemed to be the length of the deletion, even though no nucleotides of the mixed duplex oligonucleotide are within the heterologous region. The distance between the fragments of the target gene that are complementary to the two homologous regions is identical to the length of the heterologous region where a substitution or substitutions is intended. When the heterologous region contains an insertion, the homologous regions are thereby separated in the mixed duplex oligonucleotide farther than their complementary homologous fragments are in the gene, and the converse is applicable when the heterologous region encodes a deletion.
(37) The RNA segments of the mixed duplex oligonucleotides are each a part of a homologous region, i.e., a region that is identical in sequence to a fragment of the target gene, which segments together preferably contain at least 13 RNA-type nucleotides and preferably from 16 to 25 RNA-type nucleotides or yet more preferably 18-22 RNA-type nucleotides or most preferably 20 nucleotides. In one embodiment, RNA segments of the homology regions are separated by and adjacent to, i.e., connected by an intervening DNA segment. In one embodiment, each nucleotide of the heterologous region is a nucleotide of the intervening DNA segment. An intervening DNA segment that contains the heterologous region of a mixed duplex oligonucleotide is termed a mutator segment.
(38) In another embodiment of the present invention, the gene repair oligonucleobase (GRON) is a single stranded oligodeoxynucleotide mutational vector (SSOMV), which is disclosed in International Patent Application PCT/US00/23457, U.S. Pat. Nos. 6,271,360, 6,479,292, and 7,060,500 which is incorporated by reference in its entirety. The sequence of the SSOMV is based on the same principles as the mutational vectors described in U.S. Pat. Nos. 5,756,325; 5,871,984; 5,760,012; 5,888,983; 5,795,972; 5,780,296; 5,945,339; 6,004,804; and 6,010,907 and in International Publication Nos. WO 98/49350; WO 99/07865; WO 99/58723; WO 99/58702; and WO 99/40789. The sequence of the SSOMV contains two regions that are homologous with the target sequence separated by a region that contains the desired genetic alteration termed the mutator region. The mutator region can have a sequence that is the same length as the sequence that separates the homologous regions in the target sequence, but having a different sequence. Such a mutator region can cause a substitution. Alternatively, the homologous regions in the SSOMV can be contiguous to each other, while the regions in the target gene having the same sequence are separated by one, two or more nucleotides. Such an SSOMV causes a deletion from the target gene of the nucleotides that are absent from the SSOMV. Lastly, the sequence of the target gene that is identical to the homologous regions may be adjacent in the target gene but separated by one, two, or more nucleotides in the sequence of the SSOMV. Such an SSOMV causes an insertion in the sequence of the target gene.
(39) The nucleotides of the SSOMV are deoxyribonucleotides that are linked by unmodified phosphodiester bonds except that the 3 terminal and/or 5 terminal internucleotide linkage or alternatively the two 3 terminal and/or 5 terminal internucleotide linkages can be a phosphorothioate or phosphoamidate. As used herein an internucleotide linkage is the linkage between nucleotides of the SSOMV and does not include the linkage between the 3 end nucleotide or 5 end nucleotide and a blocking substituent. In a specific embodiment the length of the SSOMV is between 21 and 55 deoxynucleotides and the lengths of the homology regions are, accordingly, a total length of at least 20 deoxynucleotides and at least two homology regions should each have lengths of at least 8 deoxynucleotides.
(40) The SSOMV can be designed to be complementary to either the coding or the non-coding strand of the target gene. When the desired mutation is a substitution of a single base, it is preferred that both the mutator nucleotide and the targeted nucleotide be a pyrimidine. To the extent that is consistent with achieving the desired functional result, it is preferred that both the mutator nucleotide and the targeted nucleotide in the complementary strand be pyrimidines. Particularly preferred are SSOMVs that encode transversion mutations, i.e., a C or T mutator nucleotide is mismatched, respectively, with a C or T nucleotide in the complementary strand.
(41) In addition to the oligodeoxynucleotide, the SSOMV can contain a 5 blocking substituent that is attached to the 5 terminal carbons through a linker. The chemistry of the linker is not critical other than its length, which should preferably be at least 6 atoms long and that the linker should be flexible. A variety of non-toxic substituents such as biotin, cholesterol or other steroids or a non-intercalating cationic fluorescent dye can be used. Particularly preferred reagents to make SSOMVs are the reagents sold as Cy3 and Cy5 by Glen Research, Sterling Va. (now GE Healthcare), which are blocked phosphoroamidites that upon incorporation into an oligonucleotide yield 3,3,3,3-tetramethyl N,N-isopropyl substituted indomonocarbocyanine and indodicarbocyanine dyes, respectively. Cy3 is particularly preferred. When the indocarbocyanine is N-oxyalkyl substituted it can be conveniently linked to the 5 terminal of the oligodeoxynucleotide as a phosphodiester with a 5 terminal phosphate. The chemistry of the dye linker between the dye and the oligodeoxynucleotide is not critical and is chosen for synthetic convenience. When the commercially available Cy3 phosphoramidite is used as directed, the resulting 5 modification consists of a blocking substituent and linker together which are a N-hydroxypropyl, N-phosphatidylpropyl 3,3,3,3-tetramethyl indomonocarbocyanine.
(42) In a preferred embodiment the indocarbocyanine dye is tetra substituted at the 3 and 3 positions of the indole rings. Without limitations as to theory these substitutions prevent the dye from being an intercalating dye. The identity of the substituents at these positions is not critical. The SSOMV can in addition have a 3 blocking substituent. Again the chemistry of the 3 blocking substituent is not critical.
(43) The mutations herein described might also be obtained by mutagenesis (random, somatic or directed) and other DNA editing or recombination technologies including, but not limited to, gene targeting using site-specific homologous recombination by zinc finger nucleases.
(44) Increasing Efficiency of Targeted Gene Modification
(45) Nucleic acids which direct specific changes to the genome may be combined with various approaches to enhance the availability of components of the natural repair systems present in the cells being targeted for modification. These approaches include, but are not limited to, the use of Transcription Activator-Like Effector Nucleases (TALENs) or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). See, e.g., WO2014/144951 and WO2014/144951, the contents of each of which are hereby incorporated by reference.
(46) TALENs are targetable nucleases are used to induce single- and double-strand breaks into specific DNA sites, which are then repaired by mechanisms that can be exploited to create sequence alterations at the cleavage site. The fundamental building block that is used to engineer the DNA-binding region of TALENs is a highly conserved repeat domain derived from naturally occurring TALEs encoded by Xanthomonas spp. proteobacteria. DNA binding by a TALEN is mediated by arrays of highly conserved 33-35 amino acid repeats that are flanked by additional TALE-derived domains at the amino-terminal and carboxy-terminal ends of the repeats. These TALE repeats specifically bind to a single base of DNA, the identity of which is determined by two hypervariable residues typically found at positions 12 and 13 of the repeat, with the number of repeats in an array corresponded to the length of the desired target nucleic acid, the identity of the repeat selected to match the target nucleic acid sequence. The target nucleic acid is preferably between 15 and 20 base pairs in order to maximize selectivity of the target site. Cleavage of the target nucleic acid typically occurs within 50 base pairs of TALEN binding. Computer programs for TALEN recognition site design have been described in the art. See, e.g., Cermak et al., Nucleic Acids Res. 2011 July; 39(12): e82. Once designed to match the desired target sequence, TALENS can be expressed recombinantly and introduced into protoplasts as exogenous proteins, or expressed from a plasmid within the protoplast.
(47) Similarly, the CRISPR/Cas system can be used for gene editing. By delivering the Cas9 or other CRISPR-associated protein and appropriate guide RNAs (gRNAs) into a cell, the organism's genome can be cut at any desired location. The gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement to the target sequence in the genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the wild-type Cas9 can cut both strands of DNA causing a Double Strand Break (DSB). Cas9 will cut 3-4 nucleotides upstream of the PAM sequence. A DSB can be repaired through one of two general repair pathways: (1) the Non-Homologous End Joining (NHEJ) DNA repair pathway or (2) the Homology Directed Repair (HDR) pathway. The HDR pathway utilizes a repair template to fix the DSB. HDR faithfully copies the sequence of the repair template to the cut target sequence. Specific nucleotide changes can be introduced into a targeted gene by the use of HDR with a repair template to edit a gene.
(48) Another class of artificial endonucleases is the engineered meganucleases. Engineered homing endonucleases are generated by modifying the specificity of existing homing endonucleases. In one approach, variations are introduced in the amino acid sequence of naturally occurring homing endonucleases and then the resultant engineered homing endonucleases are screened to select functional proteins which cleave a targeted binding site. In another approach, chimeric homing endonucleases are engineered by combining the recognition sites of two different homing endonucleases to create a new recognition site composed of a half-site of each homing endonuclease.
(49) Delivery of Gene Repair Oligonucleobases into Plant Cells
(50) Any commonly known method used to transform a plant cell can be used for delivering the gene repair oligonucleobases. Illustrative methods are listed below.
(51) Microcarriers and Microfibers
(52) The use of metallic microcarriers (microspheres) for introducing large fragments of DNA into plant cells having cellulose cell walls by projectile penetration is well known to those skilled in the relevant art (henceforth biolistic delivery). U.S. Pat. Nos. 4,945,050; 5,100,792 and 5,204,253 describe general techniques for selecting microcarriers and devices for projecting them.
(53) Specific conditions for using microcarriers in the methods of the present invention are described in International Publication WO 99/07865. In an illustrative technique, ice cold microcarriers (60 mg/mL), mixed duplex oligonucleotide (60 mg/mL) 2.5 M CaCl.sub.2 and 0.1 M spermidine are added in that order; the mixture gently agitated, e.g., by vortexing, for 10 minutes and then left at room temperature for 10 minutes, whereupon the microcarriers are diluted in 5 volumes of ethanol, centrifuged and resuspended in 100% ethanol. Good results can be obtained with a concentration in the adhering solution of 8-10 g/L microcarriers, 14-17 g/mL mixed duplex oligonucleotide, 1.1-1.4 M CaCl.sub.2 and 18-22 mM spermidine. Optimal results were observed under the conditions of 8 g/L microcarriers, 16.5 g/mL mixed duplex oligonucleotide, 1.3 M CaCl.sub.2 and 21 mM spermidine.
(54) Gene repair oligonucleobases can also be introduced into plant cells for the practice of the present invention using microfibers to penetrate the cell wall and cell membrane. U.S. Pat. No. 5,302,523 to Coffee et al. describes the use of 30.times.0.5 m and 10.times.0.3 m silicon carbide fibers to facilitate transformation of suspension maize cultures of Black Mexican Sweet. Any mechanical technique that can be used to introduce DNA for transformation of a plant cell using microfibers can be used to deliver gene repair oligonucleobases for transmutation.
(55) An illustrative technique for microfiber delivery of a gene repair oligonucleobase is as follows: Sterile microfibers (2 g) are suspended in 150 L of plant culture medium containing about 10 g of a mixed duplex oligonucleotide. A suspension culture is allowed to settle and equal volumes of packed cells and the sterile fiber/nucleotide suspension are vortexed for 10 minutes and plated. Selective media are applied immediately or with a delay of up to about 120 h as is appropriate for the particular trait.
(56) Protoplast Electroporation
(57) In an alternative embodiment, the gene repair oligonucleobases can be delivered to the plant cell by electroporation of a protoplast derived from a plant part. The protoplasts are formed by enzymatic treatment of a plant part, particularly a leaf, according to techniques well known to those skilled in the art. See, e.g., Gallois et al., 1996, in Methods in Molecular Biology 55:89-107, Humana Press, Totowa, N.J.; Kipp et al., 1999, in Methods in Molecular Biology 133:213-221, Humana Press, Totowa, N.J. The protoplasts need not be cultured in growth media prior to electroporation. Illustrative conditions for electroporation are 3.times.10.sup.5 protoplasts in a total volume of 0.3 mL with a concentration of gene repair oligonucleobase of between 0.6-4 g/mL.
(58) Protoplast PEG-Mediated DNA Uptake
(59) In an alternative embodiment, nucleic acids are taken up by plant protoplasts in the presence of the membrane-modifying agent polyethylene glycol, according to techniques well known to those skilled in the art (see, e.g., Gharti-Chhetri et al., 1992; Datta et al., 1992).
(60) Microinjection
(61) In an alternative embodiment, the gene repair oligonucleobases can be delivered by injecting it with a microcapillary into plant cells or into protoplasts (see, e.g., Miki et al., 1989; Schnorf et al., 1991).
(62) Selection of Herbicide Resistant Plants and Application of Herbicide
(63) Plants and plant cells can be tested for resistance or tolerance to an herbicide using commonly known methods in the art, e.g., by growing the plant or plant cell in the presence of an herbicide and measuring the rate of growth as compared to the growth rate in the absence of the herbicide.
(64) As used herein, substantially normal growth of a plant, plant organ, plant tissue or plant cell is defined as a growth rate or rate of cell division of the plant, plant organ, plant tissue, or plant cell that is at least 35%, at least 50%, at least 60%, or at least 75% of the growth rate or rate of cell division in a corresponding plant, plant organ, plant tissue or plant cell expressing the wild-type AHAS protein.
(65) As used herein, substantially normal development of a plant, plant organ, plant tissue or plant cell is defined as the occurrence of one or more development events in the plant, plant organ, plant tissue or plant cell that are substantially the same as those occurring in a corresponding plant, plant organ, plant tissue or plant cell expressing the wild-type AHAS protein.
(66) In certain embodiments plant organs provided herein include, but are not limited to, leaves, stems, roots, vegetative buds, floral buds, meristems, embryos, cotyledons, endosperm, sepals, petals, pistils, carpels, stamens, anthers, microspores, pollen, pollen tubes, ovules, ovaries and fruits, or sections, slices or discs taken therefrom. Plant tissues include, but are not limited to, callus tissues, ground tissues, vascular tissues, storage tissues, meristematic tissues, leaf tissues, shoot tissues, root tissues, gall tissues, plant tumor tissues, and reproductive tissues. Plant cells include, but are not limited to, isolated cells with cell walls, variously sized aggregates thereof, and protoplasts.
(67) Plants are substantially tolerant to a relevant herbicide when they are subjected to it and provide a dose/response curve which is shifted to the right when compared with that provided by similarly subjected non-tolerant like plant. Such dose/response curves have dose plotted on the X-axis and percentage kill, herbicidal effect, etc., plotted on the y-axis. Tolerant plants will require more herbicide than non-tolerant like plants in order to produce a given herbicidal effect. Plants that are substantially resistant to the herbicide exhibit few, if any, necrotic, lytic, chlorotic or other lesions, when subjected to herbicide at concentrations and rates which are typically employed by the agrochemical community to kill weeds in the field. Plants which are resistant to an herbicide are also tolerant of the herbicide.
EXAMPLES
(68) Following are examples, which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Example 1: Preparation of Herbicide-Resistant Euphorbiaceae Samples
(69) Unless otherwise specified, as used herein, numbering of the gene(s) is based on the amino acid sequence of the Arabidopsis acetolactate synthase (ALS) or acetohydroxyacid synthase (AHAS) At3g48560 (SEQ ID NO:4). In references prior to October 2005, the S653 position (based on the Arabidopsis amino acid sequence) is referred to as S621 based on the corn amino acid sequences ZmAHAS108 and ZmAHAS109 (Fang et al., 1992).
(70) Mutations were generated by site-directed mutagenesis (SDM) of the wild-type Cassava AHAS gene 1 and transformed into CHI bacterial cells lacking the endogenous AHAS homolog. Serially-diluted cells were plated onto plates with increasing concentrations of either imazamox (IM) or flumetsulam (TP). Cassava AHAS wt and a canola ALS mutant known to be highly herbicide tolerant were used as negative and positive controls, respectively. The results are shown in
(71) Cells with the negative control wt cassava AHAS gene grew on plates with no herbicide, but failed to grow on plates containing either the IM or TP herbicide. Positive control cells with the canola ALS mutant grew on all concentrations of IM and TP, until all growth ceased at 5 mM IM or TP.
(72) Cells with the cassava W574S mutant display robust growth on both IM and TP containing plates that was similar to the canola positive control.
(73) Mutants were also tested using a kill curve assay where equal numbers of cells containing the mutant of interest were plated onto plates with increasing concentrations of herbicide and the number of resulting colonies counted. Kill curve results averaged between three experiments, each with an average of three technical replicates. Error bars are one standard deviation of the averaged data. Results are depicted in
Example 2: Preparation of Herbicide-Resistant Euphorbiaceae Samples
(74) Mutations were generated by site-directed mutagenesis (SDM) of the wild-type Cassava AHAS gene 1 and transformed into CHI bacterial cells lacking the endogenous AHAS homolog. Serially-diluted cells were plated onto plates with increasing concentrations of either imazamox (IM) or flumetsulam (TP). Cassava AHAS wt and a canola ALS mutant known to be highly herbicide tolerant were used as negative and positive controls, respectively. The results are shown in
(75) Cells with the negative control wt cassava AHAS gene grew on plates with no herbicide, but failed to grow on plates containing either the IM or TP herbicide. Positive control cells with the canola ALS mutant grew on all concentrations of IM and TP, until all growth ceased at 5 mM IM or TP.
(76) D376A, and its robust tolerance to IM, is surprising as this has not been described in cassava to date. W574L also has robust tolerance to both TP and IM, although growth is inconsistent.
(77) Mutants were also tested using a kill curve assay where equal numbers of cells containing the mutant of interest were plated onto plates with increasing concentrations of herbicide and the number of resulting colonies counted. Kill curve results averaged between three experiments, each with an average of three technical replicates. Error bars are one standard deviation of the averaged data. Results are depicted in
Example 3: Production of Cassava Plant Tissues from Culture
(78) In vitro plantlets are maintained by monthly subcultures as shoot cuttings following the procedure described by Hankoua et al., Regeneration of a wide range of African cassava genotypes via shoot organogenesis from cotyledon of maturing somatic embryos and conformity of the field-established regenerants. Plant Cell, Tiss. Org. 81(2):200-211, 2005. Shoot apical meristems and immature leaf lobes (0.1-0.9 mm in length) are exited from plantlets 10-14-days after previous subculture and cultured on picloram-based embryo induction medium (P-CIM) for the induction of primary somatic embryos and organized embryogenic structure (OES). OES are divided into small clusters of 5-10 embryos each and transferred into cassava embryo maturation media (CMML) (Table 1) as described by Hankoua et al. (2005) to enhance their development into green cotyledon stage embryos. Green cotyledon pieces (about 5 mm.sup.2 each), obtained from 14-15 days old cotyledonary stage embryos using scalpel blades, are placed on P-CIM for the production of secondary somatic embryos. Secondary somatic embryo clusters induced from P-CIM are transferred to CMML for maturation. Green somatic cotyledon pieces obtained from 14-15 day-old secondary stage embryos are placed on P-CIM for induction of cyclic somatic embryogenesis. OES induced from all cassava genotypes are fragmented into small pieces of about 5 mm.sup.2 each and sub cultured onto friable callus induction medium and maintenance medium (FEC-IM) for the induction of friable embryogenic callus (FEC) as described by Taylor et al., Development of friable embryogenic callus and embryogenic suspension systems in cassava (Manihot esculenta Crantz), Nature Biotechnol. 14(6):726-730, 1996. FEC-IM is modified by the inclusion of 25-mg/l-casein hydrolysate and 2 M copper sulfate. Calli with the potential to develop into FECs and induced FECs are sub-cultured on the same medium for the selection and proliferation of high quality friable embryogenesis callus. Embryogenic suspensions are initiated by transferring approximately 35 mg of pure FEC into 50 ml embryogenesis suspension medium (EMS) and culturing as described by Taylor et al. (1996). All cultures are incubated in the growth room at temperatures varying from 25 C. to 28 C. either under total dark (one week) for embryo induction from leaf lobe and apical meristem explants or with a photoperiod of 16 h (40-100 m photon s.sup.1 m.sup.2 PAR) for multiplication and maintenance of all other tissues. Unless otherwise stipulated, all culture media are supplemented with 0.6% agar.
Example 4. Isolation of Cassava Protoplasts
(79) Two grams of FEC is placed in Petri dishes containing 10 ml of cell wall digestion solution. Cell wall digestion solution consisted of a mixture of cell wall degrading enzymes; 10 mg/l pectolyase, 10 g/l cellulose, 200 mg/l macero enzym growth regulators (NAA 1 mg/l, 2,4-D 1 mg/l, Zeatin 1 mg/l), major salts (368 mg/l CaCl.sub.2; 34 mg/l KH.sub.2PO.sub.4; 740 mg/KNO.sub.3; 492 mg/l MgSO.sub.4.7H.sub.2O); minor salts (19.2 mg/l NA-EDTA; 14 mg/l FeSO.sub.4.7H.sub.2O) and osmoticum (91 g/l D-mannitol) and 0.5 g/l MES. The cell wall degrading enzymes cellulase (1-10 g/l) plus Macerozyme (200 mg/l) are successful for protoplast isolation. The extra addition of Pectolyase (0.001-0.01 g/l) and/or Driselase (0.02 g/l) increased the yield of protoplasts. After 18 h of incubation, 10 ml of washing medium is added to the solution. Washing medium with an osmolarity 0.530 mOsm/kg consisted of major salts (see cell wall digestion solution), 45.5 g/l mannitol and 7.3 g/l NaCl. The digested tissue is filtered through a 73 M pore size filter (PA 55/34 Nybolt-Switzerland) into a 250 ml beaker glass. The filtrate is divided equally over two 12 ml conical screw cap tubes, and centrifuged at 600 rpm for 3 min. (Mistral 2000). The washing procedure is repeated once after removal of the supernatant. The protoplast solution is resuspended by floating on 9.5 ml solution containing major and minor salts (see cell wall digestion solution) and 105 g/l sucrose. The pH is 5.8 and the osmolarity 0.650 mOsm. The solution with protoplasts is allowed to equilibrate for 5 minutes before 0.5 ml of washing medium is gently added on the top. After centrifugation at 700 rpm for 15 min. (Mistral 2000), the protoplasts ware concentrated in a band between the sucrose and washing medium. The protoplast layer is harvested with a pasteur pipette and the yield is counted in a standard haemocytometer chamber.
Example 5: Protoplast Culture
(80) Protoplasts ware cultured in media solidified with agarose 0.2% w/v in petri dishes containing 10 ml of the same liquid medium. The following media resulted in the formation of micro callus:
(81) TM2G medium (Wolters et al., 1991) supplemented with only auxins (0.1-10 mg/l NAA or 0.1-10 mg/l Picloram, or 0.1-10 mg/l IAA, or 0.1-10 mg/l 2,4-D, or 0.1-10 mg/l Dicamba, or 0.1-10 mg/l, or 0.1-10 mg/l) or auxins plus cytokinins (0.01-1 mg/l zeatin, 0.01-1 mg/l 2-iP, 0.01-1 mg/l BA, 0.01-1 mg/l TDZ, 0.01-1 mg/l kinetin).
(82) Medium A (Murashige and Skoog (1962) salts and vitamins, 4.5 g/l myo-inositol, 4.55 g/l mannitol, 3.8 g/l xylitol, 4.55 g/l sorbitol, 0.098 g/l MES, 40 mg/l adeninsulphate and 150 mg/l caseinhydrolysate, 0.5 mg/l d-calcium-panthotenate, 0.1 mg/l choline-chloride, 0.5 mg/l ascorbic acid, 2.5 mg/l nicotinic acid, 1 mg/l pyridoxine-HCl, 10 mg/l thiamine-HCl, 0.5 mg/l folic acid, 0.05 mg/l biotine, 0.5 mg/l glycine, 0.1 mg/l L-cysteine and 0.25 mg/l riboflavine and 59.40 g/l glucose) supplemented with only auxins (0.1-10 mg/l NAA or 0.1-10 mg/l Picloram, or 0.1-10 mg/l IAA, or 0.1-10 mg/l 2,4-D, or 0.1-10 mg/l Dicamba plus cytokinins (0.01-1 mg/l zeatin, 0.01-1 mg/l 2-iP, 0.01-1 mg/l BA, 0.01-1 mg/l TDZ, 0.01-1 mg/l kinetin).
(83) The media are refreshed every 10 days, by replacing 9 ml with fresh medium. After two months of culture in the first medium, high quality FEC is selected and either culture for further proliferation or for maturation. For proliferation FEC is transferred to Gresshoff and Doy medium supplemented with 40 g/l sucrose, 7 g/l Daichin agar and 2 mg/l picloram (GD4). After 3 weeks the FEC is transferred to a Gresshoff and Doy medium supplemented with 20 g/l sucrose, 7 g/l agar and 10 mg/l Picloram (GD2). Suspension cultures ware initiated by transferring 1.0 g of FEC to liquid SH6% medium supplemented with 10 mg/l Picloram. Two weeks later the suspension is divided over new flasks with an initial packed cell volume of 1.0 nil.
(84) After 2 months of culture, 10.sup.4 protoplasts cultured in TM2G supplemented with 0.5 mg/l NAA and 1 mg/l Zeatin at a density of 10.sup.5/ml can produce>1000 micro-calli, whereas 10.sup.4 protoplasts cultured at a density of 10.sup.6/ml can produced 64 micro-calli. Replacing TM2G medium with medium A reduced at both densities the number of micro-calli significantly. At this stage at least three types of calli can be distinguished. One type consists of globular shaped embryos which are mostly observed in protoplasts cultured at a density of 10.sup.6. Some of them develop cotyledon like structures, light green in color. However, these embryos may not germinate properly. Another type is fast growing and consisted of a large compact callus. This callus never develops embryos. The third type is highly friable callus and is observed at both densities. At a density of 2-510.sup.5 (medium TM2G) about 60% of the calli are friable and embryogenic. The FEC can either be subcultured for further proliferation or for maturation.
Example 6: Proliferation of FEC Derived from Protoplasts
(85) Following selection of FEC, 0.1 g of it cultured for three weeks on GD4 plus 2 mg/l Picloram increases into 0.7 g of tissue. More than 95% of the tissue consists of high quality FEC. Subsequently, this tissue is maintained by subcultures of three weeks on GD2 medium supplemented with 10 mg/l Picloram. To initiate suspension cultures, FEC is transferred to liquid medium.
Example 7: Maturation of FEC Derived from Protoplasts
(86) FEC isolated after two months of culture in TM2G is cultured on maturation medium. Maturation medium consisted of Murashige and Skoog (1962) salts and vitamins, 10 g/l Daichin agar, 0.1 g/l myo-inositol, 20 g/l sucrose, 18.2 g/l mannitol, 0.48 g/l MES, 0.1 g/l caseinhydrolysate, 0.08 g/l adenine sulphate, 0.5 mg/l d-calcium-panthotenate, 0.1 mg/l choline chloride, 0.5 mg/l ascorbic acid, 2. Mg/l nicotinic acid, 1 mg/l pyridoxine-HCl, 10 mg/l thiamine HCl, 0.5 mg/l folic acid, 0.05 mg/l biotin, 0.5 mg/l glycine, 0.1 mg/l L-cysteine, 0.25 mg/l riboflavine and 1 mg/l picloram. This maturation medium is refreshed every 3 weeks.
(87) On this medium there is a gradual shift from proliferation to maturation. As a result the packed cell volume increases by a factor 4 after two weeks of culture in liquid maturation medium. Also after transfer to solid maturation medium there is proliferation. After two weeks on solid medium most of the embryos reach a globular shape and only a few of these globular embryos developed further. The first torpedo shaped embryos become visible after one month of culture on solid maturation medium. The number of mature and torpedo shaped embryos are not correlated with the plating efficiency but with the density of the initially cultured protoplasts. No such embryos are obtained if protoplasts are cultured on TM2G without growth regulators. The highest number of mature and torpedo shaped embryos is formed from protoplasts cultured on TM2G supplemented with 0.5 mg/l NAA and 1 mg/l Zeatin. After 3 months of culture between 60 and 200 torpedo shaped and mature embryos are isolated per agarose drop. Torpedo shaped embryos become mature at high frequency if they are cultured on fresh maturation medium or on MS2 plus 0.1 mg/l BAP.
Example 8: Secondary Somatic Embryogenesis and Germination of Mature Embryos Derived from Protoplasts
(88) In both liquid and solid medium 2,4-D is superior for induction of secondary embryogenesis as compared to NAA. If mature embryos are first cultured in 2,4-D and then in liquid NAA the response is comparable with culture in 2,4-D alone. Also embryos which first had undergone a cycle of secondary somatic embryogenesis in medium with 2,4-D, produced highly efficient secondary embryos in MS20 supplemented with 10 mg/l NAA. Desiccation stimulated normal germination of NAA induced embryos. However, the desiccated embryos, require a medium supplemented with cytokinins such as benzytaminopurine (BAP) for high frequency germination. With 1 mg/l BAP plants with thick and short taproots and branched shoots with short internodes are formed. With 0.1 mg/l BAP the taproots are thin and slender. Also desiccated embryos which are cultured in the dark require a lower concentration of BAP and, furthermore, these embryos germinate faster than embryos cultured in the light. Complete plants are obtained four weeks after the start of somatic embryo induction. 2,4-D induced embryos show a different response. In all genotypes desiccation stimulates root formation. Embryos cultured in the dark form predominantly adventitious roots, whereas embryos cultured in the light form predominantly taproots.
Example 9: CRISPRs and GRONs in Cassava
(89) This example demonstrates AHAS W574S conversion in Manihot esculenta at 4 weeks after PEG delivery of CRISPR-Cas9 plasmids and GRONs into protoplasts. The CRISPR-Cas9 used in this experiment targets the AHAS genes in the cassava genome by introducing into protoplasts plasmid(s) encoding the Cas9 gene and sgRNAs. The sgRNA is a fusion of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The crRNA guides the Cas9 to the target genes, where Cas9 creates a double-stranded break in the AHAS genes and the GRONs are used as a template to convert the AHAS genes in a site-directed manner.
(90) Methods
(91) Cassava protoplasts were isolated from root cell suspensions. The CRISPR-Cas9 encoding plasmid (pTD1315,
(92) The CRISPR consists of two components: the plant codon-optimized Streptococcus pyogenes Cas9 (SpCas9) and sgRNA both of which were expressed from the same plasmid. The sgRNA is a fusion of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The crRNA region contains the spacer sequence 5-ACGAGGAGGGGCTTGGGTTGTGG-3 (SEQ ID NO: 6) used to guide the Cas9 nuclease to the target gene. In this experiment the CRISPRs target the AHAS genes. The following sequences were utilized in these methods:
(93) TABLE-US-00002 AHAS1sgRNA(SEQIDNO:7): ATTTGGGAATGGTGGTACAATGGGAGG AHAS2sgRNA(SEQIDNO:8): GAACAATCAACATCTGGGTATGGTTGTTCAATGG AHAS1-2-CGRON(SEQIDNO:9): TCTGCCAATTAAAATAATGCTTTTGAATAATCAGCATTTGGGAATGGTGG TACAATCGGAAGACCGATTCTACAAGGCTAATAGAGCTCATACTTATTTG GGGGATCCATCAA AHAS2-2-CGRON(SEQIDNO:10): ACCTGCCTGTGAAGATCTTGTTACTGAACAATCAACATCTGGGTATGGTT GTTCAGTCGGAGGACAGATTCTATCATTCCAACAGAGCACATACATATTT AGGGAACCCATCA
(94) Results
(95) At 4 weeks, rice protoplasts have 0.024% AHAS1 and 0.007% AHAS2 gene conversion as determined by NGS. GRON only controls with no CRISPR-Cas9 and the untreated controls showed no conversion. Additionally, these data show that the CRISPR-Cas9 is active and able to cleave the AHAS target genes and form indels at a rate up to 52.1%.
REFERENCES
(96) Datta S K, Datta K, Soltanifar N, Donn G, Potrykus I (1992) Herbicide-resistant Indica rice plants from IRRI breeding line IR72 after PEG-mediated transformation of protoplasts. Plant Molec. Biol. 20:619-629 Dovzhenko A (2001) Towards plastid transformation in rapeseed (Brassica napus L.) and sugarbeet (Beta vulgaris L.). PhD Dissertation, LMU Munich, Faculty of Biology Duggleby, R. G. McCourt, J. A.; Guddat L. W. Plant Physiology and Biochemistry. 46, (2008) 309-324. Edwards K, Johnstone C, Thompson C (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 19:1349. Frigerio L, Vitale A, Lord J M, Ceriotti A, Roberts L M (1998) Free ricin A chain, proricin, and native toxin have different cellular fates when expressed in tobacco protoplasts. J Biol Chem 273:14194-14199 Fang L Y, Gross P R, Chen C H, Lillis M (1992) Sequence of two acetohydroxyacid synthase genes from Zea mays. Plant Mol Biol. 18(6):1185-7 Gharti-Chhetri G B, Cherdshewasart W, Dewulf J, Jacobs M, Negrutiu I (1992) Polyethylene glycol-mediated direct gene transfer in Nicotiana spp. Physiol. Plant. 85:345-351 Klaus S (2003) Markerfreie transplastome Tabakpflanzen (Marker-free transplastomic tobacco plants). PhD Dissertation, LMU Munich, Faculty of Biology Miki B, Huang B, Bird S, Kemble R, Simmonds D, Keller W (1989) A procedure for the microinjection of plant cells and protoplasts. Meth. Cell Science 12:139-144 Pelletier G, Primard C, Vedel F, Chetrit P, Remy R, Rouselle P, Renard M (1983) Intergeneric cytoplasm hybridization in Cruciferae by protoplast fusion. Mol. Gen. Genet. 191: 244-250 Schnorf M, Neuhaus-Url G, Galli A, Iida S, Potrykus I, Neuhaus G (1991) An improved approach for transformation of plant cells by microinjection: molecular and genetic analysis. Transgen. Res. 1:23-30 Tan S, Evans R R, Dahmer M L, Singh B K, Shaner D L (2005) Imidazolinone-tolerant crops: history, current status and future. Pest Manag Sci. 61(3):246-57.
(97) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
(98) The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof. It is recognized that various modifications are possible within the scope of the invention claimed.
(99) Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification, improvement, and variation of the inventions disclosed may be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this invention. The materials, methods, and examples provided here are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.
(100) The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
(101) In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
(102) All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.
(103) Other embodiments are set forth within the following claims.