EVOLUTION OF BIOACTIVE SEQUENCE-DEFINED SYNTHETIC POLYMERS USING DNA-TEMPLATED POLYMERIZATION
20200172896 ยท 2020-06-04
Assignee
Inventors
Cpc classification
C12N15/1068
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides methods and compositions for performing ordered multi-step syntheses involving modified nucleic acids by nucleic acid-mediated chemistry. This approach is useful for generating sequence-defined highly functionalized nucleic acid polymers. The invention also provides modified nucleic acid polymers that bind to proteins of interest (e.g., PCSK9 and IL-6), which are implicated in human disease.
Claims
1. A modified nucleic acid library comprising one or more modified cytosine (C) residues, and/or one or more modified thymine (T) residues (a) wherein the one or more modified C residues are of the formula: ##STR00029## and (b) wherein the one or more modified T residues are of the formula: ##STR00030## wherein: each instance of - - - is independently a single, double, or triple bond; each instance of n is independently 0, 1, 2, 3, 4, 5, or 6; each instance of ##STR00031## is independently a single bond, O, S, N(R.sup.A), C(O), C(O)O, C(O)N(R.sup.A), C(NR.sup.A), C(NR.sup.A)O, C(NR.sup.A)N(R.sup.A), NR.sup.AC(O), NR.sup.AC(O)O, NR.sup.AC(O)N(R.sup.A), NR.sup.AC(NR.sup.A), NR.sup.AC(NR.sup.A)O, NR.sup.AC(NR.sup.A)NR.sup.A), OC(O), OC(O)O, OC(O)N(R.sup.A), OC(NR.sup.A), OC(NR.sup.A)O, or OC(NR.sup.A)N(R.sup.A), wherein each instance of R.sup.A is independently hydrogen, substituted or unsubstituted C.sub.1-6 alkyl, or a nitrogen protecting group; each instance of R is independently substituted or unsubstituted C.sub.1-12 alkyl; substituted or unsubstituted C.sub.2-12 alkenyl; substituted or unsubstituted C.sub.2-12 alkynyl; substituted or unsubstituted, 3- to 13-membered, monocyclic or bicyclic carbocyclyl; substituted or unsubstituted, 3- to 13-membered, monocyclic or bicyclic heterocyclyl; substituted or unsubstituted, 6- to 11-membered, monocyclic or bicyclic aryl; or substituted or unsubstituted, 5- to 11-membered, monocyclic or bicyclic heteroaryl.
2. The modified nucleic acid library of claim 1, wherein each instance of - - - is a double bond.
3. The modified nucleic acid library of claim 1 or 2, wherein each instance of n is 0.
4. The modified nucleic acid library of any one of the preceding claims, wherein each instance of ##STR00032## is a single bond.
5. The modified nucleic acid library of any one of the preceding claims, wherein each instance of ##STR00033## is C(O)N(R.sup.A).
6. The modified nucleic acid library of any one of the preceding claims, wherein each instance of ##STR00034## is C(O)NH.
7. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is substituted or unsubstituted C.sub.1-12 alkyl.
8. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is ##STR00035##
9. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is substituted or unsubstituted, 3- to 13-membered, monocyclic or bicyclic carbocyclyl.
10. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is ##STR00036##
11. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is substituted or unsubstituted, 6- to 11-membered, monocyclic or bicyclic aryl.
12. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is ##STR00037##
13. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is substituted or unsubstituted, 5- to 11-membered, monocyclic or bicyclic heteroaryl.
14. The modified nucleic acid library of any one of the preceding claims, wherein each instance of R is ##STR00038##
15. The modified nucleic acid library of any one of the preceding claims, wherein the library comprises one or more tri-oligonucleotides, and wherein the one or more tri-oligonucleotides comprises the modified C or T of any one of claims 1-3 at the 5 end of the one or more tri-oligonucleotides.
16. The modified nucleic acid library of any one of the preceding claims, wherein the library comprises one or more of the following modified tri-oligonucleotides: (a) C.sub.1TT, C.sub.1TG, C.sub.1GT, C.sub.1CG, wherein C.sub.1 is ##STR00039## wherein R is ##STR00040## (b) C.sub.2AA, C.sub.2AC, C.sub.2TC, C.sub.2GG, wherein C.sub.2 is ##STR00041## wherein R is ##STR00042## (c) C.sub.3AT, C.sub.3AG, C.sub.3GA, C.sub.3GC, wherein C.sub.3 is ##STR00043## wherein R is ##STR00044## (d) C.sub.4TA, C.sub.4CA, C.sub.4CT, C.sub.4CC, wherein C.sub.4 is ##STR00045## wherein R is ##STR00046## (e) T.sub.1TT, T.sub.1TG, T.sub.1GT, T.sub.1CG, wherein T.sub.1 is ##STR00047## wherein R is ##STR00048## (f) T.sub.2AT, T.sub.2AG, T.sub.2GA, T.sub.2GC, wherein T.sub.2 is ##STR00049## wherein R is ##STR00050## (g) T.sub.3AA, T.sub.3AC, T.sub.3CA, T.sub.3CC, wherein T.sub.3 is ##STR00051## wherein R is ##STR00052## and (h) T.sub.4TA, T.sub.4TC, T.sub.4CT, T.sub.4GG, wherein T.sub.4 is ##STR00053## wherein R is ##STR00054##
17. The modified nucleic acid library of claim 16, wherein the library comprises the modified tri-oligonucleotides of (a-h).
18. A modified nucleic acid comprising the modified nucleic acid sequence C.sub.1CAC.sub.2GTT.sub.3ACT.sub.4GAT.sub.5TCT.sub.6TCT.sub.7ACC.sub.8GTT.sub.9TTT.sub.10GCC.sub.11CCC.sub.12GGC.sub.13ACC.sub.14TT C.sub.15TG (SEQ ID NO: 67), (a) wherein T.sub.9 comprises the structure ##STR00055## wherein R is ##STR00056## or wherein T.sub.9 comprises the structure ##STR00057## wherein R is H, and (b) wherein C.sub.14 comprises the structure ##STR00058## wherein R is ##STR00059##
19. The modified nucleic acid of claim 18, wherein C.sub.13 comprises the structure ##STR00060## wherein R is ##STR00061##
20. The modified nucleic acid of claim 18 or 19, wherein the modified nucleic acid binds to PCSK9.
21. A modified nucleic acid comprising the modified nucleic acid sequence T.sub.1GCT.sub.2GCT.sub.3GTT.sub.4TAT.sub.5TTC.sub.6GTT.sub.7GCC.sub.8CTT.sub.9CCT.sub.10CGT.sub.11ACT.sub.12CAT.sub.13TCC.sub.14TCC.sub.15GG (SEQ ID NO: 68), wherein C.sub.14 and C.sub.15 comprise the structure ##STR00062## wherein R is ##STR00063##
22. The modified nucleic acid of claim 21, wherein the modified nucleic acid binds to IL-6.
23. A pharmaceutical composition comprising the modified nucleic acid of any one of claims 18-22.
24. A method of treating a subject in need thereof comprising administering to the subject the pharmaceutical composition of claim 23.
25. A method of inhibiting PCSK9 activity comprising contacting a PCSK9 protein with the modified nucleic acid of any one of claims 18-20.
26. A method of inhibiting IL-6 activity comprising contacting an IL-6 protein with the modified nucleic acid of any one of claims 21-22.
27. A method of making a modified nucleic acid polymer, the method comprising (a) contacting two or more nucleic acid molecules from the library of any one of claims 1-17 with a template nucleic acid, thereby forming a complex, wherein the two or more nucleic acid molecules from the library bind to the template nucleic acid, and (b) contacting the complex of (a) with a ligase, thereby ligating the two or more nucleic acid molecules from the library to form the modified nucleic acid polymer.
28. The method of claim 27, wherein at least 5, 10, 15, 20, 30, 40 or 50 nucleic acid molecules from the library are bound to the template nucleic acid of (a) and are ligated together in (b) to form the modified nucleic acid polymer.
29. A method of making a library of modified nucleic acid polymers, the method comprising (a) contacting the modified nucleic acid library of any one of claims 1-17 with a library of template nucleic acids, thereby forming complexes between modified nucleic acids of the modified nucleic acid library and template nucleic acids of the library of template nucleic acids, and (b) contacting the complexes of (a) with a ligase, thereby forming a library of modified nucleic acid polymers.
30. A method of generating a modified nucleic acid polymer that binds to a target protein comprising (a) contacting the library of modified nucleic acid polymers of claim 29 with the target protein, and (b) isolating one or more nucleic acid polymers that bind to the target protein.
31. The method of claim 30, further comprising repeating steps (a)-(b) two or more times.
32. The method of claim 30, further comprising repeating steps (a)-(b) at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.
33. The method of claim 30, further comprising (c) reverse transcribing one or more of the nucleic acid polymers of (b).
34. The method of claim 33, further comprising repeating steps (a)-(c) two or more times.
35. The method of claim 33, further comprising repeating steps (a)-(c) at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0004]
[0005]
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
EXAMPLES
[0019] Some aspects of the disclosure are based at least in part on the surprising discovery that modified tri-nucleotide polymers may be assembled using nucleic acid chemistry to evolve sequence-defined highly functionalized nucleic acid polymers that are capable of binding proteins (e.g., PCSK9 and IL-6) that are implicated in human diseases.
[0020] The gene-encoded synthesis and Darwinian selection of sequence-defined biopolymers are fundamental features of all known forms of life. These processes have been harnessed in the laboratory to evolve RNA (1-3), DNA (4-6), and polypeptides (7-10) with a variety of binding and catalytic properties through iterated cycles of biopolymer translation, selection, replication, and mutation. The speed and effectiveness of the evolutionary process has inspired efforts to apply these principles to the much larger chemical space of synthetic polymers (11). To date, however, the evolution of sequence-defined non-natural polymers in the laboratory has been limited to analogs of nucleic acids (12-15) and polypeptides (16) that can be synthesized by polymerases and ribosomes. Polymerases and ribosomes impose structural requirements on the building blocks that can be polymerized and thereby limit the diversity of synthetic polymers that are accessible to directed evolution. For example, polymerases use only mononucleotides as substrates, precluding the ability to encode a diverse set of codons and side chains. Known classes of polymerase-synthesized functional non-natural nucleic acid polymers, including those derived from non-natural sugar backbones (17-20), uniform installation of hydrophobic (21-28) or positively charged (29-35) side-chains on nucleobases, or introduction of novel nucleobases among the four possibilities (36-38), therefore have chemical diversities that are only modestly expanded beyond those of natural DNA and RNA, and fall short of the much more diverse chemical functionality present in proteins.
[0021] Previously an in vitro system was developed that uses DNA ligase to translate DNA sequences into sequence-defined highly functionalized nucleic acid polymers (HFNAPs) containing a wide range of side-chains chosen by the researcher (39). In a previous report, it was shown that DNA sequences can be translated into HFNAPs using DNA ligase to catalyze the polymerization of up to 50 consecutive short, chemically functionalized oligonucleotide building blocks along a DNA template (39) (
[0022] This artificial translation system allows researchers, in principle, to mimic and even expand the chemical repertoire of protein building blocks in an evolvable synthetic polymer system. The broad chemical scope of HFNAPs gives them the potential to adopt unique folding and functional properties distinct from those of known natural or non-natural nucleic acid polymers. The original HFNAP system proved unable to support the evolution of functional polymers, however, likely because of the limited diversity provided by its eight-codon genetic code and the long, flexible linkers present in the building blocks. In this study a new HFNAP genetic code, translation system, and in vitro selection system was designed that overcomes these challenges, then applied the resulting HFNAP evolution system to generate sequence-defined synthetic polymers that binds two protein targets of biomedical interest.
Results
[0023] The new genetic code was designed to offer a high degree of both codon and side-chain diversity to evolving polymers (
[0024] Translation DNA-templated polymerization (artificial translation) reactions were improved by screening ligase enzymes and adjusting polymerization conditions. It was found that subjecting translation reactions to a slow (0.01 C./s) temperature ramp to 4 C. before initiating ligation with T3 DNA ligase substantially improved yields of full-length HFNAP from libraries of DNA templates containing random coding regions of 45 nt, which encoded the incorporation of 15 consecutive side-chain-functionalized trinucleotide building blocks of mixed sequence (
[0025] These observations are qualitatively consistent with results from Hili and coworkers, who reported fidelities ranging from 95.1% to 98.4% per codon for ligase-mediated DNA-templated polymerization of functionalized pentanucleotides (40). Perfect fidelity is not expected for a ligase-mediated polymerization, which lacks proofreading mechanisms, but we reasoned that the level of fidelity in our system may be sufficient to support iterated selection for functional polymers, consistent with our previous mock selection results (39). Modest levels of mutations may also confer a benefit to the selection, as reported by Benner and coworkers for selections of aptamers containing novel nucleobases (37).
[0026] Encouraged by these developments, a library of HFNAPs was generated containing 15 consecutive building blocks drawn from the set of 32 (theoretical polymer library space=310.sup.22; average HFNAP molecular weight=28 kDa) and subjected the resulting library (starting quantity=310.sup.12 molecules) to iterated rounds of in vitro selection for binding to PCSK9 protein, a target implicated in low-density lipoprotein (LDL) metabolism and cardiovascular disease (41-43) (
[0027] As the iterated rounds of selection progressed, the fraction of HFNAP that was retained on PCSK9-linked beads generally increased, consistent with enrichment of PCSK9-binding polymers, even though selection stringency was steadily elevated by decreasing the amount of PCSK9 protein (
[0028] Results from high-throughput DNA sequencing after nine rounds of selection indicated that the HFNAP pool had strongly converged to just seven sequence families containing conserved sub-sequences suggestive of common binding motifs (
[0029] PCSK9-A5, the polymer with the highest apparent PCSK9 binding activity (
[0030] Given the vast sequence space of the HFNAP library (310.sup.22 possible polymers), evolution would likely generate polymer variants with improved activity in the initial population of 310.sup.12 HFNAP molecules. To evolve the PCSK9-A5 polymer into variants with improved PCSK9 affinity, a library of mutated PCSK9-A5 templates was synthesized containing 79% identity and 21% diversity (79:21 at the pyrimidine-only first position and 79:7:7:7 at the second and third positions of each codon) for each nucleotide in the variable region (
[0031] High-throughput sequencing revealed new consensus codons at four out of 15 positions within the population of evolved polymers (
[0032] A biotinylated, truncated HFNAP (designated PCSK9-Evo5;
[0033] To further characterize PCSK9-Evo5, the multi-milligram-scale total synthesis of a variant of PCSK9-Evo5 (PCSK9-Evo5-syn) was executed, which has an additional 3 inverted dT base for exonuclease resistance (46), using standard phosphoramidite chemistry on solid support (
[0034] PCSK9 regulates cholesterol metabolism by binding the LDL receptor (LDLR) and promoting the lysosomal degradation of LDLR (42). The ability of PCSK9-Evo5-syn to disrupt PCSK9-LDLR binding in an SPR assay was tested. PCSK9-Evo5-syn dose-dependently reduced binding of PCSK9 to surface-immobilized LDLR (
[0035] To test the generality of our polymer evolution system and to investigate the potential of this new class of polymers to evolve receptors to different proteins, a separate selection for HFNAPs that bind a protein unrelated to PCSK9 was performed. Human interleukin-6 (IL-6), a key cytokine involved in inflammation and the target of many drugs and drug candidates (48), including modified DNA aptamers (24, 25) was chosen. After seven iterated cycles of translation, selection for binding to immobilized IL-6 protein, reverse translation, and amplification, the most abundant sequence accounted for 3.6% of the population (
[0036] The binding kinetics and affinity of IL6-A7 to E. coli-expressed IL-6 (used in the selection) and to human HEK293 cell-expressed IL-6 protein were comparable (
[0037] Discussion
[0038] We used a ligase-mediated DNA-templated polymerization system and in vitro selection to evolve HFNAPs, nucleic acid polymers that are densely functionalized with chemically diverse side-chains. HFNAPs that bind PCSK9 and IL-6 were selected from random polymer libraries. Through diversification and reselection, we evolved an improved PCSK9-binding HFNAP (Evo5) with KD=3 nM. We characterized structure-activity relationships within this polymer, revealing side chains at specific positions that are critical to target-binding activity. Evo5 potently inhibits binding between PCSK9 and the LDL receptor.
[0039] Collectively, these findings represent the first laboratory evolution of functional, genetically encoded sequence-defined synthetic polymers without the constraints imposed by polymerases or ribosomes. The DNA-templated, ligase-based translation system developed here supports many rounds of iterated selection of polymers with diverse side-chains, including side-chains that mimic and extend beyond the repertoire of amino acid side-chains found in proteins. Both the PCSK9-binding and IL-6-binding polymers generated in this system exhibit position-dependent and side-chain dependent structure-activity relationships resembling those of proteins. Finally, it is noted that the PCSK9-binding polymers generated in this work depend on the presence of multiple side-chains with different physical properties, consistent with the importance of chemical diversity to the functional potential of these polymers.
[0040] Recently, Gawande and coworkers performed selections for PCSK9 aptamers from modified DNA libraries in which all instances of one or both pyrimidines (C and/or T) were replaced by side-chain-functionalized variants (27). High-affinity aptamers with dissociation constants similar to those of FDA-approved anti-PCSK9 monoclonal antibodies (evolocumab, KD=8.0 pM49, and alirocumab, KD=0.58 nM50) were enriched from doubly modified libraries in which hydrophobic or phenolic side chains were present on 50% of the nucleobases on average. Aptamers enriched from singly modified libraries (25% hydrophobic side chains on average) were less potent (KD100 pM), while libraries containing hydrophilic side chains or consisting of unmodified DNA did not produce aptamers with KD30 nM. Consistent with their findings, the highest affinity binders from our HFNAP library, which contains a roughly equal mix of hydrophilic and hydrophobic side chains installed at 33% total frequency, has KD=3 nM to PCSK9. We note, though, that different modifications may be suitable for other applications, as demonstrated by DNA-based catalysts functionalized with nitrogen nucleophiles as side-chains (29-33, 35). Therefore, the diverse, balanced set of side-chains in HFNAPs, similar to the natural repertoire of proteins, may be more versatile in other settings.
[0041] The ligase-based polymerization method allows straightforward redesign of the genetic code of the polymer, as it was exploited to expand the sequence and structural diversity of the polymers used in this work compared with those of another system (39). This feature also enables researchers to generate and select HFNAPs with side-chains tailored toward specific applications, as recently demonstrated by Hili and coworkers for scaffolding peptides on a DNA template(51). Moreover, the side-chain flexibility of this polymer evolution system raises the possibility of performing parallel evolution experiments with libraries of different side-chain compositions to shed light on the fundamental relationship between the structure of the building blocks in a genetic code and the evolutionary potential of the resulting polymers.
Methods
[0042] Additional experimental procedures and characterization data are provided herein.
[0043] Synthesis of HFNAP by Templated Translation Via DNA Ligase-Mediated Polymerization
[0044] DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10T4 RNA ligase reaction buffer (New England Biolabs; 1 L) were mixed in a total volume of 8 L in a PCR tube. The mixture was subjected to the following temperature program on a thermocycler: 95 C. for 10 sec; 65 C. for 4 min; a ramp from 65 C. to 4 C. at 0.1 C. per 10 s. To the PCR tube were added 1 L of 10 mM ATP and 1 L of T3 DNA ligase (New England Biolabs). The reaction was incubated at 4 C. for 12 h and then at 16 C. for 2 h.
[0045] Selections of HFNAP that Bind Protein Targets
[0046] Selection bait was prepared by immobilizing recombinant protein onto AminoLink Plus aldehyde-functionalized agarose resin via reductive amination with a MicroLink Protein Coupling Kit (ThermoFisher Scientific). Loading was 1 mg PCSK9 protein (ACROBiosystems) per mL resin for the initial PCSK9 binder selection and the first two rounds of PCSK9 binder re-selection; 150 g PCSK9 per mL resin for rounds 3-5 of the re-selection; 40 g protein per mL resin for round 6 of the re-selection; and 250 g IL-6 protein (PeproTech) per mL resin throughout the IL-6 binder selection.
[0047] To initiate the selection, primer extension was performed with a biotinylated primer on 5 pmol of the sense strand randomized DNA library (Integrated DNA Technologies or TriLink BioTechnologies) with Klenow (exo-) polymerase (New England Biolabs). Biotinylated species was captured on streptavidin magnetic beads, which were then washed three times with 20 mM NaOH and then twice with 1T4 RNA ligase reaction buffer. The bead-immobilized template strand library was then translated in a ligase-mediated polymerization to produce HFNAPs. The beads were suspended in 20 mM NaOH to denature the HFNAP-template hybrids. HFNAP strands in the supernatant were cleaned up with a MinElute column (Qiagen).
[0048] The HFNAP library was added to DPBS (with calcium and magnesium; Lonza) supplemented with BSA (0.1 mg/ml final) and Tween-20 (0.01% final), and then incubated with PCSK9 resin in a micro-spin filtration column (Pierce) at room temperature for 1 h on a rotor. (The amounts of resin-bound protein used in each round of the PCSK9 selection are indicated in
[0049] Samples of 1 L each from the flow-through, the three washes, and the elution were quantified by qPCR (20 L reaction volume) using the iTaq Supermix (Bio-rad). The number of cycles for the qPCR curve of the elution sample to reach the end of exponential growth was used as the number of cycles for the preparative PCR (400 L reaction volume split into 850 L) of the selection elution pool (20 L) with Q5 Hot Start High-Fidelity 2 Master Mix (New England Biolabs), using a biotinylated primer for the strand that will serve as translation template. The PCR product was cleaned up with a MinElute column and PAGE purified on a non-denaturing 10% TBE gel. A portion (indicated in
[0050] Surface Plasmon Resonance (SPR) Assays
[0051] All SPR assays were performed at 25 C. on a Biacore X100 or Biacore T200 (GE Healthcare Life Sciences). Binding kinetics between enzymatically synthesized biotinylated HFNAPs and unlabeled recombinant proteins were measured using single-cycle kinetics with the Biotin CAPture kit (GE Life Sciences) using 0.9HBS-EP buffer (GE Life Sciences) at a flow rate of 30 L/min. The injected PCSK9 concentration ranged from 10 to 300 nM for PCSK9-A5 and its variants, or from 2 to 60 nM for PCSK9-Evo5 and its variants. The injected IL-6 concentration ranged from 10 to 300 nM.
[0052] Binding kinetics between chemically synthesized PCSK9-Evo5-syn and biotinylated Avi-tagged PCSK9 (ACROBiosystems) were measured using single-cycle kinetics on a Series S SA chip (GE Life Sciences) using 0.9HBS-EP buffer at a flow rate of 30 L/min. The injected PCSK9-Evo5-syn concentration ranged from 1.8 to 180 nM.
[0053] Binding of PCSK9 on surface-immobilized LDLR in the presence of various competing agents was measured on a Series S SA chip using 10 mM HEPES, 150 mM NaCl, 0.1 mM CaCl.sub.2, 0.005% Tween-20, pH 7.5 as bulk buffer at a flow rate of 10 L/min. The injected solutions contained 20 nM PCSK9 and various competing agents ranging from 2 to 200 nM.
[0054] Data Availability
[0055] The principal data supporting the findings of this work are available within the figures and information provided herein. Additional data that support the findings of this study are available from the authors on request.
REFERENCES AND NOTES
[0056] 1. Ellington, A. D. & Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822 (1990). [0057] 2. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510 (1990). [0058] 3. Robertson, D. L. & Joyce, G. F. Selection in vitro of an RNA enzyme that specifically cleaves single-stranded DNA. Nature 344, 467-468 (1990). [0059] 4. Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H. & Toole, J. J. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564-566 (1992). [0060] 5. Ellington, A. D. & Szostak, J. W. Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Nature 355, 850-852 (1992). [0061] 6. Breaker, R. R. & Joyce, G. F. A DNA enzyme that cleaves RNA. Chem. Biol. 1, 223-229 (1994). [0062] 7. Mattheakis, L. C., Bhatt, R. R. & Dower, W. J. An in vitro polysome display system for identifying ligands from very large peptide libraries. Proc. Natl. Acad. Sci. U.S.A 91, 9022-9026 (1994). [0063] 8. Roberts, R. W. & Szostak, J. W. RNA-peptide fusions for the in vitro selection of peptides and proteins. Proc. Natl. Acad. Sci. U.S.A 94, 12297-12302 (1997). [0064] 9. Nemoto, N., Miyamoto-Sato, E., Husimi, Y. & Yanagawa, H. In vitro virus: Bonding of mRNA bearing puromycin at the 3-terminal end to the C-terminal end of its encoded protein on the ribosome in vitro. FEBS Lett. 414, 405-408 (1997). [0065] 10. Yamaguchi, J. et al. cDNA display: a novel screening method for functional disulfide-rich peptides by solid-phase synthesis and stabilization of mRNA-protein fusions. Nucleic Acids Res. 37, e108 (2009). [0066] 11. Brudno, Y. & Liu, D. R. Recent Progress Toward the Templated Synthesis and Directed Evolution of Sequence-Defined Synthetic Polymers. Chem. Biol. 16, 265-276 (2009). [0067] 12. Chaput, J. C., Yu, H. & Zhang, S. The Emerging World of Synthetic Genetics. Chem. Biol. 19, 1360-1371 (2012). [0068] 13. Pinheiro, V. B. & Holliger, P. The XNA world: progress towards replication and evolution of synthetic genetic polymers. Curr. Opin. Chem. Biol. 16, 245-252 (2012). [0069] 14. Pinheiro, V. B. & Holliger, P. Towards XNA nanotechnology: new materials from synthetic genetic polymers. Trends Biotechnol. 32, 321-328 (2014). [0070] 15. Hollenstein, M. Nucleoside TriphosphatesBuilding Blocks for the Modification of Nucleic Acids. Molecules 17, 13569-13591 (2012). [0071] 16. Rogers, J. M. & Suga, H. Discovering functional, non-proteinogenic amino acid containing, peptides using genetic code reprogramming. Org. Biomol. Chem. 13, 9353-9363 (2015). [0072] 17. Yu, H., Zhang, S. & Chaput, J. C. Darwinian evolution of an alternative genetic system provides support for TNA as an RNA progenitor. Nat. Chem. 4, 183-187 (2012). [0073] 18. Pinheiro, V. B. et al. Synthetic Genetic Polymers Capable of Heredity and Evolution. Science 336, 341-344 (2012). [0074] 19. Taylor, A. I. et al. Catalysts from synthetic genetic polymers. Nature 518, 427-430 (2014). [0075] 20. Dunn, M. R. & Chaput, J. C. Reverse Transcription of Threose Nucleic Acid by a Naturally Occurring DNA Polymerase. ChemBioChem 17, 1804-1808 (2016). [0076] 21. Vaught, J. D. et al. Expanding the chemistry of DNA for in vitro selection. J. Am. Chem. Soc. 132, 4141-4151 (2010). [0077] 22. Gold, L. et al. Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery. PLoS One 5, e15004 (2010). [0078] 23. Davies, D. R. et al. Unique motifs and hydrophobic interactions shape the binding of modified DNA ligands to protein targets. Proc. Natl. Acad. Sci. U.S.A 109, 19971-19976 (2012). [0079] 24. Gupta, S. et al. Chemically-Modified DNA Aptamers Bind Interleukin-6 with High Affinity and Inhibit Signaling by Blocking its Interaction with Interleukin-6 Receptor. J. Biol. Chem. 289, 8706-8719 (2014). [0080] 25. Gelinas, A. D. et al. Crystal Structure of Interleukin-6 in Complex with a Modified Nucleic Acid Ligand. J. Biol. Chem. 289, 8720-8734 (2014). [0081] 26. Imaizumi, Y. et al. Efficacy of Base-Modification on Target Binding of Small Molecule DNA Aptamers. J. Am. Chem. Soc. 135, 9412-9419 (2013). [0082] 27. Gawande, B. N. et al. Selection of DNA aptamers with two modified bases. Proc. Natl. Acad. Sci. U.S.A 114, 2898-2903 (2017). [0083] 28. Tolle, F., Brndle, G. M., Matzner, D. & Mayer, G. A Versatile Approach Towards Nucleobase-Modified Aptamers. Angew. Chem. Int. Ed. 54, 10971-10974 (2015). [0084] 29. Santoro, S. W., Joyce, G. F., Sakthivel, K., Gramatikova, S. & Barbas, C. F., III. RNA cleavage by a DNA enzyme with extended chemical functionality. J. Am. Chem. Soc. 122, 2433-2439 (2000). [0085] 30. Perrin, D. M., Garestier, T. & Hlne, C. Expanding the catalytic repertoire of nucleic acid catalysts: simultaneous incorporation of two modified deoxyribonucleoside triphosphates bearing ammonium and imidazolyl functionalities. Nucleosides Nucleotides 18, 377-391 (1999). [0086] 31. Perrin, D. M., Garestier, T. & Hlne, C. Bridging the Gap between Proteins and Nucleic Acids: A Metal-Independent RNAseA Mimic with Two Protein-Like Functionalities. J. Am. Chem. Soc. 123, 1556-1563 (2001). [0087] 32. Lermer, L., Roupioz, Y., Ting, R. & Perrin, D. M. Toward an RNaseA mimic: A DNAzyme with imidazoles and cationic amines. J. Am. Chem. Soc. 124, 9960-9961 (2002). [0088] 33. Hollenstein, M., Hipolito, C. J., Lam, C. H. & Perrin, D. M. A self-cleaving DNA enzyme modified with amines, guanidines and imidazoles operates independently of divalent metal cations (M2+). Nucleic Acids Res. 37, 1638-1649 (2009). [0089] 34. Shoji, A., Kuwahara, M., Ozaki, H. & Sawai, H. Modified DNA Aptamer That Binds the (R)-Isomer of a Thalidomide Derivative with High Enantioselectivity. J. Am. Chem. Soc. 129, 1456-1464 (2007). [0090] 35. Sidorov, A. V., Grasby, J. A. & Williams, D. M. Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities. Nucleic Acids Res. 32, 1591-1601 (2004). [0091] 36. Sefah, K. et al. In vitro selection with artificial expanded genetic information systems. Proc. Natl. Acad. Sci. U.S.A 111, 1449-1454 (2014). [0092] 37. Zhang, L. et al. Evolution of functional six-nucleotide DNA. J. Am. Chem. Soc. 137, 6734-6737 (2015). [0093] 38. Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S. & Hirao, I. Generation of high-affinity DNA aptamers using an expanded genetic alphabet. Nat. Biotechnol. 31, 453-457 (2013). [0094] 39. Hili, R., Niu, J. & Liu, D. R. DNA ligase-mediated translation of DNA into densely functionalized nucleic acid polymers. J. Am. Chem. Soc. 135, 98-101 (2013). [0095] 40. Lei, Y., Kong, D. & Hili, R. A High-Fidelity Codon Set for the T4 DNA Ligase-Catalyzed Polymerization of Modified Oligonucleotides. ACS Comb. Sci. 17, 716-721 (2015). [0096] 41. Cohen, J. C., Boerwinkle, E., Mosley, T. H., Jr. & Hobbs, H. H. Sequence Variations in PCSK9, Low LDL, and Protection against Coronary Heart Disease. N. Engl. J. Med. 354, 1264-1272 (2006). [0097] 42. Lambert, G., Charlton, F., Rye, K.-A. & Piper, D. E. Molecular basis of PCSK9 function. Atherosclerosis 203, 1-7 (2009). [0098] 43. Stein, E. A. et al. Effect of a Monoclonal Antibody to PCSK9 on LDL Cholesterol. N. Engl. J. Med. 366, 1108-1118 (2012). [0099] 44. Brudno, Y., Birnbaum, M. E., Kleiner, R. E. & Liu, D. R. An in vitro translation, selection and amplification system for peptide nucleic acids. Nat. Chem. Biol. 6, 148-155 (2010). [0100] 45. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415 (2003). [0101] 46. Ortigo, J. F. R. et al. Antisense Effect of Oligodeoxynucleotides with Inverted Terminal Internucleotidic Linkages: A Minimal Modification Protecting against Nucleolytic Degradation. Antisense Res. Dev. 2, 129-146 (1992). [0102] 47. Lo Surdo, P. et al. Mechanistic implications for LDL receptor degradation from the PCSK9/LDLR structure at neutral pH. EMBO Rep. 12, 1300-1305 (2011). [0103] 48. Hunter, C. A. & Jones, S. A. IL-6 as a keystone cytokine in health and disease. Nat. Immunol. 16, 448-457 (2015). [0104] 49. Gibbs, J. P. et al. Impact of Target-Mediated Elimination on the Dose and Regimen of Evolocumab, a Human Monoclonal Antibody Against Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9). J. Clin. Pharmacol. 57, 616-626 (2017). [0105] 50. Khnast, S. et al. Alirocumab inhibits atherosclerosis, improves the plaque morphology, and enhances the effects of a statin. J. Lipid Res. 55, 2103-2112 (2014). [0106] 51. Guo, C., Watkins, C. P. & Hili, R. Sequence-Defined Scaffolding of Peptides on Nucleic Acid Polymers. J. Am. Chem. Soc. 137, 11191-11196 (2015).
Materials and Methods
General Information
[0107] Unless otherwise specified, all materials and compounds were prepared using commercially available reagents from Sigma-Aldrich, and used without further purification. Water was purified with a Milli-Q purification system. DNA oligonucleotides without nucleobase side chain functional groups were purchased from Integrated DNA Technologies (IDT) unless noted otherwise. In-house synthesis of side-chain-functionalized DNA was performed on a PerSeptive Biosystems Expedite 8909 DNA synthesizer and purified by reverse-phase high-pressure liquid chromatography (HPLC, Agilent 1200) using a C18 stationary phase (Waters XBridge Prep C18, 5 m, 10250 mm) and an acetonitrile/100 mM triethylammonium acetate gradient. All materials and reagents used for oligonucleotide synthesis were purchased from Glen Research, Berry & Associates, or ChemGenes, or custom synthesized by WuXi AppTec. Oligonucleotide and protein concentrations were quantified by UV spectroscopy using a Nanodrop ND1000 spectrophotometer, using extinction coefficients calculated with the IDT Oligo Analyzer and Expasy ProtParam web servers, respectively. Non-commercial oligonucleotides were characterized at the Harvard FAS Small Molecule Mass Spectrometry Facility by ESI-MS on a Bruker Impact II q-TOF mass spectrometer equipped with an Agilent 1290 uHPLC using flow injection analysis. Polyacrylamide gels were purchased from Bio-Rad. Sanger sequencing was performed by Eton BioSciences and analyzed with ApE A plasmid Editor. Quantitative polymerase chain reactions (qPCRs) were performed on a Bio-rad CFX96 system. Deep sequencing was performed on an Illumina MiSeq. Surface plasmon resonance (SPR) analysis was carried out on a Biacore X100 or Biacore T200 (GE Healthcare Life Sciences). Time-resolved FRET assays were performed on a Tecan Infinite M1000 PRO microplate reader.
Oligonucleotide Sequences
[0108] All occurrences of U below are 2-deoxy-U. Commercially available oligonucleotide modifiers are denoted by shorthand notations used by IDT.
Evaluation of Translation Yield on Template Libraries
[0109]
TABLE-US-00001 Name Sequence Template-11codon CGTACGGTCGACGCTAGCNNRNNRNNRNNRNNR NNRNNRNNRNNRNNRNNRCACGTGGAGCTCGGA TCC(SEQIDNO:1) Template-13codon CGTACGGTCGACGCTAGCNNRNNRNNRNNRNNR NNRNNRNNRNNRNNRNNRNNRNNRCACGTGGAG CTCGGATCC(SEQIDNO:2) Template-15codon CGTACGGTCGACGCTAGCNNRNNRNNRNNRNNR NNRNNRNNRNNRNNRNNRNNRNNRNNRNNRCAC GTGGAGCTCGGATCC(SEQIDNO:3) pp1-library /5Phos/GCTAGCGTCGACCGTACG (SEQIDNO:4) pp2-library GGATCCGAGCTCCACGTG(SEQIDNO:5)
Validation of Sequence Specificity of Translation and Amplification
[0110]
TABLE-US-00002 Name Sequence Template-Bt-CATA /52-Bio//iSp18/CGTACGGTCGACGCTAG CTTGAAAGTGCAAGAGACACCGCGACACGTGG AGCTCGGATCC(SEQIDNO:6) Template-Bt-CBTB /52-Bio//iSp18/CGTACGGTCGACGCTAG CATGTTACTGGTATCGTGAGCGGGACACGTGG AGCTCGGATCC(SEQIDNO:7) Template-Bt-CCTC /52-Bio//iSp18/CGTACGGTCGACGCTAG CTAGATATGGCTAGGGTCAAGGGCACACGTGG AGCTCGGATCC(SEQIDNO:8) Template-Bt-CDTD /52-Bio//iSp18/CGTACGGTCGACGCTAG CAAGTAACAGGAAACGAGACGGCCACACGTGG AGCTCGGAUCC(SEQIDNO:9) pp1-library-T7 /5Phos/GCTAGCGTCGACCGTACGAGCGTCG CTACGCGTGAC(SEQIDNO:10) pp2-library GGATCCGAGCTCCACGTG(SEQIDNO: 11) T7-out-PCR2 TAATACGACTCACTATAGGGCTCGATTTAATT TCGCCGACGTGATGACATTCCAGGCAGTGTCA CGCGTAGCGACGCT(SEQIDNO:12)
PCSK9 Binder Selection and Evolution
[0111]
TABLE-US-00003 Name Sequence NavelibraryAZ15 CGAATCAGATTGGACCAGYNNYNN YNNYNNYNNYNNYNNYNNYNNYNN YNNYNNYNNYNNYNNGAGTCCAGA TGTAGGTAG(SEQIDNO:13) BtBt-ExtA /52-Bio//iSp18/CTACCTACATCT GGACTC(SEQIDNO:14) ExtA CTACCTACATCTGGACTC (SEQIDNO:15) pp1A /5Phos/GAGTCCAGATGTAGGTAG (SEQIDNO:16) pp2Z CGAATCAGATTGGACCAG (SEQIDNO:17) MiSeqA ACACTCTTTCCCTACACGACGCTC TTCCGATCTNNNNCTACCTACA TCTGGACTC(SEQIDNO:18) MiSeqZ TGGAGTTCAGACGTGTGCTCTTCC GATCTNNNNCGAATCAGATTGGAC CAG(SEQIDNO:19) IlluminaAdapterFwd AATGATACGGCGACCACCGAGATCTACAC [8-basebarcode]ACACTCTTTCCCTA CACGAC(SEQIDNO:20) IlluminaAdapterRev CAAGCAGAAGACGGCATACGAGAT[8-base barcode]GTGACTGGAGTTCAGACGTGTGC T(SEQIDNO:21) RedivlibraryAZ15 CGAATCAGATTGGACCAGXZPXFO JPZJFPJOZJOZJPZXFOJOOJFZ XZZXFFXPZXOOXOFGAGTCCAGA TGTAGGTAG(SEQIDNO:22) X=79%dC,21%T Z=7%dA,79%dC,7%dG,7%T P=79%dA,7%dC,7%dG,7%T F=7%dA,7%dC,79%dG,7%T O=7%dA,7%dC,7%dG,79%T J=21%dC,79%T pp1A-3ddC /5Phos/GAGTCCAGATGTAGGTAG/ 3ddC/(SEQIDNO:23)
Synthesis of Putative PCSK9 Binders for Bead Retention Assay
[0112]
TABLE-US-00004 Name Sequence pp1A /5Phos/GAGTCCAGATGTAGGTAG(SEQIDNO:16) pp2Z CGAATCAGATTGGACCAG(SEQIDNO:17) PCSK9A1- /52-Bio//iSp18/CTACCTACATCTGGACTCCAGAAGGTGATGCAA BtTempl AGGCAAACGGTAGGAGAGAGAATATAGTGGCTGGTCCAATCT GATTCG(SEQIDNO:24) PCSK9A1-DNA CGAATCAGATTGGACCAGCCACTATATTCTCTCTCCTACCGT TTGCCTTTGCATCACCTTCTGGAGTCCAGATGTAGGTAG (SEQIDNO:25) PCSK9A2- /52-Bio//iSp18/CTACCTACATCTGGACTCTCAGCGCAGAAGGTG BtTempl AGGGCAAAAACGGTAGAAGAATCATTGTTGCTGGTCCAATCT GATTCG(SEQIDNO:26) PCSK9A2-DNA CGAATCAGATTGGACCAGCAACAATGATTCTTCTACCGTTTT TGCCCTCACCTTCTGCGCTGAGAGTCCAGATGTAGGTAG (SEQIDNO:27) PCSK9A3- /52-Bio//iSp18/CTACCTACATCTGGACTCTGATCAGGATAAGTA BtTempl GTGCTAAAGACATGAAAGAGGTTGTAGAGACTGGTCCAATCT GATTCG(SEQIDNO:28) PCSK9A3-DNA CGAATCAGATTGGACCAGTCTCTACAACCTCTTTCATGTCTT TAGCACTACTTATCCTGATCAGAGTCCAGATGTAGGTAG(SEQ IDNO:29) PCSK9A4- /52-Bio//iSp18/CTACCTACATCTGGACTCGAATAGGTACCGCTA BtTempl AAGACGTGATAGAAACGAAAAGCATTGGGGCTGGTCCAATCT GATTCG(SEQIDNO:30) PCSK9A4-DNA CGAATCAGATTGGACCAGCCCCAATGCTTTTCGTTTCTATCA CGTCTTTAGCGGTACCTATTCGAGTCCAGATGTAGGTAG (SEQIDNO:31) PCSK9A5- /52-Bio//iSp18/CTACCTACATCTGGACTCCAGAAGGTGCCGGGG BtTempl GCAAAAACGGTAGAAGAATCAGTAACGTGGCTGGTCCAATCT GATTCG(SEQIDNO:32) PCSK9A5-DNA CGAATCAGATTGGACCAGCCACGTTACTGATTCTTCTACCGT TTTTGCCCCCGGCACCTTCTGGAGTCCAGATGTAGGTAG (SEQIDNO:33) PCSK9A6- /52-Bio//iSp18/CTACCTACATCTGGACTCGGAACAACGCAGAAG BtTempl GAGCCGTGGAGAAGGCAGAAGAGGTTGAAACTGGTCCAATCT GATTCG(SEQIDNO:34) PCSK9A6-DNA CGAATCAGATTGGACCAGTTTCAACCTCTTCTGCCTTCTCCA CGGCTCCTTCTGCGTTGTTCCGAGTCCAGATGTAGGTAG (SEQIDNO:35) PCSK9A7- /52-Bio//iSp18/CTACCTACATCTGGACTCCAGAAGGTGAAAGTA BtTempl AGAGAACAAACGGTAGAGGAATAGGGAAGACTGGTCCAATCT GATTCG(SEQIDNO:36) PCSK9A7-DNA CGAATCAGATTGGACCAGTCTTCCCTATTCCTCTACCGTTTG TTCTCTTACTTTCACCTTCTGGAGTCCAGATGTAGGTAG(SEQ IDNO:37)
Synthesis of Biotinylated PCSK9-A5 and Variants for Surface Plasmon Resonance Assay
[0113]
TABLE-US-00005 Name Sequence pp1A /5Phos/GAGTCCAGATGTAGGTAG (SEQIDNO:16) BtBt-pp2Z /52-Bio//iSp18/CGAATCAGATTGGAC CAG(SEQIDNO:38) PCSK9A5-Templ CTACCTACATCTGGACTCCAGAAGGTG CCGGGGGCAAAAACGGTAGAAGAATCA GTAACGTGGCTGGTCCAATCTGATTCG (SEQIDNO:39)
Synthesis of Biotinylated PCSK9-Evo5 and Variants for Surface Plasmon Resonance Assay
[0114]
TABLE-US-00006 Name Sequence pp1A-3primeStBt /5Phos/GAGTCCAGATGTAGGTAG/ iSp18/iBiodT/3Bio/(SEQIDNO:40) pp1A-3primeStBt- /5Phos/GAGTCCAGATGTAG/i5p18/ 14nt iBiodT/3Bio/(SEQIDNO:41) Evo5-pp2-dU CCACGTTACTGATTCUGC(SEQID NO:42) PCSK9Evo5- CTACCTACATCTGGACTCCAGAAG Templ GTGGCAGGGTAAACAACGGTAGCA GAATCAGTAACGTGG(SEQIDNO: 43)
Synthesis of PCSK9-Evo5-Fluor and Negative Control for EMSA Assay
[0115]
TABLE-US-00007 Name Sequence pp1A-Alexa647 /5phos/GAGTCCAGATGTAGGTAG/ iSp18//3AlexF647N/(SEQIDNO: 44) Evo_5DNA-LeftHalf TGCTACCGTTGTTTACCCTGCCACCTTCTG (SEQIDNO:45) BtBt_Evo5-Template /52-Bio//iSp18/CTACCTACATCT GGACTCCAGAAGGTGGCAGGGTAA ACAACGGTAGCAGAATCAGTAACG TGGCTG(SEQIDNO:46)
Negative Control for PCSK9-Evo5-Syn SPR Assay
[0116]
TABLE-US-00008 Name Sequence Evo5DNA-InvdT TGCTACCGTTGTTTACCCTGCCACCTT CTGGAGTCCAGATGTAGGTAG/ 3InvdT/(SEQIDNO:47)
IL-6 Binder Selection
[0117]
TABLE-US-00009 Name Sequence NavelibraryCW15 CTCGGATGAACCTGGACTYNN YNNYNNYNNYNNYNNYNNYNN YNNYNNYNNYNNYNNYNNYNN GGACTGAGTCCAGAGTAA (SEQIDNO:48) BtBt-ExtC /52-Bio//i5p18/TTACTCTGGACT CAGTCC(SEQIDNO:49) ExtC TTACTCTGGACTCAGTCC(SEQID NO:50) pp1C /5Phos/GGACTGAGTCCAGAGTAA (SEQIDNO:51) pp2W CTCGGATGAACCTGGACT(SEQ IDNO:52) MiSeqC ACACTCTTTCCCTACACGACGCTC TTCCGATCTNNNNNNTTACTCTGG ACTCAGTCC(SEQIDNO:53) MiSeqW TGGAGTTCAGACGTGTGCTCTTCC GATCTNNNNCTCGGATGAACCTGG ACT(SEQIDNO:54) IlluminaAdapterFwd AATGATACGGCGACCACCGAGATCTACAC [8-basebarcode]ACACTCTTTCCCT ACACGAC(SEQIDNO:55) IlluminaAdapterRev CAAGCAGAAGACGGCATACGAGAT[8- basebarcode]GTGACTGGAGTTCA GACGTGTGCT(SEQIDNO:56)
Synthesis of Putative IL-6-Binding HFNAPs for Bead Retention Assay
[0118]
TABLE-US-00010 Name Sequence pp1C /5phos/GGACTGAGTCCAGAGTAA (SEQIDNO:51) pp2W CTCGGATGAACCTGGACT(SEQIDNO: 52) IL6-A1-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCTGGTGGCCACTGGCAGCACCGTCA CGGAGGCTGAGACTGCCGCAAAGT CCAGGTTCATCCGAG(SEQIDNO:57) IL6-A2-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCACAGGAGGGATACCGGAAGGGCAA AGGCCGTAGCCAGAACAAAAAAGTCCA GGTTCATCCGAG(SEQIDNO:58) 1L6-A3-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCACAACGCAGCCGGAAGCACCACAG GAGAGGCGGTAACCAGCAACAAGT CCAGGTTCATCCGAG(SEQIDNO:59) 1L6-A4-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCTCGGAAGCGTCACGACGGTAACCG GCACTGAGAGCAACACCACAAAGTCCA GGTTCATCCGAG(SEQIDNO:60) 1L6-A5-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCTGGCTAAGGCGACCACGGGCACTG CAACCACAGCCAAAGGGGTGAAGTCCA GGTTCATCCGAG(SEQIDNO:61) 1L6-A6-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCCAATGAGGGAGAGAGGGGGAAGGG CGACAAAGGCCGTAACCAGGAAGTCCA GGTTCATCCGAG(SEQIDNO:62) 1L6-A7-BtTempl /52-Bio//iSp18/TTACTCTGGACTCAG TCCCCGGAGGAATGAGTACGAGGAAGG GCAACGAAATAAACAGCAGCAAGTCCA GGTTCATCCGAG(SEQIDNO:63)
Synthesis of Biotinylated IL6-A7 and Variants for Surface Plasmon Resonance Assay
[0119]
TABLE-US-00011 Name Sequence pp1C-3ddC /5Phos/GGACTGAGTCCAGAGTAA/3ddC/ (SEQIDNO:64) BtBt-pp2W /52-Bio//iSp18/CTCGGATGAACCTGGACT (SEQIDNO:65) IL6-A7-Templ TTACTCTGGACTCAGTCCCCGGAGGAA TGAGTACGAGGAAGGGCAACGAAATAA ACAGCAGCAAGTCCAGGTTCATCCGAG (SEQIDNO:66)
Synthesis and Characterization of Phosphoramidite Intermediates
[0120] Compounds were prepared and characterized by Wuxi AppTec Co. under the direction of Xun Hong. The protocols and characterization furnished along with these compounds are printed here. NMR spectra were recorded on a Bruker Avance 400 MHz for .sup.1H NMR. Chemical shifts are reported in ppm (). Chromatographic purifications were by flash chromatography using 100200 mesh silica gel. Anhydrous solvents were pre-treated with 3 MS column before use. All commercially available reagents were used as received unless otherwise stated. General synthetic routes:
##STR00001## ##STR00002## ##STR00003##
Synthesis of Phosphoramidites 5a-d
[0121] ##STR00004##
[0122] To a solution of 1 (40.0 g, 113.2 mmol, 1 equiv) and DMAP (0.113 g, 1.13 mmol, 0.01 equiv) in pyridine (400 mL) was added dropwise DMTrCl (40.2 g, 119 mmol, 1.05 equiv) and at 0 C. The mixture was stirred at 25 C. for 16 h. TLC (DCM/MeOH=20/1) indicated that 1 was consumed completely. The reaction mixture was concentrated with MeOH (50 mL) under reduced pressure to remove pyridine. The residue was purified by column chromatography (SiO.sub.2, DCM/MeOH=50/1 to 20/1) to give the 2 (62 g, yield 84%) as a white foam. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 8.65 (d, J=4.02 Hz, 1H), 7.99 (s, 1H), 7.53 (dd, J=7.28, 5.77 Hz, 1H), 7.36-7.42 (m, 2H), 7.20-7.35 (m, 6H), 6.90 (d, J=9.03 Hz, 4H), 6.09 (t, J=6.78 Hz, 1H), 4.15-4.24 (m, 1H), 3.91 (d, J=3.51 Hz, 1H), 3.74 (s, 6H), 3.18 (d, J=3.01 Hz, 2H), 2.22 (ddd, J=13.30, 5.77, 3.01 Hz, 1H), 2.06-2.16 (m, 1H).
##STR00005##
[0123] To a solution of 2 (6 g, 9.15 mmol, 1 equiv), Cs.sub.2CO.sub.3 (8.95 g, 27.5 mmol, 3 equiv), (E)-4,4,5,5-tetramethyl-2-(5-methylhex-1-en-1-yl)-1,3,2-dioxaborolane (2.46 g, 11 mmol, 1.2 equiv) and PPh.sub.3 (1.2 g, 4.58 mmol, 0.5 equiv) in dioxane (700 mL) and water (30 mL) was added Pd(OAc).sub.2 (2.35 g, 10.5 mmol, 0.1 equiv) at 25 C. under N.sub.2 current. The mixture was heated to 90 C. and stirred for 16 h. TLC (ethyl acetate/MeOH=20/1) showed 2 was consumed completely. The reaction mixture was diluted with water 50 mL and extracted with ethyl acetate (100 mL2). The combined organic layers were washed with sat. aqueous NaCl (50 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO.sub.2, DCM/MeOH=50/1 to 20:1) to give compound 3a (5.1 g, 8.15 mmol, 89% yield) was obtained as a light-yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 7.86 (s, 1H), 7.42 (d, J=7.53 Hz, 2H), 7.18-7.35 (m, 7H), 6.81 (d, J=7.53 Hz, 4H), 6.46 (t, J=6.53 Hz, 1H), 5.53-5.70 (m, 2H), 4.47-4.57 (m, 1H), 4.13 (d, J=3.01 Hz, 1H), 3.79 (s, 5H), 3.47 (dd, J=10.54, 3.01 Hz, 1H), 3.28 (dd, J=10.54, 3.01 Hz, 1H), 2.70 (ddd, J=13.55, 5.52, 3.01 Hz, 1H), 2.24 (dt, J=13.55, 6.78 Hz, 1H), 1.56-1.83 (m, 4H), 1.13-1.40 (m, 3H), 0.91 (dtd, J=9.47, 6.43, 6.43, 3.26 Hz, 2H), 0.75 (dd, J=6.78, 2.76 Hz, 6H).
##STR00006##
[0124] To a solution of 0.3a (4.23 g, 6.76 mmol, 1.00 equiv) in DMF (40.00 mL) was added Et.sub.3N (1.03 g, 10.14 mmol, 1.41 mL, 1.50 equiv) and benzoic anhydride (1.84 g, 8.11 mmol, 1.53 mL, 1.20 equiv). The mixture was stirred at 0 to 25 C. for 16 h. TLC (petroleum ether/ethyl acetate=1/1) indicated 3a was consumed completely and the reaction was clean. The reaction mixture was quenched by addition water 20 mL at 0-5 C., and then extracted with ethyl acetate (50 mL). The combined organic layers were washed with sat. aqueous NaCl (20 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Basic SiO.sub.2, petroleum ether/ethyl acetate=5/1 to 2/1) to a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.52 (br. s., 1H), 8.30 (d, J=7.03 Hz, 2H), 7.96 (s, 1H), 7.50-7.57 (m, 1H), 7.40-7.50 (m, 4H), 7.21-7.37 (m, 7H), 6.84 (dd, J=8.53, 1.51 Hz, 4H), 6.40 (t, J=6.78 Hz, 1H), 6.21 (d, J=16.06 Hz, 1H), 5.92-6.03 (m, 1H), 4.55 (d, J=3.01 Hz, 1H), 4.10 (d, J=3.01 Hz, 1H), 3.79 (s, 6H), 3.56 (dd, J=10.54, 3.01 Hz, 1H), 3.31 (dd, J=10.54, 3.01 Hz, 1H), 2.52 (ddd, J=13.55, 5.77, 2.76 Hz, 1H), 2.35 (dt, J=13.68, 6.96 Hz, 1H), 2.09 (d, J=3.51 Hz, 1H), 1.72-1.91 (m, 2H), 1.41 (dt, J=13.43, 6.59 Hz, 1H), 0.83-1.00 (m, 2H), 0.77 (dd, J=6.53, 1.51 Hz, 6H).
##STR00007##
[0125] To a solution of 4a (2.87 g, 3.93 mmol, 1 equiv) and 4,5-dicyanoimidazole (0.696 g, 5.90 mmol, 1.5 equiv) in DCM (30 mL) was added drop wise of 3-bis(diisopropylamino) phosphanyloxypropanenitrile (1.42 g, 4.72 mmol, 1.2 equiv) at 0 C. under N.sub.2 current. Then the mixture was stirred at 0-25 C. for 2 h under N.sub.2 current. A clear yellow solution was obtained. TLC (petroleum ether/ethyl acetate=2/1) showed 4a was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue. The resulting residue was purified by column chromatography (basic SiO.sub.2, petroleum ether/ethyl acetate=10/1 to 5/1) to give phosphoramidite 5a (1.75 g, 1.88 mmol, 48% yield) as a light-yellow foam. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.51 (br. s., 1H) 8.30 (d, J=7.53 Hz, 2H) 7.99 (d, J=18.57 Hz, 1H) 7.50-7.58 (m, 1H) 7.41-7.50 (m, 4H) 7.21-7.37 (m, 8H) 6.84 (ddd, J=6.65, 4.64, 2.26 Hz, 4H) 6.36-6.48 (m, 1H) 6.18 (d, J=16.06 Hz, 1H) 5.88-6.02 (m, 1H) 4.62 (td, J=6.65, 3.26 Hz, 1H) 4.15-4.26 (m, 1H) 3.79 (d, J=2.51 Hz, 7H) 3.50-3.66 (m, 4H) 3.25 (dt, J=10.79, 3.39 Hz, 1H) 2.54-2.70 (m, 2H) 2.27-2.44 (m, 2H) 1.66-1.86 (m, 2H) 1.38 (dd, J=13.30, 6.78 Hz, 1H) 1.12-1.22 (m, 9H) 1.04 (d, J=7.03 Hz, 3H) 0.79-0.93 (m, 3H) 0.75 (t, J=5.77 Hz, 6H). .sup.31P NMR (162 MHz, CDCl.sub.3) 148.40-149.28 (m, 1P). TLC petroleum ether/ethyl acetate=2/1 (R.sub.f=0.43).
##STR00008##
[0126] To a solution of 2 (8.00 g, 12.2 mmol, 1 equiv), Cs.sub.2CO.sub.3 (11.9 g, 36.6 mmol, 3 equiv), (E)-2-(2-cyclopropylvinyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (2.84 g, 14.7 mmol, 1.2 equiv) and PPh.sub.3 (1.60 g, 6.10 mmol, 0.5 equiv) in dioxane (60 mL) and water (30 mL) was added Pd(OAc).sub.2 (0.274 g, 1.22 mmol, 0.1 equiv) at 25 C. under N.sub.2 current. The mixture was heated to 90 C. and stirred for 16 h. TLC (ethyl acetate/MeOH=20/1) showed compound 2 was consumed completely. The reaction mixture was diluted with water 50 mL and extracted with ethyl acetate (100 mL2). The combined organic layers were washed with sat. aqueous NaCl (50 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO.sub.2, DCM/MeOH=50/1 to 20:1) to give 3b (7.00 g, 11.8 mmol, 96% yield), obtained as a light-yellow solid.
##STR00009##
[0127] To a solution of 3b (3.4 g, 5.71 mmol, 1.00 equiv) in DMF (30.00 mL) was added Et.sub.3N (0.693 g, 6.85 mmol, 1.50 equiv) and benzoic anhydride (1.42 g, 6.28 mmol, 1.20 equiv). The mixture was stirred at 0-25 C. for 16 h. TLC (DCM/MeOH=20/1) indicated 3b was consumed completely and the reaction was clean. The reaction mixture was quenched by addition sat. aqueous NaCl 20 mL at 25 C., and then extracted with ethyl acetate (50 mL). The combined organic layers were washed with sat. aqueous NaCl (20 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (Basic SiO.sub.2, petroleum ether/ethyl acetate=3/1 to 2:1) to give 4b (2.6 g, yield 66%) as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.53 (br. s., 1H), 8.29 (d, J=7.53 Hz, 2H), 7.92 (s, 1H) 7.50-7.57 (m, 1H), 7.41-7.49 (m, 4H), 7.21-7.37 (m, 8H), 6.85 (d, J=7.53 Hz, 4H), 6.39 (t, J=6.53 Hz, 1H), 6.30 (d, J=16.06 Hz, 1H), 5.60 (dd, J=15.56, 9.03 Hz, 1H), 4.48-4.56 (m, 1H), 4.08 (d, J=3.01 Hz, 1H), 3.80 (s, 6H), 3.56 (dd, J=10.54, 3.01 Hz, 1H), 3.28 (dd, J=10.79, 3.26 Hz, 1H), 2.51 (ddd, J=13.55, 6.02, 3.01 Hz, 1H), 2.32 (dt, J=13.93, 6.84 Hz, 1H), 2.19 (d, J=4.02 Hz, 1H), 1.28 (td, J=8.41, 4.77 Hz, 2H), 0.43-0.61 (m, 2H), 0.22-0.01 (m, 2H).
##STR00010##
[0128] To a solution of 4b (2.25 g, 3.22 mmol, 1 equiv) and 4,5-dicyanoimidazole (0.570 g, 4.83 mmol, 1.5 equiv) in DCM (20 mL) was added dropwise of 3-bis(diisopropylamino) phosphanyloxypropanenitrile (1.16 g, 3.86 mmol, 1.2 equiv) at 0 C. under N.sub.2 current. Then the mixture was stirred at 0-25 C. for 2 h under N.sub.2 current. A clear yellow solution was obtained. TLC (DCM/MeOH=20/1) showed 4b was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue. The resulting residue was purified by column chromatography (basic SiO.sub.2, petroleum ether/ethyl acetate=6/1 to 5/1) to give phosphoramidite 5b (2.20 g, 2.44 mmol, 75.9% yield) as a light-yellow foam. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.53 (br. s., 1H) 8.29 (d, J=7.53 Hz, 2H) 7.95 (d, J=18.57 Hz, 1H) 7.50-7.57 (m, 1H) 7.41-7.49 (m, 4H) 7.21-7.38 (m, 7H) 6.85 (dd, J=7.53, 4.52 Hz, 4H) 6.36-6.46 (m, 1H) 6.28 (dd, J=15.81, 3.76 Hz, 1H) 5.57 (dd, J=15.81, 9.29 Hz, 1H) 4.59 (td, J=6.53, 3.01 Hz, 1H) 4.19 (dd, J=15.56, 2.01 Hz, 1H) 3.80 (d, J=2.51 Hz, 6H) 3.48-3.66 (m, 4H) 3.22 (dt, J=10.54, 3.01 Hz, 1H) 2.52-2.70 (m, 2H) 2.27-2.43 (m, 2H) 1.21-1.31 (m, 2H) 1.17 (dd, J=6.78, 2.76 Hz, 10H) 1.04 (d, J=6.53 Hz, 3H) 0.78-0.92 (m, 1H) 0.39-0.56 (m, 2H) 0.29-0.08 (m, 2H). .sup.31P NMR (162 MHz, CDCl.sub.3) 148.36-149.25 (m, 1P). TLC 20:1 DCM:methanol (R.sub.f=0.85).
##STR00011##
[0129] To a solution of 2 (6.00 g, 9.15 mmol, 1 equiv), Cs.sub.2CO.sub.3 (8.95 g, 27.5 mmol, 3 equiv), (E)-2-(2-cyclopropylvinyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (2.59 g, 11.0 mmol, 1.2 equiv) and PPh.sub.3 (1.20 g, 4.58 mmol, 0.5 equiv) in dioxane (40 mL) and water (20 mL) was added Pd(OAc).sub.2 (0.274 g, 1.22 mmol, 0.1 equiv) at 25 C. under N.sub.2 current. The mixture was heated to 90 C. and stirred for 16 h. TLC (DCM/MeOH=20/1) showed 2 was consumed completely. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (100 mL2). The combined organic layers were washed with sat. aqueous NaCl (50 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO.sub.2, DCM/MeOH=50/1 to 20:1) to give the 3c (4.90 g, 7.68 mmol, 83% yield) was obtained as a light-yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 7.82 (s, 1H), 7.43 (d, J=7.53 Hz, 2H), 7.19-7.36 (m, 8H), 6.82 (d, J=8.53 Hz, 4H), 6.52 (t, J=6.53 Hz, 1H), 5.55-5.69 (m, 2H), 4.46-4.55 (m, 1H), 4.16 (d, J=2.51 Hz, 2H), 3.72-3.84 (m, 6H), 3.45 (dd, J=10.04, 3.01 Hz, 1H), 3.29 (dd, J=10.29, 3.26 Hz, 1H), 3.09 (q, J=7.19 Hz, 1H), 2.74 (dt, J=10.79, 2.89 Hz, 1H), 2.21 (dt, J=13.80, 6.65 Hz, 1H), 1.72-1.86 (m, 2H), 1.35-1.59 (m, 9H), 0.92 (br. s., 2H).
##STR00012##
[0130] To a solution of compound 3c (4.8 g, 7.53 mmol, 1.00 equiv) in DMF (50.0 mL) was added Et.sub.3N (1.14 g, 11.3 mmol, 1.50 equiv) and benzoic anhydride (2.04 g, 9.04 mmol, 1.20 equiv). The mixture was stirred at 0-25 C. for 16 h. TLC (DCM/MeOH=20/1) indicated 3c was consumed completely and the reaction was clean. The reaction mixture was quenched by addition water 20 mL at 25 C., and then extracted with ethyl acetate (50 mL). The combined organic layers were washed with sat. aqueous NaCl (20 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (basic SiO.sub.2, petroleum ether/ethyl acetate=5/1 to 2:1) to give compound 4c (3.60 g, yield 64%) as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.52 (br. s., 1H), 8.30 (d, J=7.53 Hz, 2H), 7.90 (s, 1H), 7.50-7.57 (m, 1H), 7.40-7.48 (m, 4H), 7.20-7.37 (m, 8H), 6.84 (d, J=8.03 Hz, 4H), 6.39 (t, J=6.53 Hz, 1H), 6.13 (s, 2H), 4.51-4.58 (m, 1H), 4.10 (d, J=3.01 Hz, 1H), 3.79 (s, 6H), 3.53 (dd, J=10.54, 3.51 Hz, 1H), 3.33 (dd, J=10.54, 3.51 Hz, 1H), 2.52 (ddd, J=13.68, 5.90, 3.01 Hz, 1H), 2.33 (dt, J=13.55, 6.78 Hz, 1H), 2.18 (d, J=3.51 Hz, 1H), 1.79-1.94 (m, 2H), 1.37-1.61 (m, 7H), 1.00 (br. s., 2H). TLC DCM/MeOH=20/1 (R.sub.f=0.43).
##STR00013##
[0131] To a solution of 4c (2.40 g, 3.24 mmol, 1 equiv) and 4,5-dicyanoimidazole (0.574 g, 4.86 mmol, 1.5 equiv) in DCM (20 mL) was added dropwise of 3-bis(diisopropylamino) phosphanyloxypropanenitrile (1.17 g, 3.89 mmol, 1.2 equiv) at 0 C. under N.sub.2 current. Then the mixture was stirred at 0-25 C. for 2 h under N.sub.2 current. A clear yellow solution was obtained. TLC (petroleum ether/ethyl acetate=2/1) showed 4c was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (basic SiO.sub.2, petroleum ether/ethyl acetate=10/1 to 6/1) to give phosphoramidite 5c (1.70 g, 2.44 mmol, 56% yield) as a white foam. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.51 (br. s., 1H), 8.30 (d, J=7.03 Hz, 2H), 7.93 (d, J=18.57 Hz, 1H), 7.50-7.57 (m, 1H), 7.41-7.49 (m, 4H), 7.22-7.37 (m, 8H), 6.84 (dd, J=7.53, 5.02 Hz, 4H), 6.36-6.46 (m, 1H), 6.03-6.18 (m, 2H), 4.62 (td, J=6.78, 3.01 Hz, 1H), 4.16-4.26 (m, 1H), 3.79 (d, J=2.51 Hz, 6H), 3.49-3.66 (m, 4H), 3.27 (dt, J=10.54, 3.76 Hz, 1H), 2.53-2.70 (m, 2H), 2.27-2.44 (m, 2H), 1.72-1.91 (m, 2H), 1.35-1.56 (m, 6H), 1.14-1.23 (m, 9H), 1.05 (d, J=6.53 Hz, 2H), 0.97 (d, J=3.01 Hz, 3H). .sup.31P NMR (162 MHz, CDCl.sub.3) 148.49-149.26 (m, 1P).
##STR00014##
[0132] To a solution of 2 (6.00 g, 12.211.0 mmol, 1 equiv), Cs.sub.2CO.sub.3 (8.95 g, 27.5 mmol, 3 equiv), (E)-2-(4-fluorostyryl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (2.72 g, 11.0 mmol, 1.2 equiv) and PPh.sub.3 (1.20 g, 4.58 mmol, 0.5 equiv) in dioxane (60 mL) and water (30 mL) was added Pd(OAc).sub.2 (0.206 g, 0.915 mmol, 0.1 equiv) at 25 C. under N.sub.2 current. The mixture was heated to 90 C. and stirred for 16 h. TLC (DCM/MeOH=20/1) showed 2 was consumed completely. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (100 mL2). The combined organic layers were washed with sat. aqueous NaCl (50 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO.sub.2, DCM/MeOH=50/1 to 20:1) to give 3d (3.10 g, 4.77 mmol, 52% yield) as a light-yellow solid. TLC DCM/MeOH=20/1 (R.sub.f=0.20).
##STR00015##
[0133] To a solution of 3d (2.7 g, 4.16 mmol, 1.00 equiv) in DMF (30.00 mL) was added Et.sub.3N (0.631 g, 6.24 mmol, 1.50 equiv) and benzoic anhydride (1.13 g, 4.99 mmol, 1.20 equiv). The mixture was stirred at 0-25 C. for 16 h. TLC (petroleum ether/ethyl acetate=1/1) indicated 3d was consumed completely and the reaction was clean according to TLC. The reaction mixture was quenched by addition water 100 mL at 0-5 C., and then extracted with ethyl acetate (50 mL). The combined organic layers were washed with sat. aqueous NaCl (20 mL), dried over MgSO.sub.4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (basic SiO.sub.2, petroleum ether/ethyl acetate=2/1 to 1:1) to give 4d (2.00 g, yield 64%) as a yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.59 (br. s., 1H), 8.32 (d, J=7.53 Hz, 2H), 8.22 (s, 1H), 7.52-7.59 (m, 1H), 7.42-7.51 (m, 4H), 7.33 (dd, J=8.78, 1.76 Hz, 4H), 7.22-7.29 (m, 3H), 7.14-7.21 (m, 1H), 7.05 (d, J=16.56 Hz, 1H), 6.71-6.89 (m, 9H), 6.43 (t, J=6.53 Hz, 1H), 4.58 (br. s., 1H), 4.15 (d, J=2.51 Hz, 1H), 3.59-3.75 (m, 7H), 3.29 (dd, J=11.04, 3.01 Hz, 1H), 2.59 (ddd, J=13.55, 6.02, 3.01 Hz, 1H), 2.41 (dt, J=13.55, 6.78 Hz, 1H), 2.14 (br. s., 1H); .sup.19F NMR (376 MHz, CDCl.sub.3) 114.32 (s, 1F)
##STR00016##
[0134] To a solution of 4d (2.30 g, 3.05 mmol, 1 equiv) and 4,5-dicyanoimidazole (0.570 g, 4.27 mmol, 1.5 equiv) in DCM (20 mL) was added drop wise of 3-bis(diisopropylamino) phosphanyloxypropanenitrile (1.10 g, 3.66 mmol, 1.2 equiv) at 0 C. under N.sub.2 current. Then the mixture was stirred at 0-25 C. for 3 h under N.sub.2 current. A clear yellow solution was obtained. TLC (petroleum ether/ethyl acetate=2/1) showed 4d was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (basic SiO.sub.2, petroleum ether/ethyl acetate=6/1 to 5/1) to give phosphoramidite 5d (2.10 g, 2.20 mmol, 72% yield) as a light-yellow foam. .sup.1H NMR (400 MHz, CDCl.sub.3) 13.59 (s, 1H), 8.33 (d, J=7.53 Hz, 2H), 8.25 (d, J=19.07 Hz, 1H), 7.52-7.59 (m, 1H), 7.41-7.51 (m, 4H), 7.22-7.38 (m, 7H), 7.18 (dd, J=7.03, 4.02 Hz, 1H), 7.03 (d, J=16.06 Hz, 1H), 6.66-6.85 (m, 9H), 6.45 (q, J=6.53 Hz, 1H), 4.65 (td, J=6.53, 3.01 Hz, 1H), 4.19-4.30 (m, 1H), 3.69 (s, 6H), 3.49-3.65 (m, 3H), 3.19-3.28 (m, 1H), 2.58-2.76 (m, 2H), 2.36-2.46 (m, 2H), 1.51 (d, J=6.53 Hz, 1H), 1.17 (d, J=7.03 Hz, 8H), 1.04 (d, J=6.53 Hz, 3H). .sup.31P NMR (162 MHz, CDCl.sub.3) 148.45-149.26 (m, 1P). .sup.19F NMR (376 MHz, CDCl.sub.3) 114.45 (s, 1F). TLC 2:1 pentane ether: ethyl acetate (R.sub.f=0.43).
Synthesis of Phosphoramidite 11
[0135] ##STR00017##
[0136] To a solution of 6 (50.0 g, 141.2 mmol, 1 equiv) and DMAP (0.172 g, 1.41 mmol, 0.01 equiv) in pyridine (500 mL) was added dropwise DMTrCl (50.2 g, 148.2 mmol, 1.05 equiv) and at 0 C. The mixture was stirred at 25 C. for 16 h. TLC (Petroleum ether/Ethyl acetate=1/1) indicated compound 6 was consumed completely. The reaction mixture was concentrated with MeOH (5 mL) under reduced pressure to remove pyridine. The residue was purified by column chromatography (SiO.sub.2, petroleum ether/ethyl acetate=2/1 to 1/2) to give 7 (85.0 g, yield 92%) as a white foam. .sup.1H NMR (400 MHz, CDCl.sub.3) 8.16 (s, 1H), 7.44 (d, J=7.53 Hz, 2H), 7.22-7.38 (m, 7H), 6.87 (d, J=8.53 Hz, 4H), 6.35 (dd, J=7.78, 5.77 Hz, 1H), 4.53-4.62 (m, 1H), 4.11-4.18 (m, 2H), 3.81 (s, 6H), 3.35-3.48 (m, 2H), 2.53 (ddd, J=13.55, 5.52, 2.51 Hz, 1H), 2.26-2.37 (m, 1H). TLC petroleum ether/ethyl acetate=1/1 (R.sub.f=0.15).
##STR00018##
[0137] To a solution of 7 (68.7 g, 105 mmol, 1 equiv), methyl acrylate (54 g, 627 mmol, 2 equiv), PPh.sub.3 (5.5 g, 20.9 mmol, 0.2 equiv), and trimethylamine (21.2 g, 209 mmol, 2 equiv) in dioxane (700 mL) was added Pd(OAc).sub.2 (2.35 g, 10.5 mmol, 0.1 equiv) at 25 C. under N.sub.2 current. The mixture was heated to 90 C. and stirred for 16 h. TLC (petroleum ether/ethyl acetate=1/1) showed 7 was consumed completely. The reaction mixture was filtered under reduced pressure to give a residue. The residue was purified by column chromatography (SiO.sub.2, petroleum ether/ethyl acetate=1/1 to 1.5:1) to give the compound 8 (42 g, 68.3 mmol, 65.3% yield) as a light-yellow solid.
##STR00019##
[0138] To solution of 8 (42 g, 68.3 mmol, 1 equiv) in THF (500 mL) was added NaOH aqueous (1N, 102.5 mL, 1.5 equiv) at 25 C., and then the resulting mixture was stirred at 25 C. for 16 h. TLC (DCM/MeOH=10/1) indicated 8 was consumed completely. The reaction mixture was partitioned between ethyl acetate (200 mL) and water (100 mL), the water phase was separated, acidified with sat. aqueous citric acid to pH7, the white suspension was filtered and dried under reduced pressure to give the compound 9 (30.5 g, 50.8 mmol, 74% yield) as a white solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 7.67 (s, 1H), 7.40 (d, J=7.53 Hz, 2H), 7.24-7.33 (m, 8H), 7.15-7.22 (m, 1H), 6.91 (d, J=15.56 Hz, 1H), 6.82 (d, J=9.04 Hz, 4H), 6.29 (t, J=6.27 Hz, 1H), 4.47 (d, J=6.02 Hz, 1H), 3.99 (d, J=5.02 Hz, 1H), 3.75 (s, 5H), 3.45 (dd, J=10.29, 5.27 Hz, 1H), 3.34 (dd, J=10.04, 4.52 Hz, 1H), 2.41-2.51 (m, 1H), 2.26 (dt, J=13.80, 6.65 Hz, 1H). TLC DCM/MeOH=10/1 (R.sub.f=0.15).
##STR00020##
[0139] A solution of 9 (5 g, 8.32 mmol, 1 equiv), Et.sub.3N (4.21 g, 41.6 mmol, 5 equiv) and HATU (4.75 g, 12.5 mmol, 1.5 equiv) in DMF (60 mL) was stirred for 30 min at 25 C. Then to this mixture was added 2-aminoethyl acetate hydrochloride (1.39 g, 9.99 mmol, 1.2 equiv) at 25 C. The mixture was stirred at 25 C. for 16 h. TLC (DCM/MeOH=20/1) showed the acid was consumed completely. The reaction mixture was quenched by addition of sat. aqueous NaHCO.sub.3 (50 mL) at 25 C., and then extracted with ethyl acetate (100 mL2). The combined organic layers were concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (basic SiO.sub.2, DCM/MeOH=50/1 to 30/1) to give compound 10 (2.7 g, yield 47%) as a white foam. TLC DCM/MeOH=20/1 (R.sub.f=0.30).
##STR00021##
[0140] To a solution of 10 (2.10 g, 3.06 mmol, 1 equiv) and 4,3-dicyanoimidazole (0.343 g, 4.59 mmol, 1.5 equiv) in DCM (30 mL) was added drop wise of 3-bis(diisopropylamino)phosphanyloxypropanenitrile (1.11 g, 3.67 mmol, 1.2 equiv) at 0 C. under N.sub.2 current. Then the mixture was stirred at 0-25 C. for 2 h under N.sub.2 current. A clear yellow solution was obtained. TLC (DCM/MeOH=20/1) showed 10 was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (basic SiO.sub.2, DCM/Acetone=15/1 to 8/1) to give phosphoramidite 11 (1.7 g, 1.44 mmol, 75% yield) as a white foam. .sup.1H NMR (400 MHz, CDCl.sub.3) 7.79-7.90 (m, 1H) 7.43 (d, J=7.53 Hz, 2H), 7.20-7.36 (m, 7H), 7.04 (d, J=15.56 Hz, 1H), 6.82-6.92 (m, 4H), 6.71-6.80 (m, 1H), 6.28 (t, J=6.53 Hz, 1H), 5.41-5.55 (m, 1H), 4.57 (dt, J=6.53, 3.26 Hz, 1H), 4.18-4.29 (m, 1H), 4.07 (q, J=5.02 Hz, 2H), 3.79 (s, 6H), 3.54-3.70 (m, 3H), 3.39-3.51 (m, 3H), 3.28-3.37 (m, 1H), 2.55-2.80 (m, 2H), 2.45 (t, J=6.27 Hz, 1H), 2.28 (dt, J=13.68, 6.96 Hz, 1H), 2.06 (s, 3H), 1.25-1.31 (m, 1H), 1.18 (t, J=6.27 Hz, 9H), 1.09 (d, J=7.03 Hz, 2H).
Synthesis of Phosphoramidite 15
[0141] ##STR00022##
[0142] Pivaloyl chloride (7.25 g, 61.1 mmol, 1 equiv) was added drop wise to a solution of 4-(2-aminoethyl) phenol (7.5 g, 54.5 mmol, 1 equiv) in DCM (50 mL) and TFA (50 mL) at 25 C., then the resulting brown mixture was stirred for 12 h. LCMS showed reactant was consumed completely and one main peak with desired MS was detected. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (SiO.sub.2, DCM: MeOH=20/1 to 1:1) to give compound 13 (9.5 g, 42.9 mmol, 79% yield) as a brown solid. .sup.1H NMR (400 MHz, CDCl.sub.3) 7.21 (d, J=8.53 Hz, 2H), 6.95 (d, J=8.53 Hz, 2H), 3.18 (t, J=7.28 Hz, 2H), 2.90-2.99 (m, 2H), 1.34 (s, 9H). .sup.19F NMR (376 MHz, CDCl3) 75.82 (s, 1F).
##STR00023##
[0143] A solution of 9 (2.8 g, 4.66 mmol, 1 equiv), Et.sub.3N (0.94 g, 9.32 mmol, 2 equiv) and HATU (3.54 g, 9.32 mmol) in DMF (50 mL) was stirred for 30 min at 25 C. Then to this mixture was added 13 (1.13 g, 5.13 mmol, 1.1 equiv) at 25 C. The mixture was stirred at 25 C. for 16 h. TLC (DCM/MeOH=20/1) showed the acid was consumed completely. The reaction mixture was concentrated under reduced pressure to remove solvents. The residue was purified by column chromatography (basic SiO.sub.2, DCM/MeOH=20/1 to 10/1) to give compound 14 (2 g, yield 86%) as a white foam. TLC DCM/MeOH=20/1 (R.sub.f=0.20).
##STR00024##
[0144] To a solution of 14 (2.90 g, 3.61 mmol, 1 equiv) and 4,5-dicyanoimidazole (0.639 g, 5.41 mmol, 1.5 equiv) in DCM (30 mL) was added drop wise of 3-bis(diisopropylamino)phosphanyloxypropanenitrile (1.30 g, 4.33 mmol, 1.2 equiv) at 0 C. under N.sub.2 current. Then the mixture was stirred at 0-25 C. for 2 h under N.sub.2 current. A clear yellow solution was obtained. TLC (DCM/MeOH=20/1) showed 14 was consumed completely. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (basic SiO.sub.2, DCM/acetone=15/1 to 10/1) to give phosphoramidite 15 (1.95 g, 1.94 mmol, 54% yield) as a light-brown gum. .sup.1H NMR (400 MHz, CDCl.sub.3) 7.76-7.91 (m, 2H), 7.45 (d, J=6.02 Hz, 2H), 7.27-7.38 (m, 7H), 7.13-7.26 (m, 3H), 6.97-7.09 (m, 3H), 6.87 (dd, J=8.78, 3.76 Hz, 3H), 6.61 (dd, J=15.56, 11.04 Hz, 1H), 6.28-6.35 (m, 1H), 6.18 (s, 1H), 5.01-5.12 (m, 1H), 4.59 (br. s., 1H), 4.10-4.28 (m, 4H), 3.80 (s, 5H), 3.28-3.62 (m, 9H), 2.78 (td, J=6.15, 1.76 Hz, 3H), 2.60-2.72 (m, 10H), 2.45 (t, J=6.27 Hz, 1H), 2.28 (dt, J=12.92, 6.34 Hz, 1H), 1.37 (s, 7H), 1.30 (t, J=6.27 Hz, 15H), 1.16-1.22 (m, 7H), 1.09 (d, J=6.53 Hz, 3H). .sup.31P NMR (162 MHz, CDCl.sub.3) 148.76-149.28 (m, 1P) 14.16 (s, 2P).
Synthesis and Characterization of Functionalized Oligonucleotides.
[0145] Standard phosphoramidite reagents and 1000-A controlled-pore glass (CPG) supports for dA, Ac-dC, dmf-dG, and dT were purchased from Glen Research, as were chemical phosphorylation reagent II (10-1901) and the phosphoramidite for NHS-carboxy-dT (10-1535). The phosphoramidite reagent for the incorporation of the aminoallyl side-chain-functionalized nucleotide (BA 0311) was purchased from Berry and Associates, as was the perfluoroalkyl-DMT dT phosphoramidite (FL 1300). The phosphoramidite reagents for the incorporation of isopentyl (5a), cyclopropyl (5b), cyclopentyl (5c), fluorophenyl (5d), ethanolamine (11), and tyramine (15) side-chain-functionalized nucleotides were custom synthesized by WuXi AppTec as detailed in the previous section.
[0146] Solid-phase synthesis of side-chain-functionalized DNA was performed on a PerSeptive Biosystems Expedite 8909 DNA synthesizer. All side-chain-functionalized phosphoramidites were incubated with molecular sieves overnight before use. Syntheses were performed on 1-!Imo columns using standard coupling cycles, except for 5-phosphorylation, which required 7 minutes of coupling with chemical phosphorylation reagent II. When the histamine side-chain-functionalized nucleotide was called for, NHS-carboxy-dT was incorporated in its place, and after the full-length synthesis was completed, a solution of histamine (free base; 5 mg) and diisopropylethylamine (1 l) in 200 l of 10% DMSO in acetonitrile was manually injected into the column and allowed to react overnight, and then the column was washed with acetonitrile and dried. Similarly, when a methylamine-functionalized nucleotide was required (for probing side chain SAR; see
Mass Spectrometry Characterization of Chemically Synthesized Functionalized Oligonucleotides
[0147] Oligonucleotide samples were analyzed in negative ion mode using a Bruker Impact II q-TOF mass spectrometer equipped with an Agilent 1290 uHPLC using flow injection analysis. The purified samples were introduced at a constant flow rate of 0.200 mL/minute using 50% acetonitrile and 0.1% formic acid. Each individual data file was calibrated for the m/z scale using a plug of sodium formate clusters introduced through a secondary isocratic pump and introduced using a 6-port valve. Using this internal calibration method, less than 2 ppm relative error was obtained on all samples. Bruker Data Analysis software was used to simulate the isotope pattern for each target ion.
TABLE-US-00012 Expected Expected m/z Observed m/z Observed Name ([M-2H].sup.2) m/z ([M-H].sup.) m/z phos-CAA-Isopentyl 513.6257 513.6253 1028.2588 1028.2580 phos-CAC-Isopentyl 501.6201 501.6198 1004.2475 1004.2467 phos-CTC-Isopentyl 497.1143 497.1142 995.2360 995.2355 phos-CGG-Isopentyl 529.6207 529.6204 1060.2486 1060.2478 phos-CAT- 521.0918 251.0914 1043.1908 1043.1896 Fluorophenyl phos-CAG- 533.5950 533.5946 1068.1973 1086.1961 Fluorophenyl phos-CGA- 533.5950 533.5946 1068.1973 1068.1960 Fluorophenyl phos-CGC- 521.5894 521.5890 1044.1861 1044.1849 Fluorophenyl phos-CTA- 494.0965 494.0961 989.2003 989.1990 Cyclopropyl phos-CCA- 486.5967 486.5961 974.2006 974.1993 Cyclopropyl phos-CCT- 482.0909 482.0907 965.1890 965.1885 Cyclopropyl phos-CCC- 474.5910 474.5907 950.1894 950.1885 Cyclopropyl phos-CTT- 510.6142 510.6137 1022.2356 1022.2343 Cyclopentyl phos-CTG- 523.1174 523.1170 1074.2421 1047.2406 Cyclopentyl phos-CGT- 523.1174 523.1169 1047.2421 1047.2406 Cyclopentyl phos-CCG- 515.6176 515.6170 1032.2425 1032.2408 Cyclopentyl phos-TTT-Phenol 551.5987 551.5983 phos-TTG-Phenol 564.1020 564.1019 1129.2112 1129.2099 phos-TGT-Phenol 564.1020 564.1015 1129.2112 1129.2094 phos-TCG-Phenol 556.6021 556.6017 1114.2115 1114.2103 phos-TAA-Imidazole 547.6081 547.6079 1096.2234 1096.2227 phos-TAC-Imidazole 535.6025 535.6023 1072.2122 1072.2117 phos-TCA-Imidazole 535.6025 535.6021 1072.2122 1072.2113 phos-TCC-Imidazole 523.5969 523.5964 1048.2010 1048.1999 phos-TAT-Primary 518.0889 518.0883 1037.1850 1037.1837 alcohol phos-TAG-Primary 530.5921 530.5917 1062.1915 1062.1904 alcohol phos-TGA-Primary 530.5921 530.5917 1062.1915 1062.1903 alcohol phos-TGC-Primary 518.5865 518.5862 1038.1802 1039.1793 alcohol phos-TTA-Allylamine 489.0861 489.0857 979.1795 979.1786 phos-TTC-Allylamine 955.1683 955.1672 phos-TCT-Allylamine 955.1683 955.1673 phos-TGG-Allylamine 509.5868 509.5864 1020.1809 1020.1799
[0148] Mass spectrometry data for PCSK9-Evo5-syn are given in
Additional Experimental Procedures
Isolation of Single-Stranded HFNAP by Templated Translation Via DNA Following Ligase-Mediated Polymerization
[0149] To synthesize the double-stranded HFNAP-template hybrid, template (10 pmol), polymerization initiation and termination primers (15 pmol each), functionalized trinucleotide building blocks (100 pmol for each occurrence of the corresponding codon) and 10T4 RNA ligase reaction buffer (New England Biolabs, B0216L; 1 L) were mixed in a total volume of 8 L in a PCR tube. The mixture was subjected to the following temperature program on a thermocycler: 95 C. for 10 sec; 65 C. for 4 min; a ramp from 65 C. to 4 C. at 0.1 C. per 10 s. To the PCR tube were added 1 L of 10 mM ATP and 1 L of T3 DNA Ligase (New England Biolabs, M0317L; 3000000 units/ml) while the reaction mixture was kept at 4 C. The reaction was incubated at 4 C. for 12 h and then at 16 C. for 2 h. For the evaluation of translation yield on template libraries (
[0150] To synthesize an unbiotinylated HFNAP, unbiotinylated primers and a doubly biotinylated ssDNA template (200 pmol), polymerization initiation and termination primers (300 pmol each), functionalized trinucleotide building blocks (2 nmol for each occurrence of the corresponding codon) and 10T4 RNA ligase reaction buffer (20 L) were mixed in a total volume of 180 L. The mixture was split in 10 equal volumes into PCR tubes and subjected to the following temperature program on a thermocycler: 95 C. for 10 sec; 65 C. for 4 min; a ramp from 65 C. to 4 C. at 0.1 C. per 10 s. To each PCR tube were added 1 L of 10 mM ATP and 1 L of T3 DNA Ligase while the reaction mixture was kept at 4 C. The reaction was incubated at 4 C. for 12 h and then at 16 C. for 2 h. The portions were was used in a solution phase polymerization reaction. After the reaction incubation period, the reaction mixture was combined and 50 L of a 1% suspension of with MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific, 65002; 1 L of the stock 1% suspension per 4 pmol of biotinylated template), and then an equal volume of 2 bind-and-wash buffer (2M NaCl, 2 mM EDTA, 20 mM Tris-HCl, pH 7.5) was added. After 30 minutes of incubation on a rotor, the supernatant was removed by magnetic separation, and the beads were suspended 18 L of 20 mM NaOH. The supernatant was combined with 12 L of formamide denaturing mix (95% formamide, 1 mM EDTA) and run on a 10% TBE-urea PAGE gel. Desired product was visualized by UV shadowing at 265 nm against a TLC plate (with F254 indicator), excised from the gel, eluted in 200 L of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) overnight, filtered, mixed with 2 mL of ssDNA column loading mix (40:60:0.5 v/v/v of saturated aqueous guanidinium chloride/isopropanol/3M sodium acetate, pH 5.2) and cleaned up with a Qiagen QiaQuick column. Typical isolated yield of HFNAP from 200 pmol of template was between 5 and 15 pmol as determined by Nanodrop or quantitative PCR. For the validation of sequence specificity of translation and amplification (
[0151] Synthesis and isolation of a biotinylated HFNAP followed the same procedure as above, except that an unbiotinylated ssDNA template was used, and one of polymerization primers was doubly biotinylated. After polymerization reaction, streptavidin bead capture, and alkaline denaturation, the bead-bound biotinylated molecules were immobilized on beads as described above. The supernatant was removed, and the beads were washed three times with 20 L of 20 mM NaOH. The beads were then suspended in 20 L of formamide denaturing mix (95% formamide, 1 mM EDTA) and heated to 95 C. or 30 min. After cooling to room temperature and magnetic separation, desired product was isolated from the supernatant was directly loaded onto by PAGE on a 10% denaturing TBE-urea PAGE gel and separated by electrophoresis. Desired product was excised from the gel and eluted. Typical isolated yield of HFNAP from 200 pmol of template was between 5 and 15 pmol as determined by Nanodrop or quantitative PCR.
[0152] Synthesis and isolation of a biotinylated, truncated HFNAP (such as PCSK9-Evo5) followed the same procedure, except that the primer contained a 2-deoxy-U nucleotide, and the ligation reaction mixture was treated with USER enzyme (New England Biolabs) at 37 C. for 2 h before proceeding to streptavidin bead capture.
[0153] During the selections, polymerization reactions were performed with templates immobilized on streptavidin beads and processed as detailed in the main text Methods section.
Selection of HFNAPs that Bind Protein Targets
Selection of PCSK9-Binding HFNAPs from a Nave Library
[0154] Recombinant human PCSK9 protein (ACROBiosystems, PC9-H5223) was immobilized onto AminoLink Plus aldehyde-functionalized agarose resin via reductive amination with a MicroLink Protein Coupling Kit (ThermoFisher Scientific, 20475) at a loading of 1 mg protein per mL resin according to the resin's manufacturer's instructions.
[0155] To initiate the selection, primer extension was performed with 10 pmol BtBt-ExtA on 5 pmol of sense strand randomized DNA library (nave library AZ15) with Klenow (exo-) polymerase (New England Biolabs, M0212S) at 37 C. overnight. The reaction mixture was combined with an equal volume of 2 bind-and-wash buffer (2 M NaCl, 2 mM EDTA, 20 mM Tris-HCl, pH7.5) and immobilized onto 10 L of a 1% suspension of MyOne Streptavidin C1 magnetic beads. After removal of supernatant, the beads were washed three times with 20 L of 20 mM NaOH (leaving a biotinylated ssDNA template library on the beads) and then twice with 20 L of 1T4 RNA ligase reaction buffer.
[0156] To the bead-immobilized template library were added pp1A and pp2Z (7.5 pmol each), a mixture of all 32 functionalized trinucleotide building blocks (100 pmol each), 10T4 RNA ligase reaction buffer (1 L), and water to a total of 8 L. The suspension was transferred to a PCR tube and subjected to the following temperature program on a thermocycler: 95 C. for 10 sec; 65 C. for 4 min; a ramp from 65 C. to 4 C. at 0.1 C. per 10 s. To the PCR tube were added 1 L of 10 mM ATP and 1 L of T3 DNA Ligase. The reaction was incubated at 4 C. for 12 h and then at 16 C. for 2 h. An additional 10 L of a 1% suspension of MyOne Streptavidin C1 magnetic beads and 20 L of 2 bind-and-wash buffer was added, and the mixture was incubated at room temperature for 30 min before magnetic separation. The supernatant was discarded, and then the unbiotinylated HFNAP strand was eluted from the beads by treatment with 230 L of 20 mM NaOH. To the combined HFNAP fractions was added 600 uL of ssDNA column loading mix (40:60:0.5 v/v/v of saturated aqueous guanidinium chloride/isopropanol/3M sodium acetate, pH 5.2) and the mixture was cleaned up with a Qiagen MinElute column, eluting into 15 L of water.
[0157] The HFNAP was added to 35 L of DPBS (with calcium and magnesium; Lonza 17-513Q) containing 0.1 mg/ml BSA and 0.01% Tween-20, and then incubated with PCSK9 resin in a micro-spin filtration column (Pierce 89879) at room temperature for 1 h on a rotor. (The amounts of resin-bound protein used in each round are indicated in
[0158] Samples of 1 L each from the flow-through, the three washes, and the elution were quantified by qPCR (20 L reaction volume) using the iTaq Supermix (Biorad, 172-5125) with pp2Z and ExtA (500 nM each) as primers under the following temperature program: 95 C. for 3 min; 35 cycles of 95 C. for 15 s, 59.5 C. for 30 s, 72 C. for 15 s. The number of cycles for the qPCR curve on the elution sample to reach the end of exponential growth was used as the number of cycles for the preparative PCR (400 L reaction volume split into 850 L) using Q5 Hot Start High-Fidelity 2 Master Mix (New England Biolabs, M0494), with the selection elution pool (20 L) as template and pp2Z and BtBt-ExtA (500 nM each) as primers, under the same annealing and extension temperatures as in the qPCR. The finished reaction was mixed with 2 mL of ssDNA column loading mix and cleaned up with a Qiagen MinElute column, eluting into 15 L of water. The amplified dsDNA was purified by PAGE on a non-denaturing 10% TBE gel. A portion (indicated in
Evolution of PCSK9-A5 for Higher Affinity
[0159] The evolution of PCSK9-A5 was performed in a similar fashion with the following differences. Rediv library AZ15 (custom synthesized by TriLink BioTechnologies) was used to initiate the selection. The primer pp1A-3ddC was used instead of pp1A for ligase-based polymerization in order to facilitate the removal of cheaters (
Selection of IL-6-Binding HFNAPs from a Nave Library
[0160] The selection of IL-6-binding HFNAPs was performed in a similar fashion with the following differences. Recombinant human IL-6 protein (PeproTech, 200-06) immobilized on AminoLink Plus aldehyde at 0.25 mg protein per ml resin was used as the immobilized target. Throughout the selection, 240 pmol of immobilized IL-6 protein was used in each round. A primer extension on nave library CW15 with BtBt-ExtC was used to initiate the selection. The primers pp1C and pp2W were used for ligase-based polymerization (translation) reactions. The primers ExtC and pp2W were used for qPCR reactions. The primers BtBt-ExtC and pp2W were used in PCR reactions that amplify affinity-enriched HFNAP into dsDNA for initiating the next round of selection.
High-Throughput DNA Sequencing and Data Analysis
[0161] Small samples from the elution pool of selection rounds were amplified by PCR using Q5 Hot Start High-Fidelity 2 Master Mix with MiSeqA and MiSeqZ as primers to sub-saturation number of cycles (determined during the selection by qPCR) with primers that install flanking sequences. The amplicons were PAGE-purified and amplified by PCR with IIlumina adapter primers. The amplicons were again PAGE-purified and subjected to high-throughput sequencing on an IIlumina MiSeq.
[0162] For the IL-6 selection, samples were similarly prepared by PCR amplification with MiSeqC and MiSeqW. The amplicons were PAGE-purified and PCR amplified with IIlumina adapter primers. The amplicons were again PAGE-purified and subjected to high-throughput sequencing on an IIlumina MiSeq.
Processing and Analysis of High-Throughput Sequencing Data
[0163] The FASTQ files from high-throughput sequencing were first processed with CutAdapt for the following operations: a quality-based trim (with a threshold Phred score of 30), removal of constant regions (with a one-base error tolerance in each region; sequences were discarded if either constant region was not found), and filtering for the correct length (45) in the remaining sequence. Sequences that could not be completely parsed into trimer codons (whose first nucleobase should always be C or T) were discarded.
[0164] For the initial PCSK9 selection and the IL-6 selection, the copy numbers of all unique sequences were tallied and the unique sequences above 5 reads per million were clustered using FASTAptamer. Sequence logos for PCSK9 selection-enriched sequences were then generated for individual clusters with WebLogo 3. For the PCSK9-A5 evolution, sequence logos were generated directly from sequencing data with WebLogo 3.
Affinity Characterization by Bead Retention Assay
[0165] Candidate PCSK9-binding HFNAPs (from 0.5 pmol template via a ligase-catalyzed polymerization reaction) or sequence-matched unfunctionalized DNA (0.5 pmol) in 50 L of DPBS (with calcium and magnesium) containing 0.1 mg/ml BSA and 0.01% Tween-20 was incubated with 1 L of either PCSK9 beads or thrombin beads (AminoLink Plus aldehyde-functionalized agarose resin with protein loaded at 1 mg protein per mL resin via reductive amination) in a micro-spin filtration column (Pierce 89879) at room temperature for 1 h on a rotor. Following the same procedure described for the selection, flow-through was collected, the beads were washed three times and the retained HFNAP or DNA was eluted by heating, and the amount of amplifiable HFNAP or DNA in the flow-through, wash, and elution samples were quantified by qPCR.
[0166] Candidate IL-6-binding HFNAPs and sequence-matched DNA were similarly assayed on PCSK9 beads (prepared as above, but serving as negative control) or on IL-6 beads (AminoLink Plus aldehyde-functionalized agarose resin with protein loaded at 0.25 mg protein per mL resin via reductive amination).
Detailed Procedures for Surface Plasmon Resonance (SPR) Assays
[0167] All SPR assays were performed at 25 C. on a Biacore X100 or Biacore T200 (GE Healthcare Life Sciences). Binding kinetics between enzymatically synthesized biotinylated HFNAPs and unlabeled PCSK9 (ACROBiosystems, PC9-H5223) were measured using single-cycle kinetics with the Biotin CAPture kit (GE Life Sciences, 28920233 or 28920234). HBS-EP buffer (GE Life Sciences, BR100188), diluted by MilliQ water to 0.9, was used as the bulk running buffer. Each experiment consisted of three start-up cycles followed by multiple data collection and blank cycles. In each data collection cycle, the CAP reagent was injected onto both active and control flow cells of the CAP chip to generate streptavidin-coated surfaces, and then a doubly biotinylated HFNAP was injected onto the active flow cell as the immobilized ligand. Afterwards, four ascending concentrations of PCSK9 protein [10, 30, 100, 300 nM protein supplemented with 1 mg/ml salmon sperm DNA (Invitrogen, 15632-011) as nonspecific binding reducer for PCSK9-A5 and its variants; 2, 6, 20, 60 nM protein without salmon sperm DNA for PCSK9-Evo5 and its variants] in 0.9HBS-EP were injected onto both flow cells in series at 30 L/min for 150 seconds each, followed by 240 seconds of dissociation. Both flow cells were then regenerated with a 3:1 mixture of 8 M guanidinium chloride and 1 M NaOH following manufacturer's instructions. Blank cycles were run similarly except that 0.9HBS-EP (containing 1 mg/ml salmon sperm DNA when PCSK9-A5 and its variants were assayed) without PCSK9 protein was injected. As signals from blank cycles were similar regardless of the immobilized HFNAP, one blank cycle was run for every two data collection cycles. Kinetic parameters were fitted to double-blank-subtracted sensograms using BIAEvaluation software under a 1:1 binding model, unless stated otherwise. Binding between biotinylated Evo5 and truncated PCSK9 protein missing the prodomain (human mature PCSK9, ACROBiosystems, PC9-H5226) was also assayed using this protocol.
[0168] Binding kinetics between enzymatically synthesized biotinylated HFNAPs and unlabeled IL-6 protein, expressed in either E. coli (PeproTech, 200-06) or human HEK293 cells (ACROBiosystems, IL6-H4218), were assayed similarly with the following differences. Four ascending concentrations (10, 30, 100, 300 nM) of IL-6 without additional nonspecific binding reducer were injected in the single-cycle kinetic runs. As the binding kinetics did not fit a classical 1:1 binding model, a heterogeneous ligand model was used to fit the double-blank-subtracted sensograms.
[0169] Binding kinetics between chemically synthesized Evo5-syn and biotinylated Avi-tagged PCSK9 (ACROBiosystems, PC9-H82E7) were measured using single-cycle kinetics with on a Series S SA chip (GE Life Sciences, BR100531) using 0.9HBS as the bulk running buffer. Both active and control flow cells were conditioned with three consecutive one-minute injections of 1 M NaCl in 50 mM NaOH. Biotinylated PCSK9 in 0.9HBS buffer was immobilized onto the active flow cell to 1000 RU. Either five portions of buffer or five ascending concentrations of Evo5-syn (1.8, 6, 18, 60, 180 nM) were injected onto both flow cells in series at 30 L/min for 150 seconds each, followed by 600 seconds of dissociation. Kinetic parameters were fitted to double-blank-subtracted sensograms under a 1:1 binding model using BIAEvaluation software.
[0170] Binding of PCSK9 on surface-immobilized LDLR in the presence of various competing agents was measured on a Series S SA chip. The bulk running buffer was 10 mM HEPES, 150 mM NaCl, 0.1 mM CaCl.sub.2, 0.005% Tween-20, pH 7.5. Both active and control flow cells were conditioned with three consecutive one-minute injections of 1 M NaCl in 50 mM NaOH, and then biotinylated Avi-tagged LDLR (BPS Bioscience, 71206) was immobilized onto the active flow cell to 2000 RU. In each data collection cycle, a solution consisting of PCSK9 (20 nM final), a carboxymethyl dextran-based non-specific binding reducer (GE Healthcare, BR-1006-91, 1 mg/ml final), and varying concentrations (0, 2, 6, 20, 60, or 200 nM final) of PCSK9-Evo5-syn, Evo5DNA-InvdT, unlabeled LDLR (AcroBiosystems, LDR-H5224), or a known PCSK9-neutralizing antibody (BPS Bioscience, 71207) in bulk running buffer was injected at 10 L/min for 420 s, followed by 15 s of dissociation. The surface was regenerated using two consecutive one-minute injections of 50 mM HCl. Blank cycles were run similarly except that running buffer containing 1 mg/ml non-specific binding reducer without protein was injected. Response levels at the end of the injection periods from double-blank-subtracted sensograms were recorded.
[0171] Electrophoretic Mobility Shift Assay (EMSA)
[0172] A 7.5% Tris-Glycine polyacrylamide gel (Bio-rad, 5671024) was pre-run at 150 V for 1 hour at 4 C. in a cold room. Mixtures (12 l each) of PCSK9-Evo5-Fluor or a sequence-matched DNA (1 nM final), PCSK9 protein (ACROBiosystems, PC9-H5223, between 0.3 and 300 nM final), and salmon sperm DNA (Invitrogen, 15632-011, 30 g/ml final) in 0.5HBS-EP buffer (diluted from HBS-EP buffer, GE Life Sciences, BR100188) containing 3% v/v glycerol was incubated at 25 C. for 30 minutes, and then at 4 C. for 5 minutes. The mixtures were loaded onto the pre-run gel and run at 150 V for 15 minutes at 4 C. The gel was imaged with a Typhoon imager using the Cy5 channel. DNA secondary structure prediction was performed on the mfold Web server.
Supplementary Text
[0173] The ligase-catalyzed polymerization can produce cheater byproducts by incorporating a polymerization primer into the reading frame, resulting in shorter products that more rapidly amplify during PCR (
##STR00025## ##STR00026##
##STR00027##
##STR00028##
SUPPLEMENTARY REFERENCES
[0174] 1. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17, 10-12 (2011). [0175] 2. Alam, K. K., Chang, J. L. & Burke, D. H. FASTAptamer: A Bioinformatic Toolkit for High-throughput Sequence Analysis of Combinatorial Selections. Mol. Ther.Nucleic Acids 4, e230 (2015). [0176] 3. Crooks, G. E., Hon, G., Chandonia, J.-M. & Brenner, S. E. WebLogo: a sequence logo generator. Genome Res. 14, 1188-1190 (2004). [0177] 4. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415 (2003).