Transgenic strain containing an isolated promoter

Abstract

The invention discloses a promoter which can be induced to express in acidic conditions, and relates to the field of bioengineering technology. The promoters of the invention are separated from A. niger and can actuate and/or regulate the expression of the effectively connected nucleic acids in A. niger. In the invention the expression of the promoters is studied in A. niger, and it is indicated that some promoters show weak expression, and some show strong activity. The invention provides an effective method and new thought for organic acids production by fungi or other products produced by fermentation under acidic conditions.

Claims

1. A transgenic strain comprising an expression cassette comprising an isolated promoter having the nucleotide sequence set forth in SEQ ID NO: 1, a nucleotide sequence operably linked to the isolated promoter, and a 3 transcription terminator, wherein the nucleotide sequence encodes a protein of interest.

2. The transgenic strain of claim 1, wherein the transgenic strain is obtained by transforming the expression cassette containing the isolated promoter, the nucleotide sequence and the terminator into a host cell, and the host cell being selected from the group consisting of bacteria, algae, fungi, yeast, plants, insects or animal cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows GFP expression under the Pgas and PgpdA promoters in A. niger hyphae at different pH.

(2) FIG. 2 shows GFP fluorescence intensity of transformants at different pH, wherein gpdA, pth, aat, patI and gas represent transformants with GFP gene expression controlled by PgpdA, Ppth, Paat, PpatI and Pgas respectively.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

(3) The invention will be further illustrated in more detail with reference to accompanying drawings. It is noted that, the following embodiments only are intended for purposes of illustration and are not intended to limit the scope of the invention.

Embodiment 1

(4) Genome Extraction from A. niger

(5) Conidia of A. niger (110.sup.6) were inoculated in 100 mL malt extract liquid medium (3% malt extract and 0.5% tryptone) at 35 C. and 250 r/min for 48 h. The mycelia were harvested with Miracloth (Calbiochem, San Diego, Calif., USA), washed with sterile water and frozen in liquid nitrogen. Tissues were ground by Liquid nitrogen grinding, and the genome DNA of A. niger was isolated with a DNeasy Plant Mini Kit (QIAGEN, Germantown, Md., USA).

Embodiment 2

(6) Obtaining Promoters Induced in Acidic Conditions (by Low pH)

(7) A. niger gene expression data (Accession, GSE11725) in NCBI GEO Datasets were analyzed to detect changes in mRNA levels from pH 4.5 to pH 2.5 and 4 genes was identified for increased gene expression with decreased pH value. The sequence 1500 bp upstream of the start codon ATG was analyzed using Neural Network Promoter Prediction software (version 2.2) (http://www.fruitfly.org/seq_tools/promoter.html) and all can be identified with a transcription start site, and the predicted promoters were named as Pgas, PpatI, Ppth, and Paat.

(8) Pgas was amplified from the A. niger genome using the primers gas-F (SEQ ID NO.2) and gas-R (SEQ ID NO.3) with restriction sites Eco RI and Sma I at the 5 and 3 ends, respectively. PpatI was amplified from the A. niger genome using the primers pat-F (SEQ ID NO.4) and pat-R (SEQ ID NO.5) with restriction sites Sac I and Bam HI at the 5 and 3 ends, respectively. Ppth was amplified from the A. niger genome using the primers pth-F (SEQ ID NO.6) and pth-R (SEQ ID NO.7) with restriction sites Sac I and Bam HI at the 5 and 3 ends, respectively. Paat was amplified from the A. niger genome using the primers aat-F (SEQ ID NO.8) and aat-R (SEQ ID NO.9) with restriction sites Eco RI and Bam HI at the 5 and 3 ends, respectively.

(9) Primer sequences were as follows:

(10) TABLE-US-00001 gas-F(SEQIDNO.2): GAATTCCTGCTCTCTCTCTGCTCTCTTTCT gas-R(SEQIDNO.3): CCCGGGGTGAGGAGGTGAACGAAAGAAGAC pat-F(SEQIDNO.4): GAGCTCTTAGGAAACCTACCATCCATCGTA pat-R(SEQIDNO.5): GGATCCTGTGCTGCTTGACTGGACGTTCA pth-F(SEQIDNO.6): GAGCTCTATGTGTCACGAGTTAGAAAGGA pth-R(SEQIDNO.7): GGATCCGTGGCCTACATGCTCTGAAACA aat-F(SEQIDNO.8): GAATTCCGCTATCTCCATCTGATAGCCATA aat-R(SEQIDNO.9): GGATCCGATTGCTTGTCGATTATACAGCGT

Embodiment 3

(11) Construction of Expression Cassette of Promoters Induced in Acidic Conditions

(12) GFP (SEQ ID NO.10) was synthesized with coden optimization and contained Bam HI and Pst I restriction sites at the 5 and 3 ends, respectively. Trp terminator (Ttrp) was PCR amplified with primers Ttrp-F (SEQ ID NO.11) and Ttrp-R (SEQ ID NO.12) using pAN7-1 as a template, and restriction sites Pst I and Hin dIII was added to the 5 and 3 ends, respectively. Ttrp was digested with Hin dIII and Pst I, GFP was digested with Bam HI and Pst I, and the two sequence were ligated to pUC18 digested with the same enzyme, and pGT was obtained. GFP-Ttrp was amplified with the primers GFP-F1 (SEQ ID NO.13) and Ttrp-R using pGT as a template and reversely connected to pMD19-T vector (Takara, Tokyo, Japan) to generate pMD-GFP-Ttrp. Pgas and pMD-GFP-Ttrp were digested with Eco RI and Sma I and connected to generate the Pgas-GFP-Ttrp expression vector. For co-transformation, the Pgas-GFP-Ttrp expression cassette was obtained by PCR with the primers gas-F and Ttrp-R. With the similar method, the PpatI-GFP-Ttrp, Paat-GFP-Ttrp, Ppth-GFP-Ttrp expression cassettes containing the PpatI, Ppth, Paat promoters respectively were obtained.

(13) For co-transformation, the hygromycin resistant cassette, PgpdA-hph-Ttrp, was obtained by PCR with the primers PgpdA-F (SEQ ID NO.14) and Ttrp-R-2 (SEQ ID NO.15) using pAN7-1 as a template.

(14) Primers:

(15) TABLE-US-00002 Ttrp-F(SEQIDNO.11): CTGCAGAGATCCACTTAAACGTTACTGAAATC Ttrp-R(SEQIDNO.12): AAGCTTTCGAGTGGAGATGTGGAGTGG GFP-F1(SEQIDNO.13): GATCCATGGTGAGCAAGG PgpdA-F(SEQIDNO.14): CAATTCCCTTGTATCTCTACACACAG Ttrp-R-2(SEQIDNO.15): TCGAGTGGAGATGTGGAGTGG

Embodiment 4

(16) Preparation and Transformation of Protoplast of A. niger

(17) Conidia (310.sup.5/mL) were inoculated in ME medium over night at 200 r/min under 30 C. The mycelium was harvested via filtration through Miracloth and washed with sterile water. Protoplastation was achieved in the presence of lysing enzymes in KMC (0.7M KCl, 50 mM CaCl.sub.2, 20 mM Mes/NaOH, pH 5.8) for 3 h at 1000 rpm under 37 C. The protoplasts were filtered through Miracloth and collected via centrifugation at 1,000 rpm under 4 C. for 10 min and subsequently washed twice with the same volume STC (1.2 M sorbitol, 10 mM Tris/HCl, 50 mM CaCl.sub.2, pH 7.5), and finally resuspended in 100 L STC and directly used for transformation. Ten micrograms of expression cassette (obtained in Example 3) was mixed with 100 L STC solution containing at least 10.sup.7 protoplasts and 330 L polyethylene glycol (PEG) solution (25% PEG 6000, 50 mM CaCl.sub.2, 10 mM Tris/HCl, pH 7.5) and kept on ice for 20 min. After mixing with an additional 2 mL PEG solution and incubating at room temperature for 10 min, the protoplast mixture was diluted with 4 mL STC. The aliquots were mixed with 4 mL liquid top agar warmed to 48 C., spread on bottom agar containing 150 g/mL hygromycin, and incubated at 35 C. for 4-7 days until clones appeared. All transformants were purified three times via single-colony isolation on the selection medium. The correct integration was verified with PCR analysis by using specific genomic primers.

Embodiment 5

(18) Conidia (310.sup.5/mL) of A. niger transformants were inoculated in LBL medium with different pH (pH at 2.0, 3.0, 4.0 and 5.0) and cultured at 35 C. at 120 r/min for 24 h. The samples were checked under a microscope using blue light to detect the fluorescent of GFP. Wild-type H915-1 did not show fluorescence at both pH 2.0 and pH 5.0. The PgpdA transformant showed extremely strong fluorescence intensity at pH 5.0, and strong fluorescence at pH 2.0. The Pgas transformant showed minimal GFP expression at pH 5.0, but enhanced fluorescence intensity at pH 2.0 (as shown in FIG. 1.), this indicated that the promoter acts as an acid-enhanced cis-acting element

(19) Relative GFP Fluorescence Strength

(20) The A. niger transformants were cultured at 35 C. for additional 48 h. The pellets were harvested and washed twice with WS buffer (100 mM Tris, pH 7.0) and dried with filter paper immediately. The pellets were transferred to the MP Lysing Matrix C (MP Biomedicals, Heidelberg, Germany) and the mycelia were disrupted for 330 s at 5 m/sec using a FastPrep-24 (MP Biomedicals, New York, N.Y., USA). After centrifugation at 12,000 rpm and 4 C. for 10 min, the supernatant was obtained as a protein sample. The total protein concentration was determined using the BCA Protein Assay Kit. The protein concentration of each sample was diluted to 50 g/mL and the exact protein concentration (A) was determined. The Cytation 3 Cell Imaging Multi-Mode Reader was used to detect fluorescence with an excitation wavelength of 485 nm and emission wavelength of 535 nm, and the fluorescence intensity was labeled B. The standardized fluorescent intensity was estimated as B divided by A.

(21) As shown in FIG. 2, the fluorescence intensity of PgpdA was strong at different pH, and was set as 100% at pH 5.0. The fluorescence of PgpdA decreased from pH 5.0 to pH 2.0. Nevertheless, Pgas showed little fluorescence at pH 3.0, 4.0, and 5.0, but enhanced fluorescence at pH 2.0, which was stronger than that of PgpdA at pH 2.0, but weaker than that of PgpdA at pH 5.0. The PpatI, Ppth and Paat transformants did not show significant inducement at low pH.

(22) The above preferred embodiments are described for illustration only, and are not intended to limit the scope of the invention. It should be understood, for a person skilled in the art, that various improvements or variations can be made therein without departing from the spirit and scope of the invention, and these improvements or variations should be covered within the protecting scope of the invention.