MICROORGANISMS FOR PLANT PATHOGEN INHIBITION
20200170257 ยท 2020-06-04
Inventors
- Michael R. King (Oak Creek, WI, US)
- Sona Son (Cudahy, WI, US)
- Amy Lange (Greendale, WI, US)
- Megan Duersteler (Franklin, WI, US)
- Elizabeth Galbraith (Wauwatosa, WI)
Cpc classification
A01P1/00
HUMAN NECESSITIES
C12R2001/125
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to treatment of a plant with one or more microorganisms for inhibiting a plant pathogen. More particularly, the invention relates to isolated Bacillus strains, and strains having all of the identifying characteristics of these strains, and combinations thereof, for a use comprising the above-mentioned use.
Claims
1. A method of treating a plant to inhibit a fungal disease or a bacterial disease, the method comprising contacting the plant with a composition comprising an effective amount of an isolated Bacillus strain selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof, and inhibiting the fungal disease or the bacterial disease.
2. The method of claim 1 wherein the Bacillus strain is selected from the group consisting of Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
3. The method of claim 1 wherein the Bacillus strain is selected from the group consisting of Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
4. The method of claim 2 wherein the Bacillus strain is Bacillus strain 300 (NRRL No. B-50943).
5. The method of claim 2 where the Bacillus strain is Bacillus strain 235 (NRRL No. B-67219).
6. The method of claim 2 wherein the Bacillus strain is Bacillus strain 1607 (NRRL No. B-67666).
7. The method of claim 2 wherein the Bacillus strain is Bacillus strain 101 (NRRL No. B-67218).
8. The method of claim 2 wherein the Bacillus strain is Bacillus strain 77 (NRRL No. B-67274).
9. The method of claim 1 wherein the Bacillus strain has antifungal activity.
10. The method of claim 9 wherein the fungal disease is caused by a fungus of a genus selected from the group consisting of Ganoderma, Phytophthora, Fusarium, and combinations thereof.
11. The method of claim 9 wherein the fungal disease is caused by a fungus selected from the group consisting of Ganoderma boninense, Ganoderma mirabile, Ganoderma weberianum, Phytophthora palmivora, Fusarium kyushuense, Fusarium oxysporum, Fusarium nelsonii, Cladosporium cladosporioides, Pichia manshurica, Pichia kudriavzevii, Aspergillus fumigatus, and combinations thereof.
12. The method of claim 11 wherein the fungus is Ganoderma boninense.
13. The method of claim 11 wherein the fungus is Ganoderma mirabile.
14. The method of claim 11 wherein the fungus is Ganoderma weberianum.
15. The method of claim 11 wherein the fungus is Phytophthora palmivora.
16. The method of claim 11 wherein the fungus is Fusarium kyushuense.
17. The method of claim 11 wherein the fungus is Fusarium oxysporum.
18. The method of claim 11 wherein the fungus is Fusarium nelsonii.
19. A commercial package or a composition comprising an isolated Bacillus strain selected from the group consisting of Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
20. A commercial package or a composition comprising an isolated Bacillus strain used to inhibit a fungal disease or a bacterial disease in a plant wherein the isolated Bacillus strain is selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
21. The composition of claim 20 wherein the composition is a liquid.
22. The composition of claim 20 wherein the composition is dry.
23. The composition of claim 22 wherein the composition is freeze-dried, in the form of a powder, or in the form of a pellet.
24. The method of claim 11 wherein the fungus is Cladosporium cladosporioides.
25. The method of claim 11 wherein the fungus is Pichia manshurica.
26. The method of claim 11 wherein the fungus is Pichia kudriavzevii.
27. The method of claim 11 wherein the fungus is Aspergillus fumigatus.
28. The method of claim 1 wherein the bacterial disease is caused by bacteria of the genus Ralstonia.
29. The method of claim 28 wherein the bacteria are Ralstonia solanacearum.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0070]
[0071]
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0072] Applicants have developed Bacillus strains, and combinations thereof, that can be used to treat plants to inhibit a fungal disease or a bacterial disease. More particularly, the invention relates to isolated Bacillus strains, and strains having all of the identifying characteristics of these strains, and combinations thereof, for a use comprising the above-mentioned use. These fungal and bacterial diseases detrimentally affect plants and cause significant economic losses in the horticulture, agricultural, and forestry industries, for example.
[0073] In one embodiment, a method of treating a plant to inhibit a fungal disease or a bacterial disease is provided. The method comprises contacting the plant with a composition comprising an effective amount of an isolated Bacillus strain selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof, and inhibiting the fungal disease or the bacterial disease.
[0074] In another embodiment, a commercial package is provided. The commercial package comprises an isolated Bacillus strain selected from the group consisting of Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0075] In yet another embodiment, a composition is provided comprising an isolated Bacillus strain selected from the group consisting of Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof. In another aspect, this Bacillus strain composition can be used to inhibit a fungal disease or a bacterial disease in a plant.
[0076] In another embodiment, a commercial package or a composition is provided comprising an isolated Bacillus strain used to inhibit a fungal disease or a bacterial disease in a plant wherein the isolated Bacillus strain is selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0077] The following clauses, and combinations thereof, provide various additional illustrative aspects of the invention described herein. The various embodiments described in this section titled DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS are applicable to any of the following embodiments of the invention described in the numbered clauses below.
[0078] 1. A method of treating a plant to inhibit a fungal disease or a bacterial disease, the method comprising contacting the plant with a composition comprising an effective amount of an isolated Bacillus strain selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof, and inhibiting the fungal disease or the bacterial disease.
[0079] 2. The method of clause 1 wherein the Bacillus strain is selected from the group consisting of Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0080] 3. The method of clause 1 or 2 wherein the Bacillus strain is selected from the group consisting of Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0081] 4. The method of clause 2 wherein the Bacillus strain is Bacillus strain 300 (NRRL No. B-50943).
[0082] 5. The method of clause 2 where the Bacillus strain is Bacillus strain 235 (NRRL No. B-67219).
[0083] 6. The method of clause 2 wherein the Bacillus strain is Bacillus strain 1607 (NRRL No. B-67666).
[0084] 7. The method of clause 2 wherein the Bacillus strain is Bacillus strain 101 (NRRL No. B-67218).
[0085] 8. The method of clause 2 wherein the Bacillus strain is Bacillus strain 77 (NRRL No. B-67274).
[0086] 9. The method of any one of clauses 1 to 8 wherein the Bacillus strain has antifungal activity.
[0087] 10. The method of any one of clauses 1 to 9 wherein the fungal disease is caused by a fungus of a genus selected from the group consisting of Ganoderma, Phytophthora, Fusarium, and combinations thereof.
[0088] 11. The method of clause 10 wherein the fungal disease is caused by a fungus selected from the group consisting of Ganoderma boninense, Ganoderma mirabile, Ganoderma weberianum, Phytophthora palmivora, Fusarium kyushuense, Fusarium oxysporum, Fusarium nelsonii, Cladosporium cladosporioides, Pichia manshurica, Pichia kudriavzevii, Aspergillus fumigatus, and combinations thereof.
[0089] 12. The method of clause 11 wherein the fungus is Ganoderma boninense.
[0090] 13. The method of clause 11 wherein the fungus is Ganoderma mirabile.
[0091] 14. The method of clause 11 wherein the fungus is Ganoderma weberianum.
[0092] 15. The method of clause 11 wherein the fungus is Phytophthora palmivora.
[0093] 16. The method of clause 11 wherein the fungus is Fusarium kyushuense.
[0094] 17. The method of clause 11 wherein the fungus is Fusarium oxysporum.
[0095] 18. The method of clause 11 wherein the fungus is Fusarium nelsonii.
[0096] 19. The method of any one of clauses 1 to 18 further comprising treating the plant with a different Bacillus strain, a lactic acid bacterial strain, and combinations thereof.
[0097] 20. The method of any one of clauses 1 to 19 wherein the effective amount of the Bacillus strain is about 1.010.sup.2 CFU/ml or gram of the composition used to contact the plant to about 1.010.sup.8 CFU/ml or gram of the composition used to contact the plant.
[0098] 21. The method of any one of clauses 1 to 19 wherein the effective amount of the Bacillus strain is about 1.010.sup.2 CFU/ml or gram of the composition used to contact the plant to about 1.010.sup.4 CFU/ml or gram of the composition used to contact the plant.
[0099] 22. The method of any one of clauses 1 to 19 wherein the effective amount is an amount greater than about 1.010.sup.2 CFU/ml or gram of the composition used to contact the plant to about 1.010.sup.3 CFU/ml or gram of the composition used to contact the plant.
[0100] 23. The method of any one of clauses 1 to 22 wherein the Bacillus strain comprises live Bacillus cells or spores.
[0101] 24. The method of clause 23 wherein the Bacillus strain comprises live Bacillus cells.
[0102] 25. The method of clause 23 wherein the Bacillus strain comprises spores.
[0103] 26. The method of any one of clauses 1 to 25 wherein the composition is a liquid.
[0104] 27. The method of any one of clauses 1 to 25 wherein the composition is dry.
[0105] 28. The method of clause 27 wherein the composition is lyophilized.
[0106] 29. The method of any one of clauses 1 to 28 wherein the contacting is by spraying the composition onto the plant.
[0107] 30. The method of any one of clauses 1 to 28 wherein the contacting is by manually applying the composition onto the plant.
[0108] 31. The method of any one of clauses 1 to 30 wherein the plant is contacted by contacting the composition with a part of the plant selected from the group consisting of a leaf, a seed, a root, a flower, a shoot, a bud, and combinations thereof.
[0109] 32. The method of any one of clauses 1 to 30 wherein the plant is contacted by applying the composition to the soil from which the plant obtains nutrients.
[0110] 33. The method of any one of clauses 1 to 32 wherein the plant is a palm plant.
[0111] 34. A commercial package or a composition comprising an isolated Bacillus strain selected from the group consisting of Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0112] 35. A commercial package or a composition comprising an isolated Bacillus strain used to inhibit a fungal disease or a bacterial disease in a plant wherein the isolated Bacillus strain is selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0113] 36. The commercial package or composition of any one of clauses 34 to 35 wherein the Bacillus strain is in the form of a concentrate.
[0114] 37. The commercial package or composition of any one of clauses 34 to 35 wherein the Bacillus strain is in the form of a superconcentrate.
[0115] 38. The commercial package or composition of any one of clauses 34 to 37 wherein the Bacillus strain is in a dry form.
[0116] 39. The commercial package or composition of any one of clauses 34 to 37 wherein the Bacillus strain is in a form selected from the group consisting of a powder and a liquid.
[0117] 40. The commercial package or composition of any one of clauses 34 to 39 further comprising a carrier for the Bacillus strain.
[0118] 41. The commercial package or composition of clause 40 wherein the carrier is selected from the group consisting of salt, a dextrin, and combinations thereof.
[0119] 42. The commercial package or composition of any one of clauses 34 to 41 in a bag.
[0120] 43. The commercial package or composition of clause 42 wherein the bag is a plastic bag.
[0121] 44. The commercial package or composition of any one of clauses 34 to 43 further comprising instructions for use of one or more of the Bacillus strains.
[0122] 45. The commercial package or composition of any one of clauses 42 to 43 in a 20-pound bag.
[0123] 46. The commercial package or composition of any one of clauses 42 to 43 in a 50-pound bag.
[0124] 47. The commercial package or composition of clause 39 wherein the Bacillus strain is in powder form.
[0125] 48. The commercial package or composition of clause 39 wherein the Bacillus strain is in liquid form.
[0126] 49. The commercial package or composition of any one of clauses 34 to 48 wherein the Bacillus strain is in a container for commercial use.
[0127] 50. The commercial package or composition of clause 49 wherein the container comprises plastic.
[0128] 51. The commercial package or composition of clause 49 wherein the container comprises paper.
[0129] 52. The commercial package or composition of any one of clauses 34 to 51 further comprising a binder.
[0130] 53. The commercial package or composition of clause 52 wherein the binder is selected from the group consisting of clay, yeast cell wall components, aluminum silicate, and glucan, or combinations thereof.
[0131] 54. The commercial package or composition of any one of clauses 34 or 36 to 53 wherein the Bacillus strain is used to inhibit a fungal disease in a plant.
[0132] 55. The commercial package or composition of any one of clauses 34 or 36 to 53 wherein the Bacillus strain is used to inhibit a bacterial disease in a plant.
[0133] 56. The method of clause 11 wherein the fungus is Cladosporium cladosporioides.
[0134] 57. The method of clause 11 wherein the fungus is Pichia manshurica.
[0135] 58. The method of clause 11 wherein the fungus is Pichia kudriavzevii.
[0136] 59. The method of clause 11 wherein the fungus is Aspergillus fumigatus.
[0137] 60. The method of any one of clauses 1 to 33 wherein the bacterial disease is caused by bacteria of the genus Ralstonia.
[0138] 61. The method of clause 60 wherein the bacteria are Ralstonia solanacearum.
[0139] In various embodiments, the Bacillus strain for use in accordance with the methods, commercial packages, and compositions described herein can be selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0140] Bacillus strain MDG 101 and Bacillus strain MDG 235 were deposited on Jan. 4, 2016 at the Agricultural Research Service Culture Collection (NRRL), National Center for Agricultural Utilization Research, Agricultural Research Service, USDA, 1815 North University Street, Peoria, Ill. 61604-3999, and were given accession numbers B-67218 and B-67219, respectively. Bacillus strain MGL77, Bacillus strain MGL177, and Bacillus strain MGL102 were deposited on June 7, 2016 at the Agricultural Research Service Culture Collection (NRRL), National Center for Agricultural Utilization Research, Agricultural Research Service, USDA, 1815 North University Street, Peoria, Ill. 61604-3999, and were given accession numbers B-67274, B-67275, and B-67276, respectively. The deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The NRRL strain designations are MDG 101, MDG 235, MGL77, MGL177, and MGL102 which are equivalent to Bacillus strain 101, 235, 77, 177, and 102 respectively, as referred to in the application. Bacillus strain MDG86 and Bacillus strain MDG300 were deposited on Mar. 14, 2014 at the Agricultural Research Service Culture Collection (NRRL), National Center for Agricultural Utilization Research, Agricultural Research Service, USDA, 1815 North University Street, Peoria, Ill. 61604-3999, and were given accession numbers B-50944 and B-50943, respectively. The deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The NRRL strain designations are MDG86 and MDG300, which are equivalent to Bacillus strain 86 and 300, respectively, as referred to in the application.
[0141] Bacillus strain ATC2 was deposited on Sep. 16, 2015 at the Agricultural Research Service Culture Collection (NRRL), National Center for Agricultural Utilization Research, Agricultural Research Service, USDA, 1815 North University Street, Peoria, Ill. 61604-3999, and was given accession number B-67134. The deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The NRRL strain designation is ATC2, which is equivalent to Bacillus strain ATC2, as referred to in the application.
[0142] Bacillus strain MDGA12 was deposited on Sep. 14, 2017 at the Agricultural Research Service Culture Collection (NRRL), International Depository Authority, 1815 North University Street, Peoria, Ill. 61604, and was given accession number B-67516. The deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The NRRL strain designation is MDGA12, which is equivalent to Bacillus strain A12, as referred to in the application.
[0143] Bacillus strains V17, V18, and 1607 were deposited on Aug. 14, 2018 at the Agricultural Research Service Culture Collection (NRRL), International Depository Authority, 1815 North University Street, Peoria, Ill. 61604, and were given accession numbers B-67664, B-67665, and B-67666, respectively. The deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The NRRL strain designations are MDGV17, MDGV18, and MDG1607, which are equivalent to Bacillus strain V17, V18, and 1607, respectively, as referred to in the application. Bacillus strain V17 is a Bacillus pumilus strain and Bacillus strain 1607 is a Bacillus amyloliquefaciens strain, strains 102 and 177 are Bacillus pumilus strains, strain 77 is a Bacillus licheniformis strain, and all other strains described in the application are Bacillus subtilus strains.
[0144] In one illustrative aspect, any of these strains can be used to treat plants to inhibit fungal or bacterial infections or diseases alone or in combination in the form of a liquid or dry spray to be applied to the plant or to the soil from which the plant obtains nutrients, or in the form of a liquid or dry composition for manual application to the plant or to the soil from which the plant obtains nutrients. In one embodiment, multiple strains are used to treat the plants in combination in a single composition. In another embodiment, multiple strains are used to treat the plant in combination in separate compositions.
[0145] As used herein a strain having all of the identifying characteristics of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607 can be a mutant strain having all of the identifying characteristics of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607 (e.g., a DNA fingerprint based on DNA analysis that corresponds to the DNA fingerprint of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, enzyme activities that correspond to Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, antimicrobial activity that corresponds to Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, antibiotic sensitivity and tolerance profiles that correspond to Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, or combinations thereof). In alternate embodiments, the mutation can be a natural mutation, or a genetically engineered mutation. In another embodiment, a strain having all of the identifying characteristics of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607 can be a strain, for example, produced by isolating one or more plasmids from Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607 and introducing the one or more plasmids into another bacterium, such as another Bacillus strain, as long as the one or more plasmids contain DNA that provides the identifying characteristics of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607 (e.g., a DNA fingerprint based on DNA analysis that corresponds to the DNA fingerprint of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607).
[0146] In another embodiment, one or more of the Bacillus strains described in the preceding paragraphs (e.g., Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607) can be used to treat plants along with another bacterial strain selected from the group consisting of a different Bacillus strain, a lactic acid bacterial strain, and combinations thereof. In still another embodiment, the additional Bacillus strain can be selected from the group consisting of Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus pumilus, other Bacillus strains, and combinations thereof. In yet another embodiment, one or more of the Bacillus strains described in the preceding paragraphs (e.g., Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607) can be used to treat plants along with any other bacterial strain effective to treat plants to inhibit a fungal or bacterial infection or a fungal or bacterial disease.
[0147] As used herein the terms inhibit, inhibiting, and inhibited mean to reduce or eliminate the symptoms of a fungal or bacterial disease or a fungal or bacterial infection for the plant or a human, or to reduce or eliminate the number, or an activity, of a fungus or bacterium of a type that causes a fungal or bacterial disease or a fungal or bacterial infection, and which is found in association with the plant or human. Exemplary fungal diseases that can be inhibited using the methods, commercial packages, and compositions described herein are basal stem rot disease, bud rot, wilt, soft rot, Cladosporium rot, and aspergillosis. An exemplary bacterial disease is bacterial wilt caused by Ralstonia solanacearum. The Bacillus strains described herein can also prevent off-odors on fruit, and wine spoilage resulting in loss of wine quality and financial loss.
[0148] The compositions described herein can be used to treat plants for any period of time that is effective to inhibit a fungal or bacterial disease or a fungal or bacterial infection and/or to control the detrimental effects of a fungal or bacterial disease or a fungal or bacterial infection. For example, in one embodiment treatment of the plants can occur daily, bi-weekly, three times a week, four times a week, five times a week, once weekly, monthly, or for any suitable time or using any suitable protocol for inhibiting a fungal or bacterial disease or a fungal or bacterial infection. The time periods for treatment of the plants are non-limiting and it should be appreciated that any time period or treatment schedule determined to be effective to inhibit a fungal or bacterial disease or a fungal or bacterial infection and/or control the detrimental effects of a fungal or bacterial disease or a fungal or bacterial infection may be used.
[0149] In various illustrative embodiments, the Bacillus strain (e.g., Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607), or any other bacterial strains added in addition to Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, can be used to treat plants at about 1.010.sup.2 CFU, about 1.010.sup.2 CFU to about 1.010.sup.3 CFU, about 1.010.sup.2 CFU to about 1.010.sup.4 CFU, about 1.010.sup.2 CFU to about 1.010.sup.5 CFU, about 1.010.sup.2 CFU to about 1.010.sup.6 CFU, about 1.010.sup.2 CFU to about 1.010.sup.7 CFU. about 1.010.sup.2 CFU to about 1.010.sup.8 CFU, about 1.010.sup.2 CFU to about 1.010.sup.9 CFU, about 1.010.sup.2 CFU to about 1.010.sup.10 CFU, about 1.010.sup.3 CFU to about 5.010.sup.12 CFU or at about 1.010.sup.3 CFU to about 1.010.sup.10 CFU. In other embodiments, the Bacillus strain (e.g., Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607) can be used to treat the plants at an amount greater than or about 1.010.sup.2 CFU, at greater than or about 1.010.sup.3 CFU, at greater than or about 1.110.sup.3 CFU, at greater than or about 1.2510.sup.3 CFU, at greater than or about 1.510.sup.3 CFU, at greater than or about 1.7510.sup.3 CFU, at greater than or about 1.010.sup.4 CFU, at greater than or about 2.010.sup.4 CFU, at greater than or about 3.010.sup.4 CFU, at greater than or about 4.010.sup.4 CFU, at greater than or about 5.010.sup.4 CFU, at greater than or about 6.010.sup.4 CFU, at greater than or about 7.010.sup.4 CFU, at greater than or about 8.010.sup.4 CFU, at greater than or about 1.010.sup.5 CFU, at greater than or about 1.010.sup.6 CFU, at greater than or about 1.010.sup.7 CFU, at greater than or about 1.010.sup.8 CFU, at greater than or about 1.010.sup.9 CFU, at greater than or about 1.010.sup.10 CFU, at greater than or about 1.010.sup.11 CFU, or at greater than or about 1.010.sup.12 CFU. In all of the embodiments using CFU, the CFU can be CFU/gram or CFU/ml of the liquid or powdered formulation applied to the plants.
[0150] In various illustrative aspects, the fungi that can be inhibited include a fungus of a genus selected from the group consisting of Ganoderma, Phytophthora, Fusarium, Cladosporium, Pichia, and Aspergillus, and combinations thereof, or a fungus selected from the group consisting of Ganoderma boninense, Ganoderma mirabile, Ganoderma weberianum, Phytophthora palmivora, Fusarium kyushuense, Fusarium oxysporum, Fusarium nelsonii, Cladosporium cladosporioides, Pichia manshurica, Pichia kudriavzevii, Aspergillus fumigatus, and combinations thereof. In some embodiments described herein, the Bacillus strains (e.g., Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607) can have antifungal activity. Such antifungal activity can be against, for example, a fungus of a genus selected from the group consisting of Ganoderma, Phytophthora, Fusarium, Cladosporium, Pichia, and Aspergillus, and combinations thereof, or a fungus selected from the group consisting of Ganoderma boninense, Ganoderma mirabile, Ganoderma weberianum, Phytophthora palmivora, Fusarium kyushuense, Fusarium oxysporum, Fusarium nelsonii, Cladosporium cladosporioides, Pichia manshurica, Pichia kudriavzevii, Aspergillus fumigatus, and combinations thereof. As used herein, Pichia are yeast, but can be considered a type of fungus. Other types of yeast (i.e., considered fungi) that may be inhibited by the Bacillus species described herein are Saccharomyces species, Kluyveromyces species, Torulaspora species, Schizosaccharomyces species, Hansenula species, Torulopsis species, Candida species, and Karwinskia species. In yet another embodiment, any fungal disease of a plant can be inhibited by the Bacillus strains 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, and a strain having all of the identifying characteristics of the Bacillus strains, or combinations thereof, described herein. In still another embodiment, any bacterial disease of a plant can be inhibited by the Bacillus strains 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, and a strain having all of the identifying characteristics of the Bacillus strains, or combinations thereof, described herein, such as bacterial wilt caused by Ralstonia solanacearum.
[0151] In one embodiment, a commercial package is provided comprising an isolated Bacillus strain selected from the group consisting of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, a strain having all of the identifying characteristics of any of these Bacillus strains, and combinations thereof.
[0152] In another embodiment, a composition is provided comprising an isolated Bacillus strain selected from the group consisting of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, a strain having all of the identifying characteristics of any of these Bacillus strains, and combinations thereof.
[0153] In yet another embodiment, a commercial package or a composition is provided comprising an isolated Bacillus strain used to inhibit a fungal or bacterial disease in a plant wherein the isolated Bacillus strain is selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0154] In these embodiments the Bacillus strain can be in the form of, for example, a liquid or a dry composition, such as a suspension or a lyophilized composition or a powder, a freeze-dried composition, a gel, or a pellet, for example. In one illustrative embodiment, the Bacillus strain can be in the form of a powder or a liquid, and can be formulated to be sprayed on or manually applied to the plant or to the soil from which the plant obtains nutrients. In other embodiments, the Bacillus strain can be mixed with fertilizer, mixed with soil, or used as a seed coating for contacting the plant or a plant part. Any suitable method known in the art for contacting the plant or the soil with the Bacillus strain can be used to achieve any of the effective amounts of Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, or a strain having all of the identifying characteristics of any of these Bacillus strains, or combinations thereof, described herein. In one aspect, the Bacillus strain can comprise live Bacillus cells or spores. In another illustrative embodiment, the plant can be contacted with the Bacillus strain by contacting the Bacillus strain with a part of the plant selected from the group consisting of a leaf, a seed, a root, a flower, a shoot, a bud, and combinations thereof.
[0155] In illustrative aspects, Bacillus strain 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607, or a strain having all of the identifying characteristics of any of these Bacillus strains, and combinations thereof, can be in the form of a commercial package, or any other suitable composition. In another illustrative embodiment, the Bacillus strain(s) in the commercial package, or other composition can be in the form of a concentrate (e.g., about 110.sup.8 to about 510.sup.9 CFU/g) or a superconcentrate (e.g., about 110.sup.10 to about 510.sup.12 CFU/g). In another embodiment, the Bacillus strain(s) in the commercial package or other composition can be in a dry form (e.g., a powder), a liquid form, a freeze-dried form, or in the form of a gel, or any other suitable form for application to plants or the soil from which the plant obtains nutrients.
[0156] In another illustrative embodiment, the Bacillus strain(s) in the commercial package or composition can further comprise a carrier for the Bacillus strain(s). In various embodiments, the carrier can be selected from the group consisting of bran, rice hulls, a salt, mineral oil, a dextrin (e.g., maltodextrin), whey, sugar, limestone, dried starch, sodium silico aluminate, vegetable oil, and combinations thereof. In another embodiment, the carrier can be any suitable carrier known in the art for a composition for application to plants to treat plants having a fungal or bacterial disease or infection. In another embodiment, the Bacillus strain(s) in the commercial package or composition can further comprise a binder such as clay, yeast cell wall components, aluminum silicate, glucan, or other known binders, and/or micronutrients, including but not limited to, nitrogen and phosphorus. Any of these components can be exogenously added (i.e., not naturally present in combination with the Bacillus strains) and any of the compositions described herein can be present in nutrient compositions for plants.
[0157] In yet other embodiments, the commercial package or composition comprising an isolated Bacillus strain can be for inhibiting a fungal or a bacterial disease, and the Bacillus strain can be selected from the group consisting of Bacillus strain 86 (NRRL No. B-50944), a strain having all of the identifying characteristics of Bacillus strain 86 (NRRL No. B-50944), Bacillus strain 300 (NRRL No. B-50943), a strain having all of the identifying characteristics of Bacillus strain 300 (NRRL No. B-50943), Bacillus strain 101 (NRRL No. B-67218), a strain having all of the identifying characteristics of Bacillus strain 101 (NRRL No. B-67218), Bacillus strain 235 (NRRL No. B-67219), a strain having all of the identifying characteristics of Bacillus strain 235 (NRRL No. B-67219), Bacillus strain 77 (NRRL No. B-67274), a strain having all of the identifying characteristics of Bacillus strain 77 (NRRL No. B-67274), Bacillus strain 177 (NRRL No. B-67275), a strain having all of the identifying characteristics of Bacillus strain 177 (NRRL No. B-67275), Bacillus strain 102 (NRRL No. B-67276), a strain having all of the identifying characteristics of Bacillus strain 102 (NRRL No. B-67276), Bacillus strain ATC2 (NRRL No. B-67134), a strain having all of the identifying characteristics of Bacillus strain ATC2 (NRRL No. B-67134), Bacillus strain A12 (NRRL No. B-67516), a strain having all of the identifying characteristics of Bacillus strain A12 (NRRL No. B-67516), Bacillus strain V17 (NRRL No. B-67664), a strain having all of the identifying characteristics of Bacillus strain V17 (NRRL No. B-67664), Bacillus strain V18 (NRRL No. B-67665), a strain having all of the identifying characteristics of Bacillus strain V18 (NRRL No. B-67665), Bacillus strain 1607 (NRRL No. B-67666), a strain having all of the identifying characteristics of Bacillus strain 1607 (NRRL No. B-67666), and combinations thereof.
[0158] In another embodiment, the commercial package or composition can be in a container for commercial use. In various embodiments the container can be, for example, a bag (e.g., a 20-pound bag, a 50-pound bag, a 2-ounce bag, a 1-pound bag, or a 1-kilogram bag), a pouch, a drum, a bottle, or a box. In illustrative aspects, the container comprising the Bacillus strain(s) can comprise plastic, metal, foil, paper, fiber, or cardboard (e.g., a plastic pail, a paper bag, a foil bag, a fiber drum, etc.). The commercial package can further comprise instructions for use of one or more of the Bacillus strains.
[0159] The following examples are for illustrative purposes only. The examples are non-limiting, and are not intended to limit the invention in any way.
EXAMPLE 1
Culture Conditions
[0160] All fungal cultures were obtained from ATCC and include Ganoderma boninense ATCC 204074, Ganoderma weberianum ATCC 76753, Ganoderma mirabile ATCC 76757, 76537, Phytophthora palmivora ATCC 26008, Phytophthora palmivora ATCC 52161, Fusarium oxysporum ATCC 36870, Fusarium kyushuense ATCC 56750, and Fusarium nelsonii 201410. Ganoderma species were cultured on yeast mold agar, Phytophthora species were cultured on tomato juice agar, and Fusarium species were cultured on potato dextrose agar. Bacillus strains 86, 300, 101, 235, 77, 177, 102, A12, ATC2, V17, V18, or 1607 were cultured on tryptic soy agar.
EXAMPLE 2
Antifungal Plate Assay
[0161] Plates were inoculated with an agar plug of fungal growth placed in the center of the plate. Bacillus culture was struck on the plate in two parallel lines on either side of the agar plug at a distance of 3 cm. The plates were incubated at 30 C. until the fungal culture exceeded 6 cm in diameter. Data was recorded at 6 days for all strains except F. kyushuense, which was recorded at 12 days. Fungal growth was measured, and inhibition scores were assigned for each Bacillus strain. Scores of , +, ++, or +++ were defined as no inhibition, inhibition of 1 cm fungal growth, inhibition of 2 cm, and inhibition of 3 cm, respectively.
[0162] Several Bacillus strains had strong antifungal activity against all six fungal strains (see Table 1 below). The top six strains had at least moderate activity against all fungal strains, and were further evaluated for antifungal activity in a broth assay.
TABLE-US-00001 TABLE 1 Inhibition of fungal growth by Bacillus strains in an antifungal plate assay. Inhibition of more than 3 cm of fungal growth is indicated by +++, 2 to 3 cm inhibition indicated by ++, 1 to 2 cm inhibition indicated by +, and no inhibition is indicated by . Gano- Gano- Gano- Phyto- Phyto- derma derma derma phthora phthora Fusarium Fusarium Fusarium boninense mirabile weberianum palmivora 1 palmivora 2 kyushuense oxysporum nelsonii 77 +++ + +++ ++ +++ ++ ++ ++ 1607 ++ + +++ +++ +++ ++ ++ ++ ATC2 +++ + +++ ++ +++ ++ ++ ++ 300 +++ ++ +++ ++ +++ ++ ++ ++ 101 +++ + +++ ++ +++ ++ ++ ++ 235 +++ ++ +++ ++ +++ ++ ++ + 86 ++ + + ++ +++ + ++ + V18 ++ + ++ +++ + ++ + A12 ++ + + ++ +++ + + + V17 ++ + ++ + +++ + + 102 + +++ 177 + ++
EXAMPLE 3
Antifungal Broth Assay
[0163] The top performing Bacillus strains in the plate assay were evaluated using a broth method. An agar plug of fungal growth was used to inoculate 20 ml of broth media containing 10% cell-free Bacillus supernatant. Supernatants were prepared by growing Bacillus in tryptic soy broth for 24 hours, centrifuging the culture for 20 minutes at 4000 rpm, and filter-sterilizing the supernatant with a 0.22 m filter. Fungal cultures were grown at 30 C. for two weeks. Fungal growth was filtered and allowed to dry completely. Total dry fungal weight was recorded, and inhibition was reported as a percentage of the reduction in growth weight compared to controls. G. mirabile and P. palmivora strains were excluded from the broth assay as they did not grow well in broth media.
[0164] F. nelsonii and F. kyushuense were not inhibited at all by any Bacillus species (data not shown). However, all six Bacillus strains inhibited G. boninense by over 40%, the pathogen responsible for causing basal stem rot in oil palm plants (see
Example 4
Isolation And Identification of Additional Pathogenic or Spoilage Fungi
[0165] Additional fungal isolates were obtained from molding or rotting vegetation including spoiled corn and hay silage, and were isolated by dilution plating on acidified potato dextrose agar incubated at room temperature (19-21 C.), protected from light, for 2-5 days until distinct isolate growth was observed. DNA was extracted from fungal isolates using the Nucleospin Microbial DNA extraction kit (Machery-Nagel, Duren, Germany), employing a bead-beating step for cell lysis. The fungal ribosomal intergenic spacer (ITS) region was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White, et al., Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, pp. 315-322, In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, et al., Academic Press, Inc., New York (1990), incorporated herein by reference for the amplification method described in this example), following recommended amplification parameters. Product size was determined by gel electrophoresis, the PCR product was cleaned up with the Qiagen MinElute PCR purification kit (Hilden, Germany), and DNA sequencing of each purified PCR product was performed by Eurofins Genomics (Louisville, Ky.). Sequences were trimmed for quality, in Chromas 2.6 (Technelysium, South Brisbane, Australia) and identified to the closest species match using a nucleotide BLAST search (National Center for Biotechnology Information, Bethesda, Md.).
EXAMPLE 5
Antifungal Cross-Streak Assay Using Plant and Spoilage Fungi
[0166] Strain-specific antifungal activities of Bacillus strains were tested using agar cross-streak antimicrobial susceptibility methods known in the art and described below. Briefly, Bacillus strains 77, 86, 300, 101, 235, and V18 were inoculated from frozen glycerol stocks in a single 1 cm wide vertical streak down the center of a non-acidified potato dextrose agar plate. Plates were incubated aerobically for 24 hours at 37 C., or until a confluent streak of Bacillus growth was present. Isolates of Cladosporium, Pichia and A. fumigatus were struck horizontally from the center of the plate, beginning the streak within 1 mm of the Bacillus growth and streaking out to the plate perimeter. Plates were incubated at 25 C. under aerobic conditions for 3 days for Pichia yeasts and 5 days for the remaining fungal isolates. Zones of inhibition were measured where fungal isolate growth was inhibited by the Bacillus strain. Table 2 shows antimicrobial screening utilizing the agar cross streak method against isolates of Cladosporium cladosporioides, Pichia manshurica, Pichia kudriavzevii and Aspergillus fumigatus. Scores of , +, ++, or +++ were defined as no inhibition, inhibition of 2-5 mm fungal growth, inhibition of 5-10 mm, and inhibition of >10 mm, respectively.
[0167] Several Bacillus strains had broad antifungal activity against all fungal strains tested (see Table 2 below). The top performing Bacillus strain was further evaluated for antifungal activity in a broth assay.
TABLE-US-00002 TABLE 2 Inhibition of fungal growth by Bacillus strains in an antifungal cross-streak assay. Inhibition of more than 10 mm of fungal growth is indicated by +++, 5 to 10 mm inhibition indicated by +, 2 to 5 mm inhibition indicated by +, and less than 2 mm inhibition is indicated by . Fungal isolate Pichia Pichia Pichia Pichia Pichia Pichia Clado- Asper- kudria- kudria- mans- mans- mans- mans- sporium gillus vzevii vzevii churica churica churica churica clado- fumi- Isolate 1 Isolate 2 Isolate I Isolate 2 Isolate 3 Isolate 4 sporioides gatus Bacillus 77 ++ ++ ++ ++ ++ ++ +++ + strain 86 NA NA 101 + + + + + ++ ++ 235 ++ ++ +++ ++ ++ ++ +++ + 300 ++ ++ ++ ++ ++ ++ +++ ++ V18 +++
EXAMPLE 6
Aspergillus Fumigatus Antifungal Broth Assay
[0168] The top performing Bacillus strain in the plate assay (Bacillus strain 300) was evaluated using a broth method to determine efficacy of inhibition of A. fumigatus in a liquid matrix. The supernatant was prepared by growing Bacillus strain 300 in tryptic soy broth for 24 hours at 32 C., centrifuging the culture for 20 minutes at 4000 rpm, and filter-sterilizing the supernatant with a 0.22 m filter. Aspergillus fumigatus was propagated in potato dextrose broth to produce a suspension of approximately 10.sup.5 spores/ml. A 0.1 ml amount of this inoculum was used to inoculate 5 ml of potato dextrose broth mixed with 1 ml of sterile-filtered supernatant from Bacillus strain 300 or with 1 ml of sterile culture broth (Control). Nine replicates of each treatment were prepared and all replicates were incubated for 24 hr at 37 C. Replicates were pooled into triplicate samples, fungal biomass was sedimented via centrifugation at 4000 rpm for 20 minutes, washed with sterile water to remove media residue, dried on sterile filters and weighed to determine fungal biomass. The photograph shown in
EXAMPLE 7
Inhibition of Ralstonia Solanacearum by Bacillus Strains
[0169] Ralstonia solanacearum is a soilborne pathogen that causes bacterial wilt in a variety of crops. Strains of Ralstonia were isolated from soil and tested for inhibition of the isolated Ralstonia strains by Bacillus species. Soil samples were plated for Ralstonia species on semi-selective media. Modified SMSA medium contained 1 g/L casein, 10 g/L peptone, 5 ml/L glycerol, and 17 g/L agar at pH 7.0 (Elphinstone et al., 1996). After autoclaving, media was supplemented with 5 mg/L crystal violet, 100 mg/L polymyxin B sulfate, 25 mg/L bacitracin, 5 mg/L chloromycetin, 0.5 mg/L penicillin, and 100 mg/L cycloheximide. Presumptive Ralstonia isolates were identified as Ralstonia species by 16S sequencing. Bacillus species were tested for antimicrobial activity against the Ralstonia species using a cross streak method. The zone of inhibition between the Bacillus and Ralstonia streak was measured in mm.
[0170] As shown in Table 1 below, all Bacillus species tested showed some inhibition of all three Ralstonia isolates. Bacillus species have the potential to be used as biocontrol agents against Ralstonia species.
TABLE-US-00003 TABLE 1 Inhibition (mm) of Ralstonia species by Bacillus. The zone of inhibition between the Bacillus and Ralstonia streak was measured in mm. Inhibition of more than 10 mm growth is indicated by +++, 6 to 9 mm inhibition is indicated by ++, 1 to 5 mm inhibition is indicated by +, and no inhibition is indicated by . Bacillus Ralstonia Ralstonia Ralstonia strain species 1 species 2 species 3 300 +++ +++ +++ 235 ++ +++ +++ 1607 ++ +++ +++ AlgT2 ++ +++ +++ (equivalent to ATC2) 77 ++ ++ +++ V18 + ++ ++ 101 ++ ++ ++ V17 ++ ++ +