Seed endophytes across cultivars and species, associated compositions, and methods of use thereof
10667523 ยท 2020-06-02
Assignee
Inventors
- Karen V. Ambrose (Cambridge, MA)
- Nathan A. BILLINGS (Topsfield, MA, US)
- Slavica Djonovic (Malden, MA)
- Richard Bailey Flavell (Thousand Oaks, CA)
- Trudi A. Gulick (Topsfield, MA)
- David Morris Johnston (Cambridge, MA)
- Jonathan W. Leff (Cambridge, MA)
- Stephanie M. LIVA (Arlington, MA, US)
- Jeffrey Lyford (Hollis, NH)
- Geoffrey von Maltzahn (Boston, MA)
- Luis Miguel Marquez (Belmont, MA)
- Yves Alain Millet (Newtonville, MA)
- Craig Sadowski (Somerville, MA)
- Phillip Samayoa (Cambridge, MA)
- Gerardo V. Toledo (Belmont, MA)
- David R. WEISMAN (Somerville, MA, US)
- Xuecheng Zhang (Newton, MA)
Cpc classification
A01N63/30
HUMAN NECESSITIES
C05F11/08
CHEMISTRY; METALLURGY
Y02W30/40
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A01N63/20
HUMAN NECESSITIES
A01N63/30
HUMAN NECESSITIES
International classification
C05F11/08
CHEMISTRY; METALLURGY
A01N63/00
HUMAN NECESSITIES
Abstract
Materials and methods for improving plant traits and for providing plant fitness benefits are provided. In some embodiments, the materials, and methods employing the same, can comprise endophytes.
Claims
1. A synthetic combination comprising a purified microbial population in association with a plurality of seeds or seedlings of an agricultural plant, wherein the purified microbial population comprises a first endophyte, wherein the first endophyte comprises a 16S rRNA or ITS rRNA nucleic acid sequence at least 97% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs:1-395 and 397-455, and wherein the first endophyte is heterologously disposed to the seeds or seedlings in an amount effective to provide a benefit to the seeds or seedlings or the plants derived from the seeds or seedlings.
2. The synthetic combination of claim 1, wherein the synthetic combination is present within a packaging material selected from a bag, box, bin, envelope, carton, and container.
3. The synthetic combination of claim 1, wherein the purified microbial population further comprises a second endophyte, wherein the second endophyte comprises a 16S rRNA or ITS rRNA nucleic acid sequence that is less than 95% identical to that of the first endophyte.
4. The synthetic combination of claim 1, wherein the purified microbial population further comprises a second endophyte, and wherein the first and second endophytes are independently capable of at least one of production of an auxin, nitrogen fixation, production of an antimicrobial, production of a siderophore, mineral phosphate solubilization, production of a cellulase, production of a chitinase, production of a xylanase, or production of acetoin, or a combination of two or more thereof.
5. The synthetic combination of claim 1, wherein the purified microbial population further comprises a second endophyte, wherein the first and second endophytes are independently capable of metabolizing at least one substrate selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose, or a combination of two or more thereof.
6. The synthetic combination of claim 1, wherein the benefit is selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome, relative to reference seeds or agricultural plants derived from reference seeds.
7. The synthetic combination of claim 1, wherein the combination comprises seedlings and the first endophyte is contacted with the seedlings as a spray applied to one or more leaves and/or one or more roots of the seedlings.
8. The synthetic combination of claim 1, wherein the first endophyte is present in an amount of at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, or at least 1,000,000 CFU spores per seed.
9. The synthetic combination of claim 1, further comprising one or more of the following selected from the group consisting of: a stabilizer, a preservative, a carrier, a surfactant, an anticomplex agent, a fungicide, a nematicide, a bactericide, a insecticide, a herbicide, and any combination thereof.
10. The synthetic combination of claim 1, wherein the first endophyte is present in the synthetic combination in an amount effective to provide a benefit to the seeds or seedlings or the plants obtained from the seeds or seedlings under water limited conditions.
11. The synthetic combination of claim 1, wherein the combination comprises seeds and wherein the benefit is a detectable increase in germination rate of the seeds.
12. The synthetic combination of claim 1, wherein the combination comprises seedlings and the first endophyte expresses one or more genes encoding a protein whose amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479, 483, 519, 532, 549, 557, 561, 562, 577, 578, 611, 626, 640, 656, 660, 666, 674, 676, 677, 678, 679, 680, 682, 683, 684, 685, 686, 688, 689, 690, 691, 692, 693, 696, 697, 698, 701, 704, 706, 710, 711, 716, 717, 718, 719, 720, 721, 722, 723, 724, 727, 728, 729, 730, 731, 732, 733, 734, 735, 737, 738, 741, 743, 744, 745, 746, 747, 748, 749, 751, 753, 756, 757, 759, 761, 762, 763, 764, 765, 766, 767, 768, 769, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 782, 783, 784, 785, 786, 788, 790, 793, 795, 796, 797, 798, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 815, 816, 817, 818, 819, 820, 822, 823, 824, 825, 826, 829, 830, 833, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 846, 848, 850, 851, 853, 854, 855, 856, 857, 858, 859, 860, 864, 865, 866, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 884, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 897, 898, 899, 901, 902, 903, 904, 905, 906, 907, 908, 910, 911, 912, 913, 914, 915, 916, 917, 918, 920, 921, 922, 923, 924, 926, 927, 928, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 968, 969, 971, 974, 976, 978, 979, 980, 984, 985, 987, 988, 989, 992, 993, 994, 995, 996, 998, 1000, 1001, 1002, 1003, 1006, 1008, 1010, 1011, 1012, 1014, 1015, 1016, 1017, 1018, 1019, 1021, 1022, 1023, 1024, 1025, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1036, 1037, 1038, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1055, 1056, 1058, 1059, 1060, 1062, 1064, 1065, 1066, 1068, 1070, 1071, 1072, 1076, 1077, 1079, 1080, 1081, 1083, 1085, 1086, 1087, 1088, 1090, 1091, 1092, 1094, 1095, 1096, 1097, 1098, 1099, 1101, 1102, 1103, 1104, 1106, 1107, 1108, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1121, 1122, 1123, 1124, 1126, 1127, 1129, 1130, 1131, 1132, 1133, 1134, 1136, 1137, 1138, 1139, 1140, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1151, 1153, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1174, 1176, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1196, 1197, 1198, 1199, 1200, 1201, 1203, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1213, 1214, 1216, 1217, 1218, 1219, 1221, 1222, 1223, 1225, 1226, 1228, 1229, 1230, 1231, 1232, 1233, 1235, 1237, 1238, 1239, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1290, 1292, 1293, 1296, 1297, 1298, 1300, 1301, 1303, 1304, 1306, 1307, 1308, 1309, 1311, 1312, 1313, 1314, 1317, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1330, 1331, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1350, 1351, 1352, 1353, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1368, 1369, 1370, 1371, 1372, 1374, 1375, 1376, 1379, 1380, 1382, 1383, 1384, 1385, 1386, 1388, 1389, 1390, 1391, 1392, 1393, 1396, 1397, 1398, 1399, 1400, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1424, 1425, 1426, 1427, 1428, 1430, 1431, 1432, 1433, 1437, 1438, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1452, 1453, 1456, 1459, 1466, 1467, 1469, 1471, 1478, 1479, 1482, 1483, 1484, 1485, 1487, 1488, 1489, 1490, 1495, 1497, 1498, 1499, 1500, 1501, 1504, 1505, 1506, 1508, 1511, 1513, 1514, 1516, 1520, 1526, 1529, 1534, 1535, 1537, 1538, 1540, 1545, 1547, 1548, 1549, 1550, 1551, 1552, 1553, 1554, 1556, 1559, 1561, 1562, 1565, 1566, 1568, 1569, 1570, 1571, 1573, 1574, 1575, 1576, 1577, 1578, 1579, 1580, 1581, 1582, 1583, 1585, 1588, 1589, 1591, 1592, 1593, 1594, 1595, 1596, 1597, 1598, 1601, 1603, 1604, 1605, 1607, 1608, 1609, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1622, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1632, 1633, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1646, 1647, 1648, 1650, 1651, 1652, 1654, 1657, 1659, 1660, 1661, 1664, 1665, 1666, 1667, 1668, 1671, 1673, 1675, 1676, 1678, 1679, 1681, 1684, 1685, 1686, 1689, 1690, 1692, 1693, 1694, 1695, 1696, 1697, 1698, 1701, 1705, 1706, 1707, 1709, 1711, 1712, 1713, 1714, 1716, 1717, 1718, 1720, 1721, 1723, 1724, 1725, 1726, 1728, 1729, 1731, 1732, 1734, 1735, 1736, 1737, 1738, 1739, 1740, 1741, 1743, 1744, 1745, 1746, 1747, 1750, 1751, 1753, 1754, 1755, 1760, 1761, 1762, 1763, 1764, 1765, 1767, 1770, 1771, 1772, 1775, 1776, 1777, 1778, 1779, 1780, 1781, 1782, 1786, 1787, 1788, 1789, 1791, 1792, 1793, 1794, 1795, 1797, 1798, 1799, 1800, 1801, 1803, 1804, 1805, 1806, 1809, 1810, 1811, 1814, 1815, 1818, 1819, 1820, 1821, 1822, 1823, 1824, 1825, 1826, 1828, 1830, 1831, 1833, 1835, 1836, 1837, 1838, 1839, 1840, 1841, 1842, 1843, 1846, 1851, 1852, 1854, 1857, 1858, 1860, 1861, 1862, 1863, 1864, 1866, 1868, 1869, 1870, 1872, 1873, 1874, 1875, 1876, 1878, 1879, 1880, 1881, 1883, 1884, 1885, 1887, 1888, 1892, 1893, 1894, 1896, 1898, 1899, 1900, 1901, 1902, 1903, 1904, 1905, 1906, 1907, 1910, 1911, 1913, 1915, 1916, 1917, 1918, 1920, 1921, 1924, 1925, 1926, 1927, 1928, 1930, 1932, 1933, 1934, 1935, 1938, 1939, 1940, 1942, 1943, 1945, 1946, 1948, 1949, 1950, 1951, 1953, 1954, 1955, 1959, 1960, 1961, 1962, 1963, 1965, 1966, 1967, 1970, 1971, 1973, 1975, 1976, 1977, 1979, 1981, 1982, 1983, 1984, 1985, 1986, 1988, 1990, 1994, 1995, 1996, 1998, 1999, 2000, 2001, 2002, 2003, 2006, 2007, 2008, 2009, 2010, 2011, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2021, 2022, 2024, 2025, 2026, 2027, 2028, 2029, 2030, 2031, 2032, 2034, 2035, 2036, 2037, 2038, 2039, 2040, 2041, 2042, 2043, 2044, 2045, 2046, 2047, 2048, 2049, 2050, 2052, 2054, 2055, 2059, 2060, 2062, 2065, 2066, 2067, 2068, 2069, 2070, 2071, 2074, 2076, 2077, 2080, 2081, 2082, 2083, 2085, 2086, 2087, 2088, 2089, 2090, 2091, 2092, 2093, 2095, 2096, 2097, 2098, 2100, 2101, 2102, 2103, 2104, 2105, 2108, 2109, 2110, 2112, 2113, 2115, 2116, 2117, 2118, 2119, 2120, 2121, 2125, 2127, 2128, 2129, 2131, 2132, 2134, 2135, 2136, 2138, 2140, 2141, 2142, 2143, 2145, 2146, 2147, 2148, 2149, 2150, 2153, 2154, 2155, 2156, 2158, 2159, 2160, 2162, 2163, 2165, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2174, 2176, 2177, 2179, 2180, 2181, 2182, 2183, 2184, 2185, 2186, 2188, 2190, 2191, 2192, 2193, 2194, 2195, 2196, 2197, 2198, 2200, 2202, 2204, 2205, 2206, 2207, 2208, 2210, 2211, 2212, 2214, 2215, 2216, 2217, 2218, 2219, 2220, 2221, 2222, 2223, 2225, 2226, 2227, 2228, 2229, 2230, 2231, 2232, 2233, 2234, 2235, 2236, 2238, 2239, 2241, 2242, 2243, 2244, 2245, 2246, 2248, 2249, 2251, 2253, 2254, 2255, 2257, 2258, 2259, 2261, 2262, 2265, 2267, 2268, 2269, and 2270; wherein protein expression is modulated in response to the first endophyte contacting the seedlings.
13. A method for preparing a seed comprising an endophyte population, said method comprising heterologously disposing to an exterior surface a seed formulation comprising an endophyte population comprising an endophyte comprising a 16S rRNA or ITS rRNA nucleic acid sequence at least 97% identical to a nucleicacid sequence selected from the group consisting of SEQ ID NOs: 1-395 and 397-455 in an amount effective to provide a benefit to the seed or plant derived from the seed.
14. The method of claim 13, wherein the endophyte is capable of a function or activity selected from the group consisting of auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production.
15. The method of claim 13, wherein the benefit is selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome, relative to reference seeds or agricultural plants derived from reference seeds.
16. The method of claim 13, wherein the formulation comprises at least one member selected from the group consisting of an agriculturally compatible carrier, a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient.
17. The method of claim 13, wherein the seed is contacted with at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, of the endophyte.
18. The method of claim 13, wherein the formulation comprises at least two endophyte populations comprising a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-395 and 397-455, wherein the at least two endophyte populations are present in the formulation in an amount effective to colonize the mature agricultural plant.
19. The method of claim 13, wherein the plant is a monocot.
20. The method of claim 19, wherein the monocot is selected from the group consisting of corn, wheat, barley and rice.
21. The method of claim 13, wherein the plant is a dicot.
22. The method of claim 21, wherein the dicot is selected from the group consisting of a soybean, peanut, canola, cotton, Brassica Napus, cabbage, lettuce, melon, strawberry, turnip, watermelon, tomato and pepper.
23. The method of claim 13, wherein the endophyte is present in the formulation in an amount effective to increase the biomass and/or yield of the fruit or seed produced by the plant by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the fruit or seed of a reference agricultural plant.
24. The method of claim 13, wherein the endophyte is present in the formulation in an amount effective to detectably increase the rate of germination of the seed.
25. The method of claim 13, wherein the benefit to the seeds or seedlings or the plants derived from the seeds is conferred under water limited conditions.
26. The method of claim 13, wherein the plant derived from the seed is a soybean plant in water limited conditions and the plant expresses one or more genes whose nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4131, 4140, 4142, 4150, 4153, 4162, 4167, 4181, 4183, 4184, 4195, 4199, 4201, 4206, 4213, 4222, 4223, 4250, 4253, and 4269, wherein the one or more plant genes are modulated in response to the first endophyte contacting the plant as compared to a reference microorganism contacting the plant.
27. A method for modulating a plant trait comprising heterologously disposing to vegetation or an area adjacent the vegetation, a formulation comprising an endophyte population comprising an endophyte comprising a 16S rRNA or ITS rRNA nucleicacid sequence at least 97% identical to a nucleicacid sequence selected from the group consisting of SEQ ID NOs: 1-395 and 397-455, wherein the formulation is capable of providing a benefit to the vegetation, or to a crop produced from the vegetation.
28. The method of claim 27, wherein the plant is a soybean plant in water limited conditions and the plant expresses one or more genes whose nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4131, 4140, 4142, 4150, 4153, 4162, 4167, 4181, 4183, 4184, 4195, 4199, 4201, 4206, 4213, 4222, 4223, 4250, 4253, and 4269, wherein the one or more plant genes are modulated in response to the endophyte contacting the plant as compared to a reference microorganism contacting the plant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The drawings are for illustration purposes only not for limitation.
(2)
(3)
DETAILED DESCRIPTION
Definitions
(4) In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.
(5) As used herein, an agricultural seed is a seed used to grow a plant typically used in agriculture (an agricultural plant). The seed may be of a monocot or dicot plant, and may w be planted for the production of an agricultural product, for example grain, food, feed, fiber, fuel, etc. As used herein, an agricultural seed is a seed that is prepared for planting, for example, in farms for growing.
(6) An endophyte or endophytic entity or endophytic microbe is a symbiotic organism (e.g., a microorganism, e.g., a bacterium, e.g., a fungi) capable of living within a plant or is otherwise associated therewith, and does not cause disease or harm the plant otherwise, and confers one or more beneficial properties to the host plant. In some embodiments, an endophyte is a microorganism. In some embodiments, an endophyte is a microorganism that is associated with one or more host plant tissues and is in a symbiotic, e.g., beneficial relationship with said host plant tissues. In some embodiments, an endophyte is a microorganism, e.g., a bacterial or fungal organism, that confers an increase in yield, an increase in biomass, an increase in stress resistance, an increase in fitness, or combinations thereof, in its host plant. Endophytes may occupy the intracellular or extracellular spaces of plant tissue, including the leaves, stems, flowers, fruits, seeds, roots and combinations thereof. As used herein, the term endophytic component refers to a composition and/or structure that is part of the endophyte.
(7) As used herein, the term microbe or microorganism refers to any species or taxon of microorganism, including, but not limited to, archaea, bacteria, microalgae, fungi (including mold and yeast species), mycoplasmas, microspores, nanobacteria, oomycetes, and protozoa. In some embodiments, a microbe or microorganism is an endophyte. In some embodiments, a microbe is an endophyte. In some embodiments, a microbe or microorganism encompasses individual cells (e.g., unicellular microorganisms) or more than one cell (e.g., multi-cellular microorganism). A population of microorganisms may thus refer to a multiple cells of a single microorganism, in which the cells share common genetic derivation. As used herein, the term neutral microbe or neutral microorganism refers to a microorganism that is both non-beneficial and non-pathogenic to a host plant.
(8) As used herein, the term bacteria or bacterium refers in general to any prokaryotic organism, and may reference an organism from either Kingdom Eubacteria (Bacteria), Kingdom Archaebacteria (Archae), or both.
(9) As used herein, the term fungus or fungi refers in general to any organism from Kingdom Fungi.
(10) A spore or a population of spores refers to bacteria or fungi that are generally viable, more resistant to environmental influences such as heat and bactericidal or fungicidal agents than other forms of the same bacteria or fungi, and typically capable of germination and out-growth. Bacteria and fungi that are capable of forming spores are those bacteria and fungi comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.
(11) Internal Transcribed Spacer (ITS) refers to the spacer DNA (non-coding DNA) situated between the small-subunit ribosomal RNA (rRNA) and large-subunit rRNA genes in the chromosome or the corresponding transcribed region in the polycistronic rRNA precursor transcript.
(12) A plurality of endophytes means two or more types of endophyte entities, e.g., of simple bacteria or simple fungi, complex fungi, or combinations thereof. In some embodiments, the two or more types of endophyte entities are two or more strains of endophytes. In other embodiments, the two or more types of endophyte entities are two or more species of endophytes. In yet other embodiments, the two or more types of endophyte entities are two or more genera of endophytes. In yet other embodiments, the two or more types of endophyte entities are two or more families of endophytes. In yet other embodiments, the two or more types of endophyte entities are two or more orders of endophytes.
(13) A population of endophytes refers to a plurality of cells of a single endophyte, in which the cells share common genetic derivation.
(14) A complex network means a plurality of endophytes co-localized in an environment, such as on or within an agricultural plant. Preferably, a complex network includes two or more types of endophyte entities that synergistically interact, such synergistic endophytic populations capable of providing a benefit to the agricultural seed, seedling, or plant derived thereby.
(15) The terms pathogen and pathogenic in reference to a bacterium or fungus includes any such organism that is capable of causing or affecting a disease, disorder or condition of a host comprising the organism.
(16) A spore or a population of spores refers to bacteria or fungi that are generally viable, more resistant to environmental influences such as heat and bactericidal or fungicidal agents than other forms of the same bacteria or fungi, and typically, capable of germination and out-growth. Bacteria and fungi that are capable of forming spores are those bacteria and fungi comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.
(17) As used herein, a colony-forming unit (CFU) is used as a measure of viable microorganisms in a sample. A CFU is an individual viable cell capable of forming on a solid medium a visible colony whose individual cells are derived by cell division from one parental cell.
(18) The term isolated is intended to specifically reference an organism, cell, tissue, polynucleotide, or polypeptide that is removed from its original source and purified from additional components with which it was originally associated. For example, an endophyte may be considered isolated from a seed if it is removed from that seed source and purified so that it is isolated from any additional components with which it was originally associated. Similarly, an endophyte may be removed and purified from a plant or plant element so that it is isolated and no longer associated with its source plant or plant element.
(19) As used herein, an isolated strain of a microbe is a strain that has been removed from its natural milieu. Pure cultures or isolated cultures are cultures in which the organisms present are only of one strain of a particular genus and species. This is in contrast to mixed cultures, which are cultures in which more than one genus and/or species of microorganism are present. As such, the term isolated does not necessarily reflect the extent to which the microbe has been purified. A substantially pure culture of the strain of microbe refers to a culture which contains substantially no other microbes than the desired strain or strains of microbe. In other words, a substantially pure culture of a strain of microbe is substantially free of other contaminants, which can include microbial contaminants. Further, as used herein, a biologically pure strain is intended to mean the strain separated from materials with which it is normally associated in nature. A strain associated with other strains, or with compounds or materials that it is not normally wound with in nature, is still defined as biologically pure. A monoculture of a particular strain is, of course, biologically pure. As used herein, the term enriched culture of an isolated microbial strain refers to a microbial culture that contains more that 50%, 60%, 70%, 80%, 90%, or 95% of the isolated strain.
(20) A plant element is intended to generically reference either a whole plant or a plant component, including but not limited to plant tissues, parts, and cell types. A plant element is preferably one of the following: whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, kelkis, shoot, bud. As used herein, a plant element is synonymous to a portion of a plant, and refers to any part of the plant, and can include distinct tissues and/or organs, and may be used interchangeably with the term tissue throughout.
(21) Similarly, a plant reproductive element is intended to generically reference any part of a plant that is able to initiate other plants via either sexual or asexual reproduction of that plant, for example but not limited to: seed, seedling, root, shoot, stolon, bulb, tuber, corm, keikis, or bud.
(22) A population of plants, as used herein, refers to a plurality of plants that are of the same taxonomic category, typically of the same species, and will also typically share a common genetic derivation.
(23) As used herein, an agricultural seed is a seed used to grow a plant typically used in agriculture (an agricultural plant). The seed may be of a monocot or dicot plant, and may be planted for the production of an agricultural product, for example feed, food, fiber, fuel, etc. As used herein, an agricultural seed is a seed that is prepared for planting, for example, in farms for growing.
(24) Agricultural plants, or plants of agronomic importance, include plants that are cultivated by humans for food, feed, fiber, and fuel purposes. Agricultural plants include monocotyledonous species such as: maize (Zea mays), common wheat (Triticum aestivum), spelt (Triticum spelta), einkorn wheat (Triticum monococcum), emmer wheat (Triticum dicoccum), durum wheat (Triticum durum), Asian rice (Oryza sativa), African rice (Oryza glabaerreima), wild rice (Zizania aquatica, Zizania latifolia, Zizania palustris, Zizania texana), barley (Hordeum vulgare), Sorghum (Sorghum bicolor), Finger millet (Eleusine coracana), Proso millet (Panicum miliaceum), Pearl millet (Pennisetum glaucum), Foxtail millet (Setaria italica), Oat (Avena sativa), Triticale (Triticosecale), rye (Secale cereal), Russian wild rye (Psathyrostachys juncea), bamboo (Bambuseae), or sugarcane (e.g., Saccharum arundinaceum, Saccharum barberi, Saccharum bengalense, Saccharum edule, Saccharum munja, Saccharum officinarum, Saccharum procerum, Saccharum ravennae, Saccharum robustum, Saccharum sinense, or Saccharum spontaneum); as well as dicotyledonous species such as: soybean (Glycine max), canola and rapeseed cultivars (Brassica napus), cotton (genus Gossypium), alfalfa (Medicago sativa), cassava (genus Manihot), potato (Solanum tuberosum), tomato (Solanum lycopersicum), pea (Pisum sativum), chick pea (Cicer arietinum), lentil (Lens culinaris), flax (Linum usitatissimum), peanut (Arachis hypogaea) and many varieties of vegetables.
(25) A host plant includes any plant, particularly a plant of agronomic importance, which an endophyte can colonize. As used herein, an endophyte is said to colonize a plant or plant element when it can be stably detected within the plant or plant element over a period time; such as one or more days, weeks, months or years, in other words, a colonizing entity is not transiently associated with the plant or plant element. Such host plants are preferably plants of agronomic importance.
(26) A non-host target means an organism or chemical compound that is altered in some way after contacting a host plant or host fungus that comprises an endophyte, as a result of a property conferred to the host plant or host fungus by the endophyte.
(27) As used herein, a hybrid plant refers generally refers to a plant that is the product of a cross between two genetically different parental plants. A hybrid plant is generated by either a natural or artificial process of hybridization whereby the entire genome of one species, variety cultivar, breeding line or individual plant is combined intra- or interspecifically into the genome of species, variety or cultivar or line, breeding line or individual plant by crossing.
(28) An inbred plant, as used herein, refers to a plant or plant line that has been repeatedly crossed or inbred to achieve a high degree of genetic uniformity, and low heterozygosity, as is known in the art.
(29) The term isoline is a comparative term, and references organisms that are genetically identical, but may differ in treatment. In one example, two genetically identical maize plant embryos may be separated into two different groups, one receiving a treatment (such as transformation with a heterologous polynucleotide, to create a genetically modified plant) and one control that does not receive such treatment. Any phenotypic differences between the two groups may thus be attributed solely to the treatment and not to any inherency of the plant's genetic makeup. In another example, two genetically identical seeds may be treated with a formulation that introduces an endophyte composition. Any phenotypic differences between the plants derived from those seeds may be attributed to the treatment, thus forming an isoline comparison.
(30) Similarly, by the terms reference plant, reference agricultural plant or reference seed, it is meant an agricultural plant or seed of the same species, strain, or cultivar to which a treatment, formulation, composition or endophyte preparation as described herein is not administered/contacted. A reference agricultural plant or seed, therefore, is identical to the treated plant with the exception of the presence of the endophyte and can serve as a control for detecting the effects of the endophyte that is conferred to the plant.
(31) A reference environment refers to the environment, treatment or condition of the plant in which a measurement is made. For example, production of a compound in a plant associated with an endophyte can be measured in a reference environment of drought stress, and compared with the levels of the compound in a reference agricultural plant under the same conditions of drought stress. Alternatively, the levels of a compound in plant associated with an endophyte and reference agricultural plant can be measured under identical conditions of no stress.
(32) A population of plants refers to more than one plant, that are of the same taxonomic category, typically be of the same species, and will also typically share a common genetic derivation.
(33) In some embodiments, the invention contemplates the use of microbes that are exogenous to a seed or plant. As used herein, a microbe is considered exogenous to the seed or plant if the plant element that is unmodified (e.g., a plant element that is not treated with the plurality of endophytes described herein) does not contain the microbe.
(34) In some embodiments, a microbe can be endogenous to a seed or plant. As used herein, a microbe is considered endogenous to a plant or seed, if the endophyte or endophyte component is derived from, or is otherwise found in, a plant element of the plant specimen from which it is sourced. In embodiments in which an endogenous endophyte is applied, the endogenous microbe is applied in an amount that differs from the levels typically found in the plant.
(35) In some embodiments, the present invention contemplates the synthetic compositions comprising the combination of a plant element, seedling, or whole plants and an endophyte population, in which the endophyte population is heterologously disposed.
(36) In some aspects, heterologously disposed means that the plant element, seedling, or plant does not contain detectable levels of the microbe in that same plant element, seedling, or plant. For example if said plant element or seedling or plant does not naturally have the endophyte associated with it and the endophyte is applied, the endophyte would be considered to be heterologously disposed. In some aspects, heterologously disposed means that the endophyte is being applied to a different plant element than that with which the endophyte is naturally associated. For example, if said plant element or seedling or plant has the endophyte normally found in the root tissue but not in the leaf tissue, and the endophyte is applied to the leaf, the endophyte would be considered to be heterologously disposed. In some aspects, heterologously disposed means that the endophyte being applied to a different tissue or cell layer of the plant element than that in which the microbe is naturally found. For example, if endophyte is naturally found in the mesophyll layer of leaf tissue but is being applied to the epithelial layer, the endophyte would be considered to be heterologously disposed. In some aspects, heterologously disposed means that the endophyte being applied is at a greater concentration, number, or amount of the plant element, seedling, or plant, than that which is naturally found in said plant element, seedling, or plant. For example, an endophyte concentration that is being applied is at least 1.5 times, between 1.5 and 2 times, 2 times, between 2 and 3 times, 3 times, between 3 and 5 times, 5 times, between 5 and 7 times, 7 times, between 7 and 10 times, 10 times greater, or even greater than 10 times higher number, amount, or concentration than that which is naturally present, the endophyte would be considered to be heterologously disposed. In some aspects, heterologously disposed means that the endophyte is applied to a developmental stage of the plant element, seedling, or plant in which said endophyte is not naturally associated, but may be associated at other stages. For example, if an endophyte is normally found at the flowering stage of a plant and no other stage, an endophyte applied at the seedling stage may be considered to be heterologously disposed. For the avoidance of doubt, heterologously disposed contemplates use of microbes that are exogenous to a seed or plant.
(37) In some cases, the present invention contemplates the use of microbes that are compatible with agricultural chemicals, including but not limited to, a fungicide, an anti-complex compound, a bactericide, a virucide, an herbicide, a nematicide, a parasiticide, a pesticide, or any other agent widely used in agricultural which has the effect of killing or otherwise interfering with optimal growth of another organism. As used herein, a microbe is compatible with an agricultural chemical, when the microbe is modified, such as by genetic modification, e.g., contains a transgene that confers resistance to an herbicide, or otherwise adapted to grow in, or otherwise survive, the concentration of the agricultural chemical used in agriculture. For example, a microbe disposed on the surface of plant element is compatible with the fungicide metalaxyl if it is able to survive the concentrations that are applied on the plant element surface.
(38) Biomass means the total mass or weight (fresh or dry), at a given time, of a plant tissue, plant tissues, an entire plant, or population of plants, usually given as weight per unit area. The term may also refer to all the plants or species in the community (community biomass).
(39) Some of the compositions and methods described herein involve single endophyte strains or plurality of endophytes in an amount effective to colonize a plant. As used herein, a microbe is said to colonize a plant or seed when it can exist in an endophytic relationship with the plant in the plant environment, for example inside the plant or a part or tissue thereof, including the seed.
(40) The compositions and methods herein may provide for an improved agronomic trait or trait of agronomic importance to a host plant, which may include, but not be limited to, the following: altered oil content, altered protein content, altered seed carbohydrate composition, altered seed oil composition, and altered seed protein composition, chemical tolerance, cold tolerance, delayed senescence, disease resistance, drought tolerance, ear weight, growth improvement, health enhancement, heat tolerance, herbicide tolerance, herbivore resistance, improved nitrogen fixation, improved nitrogen utilization, improved root architecture, improved water use efficiency, increased biomass, increased root length, increased seed weight, increased shoot length, increased yield, increased yield under water-limited conditions, kernel mass, kernel moisture content, metal tolerance, number of ears, number of kernels per ear, number of pods, nutrition enhancement, pathogen resistance, pest resistance, photosynthetic capability improvement, salinity tolerance, stay-green, vigor improvement, increased dry weight of mature seeds, increased fresh weight of mature seeds, increased number of mature seeds per plant, increased chlorophyll content, increased number of pods per plant, increased length of pods per plant, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, and increased number of non-wilted leaves per plant, a detectable modulation in the level of a metabolite, a detectable modulation in the level of a transcript, and a detectable modulation in the proteome, compared to an isoline plant grown from a seed without said seed treatment formulation.
(41) Additionally, altered metabolic function or altered enzymatic function may include, but not be limited to, the following: altered production of an auxin, altered nitrogen fixation, altered production of an antimicrobial compound, altered production of a siderophore, altered mineral phosphate solubilization, altered production of a cellulase, altered production of a chitinase, altered production of a xylanase, altered production of acetoin and altered ability to metabolize a carbon source.
(42) An increased yield can refer to any increase in biomass or seed or fruit weight, seed size, seed number per plant, seed number per unit area, bushels per acre, tons per acre, kilo per hectare, or carbohydrate yield. Typically, the particular characteristic is designated when referring to increased yield, e.g., increased grain yield or increased seed size.
(43) Agronomic trait potential is intended to mean a capability of a plant element for exhibiting a phenotype, preferably an improved agronomic trait, at some point during its life cycle, or conveying said phenotype to another plant element with which it is associated in the same plant. For example, a plant element may comprise an endophyte that will provide benefit to leaf tissue of a plant from which the plant element is grown; in such case, the plant element comprising such endophyte has the agronomic trait potential for a particular phenotype (for example, increased biomass in the plant) even if the seed itself does not display said phenotype.
(44) By the term capable of metabolizing a particular carbon substrate, it is meant that the endophyte is able to utilize that carbon substrate as an energy source.
(45) The term synthetic combination means a plurality of elements associated by human endeavor, in which said association is not found in nature. In some embodiments, synthetic combination is used to refer to a treatment formulation associated with a plant element. In some aspects of the present invention, synthetic combination refers to a purified population of endophytes in a treatment formulation comprising additional compositions with which said endophytes are not found associated in nature. The combination may be achieved, for example, by coating the surface of the seed of a plant, such as an agricultural plant, or host plant elements with an endophyte. In some embodiments of the present invention, synthetic combination refers to one or more plant elements in association with an isolated, purified population of endophytes in a treatment formulation comprising additional compositions with which said endophytes are not found associated in nature.
(46) A treatment formulation refers to a mixture of chemicals that facilitate the stability, storage, and/or application of the endophyte composition(s). In some embodiments, an agriculturally compatible carrier can be used to formulate an agricultural formulation or other composition that includes a purified endophyte preparation. As used herein an agriculturally compatible carrier refers to any material, other than water, that can be added to a plant element without causing or having an adverse effect on the plant element (e.g., reducing seed germination) or the plant that grows from the plant element, or the like.
(47) In some cases, the present invention contemplates the use of compositions that are compatible with agricultural chemicals, for example, a fungicide, an anti-complex compound, or any other agent widely used in agricultural which has the effect of killing or otherwise interfering with optimal growth of another organism.
(48) Some compositions described herein contemplate the use of an agriculturally compatible carrier. As used herein an agriculturally compatible carrier is intended to refer to any material, other than water, which can be added to a seed or a seedling without causing/having an adverse effect on the seed, the plant that grows from the seed, seed germination, or the like.
(49) As used herein, a nucleic acid has homology or is homologous to a second nucleic acid if the nucleic acid sequence has a similar sequence to the second, nucleic acid sequence. The terms identity, percent sequence identity or identical in the context of nucleic acid sequences refer to the residues in the two sequences that are the same when aligned for maximum correspondence. There are a number of different algorithms known in the art that can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. In some embodiments, sequences can be compared using Geneious (Biomatters, Ltd., Auckland, New Zealand). In other embodiments, polynucleotide sequences can be compared using the multiple sequence alignment algorithm MUSCLE. In some embodiments the nucleic acid sequence to be aligned is a complete gene. In some embodiments, the nucleic acid sequence to be aligned is a gene fragment. In some embodiments, if the nucleic acid sequence to be aligned is a gene fragment, the percent identity to a second nucleic acid sequence is considered X % identical if the two sequences are X % identical the length of the shortest sequence.
(50) The term substantial homology or substantial similarity, when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 76%, 80%, 85%, or at least about 90%, or at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST, MUSCLE or Gap, as discussed above.
(51) As used herein, the terms operational taxonomic unit, OTU, taxon, hierarchical cluster, and cluster are used interchangeably. An operational taxon unit (OTU) refers to a group of one or more organisms that comprises a node in a clustering tree. The level of a cluster is determined by its hierarchical order. In some embodiments, an OTU is a group tentatively assumed to be a valid taxon for purposes of phylogenetic analysis. In other embodiments, an OTU is any of the extant taxonomic units under study. In yet another embodiment, an OTU is given a name and a rank. For example, an OTU can represent a domain, a sub-domain, a kingdom, a sub-kingdom, a phylum, a sub-phylum, a class, a sub-class, an order, a sub-order, a family, a subfamily, a genus, a subgenus, or a species. In some embodiments, OTUs can represent one or more organisms from the kingdoms eubacteria, protista, or fungi at any level of a hierarchal order. In some embodiments, an OTU represents a prokaryotic or fungal order.
(52) As used herein, the terms water-limited condition, water stress condition and drought condition, or water-limited, water stress, and drought, may be used interchangeably. For example, a method or composition for improving a plant's ability to grow under drought conditions means the same as the ability to grow under water-limited conditions. In such cases, the plant can be further said to display improved tolerance to drought stress.
(53) The terms decreased, fewer, slower and increased faster enhanced greater as used herein refers to a decrease or increase in a characteristic of the endophyte treated seed or resulting plant compared to an untreated seed or resulting plant. For example, a decrease in a characteristic may be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least about 60%, at least 75%, at least about 80%, at least about 90%, at least 100%, at least 200%, at least about 300%, at least about 400% or more lower than the untreated control. For example, a decrease may be between 1% and 5%, or between 5% and 10%, or between 10% and 15%, or between 15% and 20%, or between 20% and 25%, or between 25% and 30%, or between 30% and 35%, or between 35% and 40%, or between 45% and 50% lower than the untreated control or the formulation control. An increase may be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least about 60%, at least 75%, at least about 80%, at least about 90%, at least 100%, at least 200%, at least about 300%, at least about 400% or more higher than the untreated control. For example, an increase may be between 1% and 5%, or between 5% and 10%, or between 10% and 15%, or between 15% and 20%, or between 20% and 25%, or between 25% and 30%, or between 30% and 35%, or between 35% and 40%, or between 45% and 50% higher than the untreated control or the formulation control.
(54) Endophytes
(55) Agricultural plants appear to associate with symbiotic microorganisms termed endophytes, particularly bacteria and fungi, that may have been important during evolution and may contribute to plant survival and performance. However, modern agricultural processes may have perturbed this relationship, resulting in increased crop losses, diminished stress resilience, biodiversity losses, and increasing dependence on external chemicals, fertilizers, and other unsustainable agricultural practices. There is a need for novel methods for generating plants with novel microbiome properties that can sustainably increase yield, stress resilience, and decrease fertilizer and chemical use.
(56) The inventors have undertaken a systematic comparison of the microbial communities that reside within a wide diversity of plants. As such, the endophytic microbes useful for the invention generally relate to endophytic microbes that are present in agricultural plants.
(57) In part, the present invention describes preparations of novel endophytes, and the creation of synthetic combinations of agricultural seeds and/or seedlings with heterologous endophytes and formulations containing the synthetic combinations, as well as the recognition that such synthetic combinations display a diversity of beneficial properties present in the agricultural plants and the associated endophyte populations newly created by the present inventors. Such beneficial properties include metabolism, transcript expression, proteome alterations, morphology, and the resilience to a variety of environmental stresses, and the combination of a plurality of such properties.
(58) Provided are novel compositions, methods, and products related our invention's ability to overcome the limitations of the prior art in order to provide reliable increases in crop yield, biomass, germination, vigor, stress resilience, and other properties to agricultural crops.
(59) We find that beneficial microbes can be robustly derived from plant elements, optionally cultured, administered heterologously to agricultural plant elements such as seeds, and colonize the resulting plant tissues with high efficiency to confer multiple beneficial properties.
(60) We find that microbes can confer beneficial properties across a range of concentrations.
(61) We find that endophytes can be heterologously disposed onto seedlings of a distinct cultivar, species, or crop type and confer benefits to those new recipients. For example, endophytes from corn cultivars are heterologously provided to wheat cultivars to confer a benefit. This is surprising given the observations of distinct microbiome preferences in distinct plant and mammalian hosts and, in particular, the likelihood that microbes derived from seeds have been co-evolved to be specialized to a particular host.
(62) We further find that combinations of heterologously disposed endophytes confer additive advantages to plants, including multiple functional properties and resulting in seed, seedling, and plant hosts that display single or multiple improved agronomic properties.
(63) Endophytes are microbes that grow inside a plant. Recent appreciation that endophytes can confer remarkable traits upon the host plant is the basis for the present invention. The inventors have developed a method to introduce isolated endophytes to another plant by coating the microbes onto the surface of a seed of a plant. By combining an endophyte sourced from one plant, it is possible to transfer the beneficial agronomic trait onto an agricultural plant, and therefore holds great promise for increasing agricultural productivity.
(64) Combining a selected plant species, OTU, strain or cultivar with one or more types of endophytes thus provides mechanisms by which, alone or in parallel with plant breeding and transgenic technologies, is provided improved yield from crops and generation of products thereof. Therefore, in a first aspect, the present invention provides a synthetic combination comprising the combination of a plant element, seedling, or whole plants and a single endophyte strain or a plurality of endophytes, in which the single endophyte strain or a plurality of endophytes are heterologously disposed.
(65) Synthetic Compositions of Plant Elements and Endophytes
(66) The present invention contemplates a synthetic combination of a plant element of a plant that is coated with an endophyte on its surface. The plant element can be any agricultural plant element, for example an agricultural seed. In one embodiment, the plant element of the first plant is from a monocotyledonous plant. For example, the plant element of the first plant is from a cereal plant. The plant element of the first plant can be selected from the group consisting of a maize plant, a wheat plant, a barley plant, an onion plant, a sorghum plant, or a rice plant. In an alternative embodiment, the plant element of the first plant is from a dicotyledonous plant. The plant element of the first plant can be selected from the group consisting of a cotton plant, a Brassica napus plant, a tomato plant, a pepper plant, a cabbage plant, a lettuce plant, a melon plant, a strawberry plant, a turnip plant, a watermelon plant, a peanut plant, or a soybean plant. In a particular embodiment, the plant is not a cotton plant. In still another embodiment, the seed of the first plant can be from a genetically modified plant. In another embodiment, the seed of the first plant can be a hybrid seed.
(67) The synthetic combination can comprise a plant element of the first plant that is surface-sterilized prior to combining with the endophytes. Such pre-treatment prior to coating the plant element with endophytes removes the presence of other microbes that may interfere with the optimal colonization, growth and/or function of the endophyte. Surface sterilization of plant elements can be accomplished without killing the plant elements as described herein elsewhere (see, for example, the section Isolation of endophytes).
(68) Sources of Endophytes
(69) As described herein, endophytes can be derived from heterologous, homologous, or engineered sources, optionally cultured, administered heterologously as a single endophyte strain or a plurality of endophytes to plant elements, and, as a result of the administration, confer multiple beneficial properties. In some embodiments, endophytes are derived from plant elements or soil. In some embodiments, the plant element from which the endophyte is derived is a monocotyledonous plant. In a particular embodiment, the plant is a cereal plant or tissue thereof. In yet another embodiment, plant is selected from the group consisting of a maize plant, a barley plant, a wheat plant, a sugarcane plant, a sorghum plant, or a rice plant. In some embodiments, the plant element is a naked grain (i.e., without hulls or fruit cases). In an alternative embodiment, the plant element from which the endophyte is derived is a W dicotyledonous plant. For example, a plant can be selected from the group consisting of a cotton plant, a Brassica napus plant, a tomato plant, a pepper plant, a cabbage plant, a lettuce plant, a melon plant, a strawberry plant, a turnip plant, a watermelon plant, a peanut plant, or a soybean plant.
(70) In some embodiments, the endophytes can be obtained from a plant element of the same or different crop, and can be from the same or different cultivar or variety as the plant element to which the composition is heterologously associated. For example, endophytes from a particular corn variety can be isolated and coated onto the surface of a corn seed of the same variety. In other embodiments, the endophytes can be isolated from a related species (e.g., an endophyte isolated from Triticum monococcum (einkorn wheat) can be coated onto the surface of a T. aestivum (common wheat) plant element; or, an endophyte from Hordeum vulgare (barley) can be isolated and coated onto the plant element of another member of the Triticeae family, for example, plant elements of the rye plant, Secale cereale). In still another embodiment, the endophytes can be isolated from a plant part of a plant that is distantly related to the plant element onto which the endophyte is to be coated. For example, tomato-derived endophytes are isolated and coated onto a rice plant element. In still another embodiment, endophytes used in a composition or used to make a synthetic composition can be obtained from a plant element of a plant that is distantly related to the plant element onto which the endophyte is to be coated. For example, a tomato-derived endophyte can be isolated and coated onto a rice plant element.
(71) In some embodiments, the present invention contemplates the use of endophytes that can confer a beneficial agronomic trait upon the seed or resulting plant onto which it is coated. In another embodiment, the seed endophytes useful for the present invention can also be isolated from seeds of plants adapted to a particular environment, including, but not limited to, an environment with water deficiency, salinity, acute and/or chronic heat stress, acute and/or chronic cold stress, nutrient deprived soils including, but not limited to, micronutrient deprived soils, macronutrient (e.g., potassium, phosphate, nitrogen) deprived soils, pathogen stress, including fungal, nematode, insect, viral, bacterial pathogen stress. In one example, the endophyte is isolated from the seed of a plant that grows in a water deficient environment.
(72) The synthetic combination of the present invention contemplates the presence of an endophyte on the surface of the seed of the first plant. In one embodiment, the seed of the to first plant is coated with at least 10 CFU or spores of the endophyte per seed, for example, at least 20 CFU or spores, at least 50 CFU or spores, at least 100 CFU or spores, at least 200 CFU or spores, at least 300 CFU or spores, at least 500 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores or more per plant element. In another embodiment, the plant element is coated with at least 10, for example, at least 20, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1,000, at least 3,000, at least 10,000, at least 30,000, at least 100,000, at least 300,000, at least 1,000,000 or more of the endophyte as detected by the number of copies of a particular endophyte gene detected, for example, by quantitative PCR.
(73) The endophyte useful for the present invention can be a fungus. In another embodiment, the endophyte can be a bacterium. In one embodiment, the endophyte is not an Agrobacterium. In another embodiment, the endophyte is not capable of nitrogen fixation (for example, from the genus Rhizobium). In still another embodiment, the endophyte is not from the genus Acetobacter. In yet another embodiment, the endophyte is not from the genus Bacillus. In a particular embodiment, the endophyte is not Bacillus mojavensis. In yet another embodiment, the endophyte is not from the genus Neotyphodium.
(74) Historical taxonomic classification of fungi has been according to morphological presentation. Beginning in the mid-1800's, it was recognized that some fungi have a pleomorphic life cycle, and that different nomenclature designations were being used for different forms of the same fungus. In 1981, the Sydney Congress of the International Mycological Association laid out rules for the naming of fungi according to their status as anamorph, teleomorph, or holomorph. With the development of genomic sequencing, it became evident that taxonomic classification based on molecular phylogenetics did not align with morphological-based nomenclature. As a result, in 2011 the International Botanical Congress adopted a resolution approving the International Code of Nomenclature for Algae, Fungi, and Plants (Melbourne Code) (2012), with the stated outcome of designating One Fungus=One Name. However, systematics experts have not aligned on common nomenclature for all fungi, nor are all existing databases and information resources inclusive of updated taxonomies. As such, many fungi referenced herein may be described by their anamorph form but it is understood that based on identical genomic sequencing, any pleomorphic state of that fungus may be considered to be the same organism. For example, the genus Alternaria is the anamorph form of the teleomorph genus Lewia, ergo both would be understood to be the same organism with the same DNA sequence.
(75) Exogenous Endophytes
(76) In one embodiment, the endophyte is an endophytic microbe that was isolated from a different plant than the inoculated plant. For example, in one embodiment, the endophyte can be an endophyte isolated from a different plant of the same species as the inoculated plant. In some cases, the endophyte can be isolated from a species related to the inoculated plant.
(77) The breeding of plants for agriculture, as well as cultural practices used to combat microbial pathogens, may have resulted in the loss in modern cultivars of the endophytes present in their wild ancestors or other wild plants, or such practices may have inadvertently promoted other novel or rare plant-endophyte interactions, or otherwise altered the microbial) population. The former is the case in maize and its phylogenetically confirmed, direct wild ancestor, Parviglumis teosinte (Zea mays ssp. Parviglumis). Although both species have seeds that appear to contain a common core of endophytic bacterial species, the relative abundance of certain groups is higher in seeds of teosinte than modern corn. It is possible that this higher diversity and titer of endophytes in the ancestor is correlated with an equally wide range of physiological responses derived from the symbiosis that allow the plant to better adapt to the environment and tolerate stress. In order to survey plant groups for potentially useful endophytes, seeds of their wild ancestors, wild relatives, primitive landraces, modern landraces, modern breeding lines, and elite modern agronomic varieties can be screened for microbial endophytes by culture and culture independent methods as described herein. In addition, microbial endophytes can be isolated from other wild plants, such as grassland plants.
(78) In some cases, plants are inoculated with endophytes that are exogenous to the seed of the inoculated plant. In one embodiment, the endophyte is derived from a plant of another species. For example, an endophyte that is normally found in dicots is applied to a monocot plant (e.g., inoculating corn with a soy bean-derived endophyte), or vice versa. In other cases, the endophyte to be inoculated onto a plant can be derived from a related species of the plant that is being inoculated. In one embodiment, the endophyte can be derived from a related taxon, for example, from a related species. The plant of another species can be an agricultural plant. For example, an endophyte derived from Hordeum irregulare can be used to inoculate a Hordeum vulgare L., plant. Alternatively, it can be derived from a wild plant (i.e., a non-agricultural plant). For example, endophytes normally associated with the wild cotton Gossypium klotzschianum can be used to inoculate commercial varieties of Gossypium hirsutum plants. Endophytes normally associated with a wild turnip plant or a wild watermelon plant can be used to inoculate commercial varieties of turnip or watermelon plants, respectively. As an alternative example of deriving an endophyte from a wild plant, endophytic bacteria isolated from the South East Asian jungle orchid, Cymbidium eburneum, as can be isolated and testing for their capacity to benefit seedling development and survival of agricultural crops such as wheat, maize, soy and others. In another example, endophytes may be isolated from wild grassland plants. In other cases, the endophyte can be isolated from an ancestral species of the inoculated plant. For example, an endophyte derived from Zea diploperennis can be used to inoculate a commercial variety of modern corn, or Zea mays.
(79) Selection of Plant Species from Desired Habitats for Isolation of Microbial Endophytes
(80) Different environments can contain significantly different populations of endophytes. For example, geographically isolated soils from different parts of the Americas have been shown to differ in 96% of the bacterial species they contain. Soils containing different microbial populations can strongly influence the endophytic bacterial population observed inside Arabidopsis illustrating that the environment can at least partially alter a plant's associated microbial population. This suggests that plants growing and especially thriving in choice environments are colonized by different and perhaps beneficial endophytes, whose isolation and inoculation onto crop plants may aid these plants to better survive in the same choice environment or to better resist certain stresses encountered in a normal agricultural environment. For instance, at least some of the bacteria isolated from plants growing in arid environments are expected to confer drought tolerance to host plants they are transplanted onto. Additionally, novel endophtytes may be found in related crop varieties grown in the choice environment. Once a choice environment is selected, seeds of choice plants to be sampled will be identified by their healthy and/or robust growth, and will then be sampled at least 5 at a time by excavating the entire plants plus small root ball including roots and associated soil and any seeds or fruit present on the plant. These will be placed in a cool (4 C. environment) for storage and prompt transport back to the lab for extraction of endophytes and DNA using methods described herein. Identification of choice environments or ecosystems for bioprospecting of plant associated endophytes from either wild plants or crop plants growing in the choice environments or ecosystems follows protocols described herein.
(81) In one embodiment, the endophyte-associated plant is harvested from a soil type different than the normal soil type that the crop plant is grown on, for example from a gelisol (soils with permafrost within 2 m of the surface), for example from a histosol (organic soil), for example from a spodosol (acid forest soils with a subsurface accumulation of metal-humus complexes), for example from an andisol (soils formed in volcanic ash), for example from a oxisol (intensely weathered soils of tropical and subtropical environments), for example from a vertisol (clayey soils with high shrink/swell capacity), for example from an aridisol (CaCO3-containing soils of arid environments with subsurface horizon development), for example from a ultisol (strongly leached soils with a subsurface zone of clay accumulation and <35% base saturation), for example from a mollisol (grassland soils with high base status), for example from an alfisol (moderately leached soils with a so subsurface zone of clay accumulation and >35% base saturation), for example from a inceptisol (soils with weakly developed subsurface horizons), for example from a entisol (soils with little or no morphological development).
(82) In another embodiment, the endophyte-associated plant is harvested from an ecosystem where the agricultural plant is not normally found, for example a tundra ecosystem as opposed to a temperate agricultural farm, for example from tropical and subtropical moist broadleaf forests (tropical and subtropical, humid), for example from tropical and subtropical dry broadleaf forests (tropical and subtropical, semihumid), for example from tropical and subtropical coniferous forests (tropical and subtropical, semihumid), for example from temperate broadleaf and mixed forests (temperate, humid), for example from temperate coniferous forests (temperate, humid to semihumid), from for example from boreal forests/taiga (subarctic, humid), for example from tropical and subtropical grasslands, savannas, and shrublands (tropical and subtropical, semiarid), for example from temperate grasslands, savannas, and shrublands (temperate, semiarid), for example from flooded grasslands and savannas (temperate to tropical, fresh or brackish water inundated), for example from montane grasslands and shrublands (alpine or montane climate), for example from Mediterranean forests, woodlands, and scrub or sclerophyll forests (temperate warm, semihumid to semiarid with winter rainfall), for example from mangrove forests, and for example from deserts and xeric shrublands (temperate to tropical, arid).
(83) In another embodiment, the endophyte-associated plant is harvested from a soil with an average pH range that is different from the optimal soil pH range of the crop plant, for example the plant may be harvested from an ultra acidic soil (<3.5), from an extreme acid soil (3.5-4.4), from a very strong acid soil (4.5-5.0), from a strong acid soil (5.1-5.5), from a moderate acid soil (5.6-6.0), from an slight acid soil (6.1-6.5), from an neutral soil (6.6-7.3), from an slightly alkaline soil (7.4-7.8), from an moderately alkaline soil (7.9-8.4), from a strongly alkaline soil (8.5-9.0), or from an very strongly alkaline soil (>9.0).
(84) In one embodiment, the endophyte-associated plant is harvested from an environment with average air temperatures lower than the normal growing temperature of the crop plant, for example 2-5 C. colder than average, for example, at least 5-10 C. colder, at least 10-15 C. colder, at least at least 15-20 C. colder, at least 20-25 C. colder, at least 25-30 C. colder, at least 30-35 C. colder, at least 35-40 C. colder, at least 40-45 C. colder, at least 45-50 C. colder, at least 50-55 C. colder or more, when compared with crop plants grown under normal conditions during an average growing season.
(85) In one embodiment, the endophyte-associated plant is harvested from an environment with average air temperatures higher than the normal growing temperature of the crop plant, for example 2-5 C. hotter than average, for example, at least 5-10 C. hotter, at least 10-15 C. hotter, at least at least 15-20 C. hotter, at least 20-25 C. hotter, at least 25-30 C. hotter, at least 30-35 C. hotter, at least 35-40 C. hotter, at least 40-45 C. hotter, at least 45-50 C. hotter, at least 50-55 C. hotter or more, when compared with crop plants grown under normal conditions during an average growing season.
(86) In another embodiment, the endophyte-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall received by the crop plant, for example 2-5% less rainfall than average, for example, at least 5-10% less rainfall, at least 10-15% less rainfall, at least 15-20% less rainfall, at least 20-25% less rainfall, at least 25-30% less rainfall, at least 30-35% less rainfall, at least 35-40% less rainfall, at least 40-45% less rainfall, at least 45-50% less rainfall, at least 50-55% less rainfall, at least 55-60% less rainfall, at least 60-65% less rainfall, at least 65-70% less rainfall, at least 70-75% less rainfall, at least 80-85% less rainfall, at least 85-90% less rainfall, at least 90-95% less rainfall, or less, when compared with crop plants grown under normal conditions during an average growing season.
(87) In one embodiment, the endophyte-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, for example 2-5% more rainfall than average, for example, at least 5-10% more rainfall, at least 10-15% more rainfall, at least 15-20% more rainfall, at least 20-25% more rainfall, at least 25-30% more rainfall, at least 30-35% more rainfall, at least 35-40% more rainfall, at least 40-45% more rainfall, at least 45-50% more rainfall, at least 50-55% more rainfall, at least 55-60% more rainfall, at least 60-65% more rainfall, at least 65-70% more rainfall, at least 70-75% more rainfall, at least 80-85% more rainfall, at least 85-90% more rainfall, at least 90-95% more rainfall, at least 95-100% more rainfall, or even greater than 100% more rainfall, or even greater than 200% more rainfall, or even greater than 300% more rainfall, or even greater than 400% more rainfall, or even greater than 500% more rainfall, when compared with crop plants grown under normal conditions during an average growing season.
(88) In another embodiment, the endophyte-associated plant is harvested from a soil type with different soil moisture classification than the normal soil type that the crop plant is grown on, for example from an aquic soil (soil is saturated with water and virtually free of gaseous oxygen for sufficient periods of time, such that there is evidence of poor aeration), for example from an udic soil (soil moisture is sufficiently high year-round in most years to meet plant requirement), for example from an ustic soil (soil moisture is intermediate between udic and aridic regimes; generally, plant-available moisture during the growing season, but severe periods of drought may occur), for example from an aridic soil (soil is dry for at least half of the growing season and moist for less than 90 consecutive days), for example from a xeric soil (soil moisture regime is found in Mediterranean-type climates, with cool, moist winters and warm, dry summers).
(89) In one embodiment, the endophyte-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall of the crop plant, for example 2-95% less rainfall than average, for example, at least 5-90% less rainfall, at least 10-85% less rainfall, at least 15-80% less rainfall, at least 20-75% less rainfall, at least 25-70% less rainfall, at least 30-65% less rainfall, at least 35-60% less rainfall, at least 40-55% less rainfall, at least 45-50% less rainfall, when compared with crop plants grown under normal conditions during an average growing season.
(90) In one embodiment, the endophyte-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, for example 2-5% more rainfall than average, for example, at least 5-10% more rainfall, at least 10-15% more rainfall, at least 15-20% more rainfall, at least 20-25% more rainfall, at least 25-30% more rainfall, at least 30-35% more rainfall, at least 35-40% more rainfall, at least 40-45% more rainfall, at least 45-50% more rainfall, at least 50-55% more rainfall, at least 55-60% more rainfall, at least 60-65% more rainfall, at least 65-70% more rainfall, at least 70-75% more rainfall, at least 80-85% more rainfall, at least 85-90% more rainfall, at least 90-95% more rainfall, at least 95-100% more rainfall, or even greater than 100% more rainfall, or even greater than 200% more rainfall, or even greater than 300% more rainfall, or even greater than 400% more rainfall, or even greater than 500% more rainfall, when compared with crop plants grown under normal conditions during an average growing season.
(91) In another embodiment, the endophyte-associated plant is harvested from an agricultural environment with a crop yield lower than the average crop yield expected from the crop plant grown under average cultivation practices on normal agricultural land, for example 2-5% lower yield than average, for example, at least 5-10% lower yield, at least 10-15% lower yield, at least 15-20% lower yield, at least 20-25% lower yield, at least 25-30% lower yield, at least 30-35% lower yield, at least 35-40% lower yield, at least 40-45% lower yield, at least 45-50% lower yield, at least 50-55% lower yield, at least 55-60% lower yield, at least 60-65% lower yield, at least 65-70% lower yield, at least 70-75% lower yield, at least 80-85% lower yield, at least 85-90% lower yield, at least 90-95% lower yield, or less, when compared with crop plants grown under normal conditions during an average growing season.
(92) In a related embodiment, the endophyte-associated plant is harvested from an agricultural environment with a crop yield lower than the average crop yield expected from the crop plant grown under average cultivation practices on normal agricultural land, for example 2-95% lower yield than average, for example, at least 5-90% lower yield, at least 10-85% lower yield, at least 15-80% lower yield, at least 20-75% lower yield, at least 25-70% lower yield, at least 30-65% lower yield, at least 35-60% lower yield, at least 40-55% lower yield, at least 45-50% lower yield, when compared with crop plants grown under normal conditions during an average growing season.
(93) In one embodiment, the endophyte-associated plant is harvested from an environment with average crop yield higher than the optimal average crop yield of the crop plant, for example 2-5% more yield than average, for example, at least 5-10% more yield, at least 10-15% more yield, at least 15-20% more yield, at least 20-25% more yield, at least 25-30% more yield, at least 30-35% more yield, at least 35-40% more yield, at least 40-45% more yield, at least 45-50% more yield, at least 50-55% more yield, at least 55-60% more yield, at least 60-65% more yield, at least 65-70% more yield, at least 70-75% more yield, at least 80-85% more yield, at least 85-90% more yield, at least 90-95% more yield, at least 95-100% more yield, or even greater than 100% more yield, or even greater than 200% more yield, or even greater than 300% more yield, or even greater than 400% more yield, or even greater than 500% more yield, when compared with crop plants grown under normal conditions during an average growing season.
(94) In a related embodiment, the endophyte-associated plant is harvested from an environment with average crop yield higher than the optimal average crop yield of the crop plant, 2-500% more yield than average, 2-400% more yield than average, 2-300% more yield than average, 2-200% more yield than average, 2-95% more yield than average, for example, at least 5-90% more yield, at least 10-85% more yield, at least 15-80% more yield, at least 20-75% more yield, at least 25-70% more yield, at least 30-65% more yield, at least 35-60% more yield, at least 40-55% more yield, at least 45-50% more yield, when compared with crop plants grown under normal conditions during an average growing season.
(95) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less nitrogen than average, for example, at least 5-10% less nitrogen, at least 10-15% less nitrogen, at least 15-20% less nitrogen, at least 20-25% less nitrogen, at least 25-30% less nitrogen, at least 30-35% less nitrogen, at least 35-40% less nitrogen, at least 40-45% less nitrogen, at least 45-50% less nitrogen, at least 50-55% less nitrogen, at least 55-60% less nitrogen, at least 60-65% less nitrogen, at least 65-70% less nitrogen, at least 70-75% less nitrogen, at least 80-85% less nitrogen, at least 85-90% less nitrogen, at least 90-95% less nitrogen, or less, when compared with crop plants grown under normal conditions during an average growing season.
(96) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more nitrogen than average, for example, at least 5-10% more nitrogen, at least 10-15% more nitrogen, at least 15-20% more nitrogen, at least 20-25% more nitrogen, at least 25-30% more nitrogen, at least 30-35% more nitrogen, at least 35-40% more nitrogen, at least 40-45% more nitrogen, at least 45-50% more nitrogen, at least 50-55% more nitrogen, at least 55-60% more nitrogen, at least 60-65% more nitrogen, at least 65-70% more nitrogen, at least 70-75% more nitrogen, at least 80-85% more nitrogen, at least 85-90% more nitrogen, at least 90-95% more nitrogen, at least 95-100% more nitrogen, or even greater than 100% more nitrogen, or even greater than 200% more nitrogen, or even greater than 300% more nitrogen, or even greater than 400% more nitrogen, or even greater than 500% more nitrogen, when compared with crop plants grown under normal conditions during an average growing season.
(97) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less phosphorus than average, for example, at least 5-10% less phosphorus, at least 10-15% less phosphorus, at least 15-20% less phosphorus, at least 20-25% less phosphorus, at least 25-30% less phosphorus, at least 30-35% less phosphorus, at least 35-40% less phosphorus, at least 40-45% less phosphorus, at least 45-50% less phosphorus, at least 50-55% less phosphorus, at least 55-60% less phosphorus, at least 60-65% less phosphorus, at least 65-70% less phosphorus, at least 70-75% less phosphorus, at least 80-85% less phosphorus, at least 85-90% less phosphorus, at least 90-95% less phosphorus, or less, when compared with crop plants grown under normal conditions during an average growing season.
(98) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more phosphorus than average, for example, at least 5-10% more phosphorus, at least 10-15% more phosphorus, at least 15-20% more phosphorus, at least 20-25% more phosphorus, at least 25-30% more phosphorus, at least 30-35% more phosphorus, at least 35-40% more phosphorus, at least 40-45% more phosphorus, at least 45-50% more phosphorus, at least 50-55% more phosphorus, at least 55-60% more phosphorus, at least 60-65% more phosphorus, at least 65-70% more phosphorus, at least 70-75% more phosphorus, at least 80-85% more phosphorus, at least 85-90% more phosphorus, at least 90-95% more phosphorus, at least 95-100% more phosphorus, or even greater than 100% more phosphorus, or even greater than 200% more phosphorus, or even greater than 300% more phosphorus, or even greater than 400% more phosphorus, or even greater than 500% more phosphorus, when compared with crop plants grown under normal conditions during an average growing season.
(99) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less potassium than average, for example, at least 5-10% less potassium, at least 10-15% less potassium, at least 15-20% less potassium, at least 20-25% less potassium, at least 25-30% less potassium, at least 30-35% less potassium, at least 35-40% less potassium, at least 40-45% less potassium, at least 45-50% less potassium, at least 50-55% less potassium, at least 55-60% less potassium, at least 60-65% less potassium, at least 65-70% less potassium, at least 70-75% less potassium, at least 80-85% less potassium, at least 85-90% less potassium, at least 90-95% less potassium, or less, when compared with crop plants grown under normal conditions during an average growing season.
(100) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more potassium than average, for example, at least 5-10% more potassium, at least 10-15% more potassium, at least 15-20% more potassium, at least 20-25% more potassium, at least 25-30% more potassium, at least 30-35% more potassium, at least 35-40% more potassium, at least 40-45% more potassium, at least 45-50% more potassium, at least 50-55% more potassium, at least 55-60% more potassium, at least 60-65% more potassium, at least 65-70% more potassium, at least 70-75% more potassium, at least 80-85% more potassium, at least 85-90% more potassium, at least 90-95% more potassium, at least 95-100% more potassium, or even greater than 100% more potassium, or even greater than 200% more potassium, or even greater than 300% more potassium, or even greater than 400% more potassium, or even greater than 500% more potassium, when compared with crop plants grown under normal conditions during an average growing season.
(101) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less sulfur than average, for example, at least 5-10% less sulfur, at least 10-15% less sulfur, at least 15-20% less sulfur, at least 20-25% less sulfur, at least 25-30% less sulfur, at least 30-35% less sulfur, at least 35-40% less sulfur, at least 40-45% less sulfur, at least 45-50% less sulfur, at least 50-55% less sulfur, at least 55-60% less sulfur, at least 60-65% less sulfur, at least 65-70% less sulfur, at least 70-75% less sulfur, at least 80-85% less sulfur, at least 85-90% less sulfur, at least 90-95% less sulfur, or less, when compared with crop plants grown under normal conditions during an average growing season.
(102) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more sulfur than average, for example, at least 5-10% more sulfur, at least 10-15% more sulfur, at least 15-20% more sulfur, at least 20-25% more sulfur, at least 25-30% more sulfur, at least 30-35% more sulfur, at least 35-40% more sulfur, at least 40-45% more sulfur, at least 45-50% more sulfur, at least 50-55% more sulfur, at least 55-60% more sulfur, at least 60-65% more sulfur, at least 65-70% more sulfur, at least 70-75% more sulfur, at least 80-85% more sulfur, at least 85-90% more sulfur, at least 90-95% more sulfur, at least 95-100% more sulfur, or even greater than 100% more sulfur, or even greater than 200% more sulfur, or even greater than 300% more sulfur, or even greater than 400% more sulfur, or even greater than 500% more sulfur, when compared with crop plants grown under normal conditions during an average growing season.
(103) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total calcium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less calcium than average, for example, at least 5-10% less calcium, at least 10-15% less calcium, at least 15-20% less calcium, at least 20-25% less calcium, at least 25-30% less calcium, at least 30-35% less calcium, at least 35-40% less calcium, at least 40-45% less calcium, at least 45-50% less calcium, at least 50-55% less calcium, at least 55-60% less calcium, at least 60-65% less calcium, at least 65-70% less calcium, at least 7.0-75% less calcium, at least 80-85% less calcium, at least 85-90% less calcium, at least 90-95% less calcium, or less, when compared with crop plants grown under normal conditions during an average growing season.
(104) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total magnesium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less magnesium than average, for example, at least 5-10% less magnesium, at least 10-15% less magnesium, at least 15-20% less magnesium, at least 20-25% less magnesium, at least 25-30% less magnesium, at least 30-35% less magnesium, at least 35-40% less magnesium, at least 40-45% less magnesium, at least 45-50% less magnesium, at least 50-55% less magnesium, at least 55-60% less magnesium, at least 60-65% less magnesium, at least 65-70% less magnesium, at least 70-75% less magnesium, at least 80-85% less magnesium, at least 85-90% less magnesium, at least 90-95% less magnesium, or less, when compared with crop plants grown under normal conditions during an average growing season.
(105) In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total sodium chloride (salt) than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more salt than average, for example, at least 5-10% more salt, at least 10-15% more salt, at least 15-20% more salt, at least 20-25% more salt, at least 25-30% more salt, at least 30-35% more salt, at least 35-40% more salt, at least 40-45% more salt, at least 45-50% more salt, at least 50-55% more salt, at least 55-60% more salt, at least 60-65% more salt, at least 65-70% more salt, at least 70-75% more salt, at least 80-85% more salt, at least 85-90% more salt, at least 90-95% more salt, at least 95-100% more salt, or even greater than 100% more salt, or even greater than 200% more salt, or even greater than 300% more salt, or even greater than 400% more salt, or even greater than 500% more salt, when compared with crop plants grown under normal conditions during an average growing season.
(106) Relocalization of Endophytes
(107) In some embodiments, a single endophyte strain or a plurality of endophytes that are used to treat a plant element are capable of localizing to a different tissue of the plant, regardless of the original source of the endophyte. For example, the endophyte can be capable of localizing to any one of the tissues in the plant, including: the root, adventitious root, seminal root, root hair, shoot, leaf, flower, bud, tassel, meristem, pollen, pistil, ovaries, stamen, fruit, stolon, rhizome, nodule, tuber, trichome, guard cells, hydathode, petal, sepal, glume, rachis, vascular cambium, phloem, and xylem. In one embodiment, the endophyte is capable of localizing to the root and/or the root hair of the plant. In another embodiment, the endophyte is capable of localizing to the photosynthetic tissues, for example, leaves and shoots of the plant. In other cases, the endophyte is localized to the vascular tissues of the plant, for example, in the xylem and phloem. In still another embodiment, the endophyte is capable of localizing to the reproductive tissues (flower, pollen, pistil, ovaries, stamen, fruit) of the plant. In another embodiment, the endophyte is capable of localizing to the root, shoots, leaves and reproductive tissues of the plant. In still another embodiment, the endophyte colonizes a fruit or seed tissue of the plant. In still another embodiment, the endophyte is able to colonize the plant such that it is present in the surface of the plant (i.e., its presence is detectably present on the plant exterior, or the episphere of the plant). In still other embodiments, the endophyte is capable of localizing to substantially all, or all, tissues of the plant. In certain embodiments, the endophyte is not localized to the root of a plant. In other cases, the endophyte is not localized to the photosynthetic tissues of the plant.
(108) Endophytes Capable of Altering the Metabolome, Epigenome, or Transcriptome of Plants
(109) The endophytes useful for the invention can also be classified according to the changes conferred upon the plant. For example, the endophyte can alter the hormone status or levels of hormone production in the plant, which in turn can affect many physiological parameters, including flowering time, water efficiency, apical dominance and/or lateral shoot branching, increase in root hair, and alteration in fruit ripening. The endophyte may also introduce other changes to the plant, including biochemical, metabolomic, proteomic, genomic, epigenomic and/or transcriptomic profiles of endophyte-associated plants can be compared with reference agricultural plants under the same conditions.
(110) Metabolomic differences between the plants can be detected using methods known in the art. For example, a biological sample (whole tissue, exudate, phloem sap, xylem sap, root exudate, etc.) from the endophyte-associated and reference agricultural plants can be analyzed essentially as described in Fiehn et al., (2000) Nature Biotechnol., 18, 1157-1161, or Roessner et al., (2001) Plant Cell, 13, 11-29. Such metabolomic methods can be used to detect differences in levels in hormone, nutrients, secondary metabolites, root exudates, phloem sap content, xylem sap content, heavy metal content, and the like. Such methods are also useful for detecting alterations in microbial content and status; for example, the presence and levels of bacterial/fungal signaling molecules (e.g., autoinducers and pheromones), which can indicate the status of group-based behavior of endophytes based on, for example, population of endophyte-associated and reference agricultural plants can also be performed to detect changes in expression of at least one transcript, or a set or network of genes upon endophyte association. Similarly, epigenetic changes can be detected using methylated DNA immunoprecipitation followed by high-throughput sequencing.
(111) Combinations of Endophytes
(112) Combinations of endophytes can be selected by any one or more of several criteria. In one embodiment, compatible endophytes are selected. As used herein, compatibility refers to endophyte populations that do not significantly interfere with the growth, propagation, and/or production of beneficial substances of the other. Incompatible endophyte populations can arise, for example, where one of the populations produces or secrets a compound that is toxic or deleterious to the growth of the other population(s). Incompatibility arising from production of deleterious compounds/agents can be detected using methods known in the art, and as described herein elsewhere. Similarly, the distinct populations can compete for limited resources in a way that makes co-existence difficult.
(113) In another embodiment, combinations are selected on the basis of compounds produced by each population of endophytes. For example, the first population is capable of producing siderophores, and another population is capable of producing anti-fungal compounds. In an embodiment, the first population of endophytes or endophytic components is capable of a function selected from the group consisting of auxin production, nitrogen fixation, and production of an antimicrobial compound, siderophore production, mineral phosphate solubilization, cellulase production, chitinase production, xylanase production, and acetoin production, carbon source utilization, and combinations thereof. In another embodiment, the second population of endophytes or endophytic component is capable of a function selected from the group consisting of auxin production, nitrogen fixation, production of an antimicrobial compound, siderophore production, mineral phosphate solubilization, cellulase production, chitinase production, xylanase production, and acetoin production, and combinations thereof. In still another embodiment, the first and second populations are capable of at least one different function.
(114) In still another embodiment, the combinations of endophytes are selected for their distinct localization in the plant after colonization. For example, the first population of endophytes or endophytic components can colonize, and in some cases preferentially colonize, the root tissue, while a second population can be selected on the basis of its preferential colonization of the aerial parts of the agricultural plant. Therefore, in an embodiment, the first population is capable of colonizing one or more of the tissues selected from the group consisting of a root, shoot, leaf, flower, and seed. In another embodiment, the second population is capable of colonizing one or more tissues selected from the group consisting of root, shoot, leaf, flower, and seed. In still another embodiment, the first and second populations are capable of colonizing a different tissue within the agricultural plant.
(115) In some embodiments, combinations of endophytes are selected for their ability to confer a benefit to the host plant at different points in the life cycle of said host plant. In one example, one endophyte can be selected to impart improved seedling vigor, and a second endophyte can be selected to improve soil nutrient acquisition by roots of the mature plant.
(116) In still another embodiment, combinations of endophytes are selected for their ability to confer one or more distinct fitness traits on the inoculated agricultural plant, either individually or in synergistic association with other endophytes. In another embodiment, one endophyte may induce the colonization of a second endophyte. Alternatively, two or more endophytes may induce the colonization of a third endophyte. For example, the first population of endophytes or endophytic components is selected on the basis that it confers significant increase in biomass, while the second population promotes increased drought tolerance on the inoculated agricultural plant. Therefore, in one embodiment, the first population is capable of conferring at least one trait selected from the group consisting of thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, enhanced soil water retention, or a combination thereof. In another embodiment, the second population is capable of conferring a trait selected from the group consisting of thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, and enhanced soil water retention. In still another embodiment, each of the first and second population is capable of conferring a different trait selected from the group consisting of thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, and enhanced soil water retention.
(117) The combinations of endophytes can also be selected based on combinations of the above criteria. For example, the first population of endophytes can be selected on the basis of the compound it produces (e.g., its ability to fix nitrogen, thus providing a potential nitrogen source to the plant), while the second population can be selected on the basis of its ability to confer increased resistance of the plant to a pathogen (e.g., a fungal pathogen).
(118) In some embodiments of the present invention, it is contemplated that combinations of endophytes can provide an increased benefit to the host plant, as compared to that conferred by a single endophyte, by virtue of additive effects. For example, one endophyte strain that induces a benefit in the host plant may induce such benefit equally well in a plant that is also colonized with a different endophyte strain that also induces the same benefit in the host plant. The host plant thus exhibits the same total benefit from the combination of different endophyte strains as the additive benefit to individual plants colonized with each individual endophyte of the combination. In one example, a plant is colonized with two different endophyte strains: one provides a 1 increase in biomass when associated with the plant, and the other provides a 2 increase in biomass when associated with a different plant. When both endophyte strains are associated with the same plant, that plant would experience a 3 (additive of 1+2 single effects) increase in auxin biomass. Additive effects are a surprising embodiment of the present invention, as non-compatibility of endophytes may result in a cancellation of the beneficial effects of both endophytes.
(119) In some embodiments of the present invention, it is contemplated that a combination of endophytes can provide an increased benefit to the host plant, as compared to that conferred by a single endophyte, by virtue of synergistic effects. For example, one endophyte strain that induces a benefit in the host plant may induce such benefit beyond additive effects in a plant that is also colonized with a different endophyte strain that also induces that benefit in the host plant. The host plant thus exhibits the greater total benefit from the combination of different endophyte strains than could be seen from the additive benefit of individual plants colonized with each individual endophyte of the combination. In one example, a plant is colonized with two different endophyte strains: one provides a 1 increase in biomass when associated with a plant, and the other provides a 2 increase in biomass when associated with a different plant. When both endophyte strains are associated with the same plant, that plant would experience a 5 (greater than an additive of 1+2 single effects) increase in biomass. Synergistic effects are a surprising embodiment of the present invention.
(120) Inoculation with Multiple Endophytes
(121) In another embodiment, the present invention contemplates methods of coating a plant element, e.g., a seed of a plant, with a plurality of endophytes, as well as synthetic compositions comprising a plurality of endophytes on and/or in the plant element. The methods according to this embodiment can be performed in a manner similar to those described herein for single endophyte coating. In one example, multiple endophytes can be prepared in a single preparation that is coated onto the plant element, e.g., a seed. The endophytes can be from a common origin (i.e., a same plant). Alternatively, the endophytes can be from different plants.
(122) Where multiple endophytes are coated onto a plant element, each endophyte can be a bacterium. In the alternative, each endophyte can be a fungus. In still another embodiment, a plurality of bacterial and fungal endophytes can be coated onto the surface of a plant element.
(123) Where a plurality of endophytes are coated onto the plant element, any or all of the endophytes may be capable of conferring a beneficial trait onto the host plant. In some cases, all of the endophytes are capable of conferring a beneficial trait onto the host plant. The trait conferred by each of the endophytes may be the same (e.g., both improve the host plant's tolerance to a particular biotic stress), or may be distinct (e.g., one improves the host plant's tolerance to drought, while another improves phosphate utilization). In other cases the conferred trait may be the result of interactions between the endophytes.
(124) In one embodiment, an agricultural plant is contacted with a formulation comprising at least two endophytic microbial entities. Specific examples of pairs of endophytic microbial entities that can be applied to an agricultural plant include, for example, a pair of endophytic microbes containing nucleic acid sequences that are each at least 97% identical to the nucleic acid sequence selected from the groups provided in Table 1, Table 2, Table 7 and Table 8.
(125) Isolation of Endophytes
(126) According to the present invention, endophytes are isolated from a plant element, e.g., a seed of a plant. Because endophytes are capable of living and/or residing within the plant, or portion of the plant (including the seed), the endophytic nature of a microbe can distinguished from surface associated microbes by its resistance to surface sterilization techniques. Therefore, in one embodiment, endophytes are isolated from plant elements after the surface of the plant element is sterilized by contacting with non-specific antimicrobial agents such as sodium hypochlorite, hydrogen peroxide, copper oxychloride, copper hydroxide, copper sulfate, chlorothalonil, cuprous oxide, streptomycin, copper ammonium carbonate, copper diammonia diacetate complex, copper octanoate, oxytetracycline, fosetyl-AL or chloropicrin, in an aqueous solution and also optionally including detergents such as SDS, triton X-100, tween 20, can be used. In addition, dried seeds can be soaked in organic solvents such as ethanol, for example 50%-90% ethanol. Antibacterial or antifungal agents (e.g., captan, maneb, thiram, fludioxonil, etc.), particularly those that do not penetrate into the plant element, can also be used. In general, plant elements are soaked in an aqueous solution or commercial formulation containing one or more of these compounds for 30 seconds to 12 hours in a plastic container. After surface sterilization, the plant element is removed from the antibacterial formulation and washed 3-5 times with sterile distilled water. In an alternative embodiment where the plant element is a seed, the seed coat can be removed under sterile conditions, and the microbes inside the seed isolated and characterized.
(127) Once surface-residing microbes are removed, the surviving microbes present in the plant element are generally considered endophytes. Such endophytes can be a bacterium or fungus, and can be isolated by homogenizing the surface sterilized seeds, and placing the homogenate under conditions allowing growth of the microbe. Therefore, the loss of microbe viability upon surface sterilization indicates that the microbes are almost exclusively located on the seed surface. In contrast, resistance of the microbe population to such plant element sterilization methods indicates an internal localization of the microbes. Alternatively, the presence of microbial DNA after surface sterilization with agents that cross-link or otherwise destroy DNA can be detected using sensitive detection methods such as PCR to establish the presence of the microbe within the plant element.
(128) Growth of Endophytes
(129) Viability of the microbe can be tested after plant element surface sterilization, or after removal of the seed coat, by homogenizing the plant element and placing the homogenate under conditions that promote growth of the microbe. In the alternative, the presence of microbes can be detected visually or microscopically if the microbes can form a colony that is visible by such inspection. Reagents are also available for the detection of microbes: the stain aniline blue can be used for detecting hyphae, other assays are known in the art.
(130) Endophytes may require special conditions to allow for growth in isolation. A number of different growth media can be used to grow the endophytes. Additional details of endophyte growth are described within the examples sections.
(131) Functional Attributes of Endophytes
(132) In some cases, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, may produce one or more compounds and/or have one or more activities, e.g., one or more of the following: production of a metabolite, production of a phytohormone such as auxin, production of acetoin, production of an antimicrobial compound, production of a siderophore, production of a cellulase, production of a pectinase, production of a chitinase, production of a xylanase, nitrogen fixation, or mineral phosphate solubilization. For example, an endophyte can produce a phytohormone selected from the group consisting of an auxin, a cytokinin, a gibberellin, ethylene, a brassinosteroid, and abscisic acid. In some embodiments, the endophyte produces auxin (e.g., indole-3-acetic acid (IAA)). Production of auxin can be assayed as described herein. Many of the microbes described herein are capable of producing the plant hormone auxin indole-3-acetic acid (IAA) when grown in culture. Auxin plays a key role in altering the physiology of the plant, including the extent of root growth. Therefore, in other embodiments, endophytes are disposed on the surface or within a tissue of the plant element in an amount effective to detectably increase production of auxin in the agricultural plant when compared with a reference agricultural plant. In some embodiments, the increased auxin production can be detected in a tissue type selected from the group consisting of the root, shoot, leaves, and flowers.
(133) In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a compound with antimicrobial properties. For example, the compound can have antibacterial properties, as determined by the growth assays provided herein. In some embodiments, the compound with antibacterial properties shows bacteriostatic or bactericidal activity against E. coli and/or Bacillus sp. In other embodiments, the endophyte produces a compound with antifungal properties, for example, fungicidal or fungistatic activity against S. cerevisiae and/or Rhizoctonia.
(134) In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, is capable of nitrogen fixation, and is thus capable of producing ammonium from atmospheric nitrogen. The ability of endophytes to fix nitrogen can be confirmed by testing for growth of the fungus in nitrogen-free growth media, for example, LGI media, as described herein.
(135) In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a compound that increases the solubility of mineral phosphate in the medium, i.e., mineral phosphate solubilization, for example, using growth assays known in the art. In some embodiments, the endophytes produce a compound that allows the bacterium to grow in growth media comprising Ca.sub.3HPO.sub.4 as the sole phosphate source.
(136) In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a siderophore. Siderophores are small high-affinity iron chelating agents secreted by microorganisms that increase the bioavailability of iron. Siderophore production by the endophytes can be detected, for example, using methods known in the art.
(137) In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a hydrolytic enzyme. For example, in some embodiments, an endophytes can produce a hydrolytic enzyme selected from the group consisting of a cellulase, a pectinase, a chitinase and a xylanase. Hydrolytic enzymes can be detected using the methods known in the art.
(138) Selection of Endophytes Conferring Beneficial Traits
(139) The present invention contemplates inoculation of plants with microbes. As described earlier, the microbes can be derived from many different plants species, from different parts of the plants, and from plants isolated across different environments. Once a microbe is isolated, it can be tested for its ability to confer a beneficial trait. Numerous tests can be performed both in vitro and in vivo to assess what benefits, if any, are conferred upon the plant. In one embodiment, a microbe is tested in vitro for an activity selected from the group consisting of: liberation of complexed phosphates, liberation of complexed iron (e.g., through secretion of siderophores), production of phytohormones, production of antibacterial compounds, production of antifungal compounds, production of insecticidal compounds, production of nematicidal compounds, production and/or secretion of ACC deaminase, production and/or secretion of acetoin, production and/or secretion of pectinase, production and/or secretion of cellulase, and production and/or secretion of RNAse. Exemplary in vitro methods for the above can be found in the Examples sections below.
(140) It is noted that the initial test for the activities listed above can also be performed using a mixture of microbes, for example, a community of microbes isolated from a single plant. A positive activity readout using such mixture can be followed with the isolation of individual microbes within that population and repeating the in vitro tests for the activities to isolate the microbe responsible for the particular activity. Once validated using a single microbe isolate, then the plant can be inoculated with a microbe, and the test performed in vivo, either in growth chamber or greenhouse conditions, and comparing with a control plant that was not inoculated with the microbe.
(141) Endophyte Preparations
(142) Also described herein is a preparation comprising one or more isolated modified endophytes described above. The preparation further comprises an agriculturally acceptable carrier, and the preparation comprises an amount of endophytes sufficient to improve an agronomic trait of the population of seeds. In one embodiment, the isolated endophyte is cultured, for example, on semi-synthetic or synthetic growth medium. In one embodiment, the endophyte is provided as a powder, for example, a lyophilized powder. In another embodiment, the endophyte is applied in suspension at a suitable concentration. The preparation of microbes can be an aqueous solution, an oil-in-water emulsion or water-in-oil emulsion containing a minimum concentration of a microbe. Microbes are present as live cells, viable cells, spores, or mycelia. Typically, the concentration is at least 10.sup.4 CFU/ml or spores/ml, for example at least 310.sup.4 CFU/mL or spores/ml, at least 10.sup.5 CFU/mL or spores/ml, at least 310.sup.5 CFU/mL or spores/ml, at least 10.sup.6 CFU/mL or spores/ml, at least 310.sup.6 CFU/mL or spores/ml, at least 10.sup.7 CFU/ml or spores/ml, at least 310.sup.7 CFU/mL or spores/ml, at least 10.sup.8 CFU/mL or spores/ml, 10.sup.9 CFU/mL or spores/ml, or more. In one embodiment, the preparation is a solution containing a microbe at a concentration between about 10.sup.5 CFU/mL or spores/ml and about 10.sup.9 CFU/mL or spores/ml. In another embodiment, the preparation contains a microbe at a concentration between about 10.sup.6 CFU/mL or spores/ml and about 10.sup.8 CFU/mL or spores/ml.
(143) The synthetic preparation can also contain any number of other components. In one embodiment, the synthetic preparation may contain growth media or constituents required for the growth and propagation of the microbe. In one embodiment, the growth medium is selected from the group provided in the table below.
(144) TABLE-US-00001 TABLE 100 Exemplary growth medium Microbe Type Media Organisms Bacteria Nutrient Peptone Agar Heterotrophic bacteria MacConkey Agar + myo-inositol + Klebsiella Sp. Carbenicillin J agar Bacillus sp. and other firmicutes N-poor Medium (LGT) Aerobic heterotrophic N2- fixing bacteria Yeast Mannitol Agar Rhizobium sp. King's B medium Pseudomonas sp. SC medium Fastidious bacteria R2A agar Oligotrophic bacteria Tryptic Soy Agar Heterotrophic bacteria Fungi Cornmeal agar Fungi Glucose-Yeast extract agar + Selective enumeration of tetracycline yeasts and molds. Potato-Dextrose agar (PDA) Yeasts and molds Potato-Dextrose broth (PDB) Yeast and molds Sabouraud Agar Yeasts, molds and aciduric microorganisms V8 Agar Fungi Malt Dextrose Agar Identification of yeasts and moulds Czapek's medium Fungi and Mold SPT agar Verticillium sp.
(145) The synthetic preparation can be of a defined pH range. In one embodiment, the pH of the preparation can be between pH 5.5-6.0, pH 5.75-6.25, pH 6.0-6.5, pH 6.25-6.75, pH 6.5-7.0, pH 6.75-7.25, and pH 7.0-7.5. The pH of the medium can be adjusted using any biologically compatible buffering agent.
(146) The synthetic preparation can also comprise a carrier, such as diatomaceous earth, clay, or chitin, which act to complex with chemical agents, such as control agents.
(147) The synthetic preparation can also comprise an adherent. Such agents are useful for combining the microbes of the invention with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or seed to maintain contact between the microbe and other agents with the plant or plant part. In one embodiment, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers. Other examples of adherent compositions that can be used in the synthetic preparation include those described in EP 0818135, CA 1229497, WO 2013090628, EP 0192342, WO 2008103422 and CA 1041788, each of which is incorporated by reference in its entirety.
(148) The synthetic preparation can also contain one or more reagents that promote internalization of the microbe into the plant, and can include any one of the following classes of compounds: a surfactant, an abrasive, an osmoticum, and a plant signaling molecule.
(149) The preparation can also contain a surfactant. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N (US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision). In one embodiment, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In another embodiment, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v.
(150) The synthetic preparation of a defined osmolality can also be used. In one embodiment, the synthetic preparation has an osmolality of less than about 100 mOsm, for example less than about 75 mOsm, less than about 50 mOsm, or less than about 25 mOsm. In another embodiment, the synthetic preparation has an osmolality of at least 250 mOsm, for example at least 300 mOsm, at least 400 mOsm, at least 500 mOsm, at least 600 mOsm, at least 700 mOsm, at least 800 mOsm, 900 mOsm or greater. The osmolality of the preparation can be adjusted by addition of an osmoticum: the osmoticum can be any commonly used osmoticum, and can selected from the group consisting of: mannitol, sorbitol, NaCl, KCl, CaCl.sub.2, MgSO.sub.4, sucrose, or any combination thereof.
(151) The endophyte can be obtained from growth in culture, for example, using semi-synthetic or synthetic growth medium. In addition, the microbe can be cultured on solid media, for example on petri dishes, scraped off and suspended into the preparation. Microbes at different growth phases can be used. For example, microbes at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used.
(152) For certain microbes that exist as mycelia or mycelia-like structures, pre-treatment of the microbes with enzymes (including, but not limited to, driselase, gluculase, cellulase, beta-glucanase, lysozyme, zymolyase) can be used to generate protoplasts in order to provide a suspension of microbes. After generation of protoplasts, the microbes can be allowed to partially regenerate the cell walls by leaving the protoplasts in a growth medium or solution with relatively high osmolarity for a short time (typically less than about 12 hours at room temperature) to prevent bursting of protoplasts.
(153) Detection and Quantitation of Endophytes and Other Microbes
(154) The presence of the endophyte or other microbes can be detected and its localization in or on the host plant (including the seed) can be determined using a number of different methodologies. The presence of the microbe in the embryo or endosperm, as well as its localization with respect to the plant cells, can be determined using methods known in the art, including immunofluorescence microscopy using microbe specific antibodies, or fluorescence in situ hybridization. The presence and quantity of other microbes can be established by the FISH, immunofluorescence and PCR methods using probes that are specific for the microbe. Alternatively, degenerate probes recognizing conserved sequences from many bacteria and/or fungi can be employed to amplify a region, after which the identity of the microbes present in the tested tissue/cell can be determined by sequencing.
(155) Therefore, in one embodiment, where the endophyte is coated onto the surface of a plant element of a first plant such that the endophyte is present at a higher level on the surface of the plant element than is present on the surface of an uncoated reference plant element, the level of the endophyte present on the surface of the uncoated reference plant element is determined by culturing microbes that are present on the surface of the plant element. In another embodiment, the level of the endophyte present on the surface of the uncoated reference plant element is determined by PCR.
(156) Uniformity of Seeds and Plants
(157) In another aspect, the seeds according to the present invention provide a substantially uniform population of seeds with a uniform endophyte composition. The uniform population of seeds can be of a predefined weight. For example, a substantially uniform population of seeds containing at least 100 g seeds, for example at least 1 kg seeds, at least 5 kg seeds, at least 10 kg seeds, can be provided by the method according to the present invention that containsas a whole productmore than 1%, for example more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, especially more than 50%, of the endophytic microorganism, i.e., the strain that is coated onto the surface of the seeds. According to a preferred embodiment, the present invention provides a marketable seed product containing at least 100 g seeds, for example, at least 1 kg seeds, for example at least 5 kg seeds, at least 10 kg seeds, whereinas a whole productmore than 50%, for example, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 99%, or 100% of the seeds contain the microbe, i.e., the inoculant strain. Each of the seeds can also contain a uniform number of microbes (for example, viable endophytes): for example, at least 50% of the seeds, for example at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or more of the seeds in the population can contain at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores or more, of the endophytic microorganism. In some embodiments, at least 50% of the seeds, for example at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or more of the seeds in the population contains a single endophyte or a plurality of endophytes at a concentration between about 100 CFU or spores and about 30,000 CFU or spores, between about 100 CFU or spores and about 300 CFU or spores, between about 100 CFU or spores and about 1,000 CFU or spores, between about 100 CFU or spores and about 3,000 CFU or spores, between about 100 CFU or spores and about 10,00 CFU or spores, between about 100 CFU or spores and about 30,000 CFU or spores, between about 300 CFU or spores and about 1,000 CFU or spores, between about 300 CFU or spores and about 3,000 CFU or spores, between about 300 CFU or spores and about 10,00 CFU or spores, between about 300 CFU or spores and about 30,000 CFU or spores, between about 1,000 CFU or spores and about 3,000 CFU or spores, between about 1,000 CFU or spores and about 10,00 CFU or spores, between about 1,000 CFU or spores and about 30,00 CFU or spores, between about 3,000 CFU or spores and about 10,000 CFU or spores, between about 3,000 CFU or spores and about 30,00 CFU or spores, or between about 10,000 CFU or spores and about 30,000 CFU or spores. The endophyte can also be quantitated using other means, for example, using quantitative PCR, to detect the total number of endophyte present on each seed.
(158) The uniformity of the microbes within the seed population can be measured in several different ways. In one embodiment, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population, contains a viable endophyte on its surface. In another embodiment, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population contain on its surface a threshold number of viable microbe that is at least 1 CFU or spore per seed, at least 10 CFU or spores per seed, for example, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, or more, of the microbe per seed. In some embodiments, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population contain on its surface a threshold number of viable microbe that is between 1 CFU or spore per seed and about 3,000 CFU or spores per seed, between 1 CFU or spore per seed and about 10 CFU or spores per seed, between 1 CFU or spore per seed and about 100 CFU or spores per seed, between 1 CFU or spore per seed and about 300 CFU or spores per seed, between 1 CFU or spore per seed and about 1,000 CFU or spores per seed, between 1 CFU or spore per seed and about 3,000 CFU or spores per seed, between about 10 CFU or spore per seed and about 100 CFU or spores per seed, between about 10 CFU or spore per seed and about 300 CFU or spores per seed, between about 10 CFU or spore per seed and about 1,000 CFU or spores per seed, between about 10 CFU or spore per seed and about 3,000 CFU or spores per seed, between about 100 CFU or spore per seed and about 300 CFU or spores per seed, between about 100 CFU or spore per seed and about 1,000 CFU or spores per seed, between about 100 CFU or spore per seed and about 3,000 CFU or spores per seed, between about 300 CFU or spore per seed and about 1,000 CFU or spores per seed, between about 300 CFU or spore per seed and about 3,000 CFU or spores per seed, or between about 1,000 CFU or spore per seed and about 3,000 CFU or spores per seed.
(159) In still another aspect, the present invention discloses a substantially uniform population of plants produced by growing the population of seeds described above. In one embodiment, at least 75%, at least 80%, at least 90%, at least 95% or more of the plants comprise in one or more tissues an effective amount of the endophyte or endophytes. In another embodiment, at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the plants comprise a microbe population that is substantially similar.
(160) In some cases, a substantial portion of the population of plants or seeds, for example, at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds in a population, is coated with an endophyte that is able to perform one of the following functions, including: to stimulate plant growth, grow on nitrogen-free media, solubilize phosphate, sequester iron, secrete RNAse, antagonize pathogens, catabolize the precursor of ethylene, produce auxin and acetoin/butanediol. In some cases, a substantial portion of the population of seeds, for example, at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds in a population, exhibits at least one of the endophyte community attributes listed in herein (e.g., total CFUs, presence of a taxa, absence of a taxa, spatial distribution, intercellular colonization, functional properties of endophytes; presence of monoclonal strain, presence of conserved subset of microbial plasmid repertoire, microbe isolated from habitat that is distinct from the location of seed production, etc.).
(161) Increased uniformity of microbes in plants or seeds can also be detected by measuring the presence of non-genomic nucleic acids present in the microbes. For examples, where the microbe that is inoculated into the plant is known to harbor a plasmid or episome, the presence of the plasmid or episome can be detected in individual plants or seeds by using conventional methods of nucleic acid detection. Therefore, in one embodiment, a substantial portion of the population of seeds, for example at least example at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds in a population, has a detectable presence of the microbial plasmid or episome.
(162) Increased uniformity of the microbes' epigenetic status can also be used to detect increased uniformity of a population of seeds or plants derived from such seeds. For example, where a microbe that has been inoculated by a plant is also present in the plant (for example, in a different tissue or portion of the plant), or where the introduced microbe is sufficiently similar to a microbe that is present in some of the plants (or portion of the plant, including seeds), it is still possible to distinguish between the inoculated microbe and the native microbe, for example, by distinguishing between the two microbe types on the basis of their epigenetic status. Therefore, in one embodiment, the epigenetic status is detected in microbes across individual seeds or the plants that grow from such seeds.
(163) It is also known that certain viruses are associated with endophytic fungi (such as the Curvularia thermal tolerance virus (CThTV) described in Mrquez, L. M., et al., (2007). Science 315: 513-515). Therefore, the presence and quantity of a virus can be used to measure uniformity of seeds or plants containing the endophyte. For example, where the inoculated microbe is known to be associated with a virus, the presence of that virus can be used as a surrogate indicator of uniformity. Therefore, in one embodiment, a substantial portion of the seeds, for example at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds, contain the virus. In other embodiments, where one or more of the endogenous microbes contain associated viruses which are not found in, and not compatible with the inoculated microbe, the loss (i.e., absence) of the virus can be used to measure uniformity of the seed population. As such, in another embodiment, a substantial portion of the seeds, for example at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds, do not contain the virus. In other cases, the genetic sequence of the virus can be used to measure the genetic similarity of the virus within a population. In one embodiment, a substantial proportion of the seeds, for example, at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the seeds contain the same virus, for example, as determined by sequence analysis.
(164) Such uniformity in microbial composition is unique and is extremely advantageous for high-tech and/or industrial agriculture. It allows significant standardization with respect to qualitative endophyte load of seed products. Suitable volumes or weights are those that are currently used for plant seeds (e.g., the at least 100 g, at least 1, 5 or 10 kg; but also 25 or more, 40 or more, 50 kg or more, even 100 kg or more, 500 kg or more, 1 ton or more, etc.). Suitable containers or packages are those traditionally used in plant seed commercialization: however, also other containers with more sophisticated storage capabilities (e.g., with microbiologically tight wrappings or with gas- or water-proof containments) can be used. The amount of endophytes (qualitatively and quantitatively) contained in the seeds or in the marketable seed product as a whole can be determined by standard techniques in microbiology readily available to any person skilled in the art of plant endophyte analysis.
(165) In some cases, a sub-population of agricultural seeds can be further selected on the basis of increased uniformity, for example, on the basis of uniformity of microbial population. For example, individual seeds of pools collected from individual cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields can be tested for uniformity of microbial density, and only those pools meeting specifications (e.g., at least 80% of tested seeds have minimum density, as determined by quantitative methods described elsewhere) are combined to provide the agricultural seed sub-population.
(166) The methods described herein can also comprise a validating step. The validating step can entail, for example, growing some seeds collected from the inoculated plants into mature agricultural plants, and testing those individual plants for uniformity. Such validating step can be performed on individual seeds collected from cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields, and tested as described above to identify pools meeting the required specifications.
(167) Agricultural Field
(168) In another aspect, described herein is an agricultural field, including a greenhouse, comprising the population of plants described above. In one embodiment, the agricultural field comprises at least 100 plants. In another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises an effective amount of the microbe. In another embodiment, the population occupies at least about 100 square feet of space, wherein at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the population comprises the microbe in reproductive tissue. In still another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises at least 10 CFUs or spores, 100 CFUs or spores, 1,000 CFUs or spores, 10,000 CFUs or spores or more of the microbe. In still another embodiment, the population occupies at least about 100 square feet of space, wherein at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the population comprises between about 10 CFU or spores and about 10,000 CFU or spores, between about 10 CFU or spores and about 100 CFU or spores, between about 10 CFU or spores and about 1,000 CFU or spores, between about 100 CFU or spores and about 1,000 CFU or spores, between about 100 CFU or spores and about 10,00 CFU or spores, or between about 1,000 CFU or spores and about 10,000 CFU or spores. In yet another embodiment, the population occupies at least about 100 square feet of space, wherein at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the population comprises a exogenous microbe (i.e., the endophyte) of monoclonal origin.
(169) Plants can be grown individually from the seeds coated with the endophytes to propagate the desired microbes in indoor or outdoor settings. An advantage of the present invention is that it allows multiple plants harboring endophytes to be grown under agricultural methods as a means of providing improved uniformity of microbe-derived benefits to farmers.
(170) Therefore, in another aspect, provided herein are indoor arrangements of populations (e.g., greenhouse) of plants generated from the methods of the present invention. Such arrangements can include at least a defined number of plants of the present invention, such as at least 1, at least 2, at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000 or more plants.
(171) Also provided herein are agricultural fields that contain population of plants generated from the seeds of the present invention. Agricultural fields can occupy as little as 100 square feet or less, or can occupy hundreds or thousands of acres. Area of field containing a population of microbe-associated plants can be measured in square feet, such as at least 100, 500, 1000, 5000, 10,000, 50,000 or greater than 50,000 square feet, or can be measured in acres, such as least 1, at least 2, at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000, between 10000 and 50000, at least 50000 or greater acres. The field can also be measured in hectares, for example at least 1, at least 2, at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000 or more hectares. Additionally, a field containing a population of microbe-associated plants can be characterized by the number of plants in the population, generally a field is at least two, such as at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000, between 10000 and 25000, at least 250000, between 25000 and 50000, at least 500000, between 50000 and 75000, at least 750000, between 75000 and 100000, at least 1000000 or more plants. A field is generally a contiguous area but may be separated by geographical features such as roads, waterways, buildings, fences, and the like known to those skilled in the art. Because the microbe-associated plants described herein benefit from an increased level of uniformity of germination and other characteristics, it is desirable to maximize the percentage of plants containing microbes. For example, at least 10% (e.g., between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, between 95% and 99%, at least 99% or more) of the plants contain the microbes.
(172) Endophytes Compatible with Agrichemicals
(173) In certain embodiments, the endophyte is selected on the basis of its compatibility with commonly used agrichemicals. As mentioned earlier, plants, particularly agricultural plants, can be treated with a vast array of agrichemicals, including fungicides, biocides (anti-bacterial agents), herbicides, insecticides, nematicides, rodenticides, fertilizers, and other agents.
(174) In some cases, it can be important for the endophyte to be compatible with agrichemicals, particularly those with fungicidal or antibacterial properties, in order to persist in the plant although, as mentioned earlier, there are many such fungicidal or antibacterial agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the endophyte. Therefore, where a systemic fungicide or antibacterial agent is used in the plant, compatibility of the endophyte to be inoculated with such agents will be an important criterion.
(175) In one embodiment, natural isolates of endophytes that are compatible with agrichemicals can be used to inoculate the plants according to the methods described herein. For example, fungal endophytes which are compatible with agriculturally employed fungicides can be isolated by plating a culture of the endophytes, on a petri dish containing an effective concentration of the fungicide, and isolating colonies of the endophyte that are compatible with the fungicide. In another embodiment, an endophyte that is compatible with a fungicide is used for the methods described herein. Fungicide compatible endophytes can also be isolated by selection on liquid medium. The culture of endophytes can be plated on petri dishes without any forms of mutagenesis; alternatively, the endophytes can be mutagenized using any means known in the art. For example, microbial cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethanesulfonate (EMS) prior to selection on fungicide containing media. Finally, where the mechanism of action of a particular fungicide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate an endophyte that is resilient against that particular fungicide. It is noted that the above-described methods can be used to isolate fungi that are compatible with both fungistatic and fungicidal compounds.
(176) It will also be appreciated by one skilled in the art that a plant may be exposed to multiple types of fungicides or antibacterial compounds, either simultaneously or in succession, for example at different stages of plant growth. Where the target plant is likely to be exposed to multiple fungicidal and/or antibacterial agents, an endophyte that is compatible with many or all of these agrichemicals can be used to inoculate the plant. An endophyte that is compatible with several fungicidal agents can be isolated, for example, by serial selection. An endophyte that is compatible with the first fungicidal agent is isolated as described above (with or without prior mutagenesis). A culture of the resulting endophyte can then be selected for the ability to grow on liquid or solid media containing the second antifungal compound (again, with or without prior mutagenesis). Colonies isolated from the second selection are then tested to confirm its compatibility to both antifungal compounds.
(177) Likewise, bacterial endophytes that are compatible to biocides (including herbicides such as glyphosate or antibacterial compounds, whether bacteriostatic or bactericidal) that are agriculturally employed can be isolated using methods similar to those described for isolating fungicide compatible endophytes. In one embodiment, mutagenesis of the microbial population can be performed prior to selection with an antibacterial agent. In another embodiment, selection is performed on the microbial population without prior mutagenesis. In still another embodiment, serial selection is performed on an endophyte: the endophyte is first selected for compatibility to a first antibacterial agent. The isolated compatible endophyte is then cultured and selected for compatibility to the second antibacterial agent. Any colony thus isolated is tested for compatibility to each, or both antibacterial agents to confirm compatibility with these two agents.
(178) Resistance, or compatibility with an antimicrobial agent can be determined by a number of means known in the art, including the comparison of the minimal inhibitory concentration (MIC) of the unmodified and modified endophyte. Therefore, in one embodiment, the present invention discloses an isolated modified endophyte derived from an endophyte isolated from within a plant or tissue thereof, wherein the endophyte is modified such that it exhibits at least 3 fold greater, for example, at least 5 fold greater, at least 10 fold greater, at least 20 fold greater, at least 30 fold greater or more MIC to an antimicrobial agent when compared with the unmodified endophyte.
(179) In one particular aspect, disclosed herein are bacterial endophytes with enhanced resistance to the herbicide glyphosate. In one embodiment, the bacterial endophyte has a doubling time in growth medium containing at least 1 mM glyphosate, for example, at least 2 mM glyphosate, at least 5 mM glyphosate, at least 10 mM glyphosate, at least 15 mM glyphosate or more, that is no more than 250%, for example, no more than 200%, no more than 175%, no more than 150%, or no more than 125%, of the doubling time of the endophyte in the same growth medium containing no glyphosate. In one particular embodiment, the bacterial endophyte has a doubling time in growth medium containing 5 mM glyphosate that is no more than 150% the doubling time of the endophyte in the same growth medium containing no glyphosate.
(180) In another embodiment, the bacterial endophyte has a doubling time in a plant tissue containing at least 10 ppm glyphosate, for example, at least 15 ppm glyphosate, at least 20 ppm glyphosate, at least 30 ppm glyphosate, at least 40 ppm glyphosate or more, that is no more than 250%, for example, no more than 200%, no more than 175%, no more than 150%, or no more than 125%, of the doubling time of the endophyte in a reference plant tissue containing no glyphosate. In one particular embodiment, the bacterial endophyte has a doubling time in a plant tissue containing 40 ppm glyphosate that is no more than 150% the doubling time of the endophyte in a reference plant tissue containing no glyphosate.
(181) The selection process described above can be repeated to identify isolates of the endophyte that are compatible with a multitude of antifungal or antibacterial agents.
(182) Candidate isolates can be tested to ensure that the selection for agrichemical compatibility did not result in loss of a desired microbial bioactivity. Isolates of the endophyte that are compatible with commonly employed fungicides can be selected as described above. The resulting compatible endophyte can be compared with the parental endophyte on plants in its ability to promote germination.
(183) The agrichemical compatible endophytes generated as described above can be detected in samples. For example, where a transgene was introduced to render the endophyte resistant to the agrichemical(s), the transgene can be used as a target gene for amplification and detection by PCR. In addition, where point mutations or deletions to a portion of a specific gene or a number of genes results in compatibility with the agrichemical(s), the unique point mutations can likewise be detected by PCR or other means known in the art. Such methods allow the detection of the microbe even if it is no longer viable. Thus, commodity plant products produced using the agrichemical compatible microbes described herein can readily be identified by employing these and related methods of nucleic acid detection.
(184) Improved Traits Conferred by the Endophyte
(185) The present invention contemplates the establishment of a microbial symbiont in a plant. In one embodiment, the microbial association results in a detectable change to the seed or plant. The detectable change can be an improvement in a number of agronomic traits (e.g., improved general health, increased response to biotic or abiotic stresses, or enhanced properties of the plant or a plant part, including fruits and grains). Alternatively, the detectable change can be a physiological or biological change that can be measured by methods known in the art. The detectable changes are described in more detail in the sections below. As used herein, an endophyte is considered to have conferred an improved agricultural trait whether or not the improved trait arose from the plant, the endophyte, or the concerted action between the plant and endophyte. Therefore, for example, whether a beneficial hormone or chemical is produced by the plant or endophyte, for purposes of the present invention, the endophyte will be considered to have conferred an improved agronomic trait upon the host plant.
(186) In some embodiments, plant-endophyte combinations confer an agronomic benefit in agricultural plants. In some embodiments, the agronomic trait is selected from the group consisting of altered oil content, altered protein content, altered seed carbohydrate composition, altered seed oil composition, and altered seed protein composition, chemical tolerance, cold tolerance, delayed senescence, disease resistance, drought tolerance, ear weight, growth improvement, health enhancement, heat tolerance, herbicide tolerance, herbivore resistance, improved nitrogen fixation, improved nitrogen utilization, improved root architecture, improved water use efficiency, increased biomass, increased root length, increased seed weight, increased shoot length, increased yield, increased yield under water-limited conditions, kernel mass, kernel moisture content, metal tolerance, number of ears, number of kernels per ear, number of pods, nutrition enhancement, pathogen resistance, pest resistance, photosynthetic capability improvement, salinity tolerance, stay-green, vigor improvement, increased dry weight of mature seeds, increased fresh weight of mature seeds, increased number of mature seeds per plant, increased chlorophyll content, increased number of pods per plant, increased length of pods per plant, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, and increased number of non-wilted leaves per plant, a detectable modulation in the level of a metabolite, a detectable modulation in the level of a transcript, and a detectable modulation in the proteome relative to a reference plant. In other embodiments, at least two agronomic traits are improved in the agricultural plant.
(187) For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, at least 100%, between 100% and 150%, at least 150%, between 150% and 200%, at least 200%, between 200% and 300%, or at least 300% or more, when compared with uninoculated plants grown under the same conditions.
(188) In some aspects, provided herein, are methods for producing a seed of a plant with a heritably altered trait. The trait of the plant can be altered without known genetic modification of the plant genome, and comprises the following steps. First, a preparation of an isolated endophyte that is exogenous to the seed of the plant is provided, and optionally processed to produce a microbial preparation. The microbial preparation is then contacted with the plant. The plants are then allowed to go to seed, and the seeds, which contain the endophytes on and/or in the seed are collected. The endophytes contained within the seed are viably incorporated into the seed.
(189) The method of the present invention can facilitate crop productivity by enhancing germination, seedling vigor and biomass in comparison with a non-treated control. Moreover, the introduction of the beneficial microorganisms to within the seed instead of by, e.g., seed coating, makes the endophytes less susceptible to environmental perturbation and more compatible with chemical seed coatings (e.g., pesticides and herbicides). Using endophyte colonized seeds, the plant growth and biomass increases are statistically similar to those obtained using conventional inoculation methods e.g., exogenous seed soaking and soil inoculation (that are more laborious and less practicable in certain circumstances).
(190) Improved General Health
(191) Also described herein are plants, and fields of plants, that are associated with beneficial endophytes, such that the overall fitness, productivity or health of the plant or a portion thereof, is maintained, increased and/or improved over a period of time. Improvement in overall plant health can be assessed using numerous physiological parameters including, but not limited to, height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, or any combination thereof. Improved plant health, or improved field health, can also be demonstrated through improved resistance or response to a given stress, either biotic or abiotic stress, or a combination of one or more abiotic stresses, as provided herein.
(192) Other Abiotic Stresses
(193) Disclosed herein are endophyte-associated plants with increased resistance to an abiotic stress. Exemplary abiotic stresses include, but are not limited to: drought, salt, high metal content, low nutrients, cold stress, and heat stress.
(194) Drought and Heat Tolerance
(195) When soil water is depleted or if water is not available during periods of drought, crop yields are restricted. Plant water deficit develops if transpiration from leaves exceeds the supply of water from the roots. The available water supply is related to the amount of water held in the soil and the ability of the plant to reach that water with its root system. Transpiration of water from leaves is linked to the fixation of carbon dioxide by photosynthesis through the stomata. The two processes are positively correlated so that high carbon dioxide influx through photosynthesis is closely linked to water loss by transpiration. As water transpires from the leaf, leaf water potential is reduced and the stomata tend to close in a hydraulic process limiting the amount of photosynthesis. Since crop yield is dependent on the fixation of carbon dioxide in photosynthesis, water uptake and transpiration are contributing factors to crop yield: Plants which are able to use less water to fix the same amount of carbon dioxide or which are able to function normally at a lower water potential have the potential to conduct more photosynthesis and thereby to produce more biomass and economic yield in many agricultural systems.
(196) In some cases, a plant resulting from seeds or other plant elements treated with a single endophyte strain or a plurality of endophytes can exhibit a physiological change, such as a compensation of the stress-induced reduction in photosynthetic activity (expressed, for example, as Fv/Fm) after exposure to heat shock or drought conditions as compared to a corresponding control, genetically identical plant that does not contain the endophytes grown in the same conditions. In some cases, the endophyte-associated plant as disclosed herein can exhibit an increased change in photosynthetic activity Fv(Fv/Fm) after heat-shock or drought stress treatment, for example 1, 2, 3, 4, 5, 6, 7 days or more after the heat-shock or drought stress treatment, or until photosynthesis ceases, as compared with corresponding control plant of similar developmental stage but not comprising the endophytes. For example, a plant having a plurality of the endophytes able to confer heat and/or drought-tolerance can exhibit a Fv/Fm of from about 0.1 to about 0.8 after exposure to heat-shock or drought stress or a Fv/Fm range of from about 0.03 to about 0.8 under one day, or 1, 2, 3, 4, 5, 6, 7, or over 7 days post heat-shock or drought stress treatment, or until photosynthesis ceases. In some embodiments, stress-induced reductions in photosynthetic activity can be compensated by at least about 0.25% (for example, at least about 0.5%, between 0.5% and 1%, at least about 1%, between 1% and 2%, at least about 2%, between 2% and 3%, at least about 3%, between 3% and 5%, at least about 5%, between 5% and 10%, at least about 8%, at least about 10%, between 10% and 15%, at least about 15%, between 15% and 20%, at least about 20%, between 20$ and 25%, at least about 25%, between 25% and 30%, at least about 30%, between 30% and 40%, at least about 40%, between 40% and 50%, at least about 50%, between 50% and 60%, at least about 60%, between 60% and 75%, at least about 75%; between 75% and 80%, at least about 80%, between 80% and 85%, at least about 85%, between 85% and 90%, at least about 90%, between 90% and 95%, at least about 95%, between 95% and 99%, at least about 99%, between 99% and 100%, or at least 100%) as compared to the photosynthetic activity decrease in a corresponding reference agricultural plant following heat shock conditions. Significance of the difference between endophyte-associated and reference agricultural plants can be established upon demonstrating statistical significance, for example at p<0.05 with an appropriate parametric or non-parametric statistic, e.g., Chi-square test, Student's t-test, Mann-Whitney test, or F-test based on the assumption or known facts that the endophyte-associated plant and reference agricultural plant have identical or near identical genomes (isoline comparison).
(197) In selecting traits for improving crops, a decrease in water use, without a change in growth would have particular merit in an irrigated agricultural system where the water input costs were high. An increase in growth without a corresponding jump in water use would have applicability to all agricultural systems. In many agricultural systems where water supply is not limiting, an increase in growth, even if it came at the expense of an increase in water use also increases yield. Water use efficiency (WUE) is a parameter often correlated with drought tolerance, and is the CO2 assimilation rate per water transpired by the plant. An increased water use efficiency of the plant relates in some cases to an increased fruit/kernel size or number. Therefore, in some embodiments, the plants described herein exhibit an increased water use efficiency when compared with a reference agricultural plant grown under the same conditions. For example, the plants grown from the plant elements comprising the plurality of endophytes can have at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100% higher WUE than a reference agricultural plant grown under the same conditions. Such an increase in WUE can occur under conditions without water deficit, or under conditions of water to deficit, for example, when the soil water content is less than or equal to 60% of water saturated soil, for example, less than or equal to 50%, less than or equal to 40%, less than or equal to 30%, less than or equal to 20%, less than or equal to 10% of water saturated soil on a weight basis. In a related embodiment, the plant comprising the plurality of endophytes can have at least. 10% higher relative water content (RWC), for example, at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100% higher RWC than a reference agricultural plant grown under the same conditions.
(198) In some embodiments, the plants comprise a single endophyte strain or a plurality of endophytes able to increase heat and/or drought-tolerance in sufficient quantity, such that increased growth or improved recovery from wilting under conditions of heat or drought stress is observed. For example, a plurality of endophyte populations described herein can be present in sufficient quantity in a plant, resulting in increased growth as compared to a plant that does not contain endophytes, when grown under drought conditions or heat shock conditions, or following such conditions. Increased heat and/or drought tolerance can be assessed with physiological parameters including, but not limited to, increased height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, wilt recovery, turgor pressure, or any combination thereof, as compared to a reference agricultural plant grown under similar conditions. For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(199) In various embodiments, a a single endophyte strain or plurality of endophytes introduced into altered seed microbiota can confer in the resulting plant thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased protein content, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, enhanced soil water retention, or a combination thereof. A difference between the endophyte-associated plant and a reference agricultural plant can also be measured using other methods known in the art.
(200) Salt Stress
(201) In other embodiments, a a single endophyte strain or plurality of endophytes able to confer increased tolerance to salinity stress can be introduced into plants. The resulting plants comprising endophytes can exhibit increased resistance to salt stress, whether measured in terms of survival under saline conditions, or overall growth during, or following salt stress. The physiological parameters of plant health recited above, including height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, or any combination thereof, can be used to measure growth, and compared with the growth rate of reference agricultural plants (e.g., isogenic plants without the endophytes) grown under identical conditions. For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(202) In other instances, endophyte-associated plants and reference agricultural plants can be grown in soil or growth media containing different concentration of sodium to establish the inhibitory concentration of sodium (expressed, for example, as the concentration in which growth of the plant is inhibited by 50% when compared with plants grown under no sodium stress). Therefore, in another embodiment, a plant resulting from seeds containing an endophyte able to confer salt tolerance described herein exhibits an increase in the inhibitory sodium concentration by at least 10 mM, for example at least 15 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or more, when compared with the reference agricultural plants.
(203) High Metal Content
(204) Plants are sessile organisms and therefore must contend with the environment in which they are placed. While plants have adapted many mechanisms to deal with chemicals and substances that may be deleterious to their health, heavy metals represent a class of toxins which are highly relevant for plant growth and agriculture. Plants use a number of mechanisms to cope with toxic levels of heavy metals (for example, nickel, cadmium, lead, mercury, arsenic, or aluminum) in the soil, including excretion and internal sequestration. For agricultural purposes, it is important to have plants that are able to tolerate otherwise hostile conditions, for example soils containing elevated levels of toxic heavy metals. Endophytes that are able to confer increased heavy metal tolerance may do so by enhancing sequestration of the metal in certain compartments. Use of such endophytes in a plant would allow the development of novel plant-endophyte combinations for purposes of environmental remediation (also known as phytoremediation). Therefore, in one embodiment, the plant containing the endophyte able to confer increased metal tolerance exhibits a difference in a physiological parameter that is at least about 5% greater, for example at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80%, at least about 80%, at least about 90%, or at least 100%, at least about 200%, at least about 300%, at least about 400% or greater than a reference agricultural plant grown under the same heavy metal concentration in the soil.
(205) Alternatively, the inhibitory concentration of the heavy metal can be determined for the endophyte-associated plant and compared with a reference agricultural plant under the same conditions. Therefore, in one embodiment, the plants resulting from seeds containing an endophyte able to confer heavy metal tolerance described herein exhibit an increase in the inhibitory sodium concentration by at least 0.1 mM, for example at least 0.3 mM, at least 0.5 mM, at least 1 mM, at least 2 mM, at least 5 mM, at least 10 mM, at least 15 mM, at least 20 mM, at least 30 mM, at least 50 mM or more, when compared with the reference agricultural plants.
(206) Finally, plants inoculated with endophytes that are able to confer increased metal tolerance exhibits an increase in overall metal accumulation by at least 10%, for example at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, at least 150%, at least 200%, at least 300% or more, when compared with uninoculated plants grown under the same conditions.
(207) Low Nutrient Stress
(208) A single endophyte strain or a plurality of endophytes described herein may also confer to the plant an increased ability to grow in nutrient limiting conditions, for example by solubilizing or otherwise making available to the plants macronutrients or micronutrients that are complexed, insoluble, or otherwise in an unavailable form. In some embodiments, a plant is inoculated with a plurality of endophytes that confer increased ability to liberate and/or otherwise provide to the plant with nutrients selected from the group consisting of phosphate, nitrogen, potassium, iron, manganese, calcium, molybdenum, vitamins, or other micronutrients. Such a plant can exhibit increased growth in soil comprising limiting amounts of such nutrients when compared with reference agricultural plant. Differences between the endophyte-associated plant and reference agricultural plant can be measured by comparing the biomass of the two plant types grown under limiting conditions, or by measuring the physical parameters described above. Therefore, in some embodiments, the plant comprising endophytes shows increased tolerance to nutrient limiting conditions as compared to a reference agricultural plant grown under the same nutrient limited concentration in the soil, as measured for example by increased biomass or seed yield of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions. In other embodiments, the plant containing the plurality of endophytes is able to grown under nutrient stress conditions while exhibiting no difference in the physiological parameter compared to a plant that is grown without nutrient stress. In some embodiments, such a plant will exhibit no difference in the physiological parameter when grown with 2-5% less nitrogen than average cultivation practices on normal agricultural land, for example, at least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, or between 75% and 100%, less nitrogen, when compared with crop plants grown under normal conditions during an average growing season. In some embodiments, the microbe capable of providing nitrogen-stress tolerance to a plant is diazotrophic. In other embodiments, the microbe capable of providing nitrogen-stress tolerance to a plant is non-diazotrophic.
(209) Cold Stress
(210) In some cases, endophytes can confer to the plant the ability to tolerate cold stress. Many known methods exist for the measurement of a plant's tolerance to cold stress (as reviewed, for example, in Thomashow (2001) Plant Physiol. 125: 89-93, and Gilmour et al. (2000) Plant Physiol. 124: 1854-1865, both of which are incorporated herein by reference in their entirety). As used herein, cold stress refers to both the stress induced by chilling (0 C.-15 C.) and freezing (<0 C.). Some cultivars of agricultural plants can be particularly sensitive to cold stress, but cold tolerance traits may be multigenic, making the breeding process difficult. Endophytes able to confer cold tolerance would potentially reduce the damage suffered by farmers on an annual basis. Improved response to cold stress can be measured by survival of plants, the amount of necrosis of parts of the plant, or a change in crop yield loss, as well as the physiological parameters used in other examples. Therefore, in one embodiment, the plant containing the endophyte able to confer increased cold tolerance exhibits a difference in a physiological parameter that is at least about 5% greater, for example at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80%, at least about 80%, at least about 90%, or at least 100%, at least about 200%, at least about 300%, at least about 400% or greater than a reference agricultural plant grown under the same conditions of cold stress.
(211) Biotic Stress
(212) In other embodiments, a single endophyte strain or plurality of endophytes protects the plant from a biotic stress, for example, insect infestation, nematode infestation, complex infection, fungal infection, oomycete infection, protozoal infection, viral infection, and herbivore grazing, or a combination thereof. For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(213) Insect Herbivory
(214) There are an abundance of insect pest species that can infect or infest a wide variety of plants. Pest infestation can lead to significant damage. Insect pests that infest plant species are particularly problematic in agriculture as they can cause serious damage to crops and significantly reduce plant yields. A wide variety of different types of plant are susceptible to pest infestation including commercial crops such as cotton, soybean, wheat, barley, and corn.
(215) In some embodiments, endophytes described herein confer upon the host plant the ability to repel insect herbivores. In other cases, the endophytes may produce, or induce the production in the plant of, compounds which are insecticidal or insect repellant. The insect may be any one of the common pathogenic insects affecting plants, particularly agricultural plants. Examples include, but are not limited to: Leptinotarsa spp. (e.g., L. decemlineata (Colorado potato beetle), L. juncta (false potato beetle), or L. texana (Texan false potato beetle)); Nilaparvata spp. (e.g., N. lugens (brown planthopper)); Laode/phax spp. (e.g., L. striatellus (small brown planthopper)); Nephotettix spp. (e.g., N. virescens or N. cincticeps (green leafhopper), or N. nigropictus (rice leafhopper)); Sogatella spp. (e.g., S. furcifera (white-backed planthopper)); Chilo spp. (e.g., C. suppressalis (rice striped stem borer), C. auricilius (gold-fringed stem borer), or C. polychrysus (dark-headed stem borer)); Sesamia spp. (e.g., S. inferens (pink rice borer)); Tryporyza spp. (e.g., T. innotata (white rice borer), or T. incertulas (yellow rice borer)); Anthonomus spp. (e.g., A. grandis (boll weevil)); Phaedon spp. (e.g., P. cochleariae (mustard leaf beetle)); Epilachna spp. (e.g., E. varivetis (Mexican bean beetle)); Tribolium spp. (e.g., T. castaneum (red floor beetle)); Diabrotica spp. (e.g., D. virgifera. (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm), D. virgifera zeae (Mexican corn rootworm); Ostrinia spp. (e.g., O. nubilalis (European corn borer)); Anaphothrips spp. (e.g., A. obscrurus (grass thrips)); Pectinophora spp. (e.g., P. gossypiella (pink bollworm)); Heliothis spp. (e.g., H. virescens (tobacco budworm)); Trialeurodes spp. (e.g., T. abutiloneus (banded-winged whitefly) T. vaporariorum (greenhouse whitefly)); Bemisia spp. (e.g., B. argentifolii (silverleaf whitefly)); Aphis spp. (e.g., A. gossypii (cotton aphid)); Lygus spp. (e.g., L. lineolaris (tarnished plant bug) or L. hesperus (western tarnished plant bug)); Euschistus spp. (e.g., E. conspersus (consperse stink bug)); Chlorochroa spp. (e.g., C. sayi (Say stinkbug)); Nezara spp. (e.g., N. viridula (southern green stinkbug)); Thrips spp. (e.g., T. tabaci (onion thrips)); Frankliniella spp. (e.g., F. fusca (tobacco thrips), or F. occidentalis (western flower thrips)); Acheta spp. (e.g., A. domesticus (house cricket)); Myzus spp. (e.g., M. persicae (green peach aphid)); Macrosiphum spp. (e.g., M. euphorbiae (potato aphid)); Blissus spp. (e.g., B. leucopterus (chinch bug)); Acrostemum spp. (e.g., A. hilare (green stink bug)); Chilotraea spp. (e.g., C. polychrysa (rice stalk borer)); Lissorhoptrus spp. (e.g., L. oryzophilus (rice water weevil)); Rhopalosiphum spp. (e.g., R. maidis (corn leaf aphid)); Anuraphis spp. (e.g., A. maidiradicis (corn root aphid)), and combinations thereof.
(216) The endophyte-associated plant can be tested for its ability to resist, or otherwise repel, pathogenic insects by measuring, for example, insect load, overall plant biomass, biomass of the fruit or grain, percentage of intact leaves, or other physiological parameters described herein, and comparing with a reference agricultural plant. In some embodiments, the endophyte-associated plant exhibits increased biomass as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, endophyte-associated plants). In other embodiments, the endophyte-associated plant exhibits increased fruit or grain yield as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, endophyte-associated plants). In any of the above, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(217) Nematodes
(218) Nematodes are microscopic roundworms that feed on the roots, fluids, leaves and stems of more than 2,000 row crops, vegetables, fruits, and ornamental plants, causing an estimated $100 billion crop loss worldwide and accounting for 13% of global crop losses due to disease. A variety of parasitic nematode species infect crop plants, including root-knot nematodes (RKN), cyst- and lesion-forming nematodes. Root-knot nematodes, which are characterized by causing root gall formation at feeding sites, have a relatively broad host range and are therefore parasitic on a large number of crop species. The cyst- and lesion-forming nematode species have a more limited host range, but still cause considerable losses in susceptible crops.
(219) Signs of nematode damage include stunting and yellowing of leaves, and wilting of the plants during hot periods. Nematode infestation, however, can cause significant yield losses without any obvious above-ground disease symptoms. The primary causes of yield reduction are due to underground root damage. Roots infected by SCN are dwarfed or stunted. Nematode infestation also can decrease the number of nitrogen-fixing nodules on the roots, and may make the roots more susceptible to attacks by other soil-borne plant nematodes.
(220) In some embodiments, the endophyte-associated plant has an increased resistance to a nematode when compared with a reference agricultural plant. As before with insect herbivores, biomass of the plant or a portion of the plant, or any of the other physiological parameters mentioned elsewhere, can be compared with the reference agricultural plant grown under the same conditions. Particularly useful measurements include overall plant biomass, biomass and/or size of the fruit or grain, and root biomass. In some embodiments, the endophyte-associated plant exhibits increased biomass as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, under conditions of nematode challenge). In other embodiments, the endophyte-associated plant exhibits increased root biomass as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, under conditions of nematode challenge). In still another embodiment, the endophyte-associated plant exhibits increased fruit or grain yield as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, under conditions of nematode challenge). In any of the above, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(221) Fungal Pathogens
(222) Fungal diseases are responsible for yearly losses of over $10 Billion on agricultural crops in the US, represent 42% of global crop losses due to disease, and are caused by a large variety of biologically diverse pathogens. Different strategies have traditionally been used to control them. Resistance traits have been bred into agriculturally important varieties, thus providing various levels of resistance against either a narrow range of pathogen isolates or races, or against a broader range. However, this involves the long and labor intensive process of introducing desirable traits into commercial lines by genetic crosses and, due to the risk of pests evolving to overcome natural plant resistance, a constant effort to breed new resistance traits into commercial lines is required. Alternatively, fungal diseases have been controlled by the application of chemical fungicides. This strategy usually results in efficient control, but is also associated with the possible development of resistant pathogens and can be associated with a negative impact on the environment. Moreover, in certain crops, such as barley and wheat, the control of fungal pathogens by chemical fungicides is difficult or impractical.
(223) The present invention contemplates the use a single endophyte strain or of a plurality of endophytes that is able to confer resistance to fungal pathogens to the host plant. Increased resistance to fungal inoculation can be measured, for example, using any of the physiological parameters presented above, by comparing with reference agricultural plants. In some embodiments, the endophyte-associated plant exhibits increased biomass and/or less pronounced disease symptoms as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, infected with the fungal pathogen). In still another embodiment, the endophyte-associated plant exhibits increased fruit or grain yield as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, infected with the fungal pathogen). In other embodiments, the endophyte-associated plant exhibits decreased hyphal growth as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, infected with the fungal pathogen). In any of the above, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(224) Viral Pathogens
(225) Plant viruses are estimated to account for 18% of global crop losses due to disease. There are numerous examples of viral pathogens affecting agricultural productivity. Examples include the American wheat striate mosaic virus (AWSMV) (wheat striate mosaic), Barley stripe mosaic virus (BSMV), Barley yellow dwarf virus (BYDV), Brome mosaic virus (BMV), Cereal chlorotic mottle virus (CCMV), Corn chlorotic vein banding virus (CCVBV), Brazilian maize mosaic virus, Corn lethal necrosis Virus complex from Maize chlorotic mottle virus, (MCMV), Maize dwarf mosaic virus (MDMV), A or B Wheat streak mosaic virus (WSMV), Cucumber mosaic virus (CMV), Cynodon chlorotic streak virus (CCSV), Johnsongrass mosaic virus (JGMV), Maize bushy stunt Mycoplasma-like organism (MLO) associated virus, Maize chlorotic dwarf Maize chlorotic dwarf virus (MCDV), Maize chlorotic mottle virus (MCMV), Maize dwarf mosaic virus (MDMV), strains A, D, E and F, Maize leaf fleck virus (MLFV), Maize line virus (MLV), Maize mosaic (corn leaf stripe, Maize mosaic virus (MMV), enanismo rayado), Maize mottle and chlorotic stunt virus, Maize pellucid ringspot virus (MPRV), Maize raya gruesa virus (MRGV), Maize rayado fino (fine striping) virus (MRFV), Maize red stripe virus (MRSV), Maize ring mottle virus (MRMV), Maize rio cuarto virus (MRCV), Maize rough dwarf virus (MRDV), Cereal tillering disease virus, Maize sterile stunt virus, barley yellow striate virus, Maize streak virus (MSV), Maize stripe virus, Maize chloroticstripe virus, maize hoja blanca virus, Maize stunting virus; Maize tassel abortion virus (MTAV), Maize vein enation virus (MVEV), Maize wallaby ear virus (MWEV), Maize white leaf virus, Maize white line mosaic virus (MWLMV), Millet red leaf virus (MRLV), Northern cereal mosaic virus (NCMV), Oat pseudorosette virus, (zakuklivanie), Oat sterile dwarf virus (OSDV), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), Sorghum mosaic virus (SrMV), Sugarcane mosaic virus (SCMV) strains H, I and M, Sugarcane Fiji disease virus (FDV), Sugarcane mosaic virus (SCMV) strains A, B, D, E, SC, BC, Sabi and MB (formerly MDMV-B), and Wheat spot mosaic virus (WSMV). In one embodiment, the endophyte-associated plant provides protection against viral pathogens such that there is at least 5% greater biomass, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more biomass, than the reference agricultural plant grown under the same conditions. In still another embodiment, the endophyte-associated plant exhibits at least 5% greater fruit or grain yield, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more fruit or grain yield when challenged with a virus, as compared to a reference agricultural plant grown under the same conditions. In yet another embodiment, the endophyte-associated plant exhibits at least 5% lower viral titer, for example, at least 10%, at least 15%; at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% lower viral titer when challenged with a virus, as compared to a reference agricultural plant grown under the same conditions.
(226) Bacterial Pathogens
(227) Likewise, bacterial pathogens are a significant problem negatively affecting agricultural productivity and accounting for 27% of global crop losses due to plant disease. In one embodiment, the endophyte-associated plant described herein provides protection against bacterial pathogens such that there is at least 5% greater biomass, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more biomass, than the reference agricultural plant grown under the same conditions. In still another embodiment, the endophyte-associated plant exhibits at least 5% greater fruit or grain yield, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more fruit or grain yield when challenged with a bacterial pathogen, than the reference agricultural plant grown under the same conditions. In yet another embodiment, the endophyte-associated plant exhibits at least 5% lower bacterial count, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% lower bacterial count when challenged with a bacteria, as compared to a reference agricultural plant grown under the same conditions.
(228) Yield and Biomass Improvement
(229) In other embodiments, the improved trait can be an increase in overall biomass of the plant or a part of the plant, including its fruit or seed. In some embodiments, a single endophyte strain or a plurality of endophytes is disposed on the surface or within a tissue of the plant element in an amount effective to increase the biomass of the plant, or a part or tissue of the plant grown from the plant element. The increased biomass is useful in the production of commodity products derived from the plant. Such commodity products include an animal feed, a fish fodder, a cereal product, a processed human-food product, a sugar or an alcohol. Such products may be a fermentation product or a fermentable product, one such exemplary product is a biofuel. The increase in biomass can occur in a part of the plant (e.g., the root tissue, shoots, leaves, etc.), or can be an increase in overall biomass. Increased biomass production, such an increase meaning at at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions. Such increase in overall biomass can be under relatively stress-free conditions. In other cases, the increase in biomass can be in plants grown under any number of abiotic or biotic stresses, including drought stress, salt stress, heat stress, cold stress, low nutrient stress, nematode stress, insect herbivory stress, fungal pathogen stress, bacterial pathogen stress, and viral pathogen stress. In some embodiments, a plurality of endophytes is disposed in an amount effective to increase root biomass by at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions, when compared with a reference agricultural plant. In other cases, a plurality of endophytes is disposed on the plant element in an amount effective to increase the average biomass of the fruit or cob from the resulting plant at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
(230) Increase in Plant Growth Hormones
(231) Many of the microbes described herein are capable of producing the plant hormone auxin indole-3-acetic acid (IAA) when grown in culture. Auxin may play a key role in altering the physiology of the plant, including the extent of root growth. Therefore, in other embodiments, a single endophyte strain or a plurality of endophytes is disposed on the surface or within a tissue of the plant element in an amount effective to detectably induce production of auxin in the agricultural plant. For example, the increase in auxin production can be at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more, when compared with a reference agricultural plant. In some embodiments, the increased auxin production can be detected in a tissue type selected from the group consisting of the root, shoot, leaves, and flowers.
(232) Improvement of Other Traits.
(233) In other embodiments, a single endophyte strain or a plurality of endophytes can confer other beneficial traits to the plant. Improved traits can include an improved nutritional content of the plant or plant element used for human consumption. In some embodiments, the endophyte-associated plant is able to produce a detectable change in the content of at least one nutrient. Examples of such nutrients include amino acid, protein, oil (including any one of Oleic acid, Linoleic acid, Alpha-linoleic acid, Saturated fatty acids, Palmitic acid, Stearic acid and Trans fats), carbohydrate (including sugars such as sucrose, glucose and fructose, starch, or dietary fiber), Vitamin A, Thiamine (vit. B1), Riboflavin (vit. B2), Niacin (vit. B3), Pantothenic acid (B5), Vitamin B6, Folate (vit. B9), Choline, Vitamin C, Vitamin E, Vitamin K, Calcium, Iron, Magnesium, Manganese, Phosphorus, Potassium, Sodium, Zinc. In some embodiments, the endophyte-associated plant or part thereof contains at least one increased nutrient when compared with reference agricultural plants.
(234) In other cases, the improved trait can include reduced content of a harmful or undesirable substance when compared with reference agricultural plants. Such compounds include those which are harmful when ingested in large quantities or are bitter tasting (for example, oxalic acid, amygdalin, certain alkaloids such as solanine, caffeine, nicotine, quinine and morphine, tannins, cyanide). As such, in some embodiments, the endophyte-associated plant or part thereof contains less of the undesirable substance when compared with reference agricultural plant. In a related embodiment, the improved trait can include improved taste of the plant or a part of the plant, including the fruit or seed. In a related embodiment, the improved trait can include reduction of undesirable compounds produced by other endophytes in plants, such as degradation of Fusarium-produced deoxynivalenol (also known as vomitoxin and a virulence factor involved in Fusarium head blight of maize and wheat) in a part of the plant, including the fruit or seed.
(235) The endophyte-associated plant can also have an altered hormone status or altered levels of hormone production when compared with a reference agricultural plant. An alteration in hormonal status may affect many physiological parameters, including flowering time, water efficiency, apical dominance and/or lateral shoot branching, increase in root hair, and alteration in fruit ripening.
(236) The association between the endophytes and the plant can also be detected using other methods known in the art. For example, the biochemical, genomic, epigenomic, transcriptomic, metabolomics, and/or proteomic profiles of endophyte-associated plants can be compared with reference agricultural plants under the same conditions.
(237) Transcriptome analysis of endophyte-associated and reference agricultural plants can also be performed to detect changes in expression of at least one transcript, or a set or network of genes upon endophyte association. Similarly, epigenetic changes can be detected using methylated DNA immunoprecipitation followed by high-throughput sequencing.
(238) Metabolomic or proteomic differences between the plants can be detected using methods known in the art. The metabolites, proteins, or other compounds described herein can be detected using any suitable method including, but not limited to gel electrophoresis, liquid and gas phase chromatography, either alone or coupled to mass spectrometry, NMR, immunoassays (enzyme-linked immunosorbent assays (ELISA)), chemical assays, spectroscopy and the like. In some embodiments, commercial systems for chromatography and NMR analysis are utilized. Such metabolomic methods can be used to detect differences in levels in hormone, nutrients, secondary metabolites, root exudates, phloem sap content, xylem sap content, heavy metal content, and the like. Such methods are also useful for detecting alterations in endophyte content and status; for example, the presence and levels of signaling molecules (e.g., autoinducers and pheromones), which can indicate the status of group-based behavior of endophytes based on, for example, population density. In some embodiments, a biological sample (whole tissue, exudate, phloem sap, xylem sap, root exudate, etc.) from endophyte-associated and reference agricultural plants can be analyzed essentially as known in the art.
(239) In some embodiments, metabolites in plants can be modulated by making synthetic combinations of plants with pluralities of endophytes. For example, a plurality of endophytes can cause a detectable modulation (e.g., an increase or decrease) in the level of various metabolites, e.g., indole-3-carboxylic acid, trans-zeatin, abscisic acid, phaseic acid, indole-3-acetic acid, indole-3-butyric acid, indole-3-acrylic acid, jasmonic acid, jasmonic acid methyl ester, dihydrophaseic acid, gibberellin A3, salicylic acid, upon colonization of a plant.
(240) In some embodiments, a single endophyte strain or a plurality of endophytes modulates the level of the metabolite directly (e.g., the microbes produces the metabolite, resulting in an overall increase in the level of the metabolite found in the plant). In other cases, the agricultural plant, as a result of the association with the plurality of endophytes, exhibits a modulated level of the metabolite (e.g., the plant reduces the expression of a biosynthetic enzyme responsible for production of the metabolite as a result of the microbe inoculation). In still other cases, the modulation in the level of the metabolite is a consequence of the activity of both the microbe and the plant (e.g., the plant produces increased amounts of the metabolite when compared with a reference agricultural plant, and the endophyte also produces the metabolite). Therefore, as used herein, a modulation in the level of a metabolite can be an alteration in the metabolite level through the actions of the microbe and/or the inoculated plant.
(241) The levels of a metabolite can be measured in an agricultural plant, and compared with the levels of the metabolite in a reference agricultural plant, and grown under the same conditions as the inoculated plant. The uninoculated plant that is used as a reference agricultural plant is a plant that has not been applied with a formulation with the plurality of endophytes (e.g., a formulation comprising a plurality of populations of purified endophytes). The uninoculated plant used as the reference agricultural plant is generally the same species and cultivar as, and is isogenic to, the inoculated plant.
(242) The metabolite whose levels are modulated (e.g., increased or decreased) in the endophyte-associated plant may serve as a primary nutrient (i.e., it provides nutrition for the humans and/or animals who consume the plant, plant tissue, or the commodity plant product derived therefrom, including, but not limited to, a sugar, a starch, a carbohydrate, a protein, an oil, a fatty acid, or a vitamin). The metabolite can be a compound that is important for plant growth, development or homeostasis (for example, a phytohormone such as an auxin, cytokinin, gibberellin, a brassinosteroid, ethylene, or abscisic acid, a signaling molecule, or an antioxidant). In other embodiments, the metabolite can have other functions. For example, in some embodiments, a metabolite can have bacteriostatic, bactericidal, fungistatic, fungicidal or antiviral properties. In other embodiments, the metabolite can have insect-repelling, insecticidal, nematode-repelling, or nematicidal properties. In still other embodiments, the metabolite can serve a role in protecting the plant from stresses, may help improve plant vigor or the general health of the plant. In yet another embodiment, the metabolite can be a useful compound for industrial production. For example, the metabolite may itself be a useful compound that is extracted for industrial use, or serve as an intermediate for the synthesis of other compounds used in industry. In a particular embodiment, the level of the metabolite is increased within the agricultural plant or a portion thereof such that it is present at a concentration of at least 0.1 ug/g dry weight, for example, at least 0.3 ug/g dry weight, between 0.3 ug/g and 1.0 ug/g dry weight, at least 1.0 ug/g dry weight, between 1.0 ug/g and 3.0 ug/g dry weight, at least 3.0 ug/g dry weight, between 3.0 ug/g and 10 ug/g dry weight, at least 10 ug/g dry weight, between 10 ug/g and 30 ug/g dry to weight, at least 30 ug/g dry weight, between 30 ug/g and 100 ug/g dry weight, at least 100 ug/g dry weight, between 100 ug/g and 300 ug/g dry weight, at least 300 ug/g dry weight, between 300 ug/g and 1 mg/g dry weight, or more than 1 mg/g dry weight, of the plant or portion thereof.
(243) Likewise, the modulation can be a decrease in the level of a metabolite. The reduction can be in a metabolite affecting the taste of a plant or a commodity plant product derived from a plant (for example, a bitter tasting compound), or in a metabolite which makes a plant or the resulting commodity plant product otherwise less valuable (for example, reduction of oxalate content in certain plants, or compounds which are deleterious to human and/or animal health). The metabolite whose level is to be reduced can be a compound that affects quality of a commodity plant product (e.g., reduction of lignin levels).
(244) Commodity Plant Product
(245) The present invention provides a commodity plant product, as well as methods for producing a commodity plant product, that is derived from a plant of the present invention. As used herein, a commodity plant product refers to any composition or product that is comprised of material derived from a plant, seed, plant cell, or plant part of the present invention. Commodity plant products may be sold to consumers and can be viable or nonviable. Nonviable commodity products include but are not limited to nonviable seeds and grains; processed seeds, seed parts, and plant parts; dehydrated plant tissue, frozen plant tissue, and processed plant tissue; seeds and plant parts processed for animal feed for terrestrial and/or aquatic animal consumption, oil, meal, flour, flakes, bran, fiber, paper, tea, coffee, silage, crushed of whole grain, and any other food for human or animal consumption; and biomasses and fuel products; and raw material in industry. Industrial uses of oils derived from the agricultural plants described herein include ingredients for paints, plastics, fibers, detergents, cosmetics, lubricants, and biodiesel fuel. Soybean oil may be split, inter-esterified, sulfurized, epoxidized, polymerized, ethoxylated, or cleaved. Designing and producing soybean oil derivatives with improved functionality and improved oliochemistry is a rapidly growing field. The typical mixture of triglycerides is usually split and separated into pure fatty acids, which are then combined with petroleum-derived alcohols or acids, nitrogen, sulfonates, chlorine, or with fatty alcohols derived from fats and oils to produce the desired type of oil or fat. Commodity plant products also include industrial compounds, such as a wide variety of resins used in the formulation of adhesives, films, plastics, paints, coatings and foams.
(246) In some cases, commodity plant products derived from the plants, or using the methods of the present invention can be identified readily. In some cases, for example, the presence of viable endophytes can be detected using the methods described herein elsewhere. In other cases, particularly where there are no viable endophytes, the commodity plant product may still contain at least a detectable amount of the specific and unique DNA corresponding to the microbes described herein. Any standard method of detection for polynucleotide molecules may be used, including methods of detection disclosed herein.
(247) Formulations for Agricultural Use
(248) The present invention contemplates a synthetic combination of a plant element that is associated with a single endophyte strain or a plurality of endophytes to confer an improved trait of agronomic importance to the host plant, or an improved agronomic trait potential to a plant element associated with the endophytes, that upon and after germination will confer said benefit to the resultant host plant.
(249) In some embodiments, the plant element is associated with a single endophyte strain or a plurality of endophytes on its surface. Such association is contemplated to be via a mechanism selected from the group consisting of: spraying, immersion, coating, encapsulating, dusting, dripping, aerosolizing, seed treatment, root wash, seedling soak, foliar application, soil inocula, in-furrow application, sidedress application, soil pre-treatement, wound inoculation, drip tape irrigation, vector-mediation via a pollinator, injection, osmopriming, hydroponics, aquaponics, and aeroponics.
(250) In some embodiments, the plant element is a leaf, and the synthetic combination is formulated for application as a foliar treatment.
(251) In some embodiments, the plant element is a seed, and the synthetic combination is formulated for application as a seed coating.
(252) In some embodiments, the plant element is a root, and the synthetic combination is formulated for application as a root treatment.
(253) In certain embodiments, the plant element becomes associated with a plurality of endophytes through delayed exposure. For example, the soil in which a plant element is to be introduced is first treated with a composition comprising a plurality of endophytes. In another example, the area around the plant or plant element is exposed to a formulation comprising a plurality of endophytes, and the plant element becomes subsequently associated with the endophytes due to movement of soil, air, water, insects, mammals, human intervention, or other methods.
(254) The plant element can be obtained from any agricultural plant. In some embodiments, the plant element of the first plant is from a monocotyledonous plant. For example, the plant element of the first plant is from a cereal plant. The plant element of the first plant can be selected from the group consisting of a maize seed, a wheat seed, a barley seed, a rice seed, a sugarcane seed, a maize root, a wheat root, a barley root, a sugarcane root, a rice root, a maize leaf, a wheat leaf, a barley leaf, a sugarcane leaf, or a rice leaf. In an alternative embodiment, the plant element of the first plant is from a dicotyledonous plant. The plant element of the first plant can be selected from the group consisting of a cotton seed, a tomato seed, a canola seed, a pepper seed, a soybean seed, a cotton root, a tomato root, a canola root, a pepper root, a soybean root, a cotton leaf, a tomato leaf, a canola leaf, a pepper leaf, or a soybean leaf. In still another embodiment, the plant element of the first plant can be from a genetically modified plant. In other embodiments, the plant element of the first plant can be a hybrid plant element.
(255) The synthetic combination can comprise a plant element of the first plant which is surface-sterilized prior to combining with a plurality of endophytes. Such pre-treatment prior to coating the seed with endophytes removes the presence of other microbes which may interfere with the optimal colonization, growth and/or function of the endophytes. Surface sterilization of seeds can be accomplished without killing the seeds as described herein.
(256) A single endophyte strain or a plurality of endophytes is intended to be useful in the improvement of agricultural plants, and as such, may be formulated with other compositions as part of an agriculturally compatible carrier. It is contemplated that such carriers can include, but not be limited to: seed treatment, root treatment, foliar treatment, soil treatment. The carrier composition with a plurality of endophytes, may be prepared for agricultural application as a liquid, a solid, or a gas formulation. Application to the plant may be achieved, for example, as a powder for surface deposition onto plant leaves, as a spray to the whole plant or selected plant element, as part of a drip to the soil or the roots, or as a coating onto the seed prior to planting. Such examples are meant to be illustrative and not limiting to the scope of the invention.
(257) In some embodiments, the present invention contemplates plant elements comprising a single endophyte strain or a plurality of endophytes, and further comprising a formulation. The formulation useful for these embodiments generally comprises at least one member selected from the group consisting of an agriculturally compatible carrier, a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient.
(258) In some cases, a single endophyte strain or a plurality of endophytes is mixed with an agriculturally compatible carrier. The carrier can be a solid carrier or liquid carrier. The carrier may be any one or more of a number of carriers that confer a variety of properties, such as increased stability, wettability, or dispersability. Wetting agents such as natural or synthetic surfactants, which can be nonionic or ionic surfactants, or a combination thereof can be included in a composition of the invention. Water-in-oil emulsions can also be used to formulate a composition that includes a plurality of endophytes. Suitable formulations that may be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners, and the like, microencapsulated particles, and the like, liquids such as aqueous flowables, aqueous suspensions, water-in-oil emulsions, etc. The formulation may include grain or legume products, for example, ground grain or beans, broth or flour derived from grain or beans, starch, sugar, or oil.
(259) In some embodiments, the agricultural carrier may be soil or plant growth medium. Other agricultural carriers that may be used include fertilizers, plant-based oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, or suspensions. Mixtures of any of the aforementioned ingredients are also contemplated as carriers, such as but not limited to, pesta (flour and kaolin clay), agar or flour-based pellets in loam, sand, or clay, etc. Formulations may include food sources for the cultured organisms, such as barley, rice, or other biological materials such as seed, leaf, root, plant elements, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood from building site refuse, sawdust or small fibers from recycling of paper, fabric, or wood. Other suitable formulations will be known to those skilled in the art.
(260) In some embodiments, the formulation can comprise a tackifier or adherent. Such agents are useful for combining the microbial population of the invention with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or plant element to maintain contact between the microbe and other agents with the plant or plant part. In some embodiments, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, carragennan, PGA, other biopolymers, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers. Other examples of adherent compositions that can be used in the synthetic preparation include those described in EP 0818135, CA 1229497, WO 2013090628, EP 0192342, WO 2008103422 and CA 1041788, each of which is incorporated herein by reference in its entirety.
(261) It is also contemplated that the formulation may further comprise an anti-caking agent.
(262) The formulation can also contain a surfactant, wetting agent, emulsifier, stabilizer, or anti-foaming agent. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N (US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Auric (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision), polysorbate 20, polysorbate 80, Tween 20, Tween 80, Scattics, Alktest TW20, Canarcel, Peogabsorb 80, Triton X-100, Conco NI, Dowfax 9N, Igebapl CO, Makon, Neutronyx 600, Nonipol NO, Plytergent B, Renex 600, Solar NO, Sterox, Serfonic N, T-DET-N, Tergitol NP, Triton N, IGEPAL CA-630, Nonident P-40, and Pluronic. In some embodiments, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In other embodiments, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v. An example of an anti-foaming agent is Antifoam-C.
(263) In certain cases, the formulation includes a microbial stabilizer. Such an agent can include a desiccant. As used herein, a desiccant can include any compound or mixture of compounds that can be classified as a desiccant regardless of whether the compound or compounds are used in such concentrations that they in fact have a desiccating effect on the liquid inoculant. Such desiccants are ideally compatible with the endophytes used, and should promote the ability of the microbial population to survive application on the plant elements and to survive desiccation. Examples of suitable desiccants include one or more of trehalose, sucrose, glycerol, and Methylene glycol. Other suitable desiccants include, but are not limited to, non-reducing sugars and sugar alcohols (e.g., mannitol or sorbitol). The amount of desiccant introduced into the formulation can range from about 5% to about 50% by weight/volume, for example, between about 10% to about 40%, between about 15% and about 35%, or between about 20% and about 30%.
(264) In some cases, it is advantageous for the formulation to contain agents such as a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, a bactericide, a virucide, and a nutrient. Such agents are ideally compatible with the agricultural plant element or seedling onto which the formulation is applied (e.g., it should not be deleterious to the growth or health of the plant). Furthermore, the agent is ideally one which does not cause safety concerns for human, animal or industrial use (e.g., no safety issues, or the compound is sufficiently labile that the commodity plant product derived from the plant contains negligible amounts of the compound).
(265) In the liquid form, for example, solutions or suspensions, a plurality of endophytes can be mixed or suspended in aqueous solutions. Suitable liquid diluents or carriers include aqueous solutions, petroleum distillates, or other liquid carriers.
(266) Solid compositions can be prepared by dispersing a plurality of endophytes of the invention in and on an appropriately divided solid carrier, such as peat, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, fuller's earth, pasteurized soil, and the like. When such formulations are used as wettable powders, biologically compatible dispersing agents such as non-ionic, anionic, amphoteric, or cationic dispersing and emulsifying agents can be used.
(267) The solid carriers used upon formulation include, for example, mineral carriers such as kaolin clay, pyrophyllite, bentonite, montmorillonite, diatomaceous earth, acid white soil, vermiculite, and pearlite, and inorganic salts such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. Also, organic fine powders such as wheat flour, wheat bran, and rice bran may be used. The liquid carriers include vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol, etc.
(268) In some embodiments, the formulation is ideally suited for coating of a plurality of endophytes onto plant elements. The plurality of endophytes is capable of conferring many agronomic benefits to the host plants. The ability to confer such benefits by coating the plurality of endophytes on the surface of plant elements has many potential advantages, particularly when used in a commercial (agricultural) scale.
(269) A single endophyte strain or a plurality of endophytes can be combined with one or more of the agents described above to yield a formulation suitable for combining with an agricultural plant element or seedling. The plurality of endophytes can be obtained from growth in culture, for example, using a synthetic growth medium. In addition, the microbe can be cultured on solid media, for example on petri dishes, scraped off and suspended into the preparation. Microbes at different growth phases can be used. For example, microbes at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used. Endophytic spores may be used for the present invention, for example but not limited to: arthospores, sporangispores, conidia, chlamadospores, pycnidiospores, endospores, zoospores.
(270) The formulations comprising a plurality of endophytes of the present invention typically contains between about 0.1 to 95% by weight, for example, between about 1% and 90%, between about 3% and 75%, between about 5% and 60%, between about 10% and 50% in wet weight of a plurality of endophytes. In some embodiments, the formulation contains at least about 10{circumflex over ()}2 per ml of formulation, at least about 10{circumflex over ()}3 per ml of formulation, for example, at least about 10{circumflex over ()}4, at least about 10{circumflex over ()}5, at least about 10{circumflex over ()}6, at least about 10{circumflex over ()}7 CFU or spores, at least about 10{circumflex over ()}3 CFU or spores per ml of formulation. In some embodiments, the formulation be applied to the plant element at about 10{circumflex over ()}2 CFU/seed, between 10{circumflex over ()}2 and 10{circumflex over ()}3 CFU, at least about 10{circumflex over ()}3 CFU, between 10{circumflex over ()}3 and 10{circumflex over ()}4 CFU, at least about 10{circumflex over ()}4 CFU, between 10{circumflex over ()}4 and 10{circumflex over ()}5 CFU, at least about 10{circumflex over ()}5 CFU, between 10{circumflex over ()}5 and 10{circumflex over ()}6 CFU, at least about 10{circumflex over ()}6 CFU, between 10{circumflex over ()}6 and 10{circumflex over ()}7 CFU, at least about 10{circumflex over ()}7 CFU, between 10{circumflex over ()}7 and 10{circumflex over ()}8 CFU, or even greater than 10{circumflex over ()}8 CFU per seed.
(271) The compositions provided herein are preferably stable. The endophyte may be shelf-stable, where at least 0.01%, of the CFU or spores are viable after storage in desiccated form (i.e., moisture content of 30% or less) for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 weeks at 4 C. or at room temperature. Optionally, a shelf-stable formulation is in a dry formulation, a powder formulation, or a lyophilized formulation. In some embodiments, the formulation is formulated to provide stability for the population of endophytes. In one embodiment, the formulation is substantially stable at temperatures between about 20 C. and about 50 C. for at least about 1, 2, 3, 4, 5, or 6 days, or 1, 2, 3 or 4 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or one or more years. In another embodiment, the formulation is substantially stable at temperatures between about 4 C. and about 37 C. for at least about 5, 10, 15, 20, 25, 30 or greater than 30 days.
(272) As described above, in certain embodiments, the present invention contemplates the use of a single endophyte strain or a plurality of endophytes heterologously disposed on the plant, for example, the plant element. In certain cases, the agricultural plant may contain bacteria that are substantially similar to, or even genetically indistinguishable from, the bacteria that are being applied to the plant. It is noted that, in many cases, the bacteria that are being applied is substantially different from the bacteria already present in several significant ways. First, the bacteria that are being applied to the agricultural plant have been adapted to culture, or adapted to be able to grow on growth media in isolation from the plant. Second, in many cases, the bacteria that are being applied are derived from a clonal origin, rather than from a heterologous origin and, as such, can be distinguished from the bacteria that are already present in the agricultural plant by the clonal similarity. For example, where a microbe that has been inoculated by a plant is also present in the plant (for example, in a different tissue or portion of the plant), or where the introduced microbe is sufficiently similar to a microbe that is present in some of the plants (or portion of the plant, including plant elements), it is still possible to distinguish between the inoculated microbe and the native microbe by distinguishing between the two microbe types on the basis of their epigenetic status (e.g., the bacteria that are applied, as well as their progeny, would be expected to have a much more uniform and similar pattern of cytosine methylation of its genome, with respect to the extent and/or location of methylation).
(273) It is, of course, also possible to provide a coating with additional microorganisms (either the same or different as the endophyte that was inoculated). Therefore, according to another embodiment of the present invention, the obtained plant seed containing microorganisms is therefore subjected to a further seed impregnation step.
(274) Once coated with the endophyte formulation, the seeds can be mixed and allowed to dry before germination occurs.
(275) Endophytes Compatible with Agrichemicals
(276) In certain embodiments, the single endophyte strain or the plurality of endophytes is selected on the basis of its compatibility with commonly used agrichemicals. As mentioned earlier, plants, particularly agricultural plants, can be treated with a vast array of agrichemicals, including fungicides, biocides (anti-complex agents), herbicides, insecticides, nematicides, rodenticides, fertilizers, and other agents.
(277) In some cases, it can be important for the single endophyte strain or the plurality of endophytes to be compatible with agrichemicals, particularly those with anticomplex properties, in order to persist in the plant although, as mentioned earlier, there are many such anticomplex agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the endophytes. Therefore, where a systemic anticomplex agent is used in the plant, compatibility of the endophytes to be inoculated with such agents will be an important criterion.
(278) Fungicides
(279) In some embodiments, the control agent is a fungicide. As used herein, a fungicide is any compound or agent (whether chemical or biological) that can either inhibit the growth of a fungus or kill a fungus. In that sense, a fungicide, as used herein, encompasses compounds that may be fungistatic or fungicidal. As used herein, the fungicide can be a protectant, or agents that are effective predominantly on the seed surface, providing protection against seed surface-borne pathogens and providing some level of control of soil-borne pathogens. Non-limiting examples of protectant fungicides include captan, maneb, thiram, or fludioxonil.
(280) The fungicide can be a systemic fungicide, which can be absorbed into the emerging seedling and inhibit or kill the fungus inside host plant tissues. Systemic fungicides used for seed treatment include, but are not limited to the following: azoxystrobin, carboxin, mefenoxam, metalaxyl, thiabendazole, trifloxystrobin, and various triazole fungicides, including difenoconazole, ipconazole, tebuconazole, and triticonazole. Mefenoxam and metalaxyl are primarily used to target the water mold fungi Pythium and Phytophthora. Some fungicides are preferred over others, depending on the plant species, either because of subtle differences in sensitivity of the pathogenic fungal species, or because of the differences in the fungicide distribution or sensitivity of the plants. In some embodiments, the endophyte is compatible with at least one of the fungicides selected from the group consisting of: 2-(thiocyanatomethylthio)-benzothiazole, 2-phenylphenol, 8-hydroxyquinoline sulfate, ametoctradin, amisulbrom, antimycin, Ampelomyces quisqualis, azaconazole, azoxystrobin, Bacillus subtilis, benalaxyl, benomyl, benthiavalicarb-isopropyl, benzylaminobenzene-sulfonate (BABS) salt, bicarbonates, biphenyl, bismerthiazol, bitertanol, bixafen, blasticidin-S, borax, Bordeaux mixture, boscalid, bromuconazole, bupirimate, calcium polysulfide, captafol, captan, carbendazim, carboxin, carpropamid, carvone, chloroneb, chlorothalonil, chlozolinate, Coniothyrium minitans, copper hydroxide, copper octanoate, copper oxychloride, copper sulfate, copper sulfate (tribasic), cuprous oxide, cyazofamid, cyflufenamid, cymoxanil, cyproconazole, cyprodinil, dazomet, debacarb, diammonium ethylenebis-(dithiocarbamate), dichlofluanid, dichlorophen, diclocymet, diclomezine, dichloran, diethofencarb, difenoconazole, difenzoquat ion, diflumetorim, dimethomorph, dimoxystrobin, diniconazole, diniconazole-M, dinobuton, dinocap, diphenylamine, dithianon, dodemorph, dodemorph acetate, dodine, dodine free base, edifenphos, enestrobin, epoxiconazole, ethaboxam, ethoxyquin, etridiazole, famoxadone, fenamidone, fenarimol, fenbuconazole, fenfuram, fenhexamid, fenoxanil, fenpiclonil, fenpropidin, fenpropimorph, fentin, fentin acetate, fentin hydroxide, ferbam, ferimzone, fluazinam, fludioxonil, flumorph, fluopicolide, fluopyram, fluoroimide, fluoxastrobin, fluquinconazole, flusilazole, flusulfamide, flutianil, flutolanil, flutriafol, fluxapyroxad, folpet, formaldehyde, fosetyl, fosetyl-aluminium, fuberidazole, furalaxyl, furametpyr, guazatine, guazatine acetates, GY-81, hexachlorobenzene, hexaconazole, hymexazol, imazalil, imazalil sulfate, imibenconazole, iminoctadine, iminoctadine triacetate, iminoctadine tris(albesilate), ipconazole, iprobenfos, iprodione, iprovalicarb, isoprothiolane, isopyrazam, isotianil, kasugamycin, kasugamycin hydrochloride hydrate, kresoxim-methyl, mancopper, mancozeb, mandipropamid, maneb, mepanipyrim, mepronil, mercuric chloride, mercuric oxide, mercurous chloride, metalaxyl, mefenoxam, metalaxyl-M, metam, metam-ammonium, metam-potassium, metam-sodium, metconazole, methasulfocarb, methyl iodide, methyl isothiocyanate, metiram, metominostrobin, metrafenone, mildiomycin, myclobutanil, nabam, nitrothal-isopropyl, nuarimol, octhilinone, ofurace, oleic acid (fatty acids), orysastrobin, oxadixyl, oxine-copper, oxpoconazole fumarate, oxycarboxin, pefurazoate, penconazole, pencycuron, penflufen, pentachlorophenol, pentachlorophenyl laurate, penthiopyrad, phenylmercury acetate, phosphonic acid, phthalide, picoxystrobin, polyoxin B, polyoxins, polyoxorim, potassium bicarbonate, potassium hydroxyquinoline sulfate, probenazole, prochloraz, procymidone, propamocarb, propamocarb hydrochloride, propiconazole, propineb, proquinazid, prothioconazole, pyraclostrobin, pyrametostrobin, pyraoxystrobin, pyrazophos, pyribencarb, pyributicarb, pyrifenox, pyrimethanil, pyroquilon, quinoclamine, quinoxyfen, quintozene, Reynoutria sachalinensis extract, sedaxane, silthiofam, simeconazole, sodium 2-phenylphenoxide, sodium bicarbonate, sodium pentachlorophenoxide, spiroxamine, sulfur, SYP-Z071, SYP-Z048, tar oils, tebuconazole, tebufloquin, tecnazene, tetraconazole, thiabendazole, thifluzamide, thiophanate-methyl, thiram, tiadinil, tolclofos-methyl, tolylfluanid, triadimefon, triadimenol, triazoxide, tricyclazole, tridemorph, trifloxystrobin, triflumizole, triforine, triticonazole, validamycin, valifenalate, valiphenal, vinclozolin, zineb, ziram, zoxamide, Candida oleophila, Fusarium oxysporum, Gliocladium spp., Phlebiopsis gigantea, Streptomyces griseoviridis, Trichoderma spp., (RS)N-(3,5-dichlorophenyl)-2-(methoxymethyl)-succinimide, 1,2-dichloropropane, 1,3-dichloro-1,1,3,3-tetrafluoroacetone hydrate, 1-chloro-2,4-dinitronaphthalene, 1-chloro-2-nitropropane, 2-(2-heptadecyl-2-imidazolin-1-yl)ethanol, 2,3-dihydro-5-phenyl-1,4-dithi-ine 1,1,4,4-tetraoxide, 2-methoxyethylmercury acetate, 2-methoxyethylmercury chloride, 2-methoxyethylmercury silicate, 3-(4-chlorophenyl)-5-methylrhodanine, 4-(2-nitroprop-1-enyl)phenyl thiocyanateme, ampropylfos, anilazine, azithiram, barium polysulfide, Bayer 32394, benodanil, benquinox, bentaluron, benzamacril; benzamacril-isobutyl, benzamorf, binapacryl, bis(methylmercury) sulfate, bis(tributyltin) oxide, buthiobate, cadmium calcium copper zinc chromate sulfate, carbamorph, CECA, chlobenthiazone, chloraniformethan, chlorfenazole, chlorquinox, climbazole, cyclafuramid, cypendazole, cyprofuram, decafentin, dichlone, dichlozoline, diclobutrazol, dimethirimol, dinocton, dinosulfon, dinoterbon, dipyrithione, ditalimfos, dodicin, drazoxolon, EBP, ESBP, etaconazole, etem, ethirim, fenaminosulf, fenapanil, fenitropan, 5-fluorocytosine and profungicides thereof, fluotrimazole, furcarbanil, furconazole, furconazole-cis, furmecyclox, furophanate, glyodine, griseofulvin, halacrinate, Hercules 3944, hexylthiofos, ICIA0858, isopamphos, isovaledione, mebenil, mecarbinzid, metazoxolon, methfuroxam, methylmercury dicyandiamide, metsulfovax, milneb, mucochloric anhydride, myclozolin, N-3,5-dichlorophenyl-succinimide, N-3-nitrophenylitaconimide, natamycin, N-ethylmercurio-4-toluenesulfonanilide, nickel bis(dimethyldithiocarbamate), OCH, phenylmercury dimethyldithiocarbamate, phenylmercury nitrate, phosdiphen, picolinamide UK-2A and derivatives thereof, prothiocarb; prothiocarb hydrochloride, pyracarbolid, pyridinitril, pyroxychlor, pyroxyfur, quinacetol; quinacetol sulfate, quinazamid, quinconazole, rabenzazole, salicylanilide, SSF-109, sultropen, tecoram, thiadifluor, thicyofen, thiochlorfenphim, thiophanate, thioquinox, tioxymid, triamiphos, triarimol, triazbutil, trichlamide, urbacid, XRD-563, and zarilamide, IK-1140. In still another embodiment, an endophyte that is compatible with an antibacterial compound is used for the methods described herein. For example, the endophyte is compatible with at least one of the antibiotics selected from the group consisting of: Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Tobramycin, Paromomycin, Spectinomycin, Geldanamycin, Herbimycin, Rifaximin, streptomycin, Loracarbef, Ertapenem, Doripenem, Imipenem/Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cefalotin or Cefalothin, Cefalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefepime, Ceftaroline fosamil, Ceftobiprole, Teicoplanin, Vancomycin, Telavancin, Clindamycin, Lincomycin, Daptomycin, Azithromycin, Clarithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Telithromycin, Spiramycin, Aztreonam, Furazolidone, Nitrofurantoin, Linezolid, Posizolid, Radezolid, Torezolid, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Methicillin, Nafcillin, Oxacillin, Penicillin G, Penicillin V, Piperacillin, Penicillin G, Temocillin, Ticarcillin, Amoxicillin/clavulanate, Ampicillin/sulbactam, Piperacillin/tazobactam, Ticarcillin/clavulanate, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Nalidixic acid, Norfloxacin, Ofloxacin, Trovafloxacin, Grepafloxacin, Sparfloxacin, Temafloxacin, Mafenide, Sulfacetamide, Sulfadiazine, Silver sulfadiazine, Sulfadimethoxine, Sulfamethizole, Sulfamethoxazole, Sulfanilimide (archaic), Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole (Co-trimoxazole) (TMP-SMX), Sulfonamidochrysoidine (archaic), Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Clofazimine, Dapsone, Capreomycin, Cycloserine, Ethambutol, Ethionamide, Isoniazid, Pyrazinamide, Rifampicin (Rifampin in US), Rifabutin, Rifapentine, Streptomycin, Arsphenamine, Chloramphenicol, Fosfomycin, Fusidic acid, Metronidazole, Mupirocin, Platensimycin, Quinupristin/Dalfopristin, Thiamphenicol, Tigecycline, Tinidazole, and Trimethoprim.
(281) A fungicide can be a biological control agent, such as a bacterium or fungus. Such organisms may be parasitic to the pathogenic fungi, or secrete toxins or other substances which can kill or otherwise prevent the growth of fungi. Any type of fungicide, particularly ones that are commonly used on plants, can be used as a control agent in a seed composition.
(282) Antibacterial Agents
(283) In some cases, the seed coating composition comprises a control agent which has antibacterial properties. In some embodiments, the control agent with antibacterial properties is selected from the compounds described herein elsewhere. In other embodiments, the compound is Streptomycin, oxytetracycline, oxolinic acid, or gentamicin.
(284) Plant Growth Regulators
(285) The seed coat composition can further comprise a plant growth regulator. In some embodiments, the plant growth regulator is selected from the group consisting of: Abscisic acid, amidochlor, ancymidol, 6-benzylaminopurine, brassinolide, butralin, chlormequat (chlormequat chloride), choline chloride, cyclanilide, daminozide, dikegulac, dimethipin, 2,6-dimethylpuridine, ethephon, flumetralin, flurprimidol, fluthiacet, forchlorfenuron, gibberellic acid, inabenfide, indole-3-acetic acid, maleic hydrazide, mefluidide, mepiquat (mepiquat chloride), naphthaleneacetic acid, N-6-benzyladenine, paclobutrazol, prohexadione (prohexadionecalcium), prohydrojasmon, thidiazuron, triapenthenol, tributyl phosphorotrithioate, 2,3,5-tri-iodobenzoic acid, trinexapac-ethyl and uniconazole. Other examples of antibacterial compounds which can be used as part of a seed coating composition include those based on dichlorophene and benzylalcohol hemi formal (Proxel from ICI or Acticide RS from Thor Chemie and Kathon MK from Rohm & Haas) and isothiazolinone derivatives such as alkylisothiazolinones and benzisothiazolinones (Acticide MBS from Thor Chemie). Other plant growth regulators that can be incorporated seed coating compositions are described in US 2012/0108431, which is incorporated by reference in its entirety.
(286) Nematicides
(287) Preferred nematode-antagonistic biocontrol agents include ARF18; Arthrobotrys spp.; Chaetomium spp.; Cylindrocarpon spp.; Exophilia spp.; Fusarium spp.; Gliocladium spp.; Hirsutella spp.; Lecanicillium spp.; Monacrosporium spp.; Myrothecium spp.; Neocosmospora spp.; Paecilomyces spp.; Pochonia spp.; Stagonospora spp.; vesicular-arbuscular mycorrhizal fungi, Burkholderia spp.; Pasteuria spp., Brevibacillus spp.; Pseudomonas spp.; and Rhizobacteria. Particularly preferred nematode-antagonistic biocontrol agents include ARF18, Arthrobotrys oligospora, Arthrobotrys dactyloides, Chaetomium globosum, Cylindrocarpon heteronema, Exophilia jeanselmei, Exophilia pisciphila, Fusarium aspergilus, Fusarium solani, Gliocladium catenulatum, Gliocladium roseum, Gliocladium virens, Hirsutella rhossiliensis, Hirsutella minnesotensis, Lecanicillium lecanii, Monacrosporium drechsleri, Monacrosporium gephyropagum, Myrotehcium verrucaria, Neocosmospora vasinfecta, Paecilomyces lilacinus, Pochonia chlamydosporia, Stagonospora heteroderae, Stagonospora phaseoli, vesicular-arbuscular mycorrhizal fungi, Burkholderia cepacia, Pasteuria penetrans, Pasteuria thornei, Pasteuria nishizawae, Pasteuria ramosa, Pastrueia usage, Brevibacillus laterosporus strain G4, Pseudomonas fluorescens and Rhizobacteria.
(288) Nutrients
(289) In other embodiments, the seed coating composition can comprise a nutrient. The nutrient can be selected from the group consisting of a nitrogen fertilizer including, but not limited to Urea, Ammonium nitrate, Ammonium sulfate, Non-pressure nitrogen solutions, Aqua ammonia, Anhydrous ammonia, Ammonium thiosulfate, Sulfur-coated urea, Urea-formaldehydes, IBDU, Polymer-coated urea, Calcium nitrate, Ureaform, and Methylene urea, phosphorous fertilizers such as Diammonium phosphate, Monoammonium phosphate, Ammonium polyphosphate, Concentrated superphosphate and Triple superphosphate, and potassium fertilizers such as Potassium chloride, Potassium sulfate, Potassium-magnesium sulfate, Potassium nitrate. Such compositions can exist as free salts or ions within the seed coat composition. Alternatively, nutrients/fertilizers can be complexed or chelated to provide sustained release over time.
(290) Rodenticides
(291) Rodents such as mice and rats cause considerable economical damage by eating and soiling planted or stored seeds. Moreover, mice and rats transmit a large number of infectious diseases such as plague, typhoid, leptospirosis, trichinosis and salmonellosis. Anticoagulants such as coumarin and indandione derivatives play an important role in the control of rodents. These active ingredients are simple to handle, relatively harmless to humans and have the advantage that, as the result of the delayed onset of the activity, the animals being controlled identify no connection with the bait that they have ingested, therefore do not avoid it. This is an important aspect in particular in social animals such as rats, where individuals act as tasters. In some embodiments, the seed coating composition comprises a rodenticide selected from the group of substances consisting of 2-isovalerylindan-1,3-dione, 4-(quinoxalin-2-ylamino)benzenesulfonamide, alpha-chlorohydrin, aluminum phosphide, antu, arsenous oxide, barium carbonate, bisthiosemi, brodifacoum, bromadiolone, bromethalin, calcium cyanide, chloralose, chlorophacinone, cholecalciferol, coumachlor, coumafuryl, coumatetralyl, crimidine, difenacoum, difethialone, diphacinone, ergocalciferol, flocoumafen, fluoroacetamide, flupropadine, flupropadine hydrochloride, hydrogen cyanide, iodomethane, lindane, magnesium phosphide, methyl bromide, norbormide, phosacetim, phosphine, phosphorus, pindone, potassium arsenite, pyrinuron, scilliroside, sodium arsenite, sodium cyanide, sodium fluoroacetate, strychnine, thallium sulfate, warfarin and zinc phosphide.
(292) Compatibility
(293) In some embodiments, a single endophyte strain or a plurality of endophytes that are compatible with agrichemicals can be used to inoculate the plants according to the methods described herein. In each case below, each single endophyte strain or each type of endophyte used in a plurality of endophytes can be tested for compatibility on their own or as the plurality. Endophytes that are compatible with agriculturally employed anticomplex agents can be isolated by plating a culture of endophytes on a petri dish comprising an effective concentration of the anticomplex agent, and isolating colonies of endophytes that are compatible with the anticomplex agent. In other embodiments, a plurality of endophytes that are compatible with an anticomplex agent are used for the methods described herein.
(294) In some embodiments, the endophytes of the present invention display tolerance to an agrichemical selected from the group consisting of: Aeris, Avicta DuoCot 202, Cruiser, Syntenta CCB (A), Clariva, Albaugh, Dynasty, Apron, Maxim, Gaucho, Provoke ST, Syngenta CCB, Trilex, WG Purple, WG Silver, Azoxystrobin, Carboxin, Difenoconazole, Fludioxonil, fluxapyroxad, Ipconazole, Mefenoxam, Metalaxyl, Myclobutanil, Penflufen, pyraclostrobin, Sedaxane, TCMTB, Tebuconazole, Thiram, Triadimenol (Baytan), Trifloxystrobin, Triticonazole, Tolclofos-methyl, PCNB, Abamectin, Chlorpyrifos, Clothianidin, Imidacloprid, Thiamethoxam, and Thiodicarb.
(295) Bactericide-compatible endophytes can also be isolated by selection on liquid medium. The culture of endophytes can be plated on petri dishes without any forms of mutagenesis; alternatively, endophytes can be mutagenized using any means known in the art. For example, endophyte cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethanesulfonate (EMS), ethidium bromide (EtBr) dichlovos (DDVP, methyl methane sulphonale (MMS), triethylphosphate (TEP), trimethylphosphate (TMP), nitrous acid, or DNA base analogs, prior to selection on fungicide comprising media. Finally, where the mechanism of action of a particular bactericide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate a plurality of endophytes that are resilient against that particular chemical. It is noted that the above-described methods can be used to isolate endophytes that are compatible with both bacteriostatic and bactericidal compounds.
(296) It will also be appreciated by one skilled in the art that a plant may be exposed to multiple types of anticomplex compounds, either simultaneously or in succession, for example at different stages of plant growth. Where the target plant is likely to be exposed to multiple anticomplex agents, a plurality of endophytes that are compatible with many or all of these agrichemicals can be used to inoculate the plant. Endophytes that are compatible with several agents can be isolated, for example, by serial selection. Endophytes that are compatible with the first agent can be isolated as described above (with or without prior mutagenesis). A culture of the resulting endophytes can then be selected for the ability to grow on liquid or solid media comprising the second agent (again, with or without prior mutagenesis). Colonies isolated from the second selection are then tested to confirm its compatibility to both agents.
(297) Likewise, endophytes that are compatible to biocides (including herbicides such as glyphosate or anticomplex compounds, whether bacteriostatic or bactericidal) that are agriculturally employed can be isolated using methods similar to those described for isolating compatible endophytes. In some embodiments, mutagenesis of the endophytes can be performed prior to selection with an anticomplex agent. In other embodiments, selection is performed on the endophytes without prior mutagenesis. In still another embodiment, serial selection is performed on endophytes: the endophytes are first selected for compatibility to a first anticomplex agent. The isolated compatible endophytes are then cultured and selected for compatibility to the second anticomplex agent. Any colony thus isolated is tested for compatibility to each, or both anticomplex agents to confirm compatibility with these two agents.
(298) Compatibility with an antimicrobial agent can be determined by a number of means known in the art, including the comparison of the minimal inhibitory concentration (MIC) of the unmodified and modified endophytes. Therefore, in some embodiments, the present invention discloses modified endophytes, wherein the endophytes are modified such that they exhibits at least 3 fold greater, for example, at least 5 fold greater, between 5 and 10 fold greater, at least 10 fold greater, between 10 and 20 fold greater, at least 20 fold greater, between 20 and 30 fold greater, at least 30 fold greater or more MIC to an antimicrobial agent when compared with the unmodified endophytes.
(299) In some embodiments, disclosed herein are endophytes with enhanced compatibility to the herbicide glyphosate. In some embodiments, the endophytes have a doubling time in growth medium comprising least 1 mM glyphosate, for example, between 1 mM and 2 mM glyphosate, at least 2 mM glyphosate, between 2 mM and 5 mM glyphosate, at least 5 mM glyphosate, between 5 mM and 10 mM glyphosate, at least 10 mM glyphosate, between 10 mM and 15 mM glyphosate, at least 15 mM glyphosate or more, that is no more than 250%, between 250% and 100%, for example, no more than 200%, between 200% and 175%, no more than 175%, between 175% and 150%, no more than 150%, between 150% and 125%, or no more than 125%, of the doubling time of the endophytes in the same growth medium comprising no glyphosate. In some embodiments, the endophytes have a doubling time in growth medium comprising 5 mM glyphosate that is no more than 150% the doubling time of the endophytes in the same growth medium comprising no glyphosate.
(300) In other embodiments, the endophytes have a doubling time in a plant tissue comprising at least 10 ppm glyphosate, for example, between 10 and 15 ppm, at least 15 ppm glyphosate, between 15 and 10 ppm, at least 20 ppm glyphosate, between 20 and 30 ppm, at least 30 ppm glyphosate, between 30 and 40 ppm, at least 40 ppm glyphosate or more, that is no more than 250%, between 250% and 200%, for example, no more than 200%, between 200% and 175%, no more than 175%, between 175% and 150%, no more than 150%, between 150% and 125%, of the doubling time of the endophytes in a reference plant tissue comprising no glyphosate. In some embodiments, the endophytes have a doubling time in a plant tissue comprising 40 ppm glyphosate that is no more than 150% the doubling time of the endophytes in a reference plant tissue comprising no glyphosate.
(301) The selection process described above can be repeated to identify isolates of endophytes that are compatible with a multitude of agents.
(302) Candidate isolates can be tested to ensure that the selection for agrichemical compatibility did not result in loss of a desired bioactivity. Isolates of endophytes that are compatible with commonly employed agents can be selected as described above. The resulting compatible endophytes can be compared with the parental endophytes on plants in its ability to promote germination.
(303) The agrichemical compatible endophytes generated as described above can be detected in samples. For example, where a transgene was introduced to render the endophytes compatible with the agrichemical(s), the transgene can be used as a target gene for amplification and detection by PCR. In addition, where point mutations or deletions to a portion of a specific gene or a number of genes results in compatibility with the agrichemical(s), the unique point mutations can likewise be detected by PCR or other means known in the art. Such methods allow the detection of the endophytes even if they is no longer viable. Thus, commodity plant products produced using the agrichemical compatible endophytes described herein can readily be identified by employing these and related methods of nucleic acid detection.
(304) Populations of Plant Elements
(305) The synthetic combinations of the present invention may be confined within an object selected from the group consisting of: bottle, jar, ampule, package, vessel, bag, box, bin, envelope, carton, container, silo, shipping container, truck bed, and case. In a particular embodiment, the population of plant elements is packaged in a bag or container suitable for commercial sale. For example, a bag contains a unit weight or count of the plant elements comprising a plurality of endophytes as described herein, and further comprises a label. In one embodiment, the bag or container contains at least 100 plant elements, between 100 and 1,000 plant elements, 1,000 plant elements, between 1,000 and 5,000 plant elements, for example, at least 5,000 plant elements, between 5,000 and 10,000 plant elements, at least 10,000 plant elements, between 10,000 and 20,000 plant elements, at least 20,000 plant elements, between 20,000 and 30,000 plant elements, at least 30,000 plant elements, between 30,000 and 50,000 plant elements, at least 50,000 plant elements, between 50,000 and 70,000 plant elements, at least 70,000 plant elements, between 70,000 and 80,000 plant elements, at least 80,000 plant elements, between 80,000 and 90,000, at least 90,000 plant elements or more. In another embodiment, the bag or container can comprise a discrete weight of plant elements, for example, at least 1 lb, between 1 and 2 lbs, at least 2 lbs, between 2 and 5 lbs, at least 5 lbs, between 5 and 10 lbs, at least 10 lbs, between 10 and 30 lbs, at least 30 lbs, between 30 and 50 lbs, at least 50 lbs, between 50 and 70 lmbs, at least 70 lbs or more. The label can contain additional information, for example, the information selected from the group consisting of: net weight, lot number, geographic origin of the plant elements, test date, germination rate, inert matter content, and the amount of noxious weeds, if any. Suitable containers or packages include those traditionally used in plant plant element commercialization. The invention also contemplates other containers with more sophisticated storage capabilities (e.g., with microbiologically tight wrappings or with gas- or water-proof containments).
(306) In some cases, a sub-population of plant elements comprising a plurality of endophytes is further selected on the basis of increased uniformity, for example, on the basis of uniformity of microbial population. For example, individual plant elements of pools collected from individual cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields can be tested for uniformity of microbial density, and only those pools meeting specifications (e.g., at least 80% of tested plant elements have minimum density, as determined by quantitative methods described elsewhere) are combined to provide the agricultural plant element sub-population.
(307) The methods described herein can also comprise a validating step. The validating step can entail, for example, growing some plant elements collected from the inoculated plants into mature agricultural plants, and testing those individual plants for uniformity. Such validating step can be performed on individual plant elements collected from cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields, and tested as described above to identify pools meeting the required specifications.
(308) In some embodiments, methods described herein include planting a synthetic composition described herein. Suitable planters include an air seeder and/or fertilizer apparatus used in agricultural operations to apply particulate materials including one or more of the following, seed, fertilizer and/or inoculants, into soil during the planting operation. Seeder/fertilizer devices can include a tool bar having ground-engaging openers thereon, behind which is towed a wheeled cart that includes one or more containment tanks or bins and associated metering means to respectively contain and meter therefrom particulate materials.
(309) In certain embodiments, a composition described herein may be in the form of a liquid, a slurry, a solid, or a powder (wettable powder or dry powder). In another embodiment, a composition may be in the form of a seed coating. Compositions in liquid, slurry, or powder (e.g., wettable powder) form may be suitable for coating plant elements. When used to coat plant elements, the composition may be applied to the plant elements and allowed to dry. In embodiments wherein the composition is a powder (e.g., a wettable powder), a liquid, such as water, may need to be added to the powder before application to a seed.
(310) In still another embodiment, the methods can include introducing into the soil an inoculum of one or more of the endophyte populations described herein. Such methods can include introducing into the soil one or more of the compositions described herein. The inoculum(s) or compositions may be introduced into the soil according to methods known to those skilled in the art. Non-limiting examples include in-furrow introduction, spraying, coating seeds, foliar introduction, etc. In a particular embodiment, the introducing step comprises in-furrow introduction of the inoculum or compositions described herein.
(311) In one embodiment, plant elements may be treated with composition(s) described herein in several ways but preferably via spraying or dripping. Spray and drip treatment may be conducted by formulating compositions described herein and spraying or dripping the composition(s) onto a seed(s) via a continuous treating system (which is calibrated to apply treatment at a predefined rate in proportion to the continuous flow of seed), such as a drum-type of treater. Batch systems, in which a predetermined batch size of seed and composition(s) as described herein are delivered into a mixer, may also be employed.
(312) In another embodiment, the treatment entails coating plant elements. One such process involves coating the inside wall of a round container with the composition(s) described herein, adding plant elements, then rotating the container to cause the plant elements to contact the wall and the composition(s), a process known in the art as container coating. Plant elements can be coated by combinations of coating methods. Soaking typically entails using liquid forms of the compositions described. For example, plant elements can be soaked for about 1 minute to about 24 hours (e.g., for at least 1 min, between 1 and 5 min, 5 min, between 5 and 10 min, 10 min, between 10 and 20 min, 20 min, between 20 and 40 min, 40 min, between 40 and 80 min, 80 min, between 80 min and 3 hrs, 3 hrs, between 3 hrs and 6 hrs, 6 hr, between 6 hrs and 12 hrs, 12 hr, between 12 hrs and 24 hrs, or at least 24 hrs).
(313) Throughout the specification, the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
(314) Although the present invention has been described in detail with reference to examples below, it is understood that various modifications can be made without departing from the spirit of the invention. For instance, while the particular examples below may illustrate the methods and embodiments described herein using a specific plant, the principles in these examples may be applied to any agricultural crop. Therefore, it will be appreciated that the scope of this invention is encompassed by the embodiments of the inventions recited herein and the specification rather than the specific examples that are exemplified below.
EXAMPLES
Example 1: Cultivation-Independent Analysis of Microbial Taxa in Agriculturally Relevant Seed Communities Based on Marker Gene High-Throughput Sequencing
(315) Example Description
(316) Microbial taxa found in agriculturally relevant communities were identified using high-throughput marker gene sequencing across several crops and numerous varieties of seeds.
(317) Experimental Description
(318) To identify core (i.e. ubiquitous) microbial taxa across seeds, we used high-throughput sequencing of marker genes for bacteria, archaea, and fungi.
(319) Cereals
(320) 2 inbred, 10 landrace, 4 teosinte corn seeds, and 4 modern and 4 wild wheat seeds were obtained. Accessions were categorized into landrace, wild, and inbred varieties based on their assessment of improvement status. In order to extract microbial DNA, the seeds were first sterilized in one of four different manners. Some of the seeds were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water. Others were first soaked in sterile, DNA-free water for 48 hours to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water. Others were rinsed in deionized water, immersed in 95% ethanol for 5 seconds, 0.5% NaOCl for 2 minutes, 70% ethanol for 2 minutes, and then washed three times in deionized water for 1 minute each.
(321) Grasslands
(322) To identify microbial taxa from seeds of wild grassland plants, we used high-throughput sequencing of marker genes for bacteria, archaea, and fungi. Seeds from the following wild grassland species were obtained: Big bluestem, Side oats grama, Bicknell's sedge, Short beak sedge, Canada wild rye, Virginia wild rye, June grass, Leafy satin grass, Switch grass, Little bluestem, Prairie cord grass, Prairie dropseed, Nodding wild onion, Meadow/Canada anemone, Common milkweed, Butterfly weed, Whorled milkweed, New England aster, False boneset, Tall coreopsis, Shooting star, Pale purple coneflower, Rattlesnake master, Tall boneset, Purple joe pye weed, Biennial gaure, Prairie smoke, False sunflower, Rough blazing star, Wild bergamot, Horse mint, Common evening primrose, Wild quinine, Beardtongue, Yellow coneflower, Black-eyed Susan, Sweet black-eyed susan, Compass plant, Prairie dock, Stiff goldenrod, Showy goldenrod, Hairy aster, Hoary vervain, Culver's root, Golden alexanders, Dogtooth daisy, Wild blue iris, Pointed broom sedge, Dark green bulrush, and Blue vervain. In order to extract microbial DNA, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water.
(323) Fruits and Vegetables
(324) Seeds from 22 different varieties of cabbage were obtained, including broccoli, cauliflower, and collards. In addition, seeds from 8 different varieties of lettuce, 9 varieties of melon (including cantaloupe and honeydew), 7 varieties of onions (including cippolini, shallots, and vidalia), 4 varieties of tomatoes, one variety of toria, 4 varieties of turnip, 7 varieties of watermelon, and one variety of yellow sarcon were obtained. For strawberries, the seeds or runner plant tissue of 9 varieties were obtained. For sterilization, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water. Strawberry tissue was surface sterilized using 95% ethanol, then rinsed in water.
(325) Oilseed
(326) Seeds from 1 wild and 3 modern cultivars of Brassica Napus were also obtained. In order to extract microbial DNA, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water.
(327) The seeds or tissues from all of the plants described above were then ground using a mortar and pestle treated with 95% ethanol and RNAse Away (Life Technologies, Inc., Grand Island, N.Y.) to remove contaminant DNA. DNA was extracted from the ground seeds using the PowerPlant Pro DNA extraction kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.) according to the manufacturer's instructions. The surface wash off from certain sterilization treatments of cereal seeds was also collected and DNA was extracted as above.
(328) Marker genes were amplified and sequenced from the extracted DNA. For the bacterial and archaeal analyses, the V4 hypervariable region of the 16S rRNA gene was targeted (primers 515f/806r), and for fungi, the first internal transcribed spacer (ITS1) region of the rRNA operon (primers ITS1f/ITS2r) was targeted. The two marker genes were PCR amplified separately using 35 cycles, and error-correcting 12-bp barcoded primers specific to each sample were used to facilitate combining of samples. To reduce the amplification of chloroplast and mitochondrial DNA, PNA clamps specific to the rRNA genes in these organelles were used. PCR reactions to amplify 16S rRNA genes followed the protocol of (Lundberg et al. 2013), and those to amplify ITS regions followed the protocol of (Fierer et al. 2012). PCR products were quantified using the PicoGreen assay (Life Technologies, Inc., Grand Island, N.Y.), pooled in equimolar concentrations, and cleaned using the UltraClean kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.). Cleaned DNA pools were sequenced on an Illumina MiSeq instrument at the University of Colorado Next Generation Sequencing Facility.
(329) OTU Assignment
(330) For both 16S rRNA and ITS1 sequences, the raw sequence data were reassigned to distinct samples using a custom Python script, and quality filtering and OTU (i.e. operational taxonomic unit) clustering was conducted using the UPARSE pipeline (Edgar 2013). Briefly, a de novo sequence database with representative sequences for each OTU was created using a 97% similarity threshold, and raw reads were mapped to this database to calculate sequence counts per OTU per sample. Prior to creating the database, sequences were quality filtered using an expected error frequency threshold of 0.5 errors per sequence. In addition, sequences were dereplicated and singletons were removed prior to creating the database. OTUs were provided taxonomic classifications using the RDP classifier (Wang et al. 2007) trained with the Greengenes (McDonald et al. 2012) and UNITE (Abarenkov et al. 2010) databases for 16S rRNA and ITS sequences, respectively. To account for differences in the variable number of sequences per sample, each sample was rarefied to 1000 16S rRNA and 1000 ITS sequences per sample. OTUs classified as chloroplasts or mitochondria were discarded prior to rarefaction.
(331) Overall differences in bacterial community composition between the control and inoculated plants were evaluated using non-metric multidimensional scaling based on Bray-Curtis dissimilarities in order to visualize pairwise differences between sample communities. Permutational analysis of variance (PERMANOVA) was used to statistically test the significance of these differences. Analyses were conducted using the vegan package in R (R Core Team 2013). To determine the OTUs contributing to overall differences among crop types, mean relative abundances were calculated for each OTU within each crop type. Only OTUs with a mean relative abundance of 0.1% in either group were included in this analysis.
(332) Results
(333) Across seeds from all plants analyzed herein, a total of 144 bacterial and 145 fungal OTUs were detected and evaluated (Table 3 and Table 4) following stringent sequence quality filtering approach. Among all OTUs, 28 bacterial OTUs and 20 fungal OTUs were found to be core taxa within seeds across plants (Table 1 and Table 2).
(334) TABLE-US-00002 TABLE 3 Exemplary bacterial endophytes present in all plants. SEQ ID OTU_ID NO Phylum Class Order Family Genus Species OTU_558 1 OD1 ABY1 OTU_762 2 Actinobacteria Actinobacteria Actinomycetales Microbacteriaceae OTU_136 3 Actinobacteria Actinobacteria Actinomycetales Streptomycetaceae Streptomyces OTU_161 4 Actinobacteria Actinobacteria Actinomycetales Corynebacteriaceae Corynebacterium OTU_309 5 Actinobacteria Actinobacteria Actinomycetales Corynebacteriaceae Corynebacterium OTU_63 6 Actinobacteria Actinobacteria Actinomycetales Geodermatophilaceae OTU_67 7 Actinobacteria Actinobacteria Actinomycetales Sanguibacteraceae Sanguibacter OTU_1203 8 Actinobacteria Actinobacteria Actinomycetales Microbacteriaceae Rathayibacter caricis OTU_364 9 Actinobacteria Actinobacteria Actinomycetales Micrococcaceae Microbispora rosea OTU_130 10 Actinobacteria Actinobacteria Actinomycetales Nocardiaceae Rhodococcus fascians OTU_74 11 Actinobacteria Actinobacteria Actinomycetales Kineosporiaceae Kineococcus OTU_41 12 Actinobacteria Actinobacteria Actinomycetales Microbacteriaceae OTU_24 13 Actinobacteria Actinobacteria Actinomycetales Microbacteriaceae OTU_1230 14 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_30 15 Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae Mycoplana OTU_799 16 Proteobacteria Alphaproteobacteria Rhizobiales Rhizobiaceae Agrobacterium OTU_101 17 Proteobacteria Alphaproteobacteria Rhizobiales Aurantimonadaceae OTU_572 18 Proteobacteria Alphaproteobacteria Rhizobiales Phyllobacteriaceae Mesorhizobium OTU_153 19 Proteobacteria Alphaproteobacteria Rhizobiales Hyphomicrobiaceae Devosia OTU_140 20 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_194 21 Proteobacteria Alphaproteobacteria Rhizobiales Methylocystaceae OTU_158 22 Proteobacteria Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_124 23 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas wittichii OTU_188 24 Proteobacteria Alphaproteobacteria Rhodospirillales Acetobacteraceae OTU_1287 25 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Novosphingobium OTU_971 26 Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae Rhodobacter OTU_20 27 Proteobacteria Alphaproteobacteria Rhizobiales Aurantimonadaceae OTU_57 28 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Novosphingobium OTU_49 29 Proteobacteria Alphaproteobacteria Rhizobiales Methylobacteriaceae OTU_1222 30 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_80 31 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_436 32 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_1077 33 Proteobacteria Alphaproteobacteria Rhizobiales Methylobacteriaceae Methylobacterium adhaesivum OTU_510 34 Proteobacteria Alphaproteobacteria Rhodospirillales Rhodospirillaceae Azospirillum OTU_43 35 Proteobacteria Alphaproteobacteria Rhizobiales Methylobacteriaceae Methylobacterium adhaesivum OTU_65 36 Proteobacteria Alphaproteobacteria Rhodospirillales Acetobacteraceae OTU_64 37 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas wittichii OTU_27 38 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_47 39 Proteobacteria Alphaproteobacteria Rhizobiales Methylobacteriaceae Methylobacterium OTU_15 40 Proteobacteria Alphaproteobacteria Rhizobiales Rhizobiaceae Agrobacterium OTU_956 41 Proteobacteria Alphaproteobacteria Rhizobiales Methylobacteriaceae Methylobacterium adhaesivum OTU_21 42 Proteobacteria Alphaproteobacteria Rhizobiales Methylobacteriaceae Methylobacterium OTU_14 43 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_6 44 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_1436 45 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_61 46 Firmicutes Bacilli Bacillales Paenibacillaceae Paenibacillus OTU_77 47 Firmicutes Bacilli Lactobacillales Leuconostocaceae Leuconostoc OTU_358 48 Firmicutes Bacilli Bacillales Bacillaceae Bacillus badius OTU_353 49 Firmicutes Bacilli Bacillales Paenibacillaceae Paenibacillus OTU_1250 50 Firmicutes Bacilli Bacillales Planococcaceae Sporosarcina ginsengi OTU_84 51 Firmicutes Bacilli Bacillales Bacillaceae OTU_34 52 Firmicutes Bacilli Bacillales Bacillaceae Bacillus cereus OTU_98 53 Firmicutes Bacilli Bacillales Paenibacillaceae Paenibacillus OTU_152 54 Firmicutes Bacilli Bacillales Paenibacillaceae Paenibacillus OTU_1178 55 Firmicutes Bacilli Bacillales Planococcaceae Planomicrobium OTU_299 56 Firmicutes Bacilli Lactobacillales Leuconostocaceae Leuconostoc OTU_241 57 Firmicutes Bacilli Lactobacillales Carnobacteriaceae Carnobacterium OTU_203 58 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus OTU_25 59 Firmicutes Bacilli Bacillales Paenibacillaceae OTU_17 60 Firmicutes Bacilli Bacillales Bacillaceae Bacillus OTU_330 61 Firmicutes Bacilli Lactobacillales Lactobacillaceae OTU_211 62 Firmicutes Bacilli Lactobacillales Enterococcaceae Enterococcus OTU_108 63 Firmicutes Bacilli Bacillales Staphylococcaceae Staphylococcus OTU_19 64 Firmicutes Bacilli Bacillales Paenibacillaceae Paenibacillus amylolyticus OTU_16 65 Firmicutes Bacilli Bacillales [Exiguobacteraceae] Exiguobacterium OTU_372 66 Firmicutes Bacilli Bacillales Sporolactobacillaceae Bacillus racemilacticus OTU_222 67 Firmicutes Bacilli Bacillales Bacillaceae Geobacillus OTU_653 68 Firmicutes Bacilli Bacillales Bacillaceae Bacillus endophyticus OTU_11 69 Firmicutes Bacilli Bacillales Paenibacillaceae Paenibacillus OTU_71 70 Firmicutes Bacilli Bacillales Paenibacillaceae Saccharibacillus kuerlensis OTU_13 71 Firmicutes Bacilli Bacillales Bacillaceae Bacillus flexus OTU_10 72 Firmicutes Bacilli Bacillales Planococcaceae Sporosarcina ginsengi OTU_118 73 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Comamonas OTU_676 74 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Limnohabitans OTU_1014 75 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Janthinobacterium OTU_26 76 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_182 77 Proteobacteria Betaproteobacteria Burkholderiales Alcaligenaceae Pigmentiphaga OTU_980 78 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Janthinobacterium lividum OTU_35 79 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Polaromonas OTU_1226 80 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae OTU_1068 81 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_1252 82 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae OTU_113 83 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Janthinobacterium OTU_39 84 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae OTU_345 85 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Ralstonia OTU_168 86 Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae OTU_7 87 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Janthinobacterium OTU_1344 88 Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_87 89 Firmicutes Clostridia Clostridiales Clostridiaceae Clostridium butyricum OTU_206 90 Firmicutes Clostridia Clostridiales Clostridiaceae Clostridium intestinale OTU_258 91 Firmicutes Clostridia Clostridiales Clostridiaceae OTU_342 92 Firmicutes Clostridia Clostridiales Clostridiaceae Thermoanaero- saccharolyticum bacterium OTU_259 93 Firmicutes Clostridia Thermoanaero- Caldicell- Caldicellulosiruptor saccharolyticus bacterales ulosiruptoraceae OTU_428 94 Firmicutes Clostridia Thermoanaero- Carboxydocellaceae Carboxydocella bacterales OTU_485 95 Bacteroidetes Cytophagia Cytophagales Cytophagaceae Hymenobacter OTU_1306 96 Bacteroidetes Cytophagia Cytophagales Cytophagaceae Hymenobacter OTU_735 97 Bacteroidetes Cytophasia Cytophagales Cytophagaceae Hymenobacter OTU_37 98 Bacteroidetes Cytophagia Cytophagales Cytophagaceae Hymenobacter OTU_775 99 Bacteroidetes Cytophagia Cytophagales Cytophagaceae Hymenobacter OTU_141 100 Bacteroidetes Cytophagia Cytophagales Cytophagaceae Hymenobacter OTU_149 101 Proteobacteria Deltaproteobacteria Myxococcales Cystobacterineae OTU_70 102 Bacteroidetes Flavobacteriia Flavobacteriales [Weeksellaceae] Chryseobacterium OTU_23 103 Bacteroidetes Flavobacteriia Flavobacteriales [Weeksellaceae] Chryseobacterium OTU_236 104 Bacteroidetes Flavobacteriia Flavobacteriales [Weeksellaceae] Chryseobacterium OTU_148 105 Bacteroidetes Flavobacteriia Flavobacteriales [Weeksellaceae] Chryseobacterium OTU_181 106 Bacteroidetes Flavobacteriia Flavobacteriales [Weeksellaceae] Chryseobacterium OTU_347 107 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_1190 108 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Yersinia OTU_1201 109 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Enterobacter hormaechei OTU_679 110 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas fragi OTU_234 111 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_46 112 Proteobacteria Gammaproteobacteria Pseudomonadales Moraxellaceae Acinetobacter lwoffii OTU_1274 113 Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Stenotrophomonas maltophilia OTU_1303 114 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_401 115 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_1261 116 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_548 117 Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Stenotrophomonas OTU_132 118 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas veronii OTU_1343 119 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_22 120 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_163 121 Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Stenotrophomonas OTU_771 122 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas OTU_826 123 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas OTU_166 124 Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Xanthomonas OTU_1441 125 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_1158 126 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Serratia marcescens OTU_1083 127 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_8 128 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_18 129 Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Xanthomonas axonopodis OTU_51 130 Proteobacteria Gammaproteobacteria Oceanospirillales Halomonadaceae Halomonas OTU_72 131 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas viridiflava OTU_9 132 Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas OTU_696 133 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Escherichia coli OTU_53 134 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Enterobacter OTU_4 135 Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Pantoea agglomeraris OTU_220 136 Tenericutes Mollicutes Anaeroplasmatales Anaeroplasmataceae Asteroleplasma OTU_343 137 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_82 138 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter OTU_69 139 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_36 140 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter OTU_1386 141 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter OTU_1165 142 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter cryoconitis OTU_368 143 Bacteroidetes Sphingobacteriia Sphingobacteriales Sphingobacteriaceae Pedobacter OTU_91 144 Cyanobacteria
(335) TABLE-US-00003 TABLE 4 Exemplary fungal endophytes present in all plants SEQ ID OTU_ID NO Phylum Class Order Family Genus Species OTU_288 145 Basidiomycota Agaricomycetes Corticiales Corticiaceae Waitea circinata var circinata OTU_327 146 Basidiomycota Agaricomycetes Cantharellales Ceratobasidiaceae Thanatephorus cucumeris OTU_1 147 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria sp MY_2011 OTU_2 148 Ascomycota Dothideomycetes Capnodiales Mycosphaerellaceae Cladosporium OTU_12 149 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Davidiella tassiana OTU_9 150 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Lewia infectoria OTU_29 151 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Epicoccum nigrum OTU_15 152 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Ulocladium OTU_55 153 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Cladosporium OTU_10 154 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma sp P48E5 OTU_133 155 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Cladosporium sp ascomyc1 OTU_26 156 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae unidentified Phaeosphaeriaceae sp MJ23 OTU_47 157 Ascomycota Dothideomycetes OTU_24 158 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae OTU_522 159 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae Ampelomyces quisqualis OTU_66 160 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Dendryphiella arenaria OTU_23 161 Ascomycota Dothideomycetes Capnodiales Mycosphaerellaceae Septoria phalaridis OTU_71 162 Ascomycota Dothideomycetes Pleosporales OTU_27 163 Ascomycota Dothideomycetes Pleosporales Incertae sedis OTU_32 164 Ascomycota Dothideomycetes Dothideales Dothioraceae Aureobasidium OTU_20 165 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae unidentified Phaeosphaeriaceae sp MJ23 OTU_16 166 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma OTU_44 167 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Cladosporium sp 234B OTU_38 168 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae OTU_104 169 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria brassicicola OTU_1123 170 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae unidentified Phaeosphaeriaceae sp MJ23 OTU_90 171 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae Ampelomyces quisqualis OTU_48 172 Ascomycota Dothideomycetes Incertae sedis Incertae sedis Leptospora rubella OTU_73 173 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma rhei OTU_1432 174 Ascomycota Dothideomycetes Pleosporales Leptosphaeriaceae unidentified uncultured Epicoccum OTU_1095 175 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Lewia infectoria OTU_486 176 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae Parastagonospora caricis OTU_110 177 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Cladosporium sp ascomyc1 OTU_78 178 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae Phaeosphaeria OTU_83 179 Ascomycota Dothideomycetes unidentified unidentified unidentified Dothideomycetes sp OTU_815 180 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria sp MY_2011 OTU_244 181 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Cladosporium sphaerospermum OTU_775 182 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Alternaria sp MY_2011 OTU_259 183 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Lewia infectoria OTU_447 184 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma macrostoma OTU_1429 185 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma sp P48E5 OTU_122 186 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma macrostoma OTU_82 187 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae unidentified Phaeosphaeriaceae sp OTU_324 188 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Lewia infectoria OTU_60 189 Ascomycota Dothideomycetes Pleosporales Pleosporaceae Cochliobolus OTU_142 190 Ascomycota Dothideomycetes Incertae sedis Pseudeurotiaceae Pseudeurotium OTU_92 191 Ascomycota Dothideomycetes Capnodiales Mycosphaerellaceae Cercospora nicotianae OTU_87 192 Ascomycota Dothideomycetes Capnodiales Mycosphaerellaceae Mycosphaerella punctiformis OTU_99 193 Ascomycota Dothideomycetes Pleosporales Leptosphaeriaceae OTU_1316 194 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma OTU_138 195 Ascomycota Dothideomycetes Capnodiales Davidiellaceae Cladosporium OTU_992 196 Ascomycota Dothideomycetes Dothideales Dothioraceae Aureobasidium pullulans OTU_378 197 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma OTU_353 198 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma OTU_227 199 Ascomycota Dothideomycetes Pleosporales Incertae sedis OTU_68 200 Ascomycota Dothideomycetes Pleosporales Incertae sedis Phoma paspali OTU_680 201 Ascomycota Dothideomycetes OTU_97 202 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae unidentified Phaeosphaeriaceae sp MJ23 OTU_115 203 Ascomycota Dothideomycetes Pleosporales Phaeosphaeriaceae Phaeosphaeria OTU_22 204 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium OTU_262 205 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium citrinum OTU_17 206 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Aspergillus niger OTU_28 207 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium bialowiezense OTU_21 208 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae unidentified uncultured Eurotium OTU_938 209 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium OTU_64 210 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium spinulosum OTU_105 211 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Emericella nidulans OTU_527 212 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium bialowiezense OTU_121 213 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium OTU_77 214 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Aspergillus flavus OTU_340 215 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Penicillium OTU_186 216 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Talaromyces OTU_131 217 Ascomycota Eurotiomycetes Eurotiales Trichocomaceae Emericella nidulans OTU_18 218 Zygomycota Incertae sedis Mucorales Rhizopodaceae Rhizopus oryzae OTU_6 219 Ascomycota Leotiomycetes Helotiales Helotiaceae OTU_42 220 Ascomycota Leotiomycetes Erysiphales Erysiphaceae Erysiphe cruciferarum OTU_125 221 Ascomycota Leotiomycetes Helotiales Sclerotiniaceae Botrytis sp CID95 OTU_50 222 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces oryzicola OTU_37 223 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces roseus OTU_1406 224 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces OTU_72 225 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces ruberrimus OTU_1184 226 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces roseus OTU_70 227 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis unidentified Sporidiobolales sp OTU_65 228 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Rhodosporidium diobovatum OTU_103 229 Basidiomycota Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces symmetricus OTU_53 230 Ascomycota Saccharomycetes Saccharomycetales Pichiaceae Pichia fermentans OTU_94 231 Ascomycota Saccharomycetes Saccharomycetales Saccharomycodaceae Hanseniaspora uvarum OTU_86 232 Ascomycota Saccharomycetes Saccharomycetales Saccharomycodaceae Hanseniaspora thailandica OTU_5 233 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium OTU_11 234 Ascomycota Sordariomycetes Xylariales Incertae sedis Monographella sp 68 OTU_13 235 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium culmorum OTU_25 236 Ascomycota Sordariomycetes Sordariales OTU_120 237 Ascomycota Sordariomycetes Hypocreales Incertae sedis Acremonium sp 2 J12 OTU_1072 238 Ascomycota Sordariomycetes Hypocreales Nectriaceae Gibberella intricans OTU_58 239 Ascomycota Sordariomycetes Hypocreales Nectriaceae Gibberella intricans OTU_62 240 Ascomycota Sordariomycetes Hypocreales OTU_30 241 Ascomycota Sordariomycetes Hypocreales Nectriaceae Gibberella baccata OTU_56 242 Ascomycota Sordariomycetes Hypocreales Incertae sedis Acremonium sp 4053 OTU_209 243 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium petroliphilum OTU_34 244 Ascomycota Sordariomycetes Incertae sedis Plectosphaerellaceae Gibellulopsis sp YH_2012 OTU_45 245 Ascomycota Sordariomycetes Xylariales Incertae sedis Monographella cucumerina OTU_100 246 Ascomycota Sordariomycetes Hypocreales unidentified unidentified OTU_877 247 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium sporotrichioides OTU_682 248 Ascomycota Sordariomycetes Hypocreales Nectriaceae OTU_81 249 Ascomycota Sordariomycetes Diaporthales Diaporthaceae Phomopsis sp MAFF 239532 OTU_238 250 Ascomycota Sordariomycetes Sordariales Lasiosphaeriaceae unidentified Lasiosphaeriaceae sp OTU_85 251 Ascomycota Sordariomycetes Sordariales Chaetomiaceae Chaetomium globosum OTU_525 252 Ascomycota Sordariomycetes OTU_106 253 Ascomycota Sordariomycetes Incertae sedis Glomerellaceae Colletotrichum acutatum OTU_150 254 Ascomycota Sordariomycetes Hypocreales Incertae sedis Acremonium dichromosporum OTU_1278 255 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium sporotrichioides OTU_1403 256 Ascomycota Sordariomycetes Xylariales Incertae sedis Monographella sp 68 OTU_160 257 Ascomycota Sordariomycetes Incertae sedis Plectosphaerellaceae Lectera longa OTU_1214 258 Ascomycota Sordariomycetes Hypocreales Nectriaceae Gibberella intricans OTU_181 259 Ascomycota Sordariomycetes Hypocreales Cordycipitaceae Engyodontium album OTU_172 260 Ascomycota Sordariomycetes Hypocreales Nectriaceae Fusarium poae OTU_19 261 Basidiomycota Tremellomycetes unidentified unidentified unidentified uncultured Cryptococcus OTU_40 262 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus OTU_74 263 Basidiomycota Tremellomycetes Tremellales Incertae sedis Cryptococcus victoriae OTU_163 264 Basidiomycota Tremellomycetes Tremellales unidentified unidentified Tremellales sp TG05 OTU_52 265 Basidiomycota Tremellomycetes Tremellales Incertae sedis Cryptococcus victoriae OTU_325 266 Basidiomycota Tremellomycetes Tremellales Incertae sedis Hannaella OTU_128 267 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus wieringae OTU_180 268 Basidiomycota Tremellomycetes Tremellales Incertae sedis Cryptococcus laurentii OTU_46 269 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus oeirensis OTU_174 270 Basidiomycota Tremellomycetes Tremellales Incertae sedis Cryptococcus sp VP_2009b OTU_69 271 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus oeirensis OTU_80 272 Basidiomycota Tremellomycetes Cystofilobasidiales Cystofilobasidiaceae Udeniomyces puniceus OTU_96 273 Basidiomycota Tremellomycetes Cystofilobasidiales Cystofilobasidiaceae Udeniomyces pyricola OTU_51 274 Basidiomycota Tremellomycetes Tremellales Incertae sedis Bullera Bullera unica OTU_109 275 Basidiomycota Tremellomycetes Tremellales Incertae sedis Dioszegia fristingensis OTU_222 276 Basidiomycota Tremellomycetes Cystofilobasidiales Cystofilobasidiaceae Cystofilobasidium infirmominiatum OTU_1054 277 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus oeirensis OTU_971 278 Basidiomycota Tremellomycetes unidentified unidentified unidentified Tremellomycetes sp OTU_79 279 Basidiomycota Tremellomycetes Tremellales Incertae sedis Hannaella luteola OTU_135 280 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus albidus OTU_166 281 Basidiomycota Tremellomycetes Tremellales Incertae sedis Cryptococcus victoriae OTU_111 282 Basidiomycota Tremellomycetes unidentified unidentified unidentified Tremellomycetes sp OTU_158 283 Basidiomycota Tremellomycetes unidentified unidentified unidentified Tremellomycetes sp OTU_91 284 Basidiomycota Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus albidus OTU_127 285 Basidiomycota Tremellomycetes Tremellales Incertae sedis Hannaella OTU_1103 286 Basidiomycota Wallemiomycetes Wallemiales Wallemiaceae Wallemia sebi OTU_54 287 Basidiomycota Wallemiomycetes Wallemiales Wallemiaceae Wallemia muriae OTU_114 288 Basidiomycota Wallemiomycetes Wallemiales Wallemiaceae Wallemia sebi OTU_1326 289 Basidiomycota Wallemiomycetes Wallemiales Wallemiaceae Wallemia muriae
(336) TABLE-US-00004 TABLE 1 Exemplary core bacterial endophytes SEQ ID OTU_ID NO Phylum Class Order Family Genus Species OTU_47 39 Alphaproteobacteria Rhizobiales Methylobacteriaceae Methylobacterium OTU_14 43 Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_6 44 Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas OTU_25 59 Bacilli Bacillales Paenibacillaceae OTU_19 64 Bacilli Bacillales Paenibacillaceae Paenibacillus amylolyticus OTU_16 65 Bacilli Bacillales [Exiguobacteraceae] Exiguobacterium OTU_222 67 Bacilli Bacillales Bacillaceae Geobacillus OTU_653 68 Bacilli Bacillales Bacillaceae Bacillus endophyticus OTU_11 69 Bacilli Bacillales Paenibacillaceae Paenibacillus OTU_71 70 Bacilli Bacillales Paenibacillaceae Saccharibacillus kuerlensis OTU_13 71 Bacilli Bacillales Bacillaceae Bacillus flexus OTU_1014 75 Betaproteobacteria Burkholderiales Oxalobacteraceae Janthinobacterium OTU_168 86 Betaproteobacteria Burkholderiales Comamonadaceae OTU_7 87 Betaproteobacteria Burkholderiales Oxalobacteraceae Janthinobacterium OTU_1344 88 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_1303 114 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_401 115 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_1261 116 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_771 122 Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas OTU_1441 125 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_1158 126 Gammaproteobacteria Enterobacteriales Enterobacteriaceae Serratia marcescens OTU_8 128 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_18 129 Gammaproteobacteria Xanthomonadales Xanthomonadaceae Xanthomonas axonopodis OTU_51 130 Gammaproteobacteria Oceanospirillales Halomonadaceae Halomonas OTU_9 132 Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas OTU_696 133 Gammaproteobacteria Enterobacteriales Enterobacteriaceae Escherichia coli OTU_53 134 Gammaproteobacteria Enterobacteriales Enterobacteriaceae Enterobacter OTU_4 135 Gammaproteobacteria Enterobacteriales Enterobacteriaceae Pantoea agglomerans
(337) TABLE-US-00005 TABLE 2 Exemplary core fungal endophytes OTU_ID SEQ ID NO Phylum Class Order Family Genus Species OTU_1 147 Dothideomycetes Pleosporales Pleosporaceae Alternaria sp MY_2011 OTU_2 148 Dothideomycetes Capnodiales Mycosphaerellaceae unidentified uncultured Cladosporium OTU_12 149 Dothideomycetes Capnodiales Davidiellaceae Davidiella tassiana OTU_9 150 Dothideomycetes Pleosporales Pleosporaceae Lewia infectoria OTU_815 180 Dothideomycetes Pleosporales Pleosporaceae Alternaria sp MY_2011 OTU_775 182 Dothideomycetes Pleosporales Pleosporaceae Alternaria sp MY_2011 OTU_22 204 Eurotiomycetes Eurotiales Trichocomaceae Penicillium OTU_6 219 Leotiomycetes Helotiales Helotiaceae OTU_50 222 Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces oryzicola OTU_37 223 Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces roseus OTU_1406 224 Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces OTU_1184 226 Microbotryomycetes Sporidiobolales Incertae sedis Sporobolomyces roseus OTU_5 233 Sordariomycetes Hypocreales Nectriaceae Fusarium OTU_1072 238 Sordariomycetes Hypocreales Nectriaceae Gibberella intricans OTU_58 239 Sordariomycetes Hypocreales Nectriaceae Gibberella intricans OTU_682 248 Sordariomycetes Hypocreales Nectriaceae OTU_19 261 Tremellomycetes unidentified unidentified unidentified uncultured Cryptococcus OTU_40 262 Tremellomycetes Filobasidiales Filobasidiaceae Cryptococcus OTU_52 265 Tremellomycetes Tremellales Incertae sedis Cryptococcus victoriae OTU_166 281 Tremellomycetes Tremellales Incertae sedis Cryptococcus victoriae
Example 2Identification and Characterization of Culturable Bacterial and Fungal Endophytes Belonging to Core OTUs
(338) In order to better understand the role played by core seed-derived endophytic microbes in improving the vigor, general health and stress resilience of agricultural plants, we initiated a systematic screen to isolate and characterize endophytic microbes from seeds and tissues of commercially significant agricultural plants.
(339) Seeds from diverse types of cereals, fruits, vegetables, grasses, oilseed, and other seeds were acquired and screened for cultivatable microbes, as described below. Culturable microbes (i.e., SYM strains) belonging to the same OTUs as the core OTUs described in Table 1 and Table 2 were isolated and identified.
(340) Isolation of Bacteria and Fungi from the Interior of Seeds
(341) Isolation of fungi and bacteria (including endophytes) from the interior of surface-sterilized seeds was performed using techniques known in the art. Surface sterilized seeds were ground, diluted in liquid media, and the suspension used to inoculate solid media plates. These were incubated under different conditions at room temperature.
Experiment Description
(342) Approximately fifty surface-sterilized seeds were transferred aseptically to a sterile blender and ground. The ground seeds were resuspended in 50 mL of sterile R2A broth, and incubated for 4 h at room temperature. Ten 1 mL aliquots of the seed homogenates were collected and centrifuged, their supernatants discarded and the pellets gently resuspended in 1 mL of sterile 0.05 phosphate buffer; 0.5 mL of 50% glycerol is added to each of five tubes. These were stored at 80 C for further characterization. The remaining aliquots were diluted down twice in hundred-fold dilutions to 10.sup.4. 100 microliters of the 1, 10.sup.2, and 10.sup.4 dilutions were used to inoculate three Petri dishes containing the following media in order to isolate of bacteria and/or fungi: 1. Tryptic Soy agar 2. R2A agar 3. Potato dextrose agar 4. Sabouraud Agar 5. Other media depending on target microorganism
(343) The plates were divided into three sets comprising each media type and incubated in different environments. The first set was incubated aerobically, the second under anaerobic conditions, and the third under microaerophilic conditions and all were inspected daily for up to 5 days. 1-2 individual colonies per morphotype were isolated and streaked for purity onto fresh plates of the same media/environment from which the microorganism was isolated. Plates were incubated at room temperature for 2-5 days. After an isolate grew it was streaked once more onto a fresh plate of the same media to ensure purity and incubated under the same environmental conditions.
(344) From the second streaked plate, isolates were stored in Tryptic soy broth +15% glycerol at 80 C. for further characterization, by first scraping 2-3 colonies (about 10 L) from the plate into a cryogenic tube containing 1.5 mL of the above-mentioned media and gently resuspending the cells. Alternatively, isolates were propagated in specialized media as recommended for the particular taxon of microorganism. The microbes obtained represent those that live in the seeds of the plant accession.
(345) Isolation of Bacteria and Fungi from Plant Interior Tissues
(346) Isolation of fungi and bacteria (including endophytes) from surface-sterilized plant tissues was performed using techniques known in the art. Surface sterilized plant tissues were ground, diluted in liquid media, and then this suspension was used to inoculate solid media plates. These were incubated under different environmental conditions at room temperature.
Experiment Description
(347) Approximately fifty grams of surface-sterilized plant tissue were transferred aseptically to a sterile blender and ground. The ground tissue was resuspended in 50 mL of sterile R2A broth, and incubated for 4 h at room temperature. Ten 1 mL aliquots of the plant tissue homogenates were collected and centrifuged, their supernatants discarded and the pellets gently resuspended in 1 mL of sterile 0.05 phosphate buffer. 0.5 mL of 50% Glycerol was added to each of five tubes. These were stored at 80 C. for possible further characterization. The remaining aliquots were diluted down twice in hundred-fold dilutions to 10.sup.4. One hundred microliters of the 1, 10.sup.2, and 10.sup.4 dilutions were used to inoculate three Petri dishes containing the following media in order to isolate of bacteria and/or fungi: 1. Tryptic Soy agar 2. R2A agar 3. Potato dextrose agar 4. Sabouraud Agar 5. Other media depending on target microorganism
(348) Plates were divided into three sets comprising each media type and incubated in different environments. The first set was incubated aerobically, the second under anaerobic conditions, and the third under microaerophilic conditions and all were inspected daily for up to 5 days. 1-2 individual colonies per morphotype were isolated and streaked for purity onto fresh plates of the same media/environment from which the microorganism was isolated. Plates were incubated at room temperature for 2-5 days. After an isolate grew it was streaked once more onto a fresh plate of the same media to ensure purity and incubated under the same environmental conditions.
(349) From the second streaked plate, isolates were stored in Tryptic soy broth +15% glycerol at 80 C. for further characterization, by first scraping 2-3 colonies (about 10 L) from the plate into a cryogenic tube containing 1.5 mL of the above-mentioned media and gently resuspending the cells. Alternatively, isolates were propagated in specialized media as recommended for the particular taxon of microorganism.
(350) Isolation of Bacteria and Fungi from Plant or Seed Surfaces
(351) To collect phyllosphere, rhizosphere, or spermosphere material for culturing of microbes, unwashed shoot, roots or seeds were shaken free/cleaned of any attached soil and stuffed into sterile 50 mL Falcon tubes. To these, 10 mL of sterile 0.1 M sodium phosphate buffer was added and shaken, followed by 5 minutes of sonication to dislodge microbes from plant surfaces, with the resulting cloudy or muddy wash collected in a separate 15 mL Falcon tube. 100 L of this microbe filled wash was directly spread onto agar plates or nutrient broth for culturing and enrichment, or it was further diluted with sterile 0.1 M sodium phosphate buffer by 10, 100, 1,000, 10,000 and even 100,000, before microbial culturing on agar plates or nutrient broth. Glycerol stock preparations of the plant surface wash solution were made at this point by mixing 1 mL of the soil wash solution and 0.5 mL of sterile, 80% glycerol, flash freezing the preparation in a cryotube dipped in liquid nitrogen, and storing at 80 C. Nutrient broth inoculated with a mixture of plant surface bacteria forms a stable, mixed community of microbes which was used in plant inoculation experiments described herein, subcultured in subsequent broth incubations, or spread on agar plates and separated into individual colonies which were tested via methods described herein.
(352) Characterization of Fungal and Bacterial Isolates
(353) Characterization of fungi and bacteria isolated from surface-sterilized or non-sterilized plant or seed tissues was performed using techniques known in the art. These techniques take advantage of differential staining of microorganisms, morphological characteristics of cells, spores, or colonies, biochemical reactions that provide differential characterization, and DNA amplification and sequencing of diagnostic regions of genes, among other methods.
(354) Experimental Description
(355) Isolates of bacteria and/or fungi isolated as described herein (including endophytic bacteria and fungi) were categorized into three types: bacterial isolates, fungal isolates, and unknown isolates (since yeast colonies can resemble bacterial colonies in some cases) based on colony morphology, formation of visible mycelia, and/or formation of spores. To determine if an unknown isolate was bacterial or fungal, microscopic analysis of the isolates was performed. Some of the analyses known to the art to differentiate microorganisms include, but are not limited to: the 10% KOH test, positive staining with Lactophenol cotton blue, Gram staining, and growth on media with selective agents. The distinguishing features observed by these tests are relative cell size (yeast size is much larger than bacterial size), formation of hyphae and spores (filamentous bacteria form smaller hyphae than fungi, and do not form structures containing spores), or growth under selection agents (most bacteria can grow in the presence of antifungal compounds like nystatin, while most fungi cannot; likewise, most fungi are unaffected by the presence of broad-spectrum antibiotics like chloramphenicol and spectinomycin).
(356) To identify the isolates, DNA sequence analysis of conserved genomic regions like the ribosomal DNA loci was performed. To obtain DNA to perform PCR amplifications, some cellular growth from solid media (approximately 5-10 L) was resuspended in 30 L of sterile Tris/EDTA buffer (pH 8.0). Samples were heated to 98 C. for 10 minutes followed by cooling down to 4 C. for 1 minute in a thermocycler. This cycle was repeated twice. Samples were then centrifuged at 13,000 RCF for 1-5 minutes and used as DNA template for PCR reactions. Below is a series of exemplary primer combinations used to identify isolates to a genus level.
(357) TABLE-US-00006 TABLE5 Exemplaryprimercombinationsforisolateidentificationatagenuslevel Primer1 Primer2 Target V4_515F(5- V4_806R(5- The4.sup.thVariableregionofthe GTGCCAGCMGCCGCGGTAA- GGACTACHVGGGTWTCTAAT-3) bacterial16SrDNA 3)(SEQIDNO:453) (SEQIDNO:454) 27F(5- 1492R(5- Fulllengthofthebacterial16S AGAGTTTGATCCTGGCTCAG- GGTTACCTTGTTACGACTTT-3) rDNA,fromposition8-1507. 3)(SEQIDNO:455) (SEQIDNO:456) ITS1(5- ITS2(5- ~240bpITS1regionoffungal TCCGTAGGTGAACCTGCGG- GCTGCGTTCTTCATCGATGC-3) genome 3)(SEQIDNO:457) (SEQIDNO:458) SR1R(5- SR6(5-TGTTACGACTTTTACTT- Smallsubunit(18s)ofthe TACCTGGTTGATQCTGCCAGT- 3)(SEQIDNO:460) fungalrDNAgene 3)(SEQIDNO:459) ITS1F(5- ITS4(5- ~600-1000bpITSregionof CTTGGTCATTTAGAGGAAGTA TCCTCCGCTTATTGATATGC-3) fungalgenomes A-3)(SEQIDNO:461) (SEQIDNO:462) ITS5(Universal)(5- ITS4Asco(Ascomycota-specific):5 ~500bpfragmentfrom GGAAGTAAAAGTCGTAACAA CGTTACTRRGGCAATCCCTGTTG3 differentfungalPhyla GG-3)(SEQIDNO:463) (SEQIDNO:464)or ITS4Basidio(Basidiomycota- specific):5 GCRCGGAARACGCTTCTC3 (SEQ IDNO:465);or ITS4Chytrid(Chytridiomycota- specific):5 TTTTCCCGTTTCATTCGCCA3 (SEQIDNO:466);or ITS4Oo(Oomycota-specific):5 ATAGACTACAATTCGCC3 (SEQ IDNO:467);or ITS4Zygo(Zygomycota-specific):5 AAAACGTWTCTTCAAA3 (SEQ IDNO:468) SSUmAf-(equimolarmixof2 LSUmAr(equimolarmixof4 1000-1600bpfragmentofthe degenerateprimers)andSSUmCf degenerateprimers)andLSUmBr Glomerycota(arbuscular equimolarmixof3degenerate (equimolarmixof5degenerate mycorrhizae)genome primers) primers) comprisingpartialSSU,whole internaltranscribedspacer (ITS)rDNAregionandpartial LSU. Arch340F(5- Arch1000R(5- ~660bpproductofthe18S CCCTAYGGGGYGCASCAG-3) GAGARGWRGTGCATGGCC-3) fromArchaea (SEQIDNO:469) (SEQIDNO:470) 27F-Degen(5- 27F-Degen(5- Fulllengthofthebacterial16S AGRRTTYGATYMTGGYTYAG- HGGHTACCTTGTTACGACTT-3) rDNA,fromposition8-1507. 3)(SEQIDNO:471) (SEQIDNO:472) and799f(5- AACMGGATTAGATACCCKG- 3)(SEQIDNO:473)
(358) To decrease background noise due to the non-specific binding of primers to DNA, the thermocycler was programmed for a touchdown-PCR, which increased specificity of the reaction at higher temperatures and increased the efficiency towards the end by lowering the annealing temperature. Exemplary conditions for performing Touchdown PCR are shown in Table 6.
(359) TABLE-US-00007 TABLE 6 Exemplary conditions for performing Touchdown PCR Step # Cycle Temperature Time 1 Initial Denaturalization 98 C.* 5 m 2 Denaturalization 98 C.* 30 s 3 Annealing Predicted optimal Tm for 30 s the primer set +10 C., minus 1 C./cycle 4 Elongation 72 C.* 1 m/1 Kb 5 GoTo Step 2 10 times 6 Denaturalization 98 C.* 30 s 7 Annealing Predicted optimal Tm 30 s for the primer set 8 Elongation 72 C.* 1 m/1 Kb 9 GoTo Step 6 20 times 10 Final Elongation 72 C.* 5 m 11 Cool Down 4 C. 5 m *Or the temperature specified by the DNA polymerase manufacturer for this step.
(360) PCR reactions were purified to remove primers, dNTPs, and other components by methods known in the art, for example by the use of commercially available PCR clean-up kits.
(361) The resulting sequences were aligned as query sequences with the publicly available databases GenBank nucleotide, RDP, UNITE and PlutoF. RDP was specifically compiled and used for bacterial 16s classification. UNITE and PlutoF were specifically compiled and used for identification of fungi. In all the cases, the strains were identified to species level if their sequences were more than 95% similar to any identified accession from all databases analyzed. When the similarity percentage was between 90-97%, the strain was classified at genus, family, order, class, subdivision or phylum level depending on the information displayed in databases used. Isolates with lower similarity values (from 30-90%) were classified as unknown or uncultured depending on the information displayed after BLAST analysis. To compliment the molecular identification, fungal taxa were confirmed by inducing sporulation on PDA or V8 agar plates and using reported morphological criteria for identification of fruiting bodies structure and shape. Bacterial taxa were confirmed by using reported morphological criteria in specialized differential media for the particular taxon, or by biochemical differentiation tests, as described by the Bergey's Manual of Systematic Microbiology (Whitman, William B., et al., eds. Bergey's Manual of systematic bacteriology. Vols. 1-5. Springer, 2012).
(362) Culture-Independent Characterization of Fungal and Bacterial Communities in Seeds or Plants
(363) To understand the diversity of culturable and unculturable microbial (e.g., bacterial and fungal) taxa that reside inside of seeds or plants of agriculturally-relevant cultivars, landraces, and ancestral wild varieties, microbial DNA was extracted from surface sterilized seed or plant parts, as described herein, followed by amplification of conserved genomic regions, for example the ribosomal DNA loci. Amplified DNA represented a snapshot of the full microbial community inside seeds or plants.
Experimental Description
(364) To obtain microbial DNA from seeds, plants or plant parts, the seeds, plants or plant parts were surface sterilized under aseptic conditions as described herein. Microbial DNA from seeds, plants, or plant parts was extracted using methods known in the art, for example using commercially available Seed-DNA or plant DNA extraction kits, or the following method. 1. A sample of each kind of seed or plant tissue is placed in a cold-resistant container and 10-50 mL of liquid nitrogen is applied. The seeds or plant tissues are then macerated to a powder. 2. Genomic DNA is extracted from each seed or plant tissue preparation, following a chloroform:isoamyl alcohol 24:1 protocol (Sambrook et al. 1989).
(365) Fungal-specific primers were used to amplify the ITS (Internal Transcribed Spacer) region of nuclear ribosomal DNA. Bacterial specific primers were used to amplify region of the 16s rDNA gene of the bacterial genome. Sequences obtained through NGS platforms were analyzed against databases, such as the ones mentioned herein.
(366) Exemplary primer pairs used for this analysis are listed in Table 5.
(367) As an alternative to next generation sequencing, Terminal Restriction Fragment Length Polymorphism, (TRFLP) can be performed. Group specific, fluorescently labeled primers are used to amplify diagnostic regions of genes in the microbial population. This fluorescently labeled PCR product is cut by a restriction enzyme chosen for heterogeneous distribution in the PCR product population. The enzyme cut mixture of fluorescently labeled and unlabeled DNA fragments is then submitted for sequence analysis on a Sanger sequence platform such as the Applied Biosystems 3730 DNA Analyzer.
(368) Determination of the Plant Pathogenic Potential of Microbial Isolates
(369) Since a microbe that confers positive traits to one cultivar might be a pathogenic agent in a different plant species, a general assay was used to determine the pathogenic potential of microbial isolates. Surface and interior-sterilized seeds are germinated in water agar, and once the plant develops its first set of leaves, are inoculated with the isolate. Alternatively, the plants are inoculated as seeds. For inoculation the microbial isolate is grown on solid media, and inoculated into a plant or onto a seed via any of the methods described herein. Plants are allowed to grow under ideal conditions for 2-3 weeks and any pathogenic effect of the introduced microbe is evaluated against uninoculated control plants.
(370) Identification of Culturable Microbial Isolates that Correspond to Core OTUs
(371) To accurately characterize the isolated microbial endophytes, colonies were submitted for marker gene sequencing, and the sequences were analyzed to provide taxonomic classifications. Among the cultured microbes (SYM strains), those with at least 97% 16S or ITS sequence similarity to OTUs of Table 1 and Table 2 were identified. Exemplary isolated microbes that correspond to core OTUs are listed in Table 7 (bacteria) and Table 8 (fungi).
(372) TABLE-US-00008 TABLE 7 Exemplary bacterial endophytes SEQ ID NO SYM Taxonomic Classification 290 SYM00003 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Oxalobacteraceae; Ralstonia pickettii 291 SYM00009 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Oxalobacteraceae; Ralstonia pickettii 292 SYM00013 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas oryzihabitans 293 SYM00017A Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Rhizobiaceae; Agrobacterium larrymoorei 294 SYM00018 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea dispersa 295 SYM00020 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea dispersa 296 SYM00021b Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Escherichia hermannii 297 SYM00025 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea dispersa 298 SYM00033 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter ludwigii 300 SYM00043 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea dispersa 301 SYM00044 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter hormaechei 302 SYM00050 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter cloacae 303 SYM00053 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Escherichia hermannii 305 SYM00062c Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Saccharibacillus kuerlensis 306 SYM00065 Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; Sphingomonas sanguinis 308 SYM00068 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas psychrotolerans 309 SYM00070 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea agglomerans 310 SYM00074 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter cloacae 311 SYM00103 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Oxalobacteraceae; Ralstonia pickettii 321 SYM00170 Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Paenibacillus hunanensis 322 SYM00183 Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales; Xanthomonadaceae; Stenotrophomonas maltophilia 323 SYM00184 Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales; Xanthomonadaceae; Stenotrophomonas maltophilia 324 SYM00207 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus pumilus 325 SYM00212 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 326 SYM00219 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 327 SYM00234 Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Paenibacillus sp. 328 SYM00236 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Methylobacteriaceae; Methylobacterium sp. 329 SYM00248 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea sp. 330 SYM00249 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 331 SYM00506c Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Paenibacillus sp. 332 SYM00507 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 333 SYM00508 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter asburiae 334 SYM00525 Bacteria; Actinobacteria; incertae sedis; Actinomycetales; Microbacteriaceae; Curtobacterium sp. 335 SYM00538A Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; Sphingomonas aquatilis 336 SYM00538B Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Paenibacillus sp. 337 SYM00538i Bacteria; Bacteroidetes; Flavobacteriia; Flavobacteriales; [Weeksellaceae]; Chryseobacterium sp. 338 SYM00543 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 339 SYM00545 Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Paenibacillus sp. 340 SYM00549 Bacteria; Firmicutes; Bacilli; Bacillales; Paenibacillaceae; Paenibacillus sp. 341 SYM00563 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 343 SYM00574 Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Burkholderiaceae; Burkholderia gladioli 347 SYM00617 Bacteria; Firmicutes; Bacilli; Bacillales; Bacillaceae; Bacillus sp. 348 SYM00620 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter sp. 350 SYM00627 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter sp. 351 SYM00628 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter sp. 353 SYM00646 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas sp. 354 SYM00650 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas sp. 355 SYM00662 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae; Pseudomonas putida 358 SYM00714 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Rhizobiaceae; Agrobacterium sp. 365 SYM00905 Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales; Xanthomonadaceae; Stenotrophomonas sp. 366 SYM00924 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Methylobacteriaceae; Methylobacterium sp. 367 SYM00963 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Escherichia coli 368 SYM00982 Bacteria; Bacteroidetes; Flavobacteriia; Flavobacteriales; [Weeksellaceae]; Chryseobacterium sp. 369 SYM00987 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Escherichia coli 370 SYM00978 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Methylobacteriaceae; Methylobacterium aquaticum 371 SYM00991 Bacteria; Proteobacteria; Beta Proteobacteria; Burkholderiales; Comamonadaceae; Acidovorax avenae 372 SYM00999 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Methylobacteriaceae; Methylobacterium sp. 373 SYM01049 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Enterobacter sp. 426 SYM00057B Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; Burkholderiaceae; Burkholderia caledonica 427 SYM00091 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Rhizobiaceae; Rhizobium sp. 428 SYM00092D Bacteria; Proteobacteria; Alphaproteobacteria; Caulobacterales; Caulobacteraceae; Brevundimonas sp. 430 SYM00290 Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; Moraxellaceae; Acinetobacter lwoffii 433 SYM00576 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea dispersa 434 SYM00607 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea stewartii 435 SYM00619 Bacteria; Firmicutes; Bacilli; Bacillales; [Exiguobacteraceae]; Exiguobacterium acetylicum 436 SYM00786 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea dispersa 437 SYM00879 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Methylobacteriaceae; Methylobacterium populi 438 SYM00879B Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; Sphingomonas aquatilis 439 SYM00906 Bacteria; Proteobacteria; Gammaproteobacteria; Xanthmonadales; Xanthomonadaceae; Stenotrophomonas rhizophila 440 SYM00965 Bacteria; Proteobacteria; Alphaproteobacteria; Sphingomonadales; Erythrobacteraceae; Luteibacter yeojuensis 441 SYM01004 Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Rhizobiaceae; Agrobacterium larrymoorei 442 SYM01022 Bacteria; Actinobacteria; incertae sedis; Actinomycetales; Microbacteriaceae; Curtobacterium flaccumfaciens; 451 SYM00865 Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales; Xanthomonadaceae; Stenotrophomonas rhizophila 452 SYM01158 Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales; Enterobacteriaceae; Pantoea agglomerans
(373) TABLE-US-00009 TABLE 8 Exemplary fungal endophytes SEQ ID NO SYM Taxonomic Classification 299 SYM00034 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 304 SYM00061A Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 307 SYM00066 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 312 SYM00120 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria alternata 313 SYM00122 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Epicoccum nigrum 314 SYM00123 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Epicoccum nigrum 315 SYM00124 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium graminearum 316 SYM00129 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium proliferatum 317 SYM00135 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium proliferatum 318 SYM00136 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium proliferatum 319 SYM00151 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium proliferatum 320 SYM00154 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 342 SYM00566B Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 344 SYM00577 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 345 SYM00590 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 346 SYM00603 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 349 SYM00622 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium strictum 352 SYM00629 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium strictum 356 SYM00663 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria alternata 357 SYM00696 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria tenuissima 359 SYM00741a Fungi; Ascomycota; Dothideomycetes; Pleosporales; Incertae sedis; Phoma herbarum 360 SYM00741b Fungi; Ascomycota; Dothideomycetes; Capnodiales; Davidiellaceae; Cladosporium tenuissimum 361 SYM00793 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium verticillioides 362 SYM00795 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 363 SYM00854 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Epicoccum sorghinum 364 SYM00880 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria tenuissima 374 SYM01300 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 375 SYM01303 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 376 SYM01310 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium proliferatum 377 SYM01311 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 378 SYM01314 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae 379 SYM01315 Fungi; Ascomycota; Dothideomycetes; Capnodiales; Davidiellaceae; Cladosporium sp. 380 SYM01325 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria sp. 381 SYM01326 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria alternata 382 SYM01327 Fungi; Ascomycota; Dothideomycetes; Capnodiales; Davidiellaceae; Cladosporium sp. 383 SYM01328 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria sp. 384 SYM01333 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria infectoria 385 SYM15811 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria sp. 386 SYM15820 Fungi; Ascomycota; Sordariomycetes; Trichosphaeriales; incertae sedis; Nigrospora oryzae 387 SYM15821 Fungi; Ascomycota; Sordariomycetes; Trichosphaeriales; incertae sedis; Nigrospora oryzae 388 SYM15825 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 389 SYM15828 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 390 SYM15831 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 391 SYM15837 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 392 SYM15839 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 393 SYM15847 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium udum 394 SYM15870 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 395 SYM15872 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 396 SYM15890 Fungi; Ascomycota; Dothideomycetes; Capnodiales; Davidiellaceae; Cladosporium sp. 397 SYM15901 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 398 SYM15920 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium equiseti 399 SYM15926 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria sp. 400 SYM15928 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria sp. 401 SYM15932 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 402 SYM15939 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 429 SYM00157 Fungi; Ascomycota; Dothideomycetes; incertae sedis; incertae sedis; Leptosphaerulina chartarum 431 SYM00299 Fungi; Ascomycota; Dothideomycetes; Capnodiales; Davidiellaceae; Cladosporium tenuissimum 432 SYM00301 Fungi; Ascomycota; Eurotiomycetes; Eurotiales; Trichocomaceae; Penicillium chrysogenum 443 SYM01324 Fungi; Ascomycota; Eurotiomycetes; Eurotiales; Trichocomaceae; Aspergillus pseudoglaucus 444 SYM01329 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Didymellaceae; Peyronellaea glomerata 445 SYM01330 Fungi; Zygomycota; incertae sedis; Mucorales; Rhizopodaceae; Rhizopus oryzae 446 SYM12462 Fungi; Ascomycota; Dothideomycetes; Capnodiales; Davidiellaceae; Cladosporium sphaerospermum 447 SYM15774 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Incertae sedis; Phoma medicaginis 448 SYM15783 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Pleosporaceae; Alternaria macrospora 449 SYM00300 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium strictum 450 SYM01331 Fungi; Ascomycota; Dothideomycetes; Pleosporales; Incertae sedis; Phoma pedeiae 453 SYM15810 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium sp. 454 SYM15879 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Nectriaceae; Fusarium torulosum 455 SYM15880 Fungi; Ascomycota; Eurotiomycetes; Eurotiales; Trichocomaceae; Penicillium chrysogenum 299 SYM00034 Fungi; Ascomycota; Sordariomycetes; Hypocreales; Incertae sedis; Acremonium zeae
Example 2: Synthetic Compositions Comprising Plant Seeds and a Single Endophyte Strain or a Plurality of Endophytes Confer Benefits to Agricultural Plants
(374) This example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer one or more benefits to a host plant. Among other things, this Example describe the ability of endophytes (e.g., bacterial and fungal endophytes described herein) to confer beneficial traits on a variety of host plants, including but not limited to, dicots (e.g., soy, peanut) and monocots (e.g., corn, soy, wheat, cotton, sorghum), and combinations thereof. Endophyte-inoculated seeds (e.g., seeds described herein) were tested under water-limited conditions (e.g., drought stress) in seed germination assays and seedling root, vigor assays to test whether one or more endophytes confer an increase in tolerance to these stresses. These growth tests were performed using growth assays (e.g., germination assays and seedling root vigor assays) on sterile filter papers. Seeds were treated either with a single bacterial or fungal strain, or with a combination of two bacterial or two fungal strains. In some embodiments, seeds were treated with a combination of at least one bacterial and at least one fungal strain.
Experimental Description
(375) Growth & Scale-Up of Bacteria for Inoculation
(376) Each bacterial endophyte was streaked out onto 20% Tryptic Soy Agar, forming a lawn on regular Petri dishes (9 cm in diameter). Once the bacteria grew to high density, which happened after one or two days depending on the bacterial growth rate, a plate per bacterial strain was scraped with the aid of a sterile loop (filling the entire hole of the loop and producing a droplet of bacterial biomass of about 20 mg). The bacteria collected in this way were transferred into 1 ml of sterile 50 mM Phosphate Buffer Saline (PBS) in a microcentrifuge tube and fully resuspended by vortexing for 20 sec at maximum speed. This method achieves highly concentrated (0.5-1 optical density, corresponding to about 10.sup.8 CFU/mL) and viable bacteria pre-adapted to live coating a surface.
(377) Growth & Scale-Up of Fungi for Inoculation
(378) Fungal isolates were grown from a frozen stock on Petri dishes containing potato dextrose agar and the plates were incubated at room temperature for about a week. After mycelia and spore development, four agar plugs (1 cm in diameter) were used to inoculate erlenmeyers containing 150 ml of potato dextrose broth. Liquid cultures were grown at room temperature and agitation on an orbital shaker at 115 rpm for 4 days. Then, the cultures were transferred to 50 ml sterile test tubes with conical bottoms. Mycelium mats were disrupted by pulse sonication at 75% setting and 3 pulses of 20 seconds each, using a Fisher Scientific sonicator (Model FB120) with a manual probe (CL-18). The sonicated cultures were used in the same manner as the bacterial suspensions for seed inoculation.
(379) Surface Sterilization of Seeds
(380) Un-treated seeds (e.g., soy seeds or wheat seeds) were sterilized overnight with chlorine gas as follows: 200 g of seeds were weighed and placed in a 250 mL glass bottle. The opened bottle and its cap were placed in a dessicator jar in a fume hood. A beaker containing 100 mL of commercial bleach (8.25% sodium hypochlorite) was placed in the dessicator jar. Immediately prior to sealing the jar, 3 mL of concentrated hydrochloric acid (34-37.5%) were carefully added to the bleach. The sterilization was left to proceed for 17-24 h. After sterilization, the bottle was closed with its sterilized cap, and reopened in a sterile flow hood. The opened bottle was left in the sterile hood for a couple hours to air out the seeds and remove chlorine gas leftover. The bottle was then closed and the seeds stored at room temperature in the dark until use.
(381) Preparation of Synthetic Compositions Comprising Plant Seeds and Endophytes
(382) The following procedure was used to coat seeds with a plurality of fungal endophyte inocula for planting in greenhouse and field trials. First, 3% Sodium alginate (SA) was prepared and autoclaved in the following manner. Erlenmeyer flasks were filled with the appropriate amount of deionized water and warmed to about 50 degrees. C on a heat plate with agitation using a stirring bar. SA powder was poured slowly into the water until it all dissolved. The solution was autoclaved (121 C. @15PSI for 30 minutes). Talcum powder was autoclaved in dry cycle (121 C. @15PSI for 30 minutes) and aliquoted in Ziploc bags or 50 ml falcon tubes at a ratio of 15 g per kg of seed to be treated for formulation controls and 10 g per kg of seed for actual treatments.
(383) The next day, seeds were treated with either powdered or liquid formulations.
(384) For powdered formulations, 10 g per kg of seed was allocated to the seeds to be treated, according to the following procedure. Seeds were placed in large plastic container. 16.6 ml of 2% SA per Kg of seeds to be treated were poured on the seeds. The container was covered and shaken slowly in orbital motion for about 20 seconds to disperse the SA. Endophyte powder was mixed with an equal amount of talcum powder. The mix of endophytes and talc was added on top of the seeds, trying to disperse it evenly. The container was covered and seeds are shaken slowly in orbital motion for about 20 seconds. 13.3 ml of Flo-rite per kg of seed to be treated was poured on the seeds. Seeds were shaken again, slowly and in orbital motion.
(385) For liquid formulations, 8.5 mL per seed was allocated to the seeds to be treated, according to the following procedure. Seeds were placed in large plastic container. 8.3 ml of 2% SA per kg of seed and the same amount of bacterial culture (8.3 ml per kg of seed) was poured on the seeds. The container was covered and shaken slowly in orbital motion for about 20 seconds to disperse the SA. 15 g of talcum powder per kg of seed was added, trying to disperse it evenly. The container was covered and seeds were shaken slowly in orbital motion for about 20 seconds. 13.3 ml of Flo-rite per kg of seed to be treated are poured on the seeds. Seeds were shaken again, slowly and in orbital motion. For soy seeds, 10 L of sodium alginate and inoculum were applied for every one gram of seeds. For wheat seeds, the amount of SA and bacterial suspension or fungal inoculum was adjusted to 15 ml/kg to account for the larger surface to volume ratio of these small seeds.
(386) Testing for Germination Enhancement Under Drought Stress
(387) Polyethylene glycol (PEG) is an inert, water-binding polymer with a non-ionic and virtually impermeable long chain that accurately mimics drought stress under dry-soil conditions. The higher the concentration of PEG, the lower the water potential achieved, thus inducing higher water stress in a watery medium. To determine germination enhancement in seeds, the interiors of which are colonized by microbial strains, the effect of osmotic potential on germination is tested at a range of water potential representative of drought conditions following Perez-Fernandez et al. [J. Environ. Biol. 27: 669-685 (2006)]. The range of water potentials simulates those that are known to cause drought stress in a range of cultivars and wild plants, (0.05 MPa to 5 MPa). The appropriate concentration of polyethylene glycol (6000) required to achieve a particular water potential was determined following Michel and Kaufmann (Plant Physiol., 51: 914-916 (1973)) and further modifications by Hardegree and Emmerich (Plant Physiol., 92, 462-466 (1990)). The final equation used to determine amounts of PEG is: =0.130 [PEG].sup.2 T-13.7 [PEG].sup.2; where the osmotic potential () is a function of temperature (T).
(388) Soy Seedling Germination Assay in Drought Conditions
(389) For each SYM tested in the germination assay, ten (10) SYM-coated soy seeds were placed on a 150 mm Petri plate that contained a single heavy germination paper (SD5-1/4 76# heavy weight seed germination paper, Anchor Paper Co., St. Paul, Minn.). To each petri plate, 10 mL 8% polyethylene glycol (PEG 6000) was added for germination screening assays in drought conditions. Plates were covered and incubated at in the dark at 22 Celcius and 60% relative humidity for four days for bacterial SYM strains) or five days for fungal SYM strains. All experiments were done in triplicate under sterile conditions. Seedlings were scored based on germination percentage relative to formulation only and non-treated seedling controls at the end of the incubation period. Exemplary soy germination results under drought conditions are shown in Table A.
(390) TABLE-US-00010 TABLE A Soy germination assay results Ave (% Crop SYM1 SYM2 toNT) Type soy SYM00057B 155.83 bacteria soy SYM00074 283.33 bacteria soy SYM00091 SYM00092D 120.00 bacterial plurality soy SYM00092D 175.83 bacteria soy SYM00590 141.18 bacteria soy SYM00603 135.29 bacteria soy SYM00607 SYM00091 115.00 bacterial plurality soy SYM00607 SYM00092D 135.00 bacterial plurality soy SYM00619 212.50 bacteria soy SYM00092D SYM15879 140.00 Bacterium-Fungus plurality soy SYM00092D SYM15880 115.00 Bacterium-Fungus plurality soy SYM00092D SYM15934 115.00 Bacterium-Fungus plurarlity soy SYM00299 115.51 fungi soy SYM00301 123.02 fungi soy SYM00577 141.18 fungi soy SYM01310 135.29 fungi soy SYM01311 135.29 fungi soy SYM01314 135.29 fungi soy SYM01330 325.00 fungi soy SYM15774 115.98 fungi soy SYM15783 141.18 fungi soy SYM15879 SYM15934 110.00 fungal plurality soy SYM15880 SYM15884 158.82 fungal plurality
Soy Seedling Root Vigor Assay in Drought Conditions
(391) For each SYM tested in the root vigor assay, ten (10) soy seeds were placed equidistant to each other on moistened heavy weight germination paper sandwiches. Each layer of the germination paper was pre-soaked in 25 mL of sterile distilled water. The germination paper sandwich was rolled, taped using surgical tape, placed in glass bottles and incubated at 22 Celcius with 60% relative humidity in dark for four (4) days to allow seed germination. On day five (5), bottle lids were removed and seed samples were placed in a growth chamber set to 25 Celcius, 70% RH, 250-300 microEinsten light for 12 hours and 18 Celcius, 60% RH dark 12 hours for five (5) days. Placement of bottles were randomized daily to reduce any positional effect throughout the incubation period. At the end of the experiment, each soy seedling was measured for total root length and compared relative to formulation only and non-treated seedling controls. Exemplary soy root vigor results under drought conditions are shown in Table B.
(392) TABLE-US-00011 TABLE B Soy root vigor assay results Ave(% SE(% Crop SYM1 SYM2 toNT) toNT) Type soy SYM00057B 98.0 11.9 bacteria soy SYM00074 99.0 10.8 bacteria soy SYM00091 SYM00092D 96.7 5.9 bacterial plurality soy SYM00092D 87.9 12.9 bacteria soy SYM00590 100.6 11.8 bacteria soy SYM00603 118.2 9.3 bacteria soy SYM00607 SYM00091 82.3 5.1 bacterial plurality soy SYM00607 SYM00092D 92.1 8.1 bacterial plurality soy SYM00619 99.0 12.4 bacteria soy SYM00092D SYM15879 72.6 8.7 Bacterium - Fungus plurality soy SYM00092D SYM15880 111.2 2.2 Bacterium - Fungus plurality soy SYM00092D SYM15934 82.8 9.7 Bacterium - fungus plurality soy SYM00299 92.5 10.0 fungi soy SYM00301 111.3 8.5 fungi soy SYM00577 132.4 3.3 fungi soy SYM01310 91.2 15.7 fungi soy SYM01311 97.6 12.3 fungi soy SYM01314 107.1 12.3 fungi soy SYM01330 97.6 16.0 fungi soy SYM15774 153.7 7.6 fungi soy SYM15783 137.1 7.6 fungi soy SYM15879 SYM15934 95.0 12.3 fungal plurality soy SYM15880 SYM15884 104.7 12.3 fungal plurality
Wheat Seedling Germination Assay in Drought Conditions
(393) For each SYM tested, 25 uL of sonicated, 7-day old fungal culture or 3-day old bacteria culture was added into 15 mL of semi-solid solution [12.5% polyethylene glycol (PEG 6000) and 0.3% of agar] pre-aliquoted in a 90 mm deep well petri dish. After adding the SYM biomass, the petri dishes were horizontally shaken for even distribution of SYM biomass. Fifteen (15) surface-steriled wheat seeds were placed onto each petri dish. Plates were covered and incubated in the dark at 24 Celcius and 60% relative humidity for three days in a Conviron chamber. All experiments were done in triplicate under sterile conditions. Seedlings were scored by counting the number of germinated seedlings per dish and the performance of each SYM normalized as germination percentage relative to formulation only and non-treated seedling controls at the end of the incubation period. Exemplary wheat germination results under drought conditions are shown in Table C.
(394) TABLE-US-00012 TABLE C Wheat germination assay results Ave(% SE(% Crop SYM1 SYM2 toNT) toNT) Type wheat SYM00044 126.9 5.5 bacteria wheat SYM00044 SYM00021B 150.0 0.0 bacterial plurality wheat SYM00044 SYM00074 136.4 7.9 bacterial plurality wheat SYM00044 SYM00879 145.5 18.2 bacterial plurality wheat SYM00044 SYM00879B 136.4 7.9 bacterial plurality wheat SYM00057B 107.4 11.5 bacteria wheat SYM00057B SYM00906 154.5 16.4 bacterial plurality wheat SYM00057B SYM01004 136.4 20.8 bacterial plurality wheat SYM00074 109.4 11.0 bacteria wheat SYM00074 SYM00092D 131.8 9.1 bacterial plurality wheat SYM00074 SYM00290 131.8 12.0 bacterial plurality wheat SYM00074 SYM00879 131.8 12.0 bacterial plurality wheat SYM00074 SYM01004 136.4 7.9 bacterial plurality wheat SYM00074 SYM01022 154.5 16.4 bacterial plurality wheat SYM00092D 118.6 7.4 bacteria wheat SYM00092D SYM00021B 136.4 13.6 bacterial plurality wheat SYM00092D SYM00865 135.0 8.7 bacterial plurality wheat SYM00092D SYM00965 150.0 17.3 bacterial plurality wheat SYM00212 157.9 0.0 bacteria wheat SYM00290 119.6 6.8 bacteria wheat SYM00290 SYM00906 131.8 27.6 bacterial plurality wheat SYM00290 SYM01022 145.5 24.1 bacterial plurality wheat SYM00696 108.3 10.1 bacteria wheat SYM00786 SYM00865 140.0 18.0 bacterial plurality wheat SYM00879 111.4 7.2 bacteria wheat SYM00879 SYM01004 172.7 4.5 bacterial plurality wheat SYM00879B 105.2 17.3 bacteria wheat SYM00906 125.0 7.2 bacteria wheat SYM00906 SYM01004 136.4 7.9 bacterial plurality wheat SYM00965 SYM00865 150.0 17.3 bacterial plurality wheat SYM01004 115.2 12.5 bacteria wheat SYM01004 SYM01022 140.9 16.4 bacterial plurality wheat SYM01022 115.5 9.3 bacteria wheat SYM01158 142.1 24.1 bacteria wheat SYM01326 103.8 8.5 bacteria wheat SYM00157 115.6 10.1 fungi wheat SYM00157 SYM15783 141.7 11.0 fungal plurality wheat SYM00299 121.4 10.6 fungi wheat SYM00299 SYM00696 145.8 11.0 fungal plurality wheat SYM00299 SYM01324 133.3 25.3 fungal plurality wheat SYM00299 SYM15783 137.5 0.0 fungal plurality wheat SYM00301 112.7 10.1 fungi wheat SYM00301 SYM01326 133.3 15.0 fungal plurality wheat SYM00301 SYM15774 145.8 11.0 fungal plurality wheat SYM01324 114.2 8.8 fungi wheat SYM01326 SYM12462 129.2 11.0 fungal plurality wheat SYM12462 SYM15774 133.3 18.2 fungal plurality wheat SYM12462 SYM15783 141.7 16.7 fungal plurality wheat SYM15774 122.4 9.5 fungi wheat SYM15774 SYM01324 137.5 12.5 fungal plurality wheat SYM15783 120.0 5.4 fungi wheat SYM15783 SYM01324 129.2 8.3 fungal plurality wheat SYM15879 99.4 8.5 fungi wheat SYM15880 SYM15888 159.1 12.0 fungal plurality
Wheat Seedling Root Vigor Assay in Drought Conditions
(395) For each SYM tested, twelve (12) SYM-coated wheat seeds were placed onto a 125 mm filter paper pre-wet with 5 mL of 12.5% polyethylene glycol (PEG 6000). The seeds were arranged in a circular formation and with embryo facing toward the center of the filter paper. Plates were covered and incubated in the dark at 24 Celcius and 60% relative humidity for three days in a Conviron chamber. All experiments were done in triplicate under sterile conditions. At the end of the incubation period, images were taken for each plate and root length were measured (in pixel) on the images using ImageJ and the pixel was finally converted into cm based on an internal standard. The performance of each SYM was normalized as root length percentage relative to formulation only and non-treated seedling controls. Exemplary wheat root vigor results under drought conditions are shown in Table D.
(396) TABLE-US-00013 TABLE D Wheat root vigor assay results Crop SYM1 SYM2 Ave (% to NT) SE (% to NT) Type wheat SYM00021B 104.0 4.4 bacteria wheat SYM00044 101.4 4.0 bacteria wheat SYM00044 SYM00021B 111.7 3.7 bacterial plurality wheat SYM00044 SYM00074 101.9 5.1 bacterial plurality wheat SYM00044 SYM00879 105.4 4.6 bacterial plurality wheat SYM00044 SYM00879B 107.6 5.0 bacterial plurality wheat SYM00057B 102.8 4.6 bacteria wheat SYM00057B SYM00906 118.7 5.4 bacterial plurality wheat SYM00057B SYM01004 104.1 4.8 bacterial plurality wheat SYM00074 111.2 5.6 bacteria wheat SYM00074 SYM00092D 99.5 4.4 bacterial plurality wheat SYM00074 SYM00290 103.5 4.3 bacterial plurality wheat SYM00074 SYM00879 107.8 4.6 bacterial plurality wheat SYM00074 SYM01004 110.8 4.7 bacterial plurality wheat SYM00074 SYM01022 102.9 4.7 bacterial plurality wheat SYM00092D 112.1 3.8 bacteria wheat SYM00092D SYM00021B 103.5 5.8 bacterial plurality wheat SYM00092D SYM00865 105.2 5.5 bacterial plurality wheat SYM00092D SYM00965 119.2 4.5 bacterial plurality wheat SYM00212 117.7 5.6 bacteria wheat SYM00290 103.2 6.3 bacteria wheat SYM00290 SYM00906 103.1 5.5 bacterial plurality wheat SYM00290 SYM01022 112.7 4.0 bacterial plurality wheat SYM00696 162.0 19.6 bacteria wheat SYM00786 SYM00865 111.3 4.3 bacterial plurality wheat SYM00879 102.0 4.9 bacteria wheat SYM00879 SYM01004 111.5 5.3 bacterial plurality wheat SYM00879B 102.3 5.8 bacteria wheat SYM00906 118.3 5.2 bacteria wheat SYM00906 SYM01004 111.1 5.3 bacterial plurality wheat SYM00965 SYM00865 111.3 5.5 bacterial plurality wheat SYM01004 111.6 4.9 bacteria wheat SYM01004 SYM01022 108.2 5.6 bacterial plurality wheat SYM01022 102.1 6.3 bacteria wheat SYM01158 117.0 5.6 bacteria wheat SYM00157 128.1 17.9 fungi wheat SYM00157 SYM15783 234.4 13.5 fungal plurality wheat SYM00299 140.3 11.2 fungi wheat SYM00299 SYM00696 47.4 11.5 fungal plurality wheat SYM00299 SYM01324 72.6 15.9 fungal plurality wheat SYM00299 SYM15783 90.2 14.2 fungal plurality wheat SYM00301 183.7 17.0 fungi wheat SYM00301 SYM01326 28.9 8.2 fungal plurality wheat SYM00301 SYM15774 226.9 17.2 fungal plurality wheat SYM01324 181.9 18.5 fungi wheat SYM01326 62.4 14.1 fungi wheat SYM01326 SYM12462 60.4 10.6 fungal plurality wheat SYM01329 195.7 15.0 fungi wheat SYM01330 102.7 8.2 fungi wheat SYM12462 96.3 15.7 fungi wheat SYM12462 SYM15774 17.6 7.8 fungal plurality wheat SYM12462 SYM15783 198.2 16.3 fungal plurality wheat SYM15774 143.4 5.2 fungi wheat SYM15774 SYM01324 102.5 16.2 fungal plurality wheat SYM15783 119.0 14.8 fungi wheat SYM15783 SYM01324 61.5 13.2 fungal plurality wheat SYM15879 158.9 15.2 fungi wheat SYM15880 SYM15888 148.6 13.3 fungal plurality
Discussion
(397) Plant vigor and improved stress resilience are important components of providing fitness to a plant in an agricultural setting. These were measured in germination assays and seedling root vigor assays to test the improvement on plant phenotype as conferred by microbial inoculation. The collection of seed-derived endophytes produced a measurable response in soy and wheat when inoculated as compared to non-inoculated controls, as shown in Table A, Table B, Table C and Table D. For example, most of the strains tested were found to produce a favorable phenotype in any of the measured multiple parameters such as germination efficiency, root length, or shoot length, suggesting that the strains play an intimate role modulating and improving plant vigor and conferring stress resilience to the host plant. The stress responses in the strain collection can be seen by the ability of a subgroup to confer a beneficial response under different conditions such as water stress. These can be applicable to products for arid and marginal lands. In a large proportion of cases for the tested strains, the beneficial effect was measurable in several crops. In one aspect of the invention, it is understood that beneficial strains described herein are capable of colonizing multiple varieties and plant species.
Example 3: Synthetic Compositions Comprising Plant Seeds and a Single Endophyte Strain or a Plurality of Endophyte Strains Confer Benefits to Agricultural Plants
(398) This Example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example describe the ability of endophytes (e.g., bacterial and fungal endophytes described herein) to confer beneficial traits on a variety of host plants, including but not limited to, dicots (e.g., soy, peanuts) and monocots (e.g., corn, soy, wheat, cotton, sorghum), and combinations thereof. Endophyte-inoculated seeds (e.g., seeds described herein) are tested under normal conditions, biotic stress, heat stress, cold stress, high salt stress, soil with high metal content, and combinations thereof, in seed germination assays and seedling root vigor assays to test whether one or more endophytes confer an increase in tolerance to one or more stresses. Growth tests are performed using growth assays (e.g., germination assays and seedling root vigor assays) on sterile filter papers. In some embodiments, seeds are treated either with a single bacterial or fungal strain, or with a combination of two bacterial or two fungal strains. In some embodiments, seeds are treated with two or more bacterial or fungal strains. In some embodiments, seeds are treated with a combination of at least one bacterial and at least one fungal strain.
(399) Growth and scale-up of bacteria and fungi for inoculation, surface sterilization of seeds, and seed coating are performed as described herein.
(400) Testing for Germination Enhancement in Normal Conditions
(401) Standard Germination Tests are used to assess the ability of the endophyte to enhance the seeds' germination and early growth. Briefly, 400 seeds (e.g., seeds described herein) are coated with one or more endophytes described herein, and are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds are treated with formulation only. Paper towels are placed on top of 12 feet plastic trays and maintained in a growth chamber set at 25 C. and 70% humidity for 7 days. Seedlings are scored based on germination percentage relative to formulation only and non-treated seedling controls
(402) Testing for Germination Enhancement Under Biotic Stress
(403) A modification of the method developed by Hodgson [Am. Potato. J. 38: 259-264 (1961)] is used to test germination enhancement in microbe-colonized seeds under biotic stress. Biotic stress is understood as a concentration of inocula in the form of cell (bacteria) or spore suspensions (fungus) of a known pathogen for a particular crop (e.g., Pantoea stewartii or Fusarium graminearum for Zea mays L.). Briefly, for each level of biotic stress, 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains, and 400 seed controls (lacking the microbial strains), are placed in between brown paper towels: 8 replicates with 50 seeds each for each treatment (microbe-colonized and control). Each one of the replicates is placed inside a large petri dish (150 mm in diameter). The towels are then soaked with 10 mL of pathogen cell or spore suspension at a concentration of 10.sup.4 to 10.sup.8 cells/spores per mL. Each level corresponds with an order of magnitude increment in concentration (thus, 5 levels). The petri dishes are maintained in a growth chamber set at 25 C. and 70% humidity for 7 days. The proportion of seeds that germinate successfully is compared between the seeds coming from microbe-colonized plants with those coming from controls for each level of biotic stress.
(404) Testing for Germination Enhancement in Heat Conditions
(405) Standard Germination Tests are used to determine if a microbe colonizing the interior of a seed protects maize against heat stress during germination. Briefly, 400 seeds (e.g, seeds described herein), the interiors of which are colonized by microbial strains are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds obtained from control plants that lack the microbe is treated in the same way. The paper towels are placed on top of 12 ft plastic trays and maintained in a growth chamber set at 16:8 hour light:dark cycle, 70% humidity, and at least 120 E/m2/s light intensity for 7 days. A range of high temperatures (from 35 C. to 45 C., with increments of 2 degrees per assay) is tested to assess the germination of microbe-colonized seeds at each temperature. The proportion of seeds that germinate successfully is compared between the seeds coming from microbe-colonized plants and those coming from controls.
(406) Testing for Germination Enhancement in Cold Conditions
(407) Standard Germination Tests are used to determine if a microbe colonizing the interior of a seed protects maize against cold stress during germination. Briefly, 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds obtained from control plants that lack the microbe is treated in the same way. The paper towels are placed on top of 12 ft plastic trays and maintained in a growth chamber set at 16:8 hour light:dark cycle, 70% humidity, and at least 120 E/m2/s light intensity for 7 days. A range of low temperatures (from 0 C. to 10 C., with increments of 2 degrees per assay) is tested to assess the germination of microbe-colonized seeds at each temperature. The proportion of seeds that germinate successfully is compared between the seeds coming from microbe-colonized plants and those coming from controls.
(408) Testing for Germination Enhancement in High Salt Concentrations
(409) Germination experiments are conducted in 90 mm diameter petri dishes. Replicates consist of a Petri dish, watered with 10 mL of the appropriate solution and 20 seeds floating in the solution. 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains, and 400 seed controls (lacking the microbial strains) are tested in this way (40 petri dishes total). To prevent large variations in salt concentration due to evaporation, dishes are sealed with parafilm and the saline solutions are renewed weekly by pouring out the existing saline solution in the petri dish and adding the same amount of fresh solution. A range of saline solutions (100-500 mM NaCl) is tested for to assess the germination of microbe-colonized seeds at varying salt levels. Petri dishes are maintained in a growth chamber set at 25 C., 16:8 hour light:dark cycle, 70% humidity, and at least 120 E/m2/s light intensity. The proportion of seeds that germinates successfully after two weeks is compared between the seeds coming from inoculated plants and those coming from controls.
(410) Testing for Germination Enhancement in Soils with High Metal Content
(411) Standard Germination Tests are used to determine if a microbe colonizing the interior of a seed protects maize against stress due to high soil metal content during germination. Briefly, 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains, are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds obtained from control plants that lack the microbe (microbe-free) is treated in the same way. The paper towels are placed on top of 12 ft plastic trays with holes to allow water drainage. The paper towels are covered with an inch of sterile sand. For each metal to be tested, the sand needs to be treated appropriately to ensure the release and bioavailability of the metal. For example, in the case of aluminum, the sand is watered with pH 4.0+1 g/Kg soil Al+3 (621 uM). The trays are maintained in a growth chamber set at 25 C. and 70% humidity for 7 days. The proportion of seeds that germinates successfully is compared between the seeds coming from microbe-colonized plants and those coming from controls.
(412) Testing for Growth Promotion in Growth Chamber in Normal Conditions
(413) Soil is made from a mixture of 60% Sunshine Mix #5 (Sun Gro; Bellevue, Wash., USA) and 40% vermiculite. To determine if a particular microbe colonizing the interior of seeds is capable of promoting plant growth under normal conditions, 24 pots are prepared in two 12-pot no-hole flat trays with 28 grams of dry soil in each pot, and 2 L of filtered water is added to each tray. The water is allowed to soak into the soil and the soil surface is misted before seeding. For each seed-microbe combination, 12 pots are seeded with 3-5 seeds colonized by the microbe and 12 pots are seeded with 3-5 seeds lacking the microbe (microbe-free plants). The seeded pots are covered with a humidity dome and kept in the dark for 3 days, after which the pots are transferred to a growth chamber set at 25 C., 16:8 hour light:dark cycle, 70% humidity, and at least 120 E/m2/s light intensity. The humidity domes are removed on day 5, or when cotyledons are fully expanded. After removal of the domes, each pot is irrigated to saturation with 0.5 Hoagland's solution, then allowing the excess solution to drain. Seedlings are then thinned to 1 per pot. In the following days, the pots are irrigated to saturation with filtered water, allowing the excess water to drain after about 30 minutes of soaking, and the weight of each 12-pot flat tray is recorded weekly. Canopy area is measured at weekly intervals. Terminal plant height, average leaf area and average leaf length are measured at the end of the flowering stage. The plants are allowed to dry and seed weight is measured. Significance of difference in growth between microbe-colonized plants and controls lacking the microbe is assessed with the appropriate statistical test depending on the distribution of the data at p<0.05.
(414) Testing for Growth Promotion in Growth Chamber Under Biotic Stress
(415) Soil is made from a mixture of 60% Sunshine Mix #5 (Sun Gro; Bellevue, Wash., USA) and 40% vermiculite. To determine if a particular microbe colonizing the interior of seeds is capable of promoting plant growth in the presence of biotic stress, 24 pots are prepared in two 12-pot no-hole flat trays with 28 grams of dry soil in each pot, and 2 L of filtered water is added to each tray. The water is allowed to soak into the soil before planting. For each seed-microbe combination test, 12 pots are seeded with 3-5 seeds colonized by the microbe and 12 pots are seeded with 3-5 seeds lacking the microbe (microbe-free plants). The seeded pots are covered with a humidity dome and kept in the dark for 3 days, after which the pots are transferred to a growth chamber set at 25 C., 16:8 hour light:dark cycle, 70% humidity, and at least 120 E/m2/s light intensity. The humidity domes are removed on day 5, or when cotyledons are fully expanded. After removal of the domes, each pot is irrigated to saturation with 0.5 Hoagland's solution, allowing the excess solution to drain. Seedlings are then thinned to 1 per pot. In the following days, the pots are irrigated to saturation with filtered water, allowing the excess water to drain after about 30 minutes of soaking.
(416) Several methods of inoculation are used depending on the lifestyle of the pathogen. For leaf pathogens (e.g., Pseudomonas syringeae or Colletotrichum graminicola), a suspension of cells for bacteria (10.sup.8 cell/mL) or spores for fungi (10.sup.7 spores/mL) is applied with an applicator on the adaxial surface of each of the youngest fully expanded leaves. Alternatively for fungal pathogens that do not form conidia easily, two agar plugs containing mycelium (4 mm in diameter) are attached to the adaxial surface of each of the youngest leaves on each side of the central vein. For vascular pathogens (e.g., Pantoea stewartii or Fusarium moniliforme), the suspension of cells or spores is directly introduced into the vasculature (5-10 L) through a minor injury inflected with a sterile blade. Alternatively, the seedlings can be grown hydroponically in the cell/spore or mycelium suspension. To test the resilience of the plant-microbe combination against insect stresses, such as thrips or aphids, plants are transferred to a specially-designated growth chamber containing the insects. Soil-borne insect or nematode pathogens are mixed into or applied topically to the potting soil. In all cases, care is taken to contain the fungal, insect, nematode or other pathogen and prevent release outside of the immediate testing area.
(417) The weight of each 12-pot flat tray is recorded weekly. Canopy area is measured at weekly intervals. Terminal plant height, average leaf area and average leaf length are measured at the cease of flowering. The plants are allowed to dry and seed weight is measured. Significance of difference in growth between microbe-colonized plants and controls lacking the microbe is assessed with the appropriate statistical test depending on the distribution of the data at p<0.05.
Example 4Functional Characterization of Endophytes
(418) Auxin Production Assay
(419) Auxin is an important plant hormone, which can promote cell enlargement and inhibit branch development (meristem activity) in above ground plant tissues, while below ground it has the opposite effect, promoting root branching and growth. Interestingly, plant auxin is manufactured above ground and transported to the roots. It thus follows that plant, and especially root inhabiting microbes which produce significant amounts of auxin, will be able to promote root branching and development even under conditions where the plant reduces its own production of auxin. Such conditions can exist for example when soil is flooded and roots encounter an anoxic environment.
(420) Indole containing IAA is able to generate a pinkish chromophore under acidic conditions in the presence of ferric chloride. For auxin measurement, 1 l of overnight-grown cultures of endophytic bacterial strains were inoculated into 750 l of R2A broth supplemented with L-TRP (5 mM) in 2-mL 96 well culture plates. The plates were sealed with a breathable membrane and incubated at 23 C. with constant shaking at 200 rpm for 4 days. To measure auxin production by fungal strains, 3 l of 5-day old liquid fungal cultures were inoculated into 1 ml R2A broth supplemented with L-TRP (5 mM) in 24-well culture plates. The plates were sealed with breathable tape and incubated at 23 C. with constant shaking at 130 rpm for 4 days. After 4 days, 100 L of each culture was transferred to a 96 well plate. 25 L of Salkowski reagent (1 mL of FeCl3 0.5 M solution to 50 mL of 35% HClO4) was added into each well and the plates were incubated in the dark for 30 minutes before taking picture and measuring 540 nm absorption using the SpectraMax M5 plate reader (Molecular Devices). Dark pink halos around colonies are visualized in the membrane by background illumination using a light table.
(421) Endophytes were screened for their ability to produce auxins as possible root, growth promoting agents. Four replicates were performed for each strain assayed. Exemplary auxin production results for endophytes belonging to core OTUs are presented below in Table E, Table F, and Table G.
(422) Acetoin and Diacetyl Production Assay
(423) For acetoin measurements, microbial strains were cultured as described above in R2A broth supplemented with 5% glucose. After 4 days, 100 L of each culture was transferred to a 96 well plate and mixed with 25 L Barritt's Reagents A and B and 525 nm absorption was measured. Barritt's Reagents A and B were prepared by mixing 5 g/L creatine mixed 3:1 (v/v) with freshly prepared alpha-naphthol (75 g/L in 2.5 M sodium hydroxide). After 15 minutes, plates are scored for red or pink colouration against a copper coloured negative control. Four replicates were performed for each strain assayed. Exemplary acetoin production results for endophytes belonging to core OTUs are presented below in Table E, Table F, and Table G.
(424) Siderophore Production Assay
(425) To ensure no contaminating iron is carried over from previous experiments, all glassware is deferrated with 6 M HCl and water prior to media preparation. For siderophore measurements, microbial strains were cultured as described above in R2A broth. After 3 days of incubation at 25 C., plates are overlaid with 0-CAS overlay. Again using the cleaned glassware, 1 liter of 0-CAS overlay is made by mixing 60.5 mg of Chrome azurol S (CAS), 72.9 mg of hexadecyltrimethyl ammonium bromide (HDTMA), 30.24 g of finely crushed Piperazine-1,4-bis-2-ethanesulfonic acid (PIPES) with 10 mL of 1 mM FeCl.sub.3.6H.sub.2O in 10 mM HCl solvent. The PIPES had to be finely powdered and mixed gently with stirring (not shaking) to avoid producing bubbles, until a dark blue colour is achieved. Melted 1% agarose is then added to pre-warmed O-CAS just prior pouring the overlay in a proportion of 1:3 (v/v). After 15 minutes, colour change is scored by looking for purple halos (catechol type siderophores) or orange colonies (hydroxamate siderophores). Four replicates were performed for each strain assayed.
(426) In many environments, iron is a limiting nutrient for growth. A coping mechanism which many microbes have developed is to produce and secrete iron chelating compounds called siderophores which often only that particular species or strain has the means to re-uptake and interact with to release the bound iron, making it available for metabolism. A fringe effect of siderophore production and secretion is that a siderophore secreting microbes can remove all the bio-available iron in its environment, making it difficult for a competing species to invade and grow in that micro-environment.
(427) Siderophore production by microbes on a plant surface or inside a plant may both show that a microbe is equipped to grow in a nutrient limited environment, and perhaps protect the plant environment from invasion by other, perhaps undesirable microbes. Exemplary siderophore production results for endophytes belonging to core OTUs are presented below in Table E, Table F, and Table G.
(428) TABLE-US-00014 TABLE E Auxin, siderophore, and acetoin production by bacterial endophytes belonging to core OTUs; SEQ ID Secretes Produces Produces Strain NO. siderophores Auxin/Indoles Acetoin SYM00003 290 2 1 0 SYM00009 291 1 1 0 SYM00013 292 0 1 0 SYM00017A 293 1 3 0 SYM00018 294 0 3 2 SYM00020 295 0 2 2 SYM00021b 296 0 2 3 SYM00025 297 1 3 2 SYM00043 300 1 3 2 SYM00044 301 1 1 3 SYM00050 302 1 2 3 SYM00053 303 1 1 2 SYM00062C 305 1 2 1 SYM00068 308 2 2 0 SYM00070 309 2 2 0 SYM00074 310 2 3 0 SYM00103 311 2 2 2 SYM00183 322 0 2 1 SYM00184 323 0 2 0 SYM00207 324 1 2 2 SYM00212 325 2 2 3 SYM00219 326 3 2 3 SYM00234 327 2 2 2 SYM00236 328 0 2 0 SYM00248 329 1 2 0 SYM00249 330 2 2 2 SYM00506c 331 0 2 2 SYM00507 332 1 2 2 SYM00508 333 0 3 2 SYM00525 525 2 2 3 SYM00538A 335 3 2 3 SYM00538B 336 2 2 2 SYM00538i 337 0 1 0 SYM00543 338 0 3 1 SYM00545 339 2 2 2 SYM00549 340 2 2 2 SYM00563 341 2 2 1 SYM00574 343 3 1 0 SYM00617 347 1 3 1 SYM00620 348 1 3 0 SYM00627 350 0 1 3 SYM00628 351 2 2 3 SYM00646 353 3 2 3 SYM00650 354 2 2 0 SYM00662 355 1 1 1 SYM00714 358 1 2 2 SYM00905 365 3 2 2 SYM00924 366 2 2 2 SYM00963 367 2 2 1 SYM00978 370 2 2 1 SYM00982 368 0 2 3 SYM00987 369 1 3 2 SYM00991 371 1 2 2 SYM00999 372 1 1 3 SYM01049 373 1 1 0 Legend: 0 = no production; 1 = low production; 2 = medium production; 3 = high production
(429) TABLE-US-00015 TABLE F Auxin, siderophore, and acetoin production by fungal endophytes belonging to core OTUs; SEQ ID Secretes Produces Produces Strain NO. siderophores Auxin/Indoles Acetoin SYM00034 299 1 0 0 SYM00061A 304 1 0 2 SYM00066 307 1 0 0 SYM00120 312 1 0 0 SYM00122 313 0 0 0 SYM00123 314 1 0 3 SYM00124 315 1 1 0 SYM00129 316 0 1 0 SYM00135 317 0 1 0 SYM00136 318 0 0 1 SYM00151 319 1 1 0 SYM00154 320 0 0 0 SYM00566B 342 3 0 0 SYM00577 344 0 0 1 SYM00590 345 0 1 2 SYM00603 346 2 1 0 SYM00622 349 1 0 2 SYM00629 352 0 1 2 SYM00663 356 2 1 2 SYM00696 357 2 0 0 SYM00741b 360 0 0 0 SYM00793 361 1 0 0 SYM00795 362 1 0 1 SYM00854 363 2 0 2 SYM00880 364 2 1 2 SYM01300 374 2 1 0 SYM01310 376 0 2 0 SYM01311 377 0 0 0 SYM01314 378 2 1 0 SYM01315 379 0 0 0 SYM01325 380 0 0 2 SYM01326 381 0 0 2 SYM01327 382 2 1 2 SYM01328 383 1 0 0 SYM01333 384 0 0 0 SYM15811 385 3 1 0 SYM15820 386 1 0 0 SYM15821 387 1 0 0 SYM15825 388 0 0 2 SYM15828 389 0 0 2 SYM15831 390 2 1 2 SYM15837 391 1 0 0 SYM15839 392 2 0 0 SYM15847 393 0 0 0 SYM15870 394 0 0 0 SYM15872 395 0 0 1 SYM15890 396 0 0 2 SYM15901 397 0 0 2 SYM15920 398 2 0 2 SYM15926 399 1 2 0 SYM15928 400 0 0 0 SYM15932 401 0 0 0 SYM15939 402 0 1 0 Legend: 0 = no production; 1 = low production; 2 = medium production; 3 = high production
(430) TABLE-US-00016 TABLE G Exemplary siderophore, auxin, and acetoin production of microbial endophytes belonging to core OTUs; SEQ ID Secretes Produces Produces SYM Taxonomy Type NO. siderophores Auxin/Indoles Acetoin SYM00021B Escherichia sp. bacteria 296 1 1 3 SYM00044 Escherichia sp. bacteria 301 1 1 3 SYM00057b Burkholderia sp. bacteria 426 1 2 3 SYM00074 Enterobacter sp. bacteria 310 0 3 0 SYM00091 Agrobacterium sp. bacteria 427 2 2 0 SYM00092D Brevundimonas sp. bacteria 428 3 3 3 SYM00157 Leptosphaerulina sp. fungi 429 3 1 0 SYM00212 Bacillus sp. bacteria 325 0 0 3 SYM00290 Acinetobacter sp. bacteria 430 1 0 0 SYM00300 Acremonium sp. fungi 449 2 0 2 SYM00301 Penicillium sp. fungi 432 0 0 2 SYM00577 Acremonium sp. fungi 344 0 0 0 SYM00619 Exiguobacterium sp. bacteria 435 0 0 0 SYM00865 Stenotrophomonas sp. bacteria 451 2 1 1 SYM00879 Methylobacterium sp. bacteria 437 0 0 0 SYM00879B Sphingomonas sp. bacteria 438 3 1 0 SYM00906 Stenotrophomonas sp. bacteria 439 1 1 1 SYM00965 Luteibacter sp. bacteria 440 2 3 3 SYM01004 Agrobacterium sp. bacteria 441 1 2 2 SYM01022 Curtobacterium sp. bacteria 442 3 2 3 SYM01158 Pantoea sp. bacteria 452 1 1 1 SYM01314 Fusarium sp. fungi 378 2 1 0 SYM01324 Aspergillus sp. fungi 443 2 1 0 SYM01326 Alternaria sp. fungi 381 0 0 0 SYM01329 Phoma sp. fungi 444 1 0 2 SYM01330 Rhizopus sp. fungi 445 0 0 0 SYM01331 Phoma sp. fungi 450 0 0 1 SYM12462 Cladosporium sp. fungi 446 0 0 2 SYM15774 Phoma sp. fungi 447 0 0 1 SYM15783 Alternaria sp. fungi 448 0 0 2 SYM15810 Fusarium sp. fungi 453 0 2 1 SYM15879 Fusarium sp. fungi 454 0 0 0 SYM15880 Penicillium sp. fungi 455 0 0 1 Legend: 0 = no production; 1 = low production; 2 = medium production; 3 = high production
(431) Assay for Growth on Nitrogen Free LGI Media
(432) All glassware is cleaned with 6 M HCl before media preparation. A new 96 deep-well plate (2 mL well volume) is filled with 250 ul/well of sterile LGI broth [per. L, 50 g Sucrose, 0.01 g FeCl.sub.3-6H.sub.2O, 0.8 g K.sub.3PO.sub.4, 0.2 g MgSO.sub.4-7H.sub.2O, 0.002 g Na.sub.2MoO.sub.4-2H.sub.2O, pH 7.5]. Microbes are inoculated into the 96 wells simultaneously with a flame-sterilized 96 pin replicator. The plate is sealed with a breathable membrane, incubated at 28 C. without shaking for 3 days, and OD.sub.600 readings taken with a 96 well plate reader.
(433) A nitrogen fixing plant associated bacterium is able theoretically to add to the host's nitrogen metabolism, and the most famous beneficial plant associated bacteria, rhizobia, are able to do this within specially adapted organs leguminous plant grows for them to be able to do this. In some embodiments, seed associated microbes described herein are, able to fix nitrogen in association with developing seedling, regardless of whether they colonize the plant's surfaces or interior, and thereby add to the plant's nitrogen nutrition.
(434) ACC Deaminase Activity Assay
(435) Microbes are assayed for growth with ACC as their sole source of nitrogen. Prior to media preparation all glassware is cleaned with 6 M HCl. A 2 M filter sterilized solution of ACC (#1373A, Research Organics, USA) is prepared in water. 1 l/mL of this is added to autoclaved LGI broth (see above), and 1 mL aliquots are placed in a new 96 well plate. The plate is sealed with a breathable membrane, incubated at 25 C. with gentle shaking for 5 days, and OD600 readings taken. Only wells that are significantly more turbid than their corresponding nitrogen free LGI wells are considered to display ACC deaminase activity.
(436) Plant stress reactions are strongly impacted by the plant's own production and overproduction of the gaseous hormone ethylene. Ethylene is metabolized from its precursor 1-aminocyclopropane-1-carboxylate (ACC) which can be diverted from ethylene metabolism by microbial and plant enzymes having ACC deaminase activity. As the name implies, ACC deaminase removes molecular nitrogen from the ethylene precursor, removing it as a substrate for production of the plant stress hormone and providing for the microbe a source of valuable nitrogen nutrition.
(437) Mineral Phosphate Solubilization Assay
(438) Microbes are plated on tricalcium phosphate media. This is prepared as follows: 10 g/L glucose, 0.373 g/L NH.sub.4NO.sub.3, 0.41 g/L MgSO.sub.4, 0.295 g/L NaCl, 0.003 FeCl.sub.3, 0.7 g/L Ca.sub.3HPO.sub.4 and 20 g/L Agar, pH 6, then autoclaved and poured into 150 mm plates. After 3 days of growth at 25 C. in darkness, clear halos are measured around colonies able to solubilize the tricalcium phosphate.
(439) RNAse Activity Assay
(440) 1.5 g of torula yeast RNA (# R6625, Sigma) is dissolved in 1 mL of 0.1 M Na.sub.2HPO.sub.4 at pH 8, filter sterilized and added to 250 mL of autoclaved R2A agar media which is poured into 150 mm plates. The bacteria from a glycerol stock plate are inoculated using a flame-sterilized 96 pin replicator, and incubated at 25 C. for 3 days. On day three, plates are flooded with 70% perchloric acid (#311421, Sigma) for 15 minutes and scored for clear halo production around colonies.
(441) Pectinase Activity Assay
(442) Adapting a previous protocol 0.2% (w/v) of citrus pectin (#76280, Sigma) and 0.1% triton X-100 are added to R2A media, autoclaved and poured into 150 mm plates. Bacteria are inoculated using a 96 pin plate replicator. After 3 days of culturing in the darkness at 25 C., pectinase activity is visualized by flooding the plate with Gram's iodine. Positive colonies are surrounded by clear halos.
(443) Cellulase Activity Assay
(444) Adapting a previous protocol, 0.2% carboxymethylcellulose (CMC) sodium salt (# C5678, Sigma) and 0.1% triton X-100 are added to R2A media, autoclaved and poured into 150 mm plates. Bacteria are inoculated using a 96 pin plate replicator. After 3 days of culturing in the darkness at 25 C., cellulose activity is visualized by flooding the plate with Gram's iodine. Positive colonies are surrounded by clear halos.
(445) Antibiosis Assay
(446) Bacteria or fungi are inoculated using a 96 pin plate replicator onto 150 mm Petri dishes containing R2A agar, then grown for 3 days at 25 C. At this time, colonies of either E. coli DH5 (gram negative tester), Bacillus subtillus ssp. Subtilis (gram positive tester), or yeast strain AH109 (fungal tester) are resuspended in 1 mL of 50 mM Na.sub.2HPO.sub.4 buffer to an OD.sub.600 of 0.2, and 30 l of this is mixed with 30 mL of warm LB agar. This is quickly poured completely over a microbe array plate, allowed to solidify and incubated at 37 C. for 16 hours. Antibiosis is scored by looking for clear halos around microbial colonies.
(447) BIOLOG Characterization of Endophyte Substrate Metabolism
(448) In addition to the auxin, acetoin, and siderophore assays described above, endophytes described herein were characterized for their ability to metabolize a variety of carbon substrates. Liquid cultures of microbe were first sonicated to achieve homogeneity. 1 mL culture of each strain was harvested by centrifugation for 10 minutes at 4500 RPM and subsequently washed three times with sterile distilled water to remove any traces of residual media. Microbial samples were resuspended in sterile distilled water to a final OD.sub.590 of 0.2. Measurements of absorbance were taken using a SpectraMax M microplate reader (Molecular Devices, Sunnyvale, Calif.).
(449) Sole carbon substrate assays were done using BIOLOG Phenotype MicroArray (PM) 1 and 2A MicroPlates (Hayward, Calif.). An aliquot of each bacterial cell culture (2.32 mL) were inoculated into 20 mL sterile IF-0a GN/GP Base inoculating fluid (IF-0), 0.24 mL 100 Dye F obtained from BIOLOG, and brought to a final volume of 24 mL with sterile distilled water. Negative control PM1 and PM2A assays were also made similarly minus bacterial cells to detect abiotic reactions. An aliquot of fungal culture (0.05 mL) of each strain were inoculated into 23.95 mL FF-1F medium obtained from BIOLOG. Microbial cell suspensions were stirred in order to achieve uniformity. One hundred microliters of the microbial cell suspension was added per well using a multichannel pipettor to the 96-well BIOLOG PM1 and PM2A MicroPlates that each contained 95 carbon sources and one water-only (negative control) well.
(450) MicroPlates were sealed in paper surgical tape (Dynarex, Orangeburg, N.Y.) to prevent plate edge effects, and incubated stationary at 24 C. in an enclosed container for 70 hours. Absorbance at 590 nm was measured for all MicroPlates at the end of the incubation period to determine carbon substrate utilization for each strain and normalized relative to the negative control (water only) well of each plate (Garland and Mills, 1991; Barua et al., 2010; Siemens et al., 2012; Blumenstein et al., 2015). The bacterial assays were also calibrated against the negative control (no cells) PM1 and PM2A MicroPlates data to correct for any biases introduced by media on the colorimetric analysis (Borglin et al., 2012). Corrected absorbance values that were negative were considered as zero for subsequent analysis (Garland and Mills, 1991; Blumenstein et al., 2015) and a threshold value of 0.1 and above was used to indicate the ability of a particular microbial strain to use a given carbon substrate (Barua et al., 2010; Blumenstein et al., 2015). Additionally, bacterial MicroPlates were visually examined for the irreversible formation of violet color in wells indicating the reduction of the tetrazolium redox dye to formazan that result from cell respiration (Garland and Mills, 1991). Fungal PM tests were measured as growth assays and visual observation of mycelial growth in each well was made. Exemplary BIOLOG substrate utilization by endophytes described herein are presented in Table H, Table I, Table J, Table K, Table L, Table M, Table N, Table O, Table P, Table Q, Table R, Table S, Table T, and Table U.
(451) TABLE-US-00017 TABLE H Substrate utilization as determined by BIOLOG PM1 MicroPlates by bacterial endophytes belonging to OTUs present in landrace and wild corn and wheat seeds that are present in lower levels in modern corn and wheat seeds. Strain/Substrate SYM00013 SYM00018 SYM00183 SYM00184 SYM00219 SYM00043 D-Serine NO NO NO NO NO NO D-Glucose-6-Phosphate NO NO NO NO NO YES L-Asparagine NO NO NO NO NO NO L-glutamine NO NO NO NO NO NO Glycyl-L-Aspartic acid YES NO NO NO NO YES Glycyl-L-Glutamic acid NO NO YES YES NO NO Glycyl-L-Proline NO NO YES YES NO NO L-Arabinose YES YES NO YES NO YES D-Sorbitol NO NO NO YES NO NO D-Galactonic acid-?-lactone YES YES NO NO YES YES D-Aspartic acid NO NO NO NO NO NO m-Tartaric acid YES YES NO NO NO YES Citric acid NO NO NO NO NO NO Tricarballylic acid NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO NO NO NO NO N-Acetyl-D-Glucosamine YES YES YES YES YES YES Glycerol NO NO NO NO NO YES D-L-Malic acid NO NO NO YES NO YES D-Glucosaminic acid NO YES NO NO NO YES D-Glucose-1-Phosphate NO YES NO NO NO YES m-Inositol NO YES NO YES NO YES L-Serine NO NO NO NO NO NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO NO D-Saccharic acid NO NO NO YES NO YES L-Fucose NO NO NO NO NO NO D-Ribose NO YES YES YES NO YES 1,2-Propanediol NO NO NO NO NO NO D-Fructose-6-Phosphate NO YES NO NO NO NO D-Threonine NO NO NO NO NO NO L-Threonine NO NO NO NO NO NO Tyramine YES YES YES NO YES NO Succinic acid NO NO NO NO NO NO D-Glucuronic acid NO NO NO NO NO NO Tween 20 NO NO NO YES NO NO Tween 40 NO NO NO NO NO YES Tween 80 NO NO YES YES NO NO Fumaric acid NO NO NO NO NO NO L-Alanine YES YES YES YES YES YES D-Psicose NO YES NO NO NO YES D-Galactose YES YES NO YES YES YES D-Gluconic acid NO YES NO NO NO YES L-Rhamnose NO YES NO NO YES YES a-Keto-Glutaric acid NO NO YES NO NO NO a-Hydroxy Glutaric acid-?-lactone YES NO NO YES NO NO Bromo succinic acid NO NO NO NO NO NO L-Alanyl-Glycine YES YES YES YES NO NO L-Lyxose NO YES NO NO NO YES L-Aspartic acid NO NO YES NO NO NO D-L-a-Glycerol phosphate NO NO NO NO NO NO D-Fructose NO NO NO YES NO YES a-Keto-Butyric acid NO NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO Propionic acid NO YES NO NO NO NO Acetoacetic acid NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO L-Proline NO YES YES NO NO NO D-Xylose YES YES YES YES NO YES Acetic acid NO YES NO YES NO YES a-Methyl-D-Galactoside NO NO NO NO YES NO -Methyl-D-glucoside NO YES NO YES YES YES Mucic acid YES YES YES NO NO YES N-acetyl--D-Mannosamine NO NO NO NO NO NO Pyruvic acid NO YES YES YES YES YES D-Alanine YES YES YES YES YES NO L-Lactic acid NO NO NO NO NO YES a-D-Glucose NO YES YES YES NO YES a-D-Lactose NO NO YES YES NO NO Adonitol NO YES YES NO NO NO Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate NO NO NO NO NO NO L-Galactonic-acid-?-lactone NO YES YES YES YES YES D-Trehalose NO NO NO NO NO YES Formic acid NO YES NO NO NO YES Maltose NO YES YES YES YES YES Lactulose NO NO YES YES NO NO Maltotriose NO YES YES YES YES YES Glyoxylic acid NO NO NO NO NO NO Methyl Pyruvate NO NO NO NO NO NO D-Galacturonic acid NO NO YES NO NO YES D-Mannose NO YES YES YES NO YES D-Mannitol NO YES NO YES NO YES D-Melibiose NO YES YES YES YES YES Sucrose NO NO YES YES NO YES 2-Deoxy adenosine NO YES NO NO NO YES D-Cellobiose NO YES YES YES YES YES D-Malic acid NO NO NO NO NO NO Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO NO NO NO YES YES L-Glutamic acid NO NO NO NO NO NO Thymidine NO YES NO NO NO YES Uridine YES YES YES YES NO NO Adenosine NO YES NO NO YES YES Inosine NO NO NO YES NO NO L-Malic acid NO NO NO NO NO NO 2-Aminoethanol NO YES YES YES NO NO Strain/Substrate SYM00050 SYM00508 SYM00617 SYM00620 SYM00068 SYM00905 D-Serine YES NO NO NO NO NO D-Glucose-6-Phosphate YES YES NO YES NO NO L-Asparagine NO NO NO NO NO NO L-glutamine NO NO NO NO NO NO Glycyl-L-Aspartic acid YES NO NO NO NO NO Glycyl-L-Glutamic acid NO NO NO NO YES NO Glycyl-L-Proline YES NO NO NO YES YES L-Arabinose YES NO NO NO YES NO D-Sorbitol YES NO NO NO NO NO D-Galactonic acid-?-lactone NO NO NO NO NO NO D-Aspartic acid NO NO NO NO NO NO m-Tartaric acid NO NO NO NO NO NO Citric acid NO NO NO NO YES NO Tricarballylic acid NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid YES NO NO NO NO NO N-Acetyl-D-Glucosamine YES NO NO NO NO NO Glycerol YES NO NO NO NO NO D-L-Malic acid NO YES YES NO YES NO D-Glucosaminic acid NO YES NO NO NO NO D-Glucose-1-Phosphate YES YES NO NO NO NO m-Inositol YES NO NO NO NO NO L-Serine NO NO NO NO NO NO m-Hydroxy Phenyl Acetic acid YES NO NO YES NO NO D-Saccharic acid YES YES NO NO NO NO L-Fucose NO NO NO NO NO NO D-Ribose NO NO NO NO YES NO 1,2-Propanediol NO NO NO NO NO NO D-Fructose-6-Phosphate YES YES NO YES NO NO D-Threonine NO NO NO NO NO NO L-Threonine NO NO NO NO NO NO Tyramine NO NO NO NO YES NO Succinic acid NO NO NO NO NO NO D-Glucuronic acid YES NO NO NO NO NO Tween 20 NO NO NO NO NO NO Tween 40 NO NO NO NO NO NO Tween 80 NO NO NO NO NO YES Fumaric acid NO NO NO NO NO NO L-Alanine YES NO NO YES YES YES D-Psicose NO NO NO NO NO NO D-Galactose YES YES NO NO NO NO D-Gluconic acid YES YES NO YES NO NO L-Rhamnose YES YES YES YES YES NO a-Keto-Glutaric acid YES NO NO NO YES NO a-Hydroxy Glutaric acid-?-lactone YES NO NO NO YES NO Bromo succinic acid NO NO NO NO NO NO L-Alanyl-Glycine YES NO NO NO YES NO L-Lyxose YES YES NO NO YES NO L-Aspartic acid YES YES NO NO NO NO D-L-a-Glycerol phosphate NO NO NO NO NO NO D-Fructose YES NO NO NO YES NO a-Keto-Butyric acid NO NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO Propionic acid NO NO NO NO YES NO Acetoacetic acid NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO L-Proline NO NO NO NO YES NO D-Xylose YES NO NO NO YES NO Acetic acid NO NO NO NO NO NO a-Methyl-D-Galactoside YES NO NO YES NO NO -Methyl-D-glucoside YES YES NO NO NO NO Mucic acid YES YES NO NO YES NO N-acetyl--D-Mannosamine YES NO YES NO NO NO Pyruvic acid YES YES NO NO YES NO D-Alanine NO NO NO NO NO NO L-Lactic acid YES NO NO NO NO NO a-D-Glucose YES NO YES NO NO NO a-D-Lactose NO NO NO NO NO NO Adonitol NO NO NO NO NO NO Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate NO NO NO NO NO NO L-Galactonic-acid-?-lactone YES YES NO YES YES NO D-Trehalose YES NO NO NO NO NO Formic acid NO NO NO NO NO NO Maltose YES YES YES NO NO YES Lactulose NO NO NO NO NO NO Maltotriose YES YES YES NO NO YES Glyoxylic acid NO NO NO NO NO NO Methyl Pyruvate YES YES NO NO YES NO D-Galacturonic acid YES NO NO YES NO NO D-Mannose YES NO NO NO NO YES D-Mannitol YES NO NO NO NO NO D-Melibiose YES NO YES NO NO NO Sucrose YES NO NO NO NO NO 2-Deoxy adenosine YES YES NO YES NO NO D-Cellobiose YES YES YES NO NO YES D-Malic acid NO NO NO NO YES NO Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO NO YES NO NO NO L-Glutamic acid YES NO NO NO NO NO Thymidine YES YES NO NO NO NO Uridine YES YES NO NO NO NO Adenosine NO YES NO YES NO NO Inosine NO NO NO NO NO NO L-Malic acid NO NO NO NO NO NO 2-Aminoethanol NO NO NO NO NO NO
(452) TABLE-US-00018 TABLE I Substrate utilization as determined by BIOLOG PM2A MicroPlates by bacterial endophytes belonging to OTUs present in landrace and wild corn and wheat seeds that are present in lower levels in modern corn and wheat seeds. Strain/Substrate SYM00013 SYM00018 SYM00183 SYM00184 SYM00219 SYM00043 N-acetyl-D-Galactosamine NO NO YES YES NO NO Gentiobiose NO YES YES YES YES YES D-Raffinose NO NO NO NO YES NO Capric acid NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO Acetamide NO NO NO NO NO NO L-Ornithine YES YES NO YES YES NO Chondrointin sulfate C NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO L-glucose NO NO NO NO NO NO Salicin NO NO YES YES YES NO Caproic acid NO NO NO NO NO NO Malonic acid NO NO NO NO NO NO L-Alaninamide NO NO YES YES NO NO L-Phenylalanine YES NO NO NO NO NO a-Cyclodextrin NO NO NO NO NO NO -D-allose NO NO NO NO NO NO Lactitol NO NO YES YES NO NO Sedoheptulosan NO NO NO NO NO NO Citraconic acid YES NO NO NO NO NO Melibionic acid NO NO NO NO YES NO N-Acetyl-L-Glutamic acid NO NO NO YES NO NO L-Pyroglutamic acid YES YES YES YES YES NO -Cyclodextrin NO NO NO NO YES NO Amygdalin NO NO YES YES NO NO D-Melezitose NO NO NO NO NO NO L-Sorbose NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO L-Arginine NO NO NO NO NO NO L-Valine YES YES NO YES YES NO -Cyclodextrin NO NO NO NO YES NO D-arabinose NO NO NO NO NO NO Maltitol NO NO YES YES NO NO Stachyose NO NO NO NO NO NO D-Glucosamine YES YES YES YES YES YES Oxalomalic acid YES YES YES YES NO YES Glycine NO NO NO NO NO NO D,L-Carnitine YES YES NO NO NO NO Dextrin NO NO NO YES YES NO D-arabitol NO NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO NO NO NO D-Tagatose NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO L-Histidine NO NO NO NO NO YES Sec-Butylamine NO NO NO NO NO NO Gelatin NO NO YES YES NO NO L-arabitol NO NO NO NO NO NO D-Methyl-D-Galactoside NO NO NO YES NO NO Turanose NO NO YES YES NO NO 4-Hydroxy benzoic acid NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO L-Homoserine NO NO NO NO NO NO D,L-Octopamine YES YES YES YES YES NO Glycogen NO NO NO NO NO NO Arbutin NO NO YES YES YES NO 3-Methyl Glucose NO NO NO NO NO NO Xylitol NO NO NO YES NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sebacic acid NO NO NO NO NO NO Hydroxy-L-Proline NO NO NO NO NO NO Putrescine NO YES NO NO NO NO Inulin NO NO YES YES YES YES 2-Deoxy-D-Ribose NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO L-Isoleucine YES NO NO NO NO NO Dihydroxy acetone NO NO NO YES NO NO Laminarin NO NO NO NO NO NO i-Erythritol NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO -amino butyric acid YES YES NO NO NO YES a-Keto-valeric acid NO NO NO NO NO NO Succinamic acid NO NO NO NO NO NO L-Leucine YES NO NO NO NO NO 2,3-Butanediol YES NO NO NO NO NO Mannan NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO NO NO NO NO Itaconic acid NO NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO L-Lysine NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO Pectin NO NO NO NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO NO NO NO arabinose Palatinose NO NO YES YES YES NO Butyric acid NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO YES NO NO NO YES L-Tartaric acid YES YES NO NO NO YES L-Methionine NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO Strain/Substrate SYM00050 SYM00508 SYM00617 SYM00620 SYM00068 SYM00905 N-acetyl-D-Galactosamine YES NO NO NO NO YES Gentiobiose YES YES YES YES NO YES D-Raffinose YES NO NO YES NO NO Capric acid NO NO NO NO NO NO D-lactic acid methyl ester YES NO NO NO NO NO Acetamide NO NO NO NO YES NO L-Ornithine YES NO NO NO YES NO Chondrointin sulfate C NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO YES NO NO L-glucose NO NO NO NO NO NO Salicin YES YES YES NO NO YES Caproic acid NO YES NO NO NO NO Malonic acid NO NO NO NO NO NO L-Alaninamide NO NO NO NO NO YES L-Phenylalanine NO NO NO NO YES NO a-Cyclodextrin NO NO NO NO NO NO -D-allose NO NO NO NO NO NO Lactitol NO NO NO NO NO YES Sedoheptulosan NO NO NO NO NO NO Citraconic acid NO NO NO NO YES NO Melibionic acid YES NO NO YES YES NO N-Acetyl-L-Glutamic acid YES NO NO NO NO NO L-Pyroglutamic acid NO YES NO NO YES NO -Cyclodextrin NO NO NO NO NO NO Amygdalin NO NO YES NO NO NO D-Melezitose NO NO YES NO NO NO L-Sorbose NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO L-Arginine NO NO NO NO NO NO L-Valine NO NO NO NO YES NO -Cyclodextrin NO NO NO NO NO NO D-arabinose NO YES NO NO NO NO Maltitol NO NO NO NO NO YES Stachyose NO NO NO NO NO NO D-Glucosamine YES YES YES NO YES YES Oxalomalic acid NO NO YES NO YES YES Glycine NO NO NO NO NO NO D,L-Carnitine NO NO NO NO NO NO Dextrin NO YES YES YES NO NO D-arabitol NO YES NO NO NO NO a-Methyl-D-Glucoside NO NO NO NO NO NO D-Tagatose NO YES NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO L-Histidine NO NO NO YES NO NO Sec-Butylamine NO NO NO NO NO NO Gelatin NO NO NO NO NO YES L-arabitol NO NO NO NO NO NO D-Methyl-D-Galactoside NO YES NO YES NO NO Turanose NO NO NO NO NO NO 4-Hydroxy benzoic acid NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO L-Homoserine NO NO NO NO NO NO D,L-Octopamine NO NO YES NO YES YES Glycogen NO YES NO NO NO NO Arbutin YES YES YES NO NO YES 3-Methyl Glucose NO YES NO NO NO NO Xylitol NO NO NO NO NO NO -Hydroxy butyric acid YES YES NO NO NO NO Sebacic acid NO NO NO NO NO NO Hydroxy-L-Proline YES NO NO NO NO NO Putrescine YES NO NO NO NO NO Inulin NO NO NO NO NO NO 2-Deoxy-D-Ribose NO YES NO YES NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO L-Isoleucine NO YES NO NO YES NO Dihydroxy acetone YES YES NO NO NO NO Laminarin NO NO NO NO NO NO i-Erythritol NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO -amino butyric acid NO NO NO NO NO NO a-Keto-valeric acid NO NO NO NO NO NO Succinamic acid NO NO NO NO NO NO L-Leucine NO NO NO NO NO NO 2,3-Butanediol NO NO NO NO NO NO Mannan NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO NO NO NO NO Itaconic acid YES YES NO NO NO NO D-Tartaric acid NO NO NO NO NO NO L-Lysine NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO Pectin NO YES NO NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO NO NO NO arabinose Palatinose NO NO NO NO NO YES Butyric acid NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO YES NO NO NO NO L-Tartaric acid NO YES NO NO NO NO L-Methionine NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO
(453) Twelve SYM strains of culturable bacteria belonging to OTUs present in landrace and wild corn and wheat seeds that are present in lower levels in modern corn and wheat seeds were tested for sole carbon substrate utilization using BIOLOG PM1 and PM2A MicroPlates. The most utilized substrates by these strains are L-alanine, L-galactonic-acid--lactone, maltose, maltotriose, D-cellobiose, gentiobiose, and D-glucosamine. The least utilized substrates by these strains are L-asparagine, L-glutamine, D-aspartic acid, tricarballylic acid, L-serine, L-fucose, 1,2-propanediol, D-threonine, L-threonine, succinic acid, fumaric acid, bromo succinic acid, D-L-a-glycerol phosphate, a-keto-butyric acid, a-hydroxy butyric acid, acetoacetic acid, glucuronamide, glycolic acid, mono methyl succinate, glyoxylic acid, phenylethyl-amine, and L-malic acid.
(454) The substrates most utilized by a large number of the culturable bacteria belonging to core OTUs are mucic acid, L-arabinose, L-galactonic-acid--lactone, N-acetyl-D-glucosamine, maltose, maltotriose, and D-cellobiose. These core bacteria did not utilize sedoheptulosan, oxalic acid, 2-hydroxy benzoic acid, quinic acid, mannan, L-methionine, N-acetyl-D-glucosaminitol, sorbic acid, 2,3-butanone, succinic acid, phenylethyl-amine, and 3-hydroxy 2-butanone as sole carbon sources. Results for the culturable fungi belonging to core OTUs indicate that D-sorbitol, L-arabinose, N-acetyl-D-glucosamine, glycerol, tween 40, tween 80, D-gluconic acid, L-proline, a-D-glucose, D-trehalose, maltose, lactulose, D-mannose, D-mannitol, sucrose, D-cellobiose, L-glutamic acid, L-ornithine, and L-pyroglutamic acid are carbon substrates that are utilized by a large number of the endophyte strains examined here. The carbon substrate that seemed to be not utilized by fungi in these assays is 2-deoxy-D-ribose. All other substrates could be utilized as a sole carbon nutrient by at least one fungal SYM strain.
(455) TABLE-US-00019 TABLE J Substrate utilization as determined by BIOLOG PM1 MicroPlates by bacterial endophytes belonging to core OTUs. Strain/Substrate SYM00103 SYM01049 SYM00013 SYM00017A SYM00018 SYM00183 SYM00184 SYM00020 D-Serine NO NO NO NO NO NO NO NO D-Glucose-6-Phosphate NO NO NO YES NO NO NO NO L-Asparagine NO NO NO YES NO NO NO NO L-glutamine NO NO NO NO NO NO NO NO Glycyl-L-Aspartic acid NO YES YES NO NO NO NO NO Glycyl-L-Glutamic acid YES NO NO NO NO YES YES NO Glycyl-L-Proline NO NO NO NO NO YES YES NO L-Arabinose NO YES YES YES YES NO YES YES D-Sorbitol NO NO NO YES NO NO YES NO D-Galactonic acid-?-lactone NO YES YES NO YES NO NO YES D-Aspartic acid NO NO NO NO NO NO NO NO m-Tartaric acid NO YES YES NO YES NO NO YES Citric acid NO NO NO NO NO NO NO NO Tricarballylic acid NO NO NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO NO YES NO NO NO NO N-Acetyl-D-Glucosamine NO NO YES YES YES YES YES YES Glycerol NO NO NO YES NO NO NO NO D-L-Malic acid NO NO NO YES NO NO YES NO D-Glucosaminic acid NO NO NO YES YES NO NO YES D-Glucose-1-Phosphate NO NO NO YES YES NO NO YES m-Inositol NO NO NO YES YES NO YES YES L-Serine NO NO NO NO NO NO NO NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO NO NO NO D-Saccharic acid NO NO NO YES NO NO YES NO L-Fucose NO NO NO YES NO NO NO NO D-Ribose NO YES NO YES YES YES YES NO 1,2-Propanediol NO NO NO NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO YES YES NO NO NO D-Threonine NO NO NO NO NO NO NO NO L-Threonine NO NO NO NO NO NO NO NO Tyramine NO NO YES YES YES YES NO YES Succinic acid NO NO NO NO NO NO NO NO D-Glucuronic acid NO NO NO NO NO NO NO NO Tween 20 NO NO NO NO NO NO YES NO Tween 40 NO NO NO NO NO NO NO NO Tween 80 YES YES NO NO NO YES YES NO Fumaric acid NO NO NO NO NO NO NO NO L-Alanine YES NO YES YES YES YES YES YES D-Psicose NO NO NO YES YES NO NO YES D-Galactose NO YES YES YES YES NO YES YES D-Gluconic acid YES NO NO NO YES NO NO NO L-Rhamnose NO NO NO YES YES NO NO YES a-Keto-Glutaric acid YES NO NO YES NO YES NO NO a-Hydroxy Glutaric acid-?- NO NO YES YES NO NO YES NO lactone Bromo succinic acid NO NO NO NO NO NO NO NO L-Alanyl-Glycine YES NO YES YES YES YES YES YES L-Lyxose NO NO NO NO YES NO NO YES L-Aspartic acid YES NO NO NO NO YES NO NO D-L-a-Glycerol phosphate NO NO NO NO NO NO NO NO D-Fructose NO NO NO YES NO NO YES YES a-Keto-Butyric acid NO NO NO NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO NO NO Propionic acid NO NO NO YES YES NO NO NO Acetoacetic acid NO NO NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO NO NO L-Proline NO NO NO NO YES YES NO NO D-Xylose YES YES YES YES YES YES YES YES Acetic acid NO NO NO YES YES NO YES NO a-Methyl-D-Galactoside NO NO NO YES NO NO NO NO -Methyl-D-glucoside NO NO NO YES YES NO YES YES Mucic acid YES YES YES YES YES YES NO YES N-acetyl--D-Mannosamine NO NO NO NO NO NO NO NO Pyruvic acid NO YES NO YES YES YES YES YES D-Alanine YES NO YES YES YES YES YES YES L-Lactic acid NO NO NO NO NO NO NO NO a-D-Glucose NO YES NO YES YES YES YES NO a-D-Lactose NO NO NO NO NO YES YES NO Adonitol NO NO NO YES YES YES NO NO Glycolic acid YES NO NO NO NO NO NO NO Mono Methyl Succinate NO YES NO NO NO NO NO NO L-Galactonic-acid-?-lactone YES YES NO YES YES YES YES YES D-Trehalose YES NO NO YES NO NO NO NO Formic acid NO NO NO NO YES NO NO YES Maltose NO YES NO YES YES YES YES YES Lactulose NO NO NO YES NO YES YES NO Maltotriose NO NO NO YES YES YES YES YES Glyoxylic acid NO NO NO NO NO NO NO NO Methyl Pyruvate NO NO NO NO NO NO NO NO D-Galacturonic acid YES NO NO YES NO YES NO NO D-Mannose NO YES NO YES YES YES YES NO D-Mannitol NO NO NO YES YES NO YES NO D-Melibiose NO NO NO YES YES YES YES NO Sucrose NO NO NO YES NO YES YES NO 2-Deoxy adenosine NO NO NO NO YES NO NO NO D-Cellobiose NO YES NO YES YES YES YES YES D-Malic acid NO YES NO NO NO NO NO NO Phenylethyl-amine NO NO NO NO NO NO NO NO Dulcitol NO NO NO NO NO NO NO NO L-Glutamic acid NO NO NO NO NO NO NO NO Thymidine NO NO NO NO YES NO NO NO Uridine YES NO YES YES YES YES YES NO Adenosine YES NO NO YES YES NO NO NO Inosine NO NO NO NO NO NO YES NO L-Malic acid NO NO NO NO NO NO NO NO 2-Aminoethanol YES NO NO YES YES YES YES NO Strain/Substrate SYM00207 SYM00212 SYM00219 SYM00234 SYM00236 SYM00248 SYM00249 SYM00260 D-Serine NO NO NO NO NO YES NO NO D-Glucose-6-Phosphate NO YES NO NO NO YES YES NO L-Asparagine NO NO NO NO NO NO YES YES L-glutamine NO NO NO NO NO NO YES NO Glycyl-L-Aspartic acid NO YES NO NO NO NO NO NO Glycyl-L-Glutamic acid YES YES NO NO NO NO NO YES Glycyl-L-Proline NO NO NO NO NO NO NO NO L-Arabinose NO YES NO YES YES YES YES YES D-Sorbitol NO NO NO NO NO NO NO NO D-Galactonic acid-?-lactone NO NO YES NO NO NO NO NO D-Aspartic acid NO YES NO NO NO NO NO NO m-Tartaric acid NO YES NO NO NO NO NO NO Citric acid NO NO NO NO NO NO YES YES Tricarballylic acid NO YES NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO NO NO NO NO NO NO N-Acetyl-D-Glucosamine YES YES YES YES NO YES YES NO Glycerol NO YES NO YES NO YES NO YES D-L-Malic acid YES YES NO YES NO NO NO YES D-Glucosaminic acid NO NO NO NO NO NO NO NO D-Glucose-1-Phosphate NO YES NO NO NO NO YES NO m-Inositol NO YES NO NO NO YES YES YES L-Serine NO NO NO NO NO NO NO YES m-Hydroxy Phenyl Acetic acid YES NO NO NO NO NO NO NO D-Saccharic acid NO YES NO NO NO NO NO YES L-Fucose NO YES NO NO NO NO NO NO D-Ribose NO YES NO NO NO YES YES NO 1,2-Propanediol NO YES NO NO NO NO NO YES D-Fructose-6-Phosphate NO YES NO NO NO NO YES NO D-Threonine NO NO NO NO NO NO NO NO L-Threonine YES NO NO NO NO NO NO YES Tyramine YES YES YES YES NO YES YES NO Succinic acid NO NO NO NO NO NO NO NO D-Glucuronic acid NO NO NO NO NO NO YES NO Tween 20 NO NO NO NO NO NO NO YES Tween 40 NO NO NO NO NO NO NO YES Tween 80 NO NO NO NO NO NO NO YES Fumaric acid NO YES NO NO NO NO NO YES L-Alanine YES YES YES YES YES YES NO YES D-Psicose NO NO NO NO NO NO NO NO D-Galactose NO NO YES NO NO YES YES NO D-Gluconic acid NO YES NO YES NO NO NO YES L-Rhamnose NO YES YES YES NO YES YES NO a-Keto-Glutaric acid YES YES NO NO YES NO NO YES a-Hydroxy Glutaric acid-?- NO YES NO NO YES NO NO YES lactone Bromo succinic acid NO NO NO NO NO NO NO YES L-Alanyl-Glycine YES YES NO YES NO YES NO YES L-Lyxose NO NO NO NO NO YES NO NO L-Aspartic acid YES NO NO NO YES YES YES YES D-L-a-Glycerol phosphate NO NO NO NO NO NO NO YES D-Fructose NO YES NO YES NO YES NO NO a-Keto-Butyric acid YES YES NO NO NO NO NO NO a-Hydroxy Butyric acid NO YES NO NO NO NO NO YES Propionic acid YES YES NO NO NO NO NO YES Acetoacetic acid NO NO NO NO NO NO NO YES Glucuronamide NO NO NO NO NO NO NO NO L-Proline YES YES NO YES YES YES NO YES D-Xylose NO YES NO YES YES YES NO YES Acetic acid YES YES NO YES YES NO NO YES a-Methyl-D-Galactoside NO YES YES YES NO YES NO NO -Methyl-D-glucoside NO YES YES YES NO YES YES YES Mucic acid YES YES NO YES NO YES NO YES N-acetyl--D-Mannosamine NO NO NO YES NO NO NO YES Pyruvic acid YES YES YES YES NO NO YES YES D-Alanine NO NO YES NO NO NO YES NO L-Lactic acid NO NO NO NO NO NO NO YES a-D-Glucose NO YES NO YES NO YES NO NO a-D-Lactose NO YES NO YES NO YES NO NO Adonitol YES NO NO YES NO NO NO NO Glycolic acid YES YES NO NO NO NO NO YES Mono Methyl Succinate YES NO NO YES NO NO NO YES L-Galactonic-acid-?-lactone YES YES YES YES NO NO NO YES D-Trehalose NO NO NO YES NO YES NO NO Formic acid NO NO NO NO NO YES NO YES Maltose NO YES YES YES NO YES YES YES Lactulose NO YES NO YES NO NO NO NO Maltotriose NO YES YES YES NO YES YES YES Glyoxylic acid NO NO NO NO NO NO NO YES Methyl Pyruvate NO YES NO YES NO NO NO YES D-Galacturonic acid YES NO NO NO NO NO NO YES D-Mannose NO NO NO YES NO YES NO NO D-Mannitol NO NO NO YES NO YES YES YES D-Melibiose NO YES YES YES NO YES NO NO Sucrose NO NO NO YES NO NO YES NO 2-Deoxy adenosine NO NO NO NO NO YES NO YES D-Cellobiose YES YES YES YES NO YES YES YES D-Malic acid NO NO NO NO NO YES NO YES Phenylethyl-amine NO NO NO NO NO NO NO NO Dulcitol NO NO YES NO NO NO NO NO L-Glutamic acid NO NO NO NO NO NO NO NO Thymidine YES YES NO YES NO NO YES YES Uridine YES YES NO YES NO NO YES YES Adenosine NO YES YES YES NO YES NO YES Inosine YES NO NO YES NO NO NO NO L-Malic acid YES NO NO NO NO NO NO YES 2-Aminoethanol NO NO NO YES NO NO NO YES
(456) TABLE-US-00020 TABLE K Substrate utilization as determined by BIOLOG PM1 MicroPlates by bacterial endophytes belonging to core OTUs. Strain/Substrate SYM00290 SYM00292 SYM00003 SYM00043 SYM00050 SYM05066 SYM00508 SYM00525 SYM00053 D-Serine NO YES NO NO YES NO NO NO YES D-Glucose-6- NO NO NO YES YES NO YES NO YES Phosphate L-Asparagine NO NO NO NO NO NO NO NO NO L-glutamine NO NO NO NO NO NO NO NO NO Glycyl-L-Aspartic NO NO NO YES YES NO NO NO YES acid Glycyl-L- NO NO NO NO NO NO NO NO NO Glutamic acid Glycyl-L-Proline NO NO NO NO YES NO NO NO YES L-Arabinose YES YES YES YES YES NO NO NO YES D-Sorbitol NO NO NO NO YES NO NO YES YES D-Galactonic NO NO NO YES NO NO NO NO NO acid-?-lactone D-Aspartic acid NO NO NO NO NO NO NO NO NO m-Tartaric acid NO NO NO YES NO NO NO NO NO Citric acid NO YES NO NO NO NO NO NO NO Tricarballylic NO NO NO NO NO NO NO NO NO acid p-Hydroxy NO NO NO NO YES NO NO NO NO Phenyl acetic acid N-Acetyl-D- YES YES YES YES YES NO NO YES YES Glucosamine Glycerol YES YES NO YES YES NO NO NO NO D-L-Malic acid YES YES NO YES NO NO YES YES NO D-Glucosaminic NO NO YES YES NO NO YES NO NO acid D-Glucose-1- NO NO NO YES YES NO YES NO NO Phosphate m-Inositol NO YES NO YES YES NO NO YES YES L-Serine NO NO NO NO NO NO NO NO NO m-Hydroxy NO NO NO NO YES NO NO NO YES Phenyl Acetic acid D-Saccharic acid NO YES NO YES YES NO YES NO NO L-Fucose YES NO NO NO NO NO NO NO NO D-Ribose YES YES YES YES NO NO NO YES NO 1,2-Propanediol YES NO NO NO NO NO NO NO NO D-Fructose-6- NO NO NO NO YES NO YES NO YES Phosphate D-Threonine YES NO NO NO NO NO NO NO NO L-Threonine YES NO NO NO NO NO NO NO NO Tyramine NO YES YES NO NO NO NO NO NO Succinic acid NO NO NO NO NO NO NO NO NO D-Glucuronic NO NO NO NO YES NO NO NO NO acid Tween 20 YES NO NO NO NO NO NO NO NO Tween 40 YES NO NO YES NO NO NO NO NO Tween 80 YES NO NO NO NO NO NO NO NO Fumaric acid YES YES NO NO NO NO NO NO NO L-Alanine YES YES YES YES YES NO NO YES YES D-Psicose NO NO NO YES NO NO NO NO NO D-Galactose YES YES NO YES YES NO YES YES NO D-Gluconic acid YES YES NO YES YES NO YES NO YES L-Rhamnose YES YES NO YES YES NO YES YES YES a-Keto-Glutaric NO YES NO NO YES NO NO NO YES acid a-Hydroxy NO NO NO NO YES NO NO NO NO Glutaric acid-?- lactone Bromo succinic NO YES NO NO NO NO NO NO NO acid L-Alanyl-Glycine YES YES YES NO YES NO NO YES NO L-Lyxose NO NO NO YES YES NO YES NO NO L-Aspartic acid NO YES NO NO YES NO YES YES NO D-L-a-Glycerol NO NO NO NO NO NO NO NO NO phosphate D-Fructose YES YES NO YES YES NO NO YES YES a-Keto-Butyric NO NO NO NO NO NO NO NO NO acid a-Hydroxy YES NO NO NO NO NO NO NO NO Butyric acid Propionic acid YES YES YES NO NO NO NO NO NO Acetoacetic acid YES YES NO NO NO NO NO NO NO Glucuronamide YES NO NO NO NO NO NO NO NO L-Proline NO YES NO NO NO NO NO NO NO D-Xylose YES YES YES YES YES NO NO NO YES Acetic acid YES YES NO YES NO NO NO YES NO a-Methyl-D- YES YES NO NO YES NO NO NO YES Galactoside -Methyl-D- YES YES NO YES YES NO YES YES YES glucoside Mucic acid NO YES YES YES YES NO YES YES YES N-acetyl--D- YES YES NO NO YES NO NO NO YES Mannosamine Pyruvic acid YES YES YES YES YES NO YES NO NO D-Alanine YES NO NO NO NO NO NO NO NO L-Lactic acid NO YES NO YES YES NO NO NO YES a-D-Glucose YES YES NO YES YES NO NO NO YES a-D-Lactose YES YES NO NO NO NO NO YES NO Adonitol NO NO NO NO NO NO NO NO NO Glycolic acid NO NO NO NO NO NO NO NO NO Mono Methyl YES YES NO NO NO NO NO NO NO Succinate L-Galactonic- YES YES YES YES YES NO YES YES YES acid-?-lactone D-Trehalose YES YES NO YES YES NO NO NO YES Formic acid NO YES NO YES NO NO NO NO NO Maltose YES YES NO YES YES NO YES YES YES Lactulose YES YES NO NO NO NO NO YES NO Maltotriose YES YES NO YES YES NO YES YES YES Glyoxylic acid NO YES YES NO NO NO NO NO NO Methyl Pyruvate YES YES NO NO YES NO YES NO NO D-Galacturonic NO YES NO YES YES NO NO NO NO acid D-Mannose NO YES NO YES YES NO NO NO YES D-Mannitol YES YES NO YES YES NO NO YES YES D-Melibiose YES YES NO YES YES NO NO YES YES Sucrose YES YES NO YES YES NO NO YES YES 2-Deoxy NO YES NO YES YES NO YES NO YES adenosine D-Cellobiose YES YES NO YES YES NO YES YES YES D-Malic acid NO YES NO NO NO NO NO NO NO Phenylethyl- NO NO NO NO NO NO NO NO NO amine Dulcitol YES NO NO YES NO NO NO NO NO L-Glutamic acid NO NO NO NO YES NO NO NO NO Thymidine YES YES NO YES YES NO YES NO YES Uridine YES YES YES NO YES NO YES YES YES Adenosine YES YES YES YES NO NO YES NO NO Inosine NO YES NO NO NO NO NO NO NO L-Malic acid NO YES NO NO NO NO NO NO NO 2-Aminoethanol NO NO NO NO NO NO NO NO NO Strain/Substrate SYM00538A SYM00538B SYM00538i SYM00543 SYM00563 SYM00574 SYM00057B SYM00617 D-Serine NO NO NO YES NO NO NO NO D-Glucose-6- NO NO NO YES NO NO NO NO Phosphate L-Asparagine NO NO NO YES NO NO NO NO L-glutamine NO NO NO NO NO NO NO NO Glycyl-L-Aspartic NO NO NO NO NO NO NO NO acid Glycyl-L- NO NO NO YES NO YES NO NO Glutamic acid Glycyl-L-Proline NO NO NO NO NO NO YES NO L-Arabinose NO YES YES YES YES YES YES NO D-Sorbitol NO NO NO NO NO NO NO NO D-Galactonic NO NO NO NO NO NO NO NO acid-?-lactone D-Aspartic acid NO NO NO NO NO NO NO NO m-Tartaric acid NO NO NO NO NO NO NO NO Citric acid NO NO YES YES NO YES NO NO Tricarballylic NO NO NO NO NO NO NO NO acid p-Hydroxy NO NO NO NO NO NO NO NO Phenyl acetic acid N-Acetyl-D- YES YES YES YES NO YES NO NO Glucosamine Glycerol NO YES NO YES NO YES NO NO D-L-Malic acid YES YES YES YES NO YES NO YES D-Glucosaminic NO NO NO NO NO NO NO NO acid D-Glucose-1- NO NO NO NO NO NO NO NO Phosphate m-Inositol NO YES YES YES NO YES NO NO L-Serine NO NO NO YES NO YES NO NO m-Hydroxy NO NO NO NO NO NO YES NO Phenyl Acetic acid D-Saccharic acid NO NO YES YES NO YES NO NO L-Fucose NO NO NO YES NO NO YES NO D-Ribose NO NO NO YES NO NO NO NO 1,2-Propanediol NO NO NO NO NO YES NO NO D-Fructose-6- NO NO NO NO NO NO NO NO Phosphate D-Threonine NO NO NO NO NO NO NO NO L-Threonine NO NO NO YES NO YES NO NO Tyramine NO NO NO YES NO NO NO NO Succinic acid NO NO NO NO NO NO NO NO D-Glucuronic NO NO NO NO NO NO NO NO acid Tween 20 NO YES NO NO NO YES YES NO Tween 40 NO NO NO NO NO YES NO NO Tween 80 NO NO NO YES NO YES NO NO Fumaric acid NO NO NO NO NO YES NO NO L-Alanine NO NO NO YES NO YES NO NO D-Psicose NO NO NO NO NO NO NO NO D-Galactose NO YES NO NO NO NO YES NO D-Gluconic acid NO YES NO YES NO YES NO NO L-Rhamnose NO YES NO NO YES NO YES YES a-Keto-Glutaric YES YES YES YES NO YES NO NO acid a-Hydroxy NO NO YES NO NO YES NO NO Glutaric acid-?- lactone Bromo succinic NO NO NO YES NO YES NO NO acid L-Alanyl-Glycine YES YES YES YES NO YES NO NO L-Lyxose NO NO NO NO NO NO NO NO L-Aspartic acid NO YES YES YES NO YES NO NO D-L-a-Glycerol NO NO NO NO NO YES NO NO phosphate D-Fructose NO YES NO YES NO NO NO NO a-Keto-Butyric NO NO NO NO NO NO NO NO acid a-Hydroxy NO NO NO NO NO YES NO NO Butyric acid Propionic acid NO NO YES NO NO YES NO NO Acetoacetic acid NO NO NO YES NO YES NO NO Glucuronamide NO NO NO NO NO NO NO NO L-Proline YES NO YES NO NO YES NO NO D-Xylose NO YES NO NO NO YES NO NO Acetic acid NO YES YES YES NO YES YES NO a-Methyl-D- NO YES NO NO NO NO NO NO Galactoside -Methyl-D- NO YES NO YES NO YES NO NO glucoside Mucic acid NO NO YES YES NO YES YES NO N-acetyl--D- NO YES NO NO NO YES NO YES Mannosamine Pyruvic acid NO YES NO YES NO YES NO NO D-Alanine NO NO NO NO NO NO YES NO L-Lactic acid NO NO NO YES NO YES NO NO a-D-Glucose NO YES NO YES NO NO YES YES a-D-Lactose NO YES NO NO NO NO NO NO Adonitol NO NO NO NO NO NO NO NO Glycolic acid NO NO NO NO NO YES NO NO Mono Methyl NO YES NO NO NO YES NO NO Succinate L-Galactonic- YES NO YES NO NO YES NO NO acid-?-lactone D-Trehalose NO YES NO NO NO NO NO NO Formic acid NO YES NO YES NO YES YES NO Maltose YES YES NO YES YES YES NO YES Lactulose NO YES NO NO NO NO NO NO Maltotriose YES YES NO YES YES YES NO YES Glyoxylic acid NO NO NO NO NO YES NO NO Methyl Pyruvate YES YES NO YES NO YES NO NO D-Galacturonic NO YES YES NO NO YES NO NO acid D-Mannose YES YES NO NO YES NO NO NO D-Mannitol NO YES YES NO NO YES NO NO D-Melibiose NO YES NO NO NO NO NO YES Sucrose NO YES YES NO NO NO NO NO 2-Deoxy NO NO NO YES NO YES NO NO adenosine D-Cellobiose NO YES NO YES YES YES NO YES D-Malic acid NO NO NO NO NO YES NO NO Phenylethyl- NO NO NO NO NO NO NO NO amine Dulcitol NO NO NO NO NO NO NO YES L-Glutamic acid NO NO NO NO NO NO NO NO Thymidine NO YES NO YES NO YES NO NO Uridine NO YES YES YES NO YES NO NO Adenosine NO YES NO YES NO YES NO NO Inosine YES YES NO YES NO NO NO NO L-Malic acid NO NO NO YES NO YES NO NO 2-Aminoethanol NO YES YES NO NO YES NO NO
(457) TABLE-US-00021 TABLE L Substrate utilization as determined by BIOLOG PM1 MicroPlates by bacterial endophytes belonging to core OTUs. Strain/Substrate SYM00620 SYM00627 SYM00628 SYM00062C SYM00650 SYM00068 D-Serine NO NO YES NO NO NO D-Glucose-6-Phosphate YES YES YES NO NO NO L-Asparagine NO NO NO NO NO NO L-glutamine NO NO NO NO NO NO Glycyl-L-Aspartic acid NO NO NO NO YES NO Glycyl-L-Glutamic acid NO NO NO NO NO YES Glycyl-L-Proline NO NO NO NO NO YES L-Arabinose NO NO YES NO YES YES D-Sorbitol NO NO NO NO NO NO D-Galactonic acid-?-lactone NO YES YES NO NO NO D-Aspartic acid NO NO NO NO NO NO m-Tartaric acid NO NO NO NO NO NO Citric acid NO NO NO NO NO YES Tricarballylic acid NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO NO NO NO NO N-Acetyl-D-Glucosamine NO YES YES NO NO NO Glycerol NO NO NO NO NO NO D-L-Malic acid NO NO NO NO NO YES D-Glucosaminic acid NO NO NO NO NO NO D-Glucose-1-Phosphate NO NO NO NO NO NO m-Inositol NO NO YES NO NO NO L-Serine NO NO NO NO NO NO m-Hydroxy Phenyl Acetic acid YES NO YES NO NO NO D-Saccharic acid NO NO NO NO NO NO L-Fucose NO NO YES NO NO NO D-Ribose NO NO NO NO NO YES 1,2-Propanediol NO NO NO NO NO NO D-Fructose-6-Phosphate YES YES YES NO NO NO D-Threonine NO NO NO NO NO NO L-Threonine NO NO NO NO NO NO Tyramine NO NO NO NO NO YES Succinic acid NO NO NO NO NO NO D-Glucuronic acid NO NO NO NO NO NO Tween 20 NO NO NO NO NO NO Tween 40 NO NO NO NO NO NO Tween 80 NO NO NO NO NO NO Fumaric acid NO NO NO NO NO NO L-Alanine YES NO YES NO NO YES D-Psicose NO NO NO NO NO NO D-Galactose NO NO YES NO NO NO D-Gluconic acid YES YES NO NO NO NO L-Rhamnose YES YES YES NO YES YES a-Keto-Glutaric acid NO NO NO NO NO YES a-Hydroxy Glutaric acid-?- NO NO NO NO NO YES lactone Bromo succinic acid NO NO NO NO NO NO L-Alanyl-Glycine NO NO NO NO NO YES L-Lyxose NO NO NO NO NO YES L-Aspartic acid NO NO NO NO NO NO D-L-a-Glycerol phosphate NO NO NO NO NO NO D-Fructose NO NO NO NO NO YES a-Keto-Butyric acid NO NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO Propionic acid NO NO NO NO NO YES Acetoacetic acid NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO L-Proline NO NO YES NO NO YES D-Xylose NO YES YES NO YES YES Acetic acid NO NO NO NO NO NO a-Methyl-D-Galactoside YES YES YES NO NO NO -Methyl-D-glucoside NO YES YES NO NO NO Mucic acid NO YES YES NO YES YES N-acetyl--D-Mannosamine NO NO YES NO NO NO Pyruvic acid NO YES NO NO NO YES D-Alanine NO NO YES NO NO NO L-Lactic acid NO NO NO NO NO NO a-D-Glucose NO NO NO NO YES NO a-D-Lactose NO NO NO YES NO NO Adonitol NO NO NO NO NO NO Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate NO NO NO NO YES NO L-Galactonic-acid-?-lactone YES YES YES NO NO YES D-Trehalose NO NO NO NO YES NO Formic acid NO YES NO NO NO NO Maltose NO YES YES YES YES NO Lactulose NO NO NO YES NO NO Maltotriose NO YES YES NO NO NO Glyoxylic acid NO NO NO NO NO NO Methyl Pyruvate NO NO NO NO NO YES D-Galacturonic acid YES NO NO NO NO NO D-Mannose NO NO NO NO NO NO D-Mannitol NO NO NO NO NO NO D-Melibiose NO YES YES YES NO NO Sucrose NO YES NO NO NO NO 2-Deoxy adenosine YES YES YES NO NO NO D-Cellobiose NO YES YES NO NO NO D-Malic acid NO NO NO NO YES YES Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO YES NO YES NO NO L-Glutamic acid NO NO NO NO NO NO Thymidine NO YES YES YES NO NO Uridine NO NO YES NO NO NO Adenosine YES NO YES NO NO NO Inosine NO NO NO NO NO NO L-Malic acid NO NO NO NO NO NO 2-Aminoethanol NO NO NO NO NO NO Strain/Substrate SYM00070 SYM00714 SYM00009 SYM00905 SYM00924 SYM00963 D-Serine NO NO NO NO NO NO D-Glucose-6-Phosphate NO YES NO NO NO NO L-Asparagine NO NO NO NO NO NO L-glutamine NO NO NO NO NO NO Glycyl-L-Aspartic acid NO NO NO NO NO NO Glycyl-L-Glutamic acid NO NO NO NO NO NO Glycyl-L-Proline NO NO NO YES NO NO L-Arabinose YES YES YES NO NO NO D-Sorbitol NO YES NO NO NO NO D-Galactonic acid-?-lactone NO YES NO NO NO NO D-Aspartic acid NO NO NO NO NO NO m-Tartaric acid NO NO NO NO NO NO Citric acid NO NO NO NO NO NO Tricarballylic acid NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO NO NO NO NO N-Acetyl-D-Glucosamine YES YES NO NO NO NO Glycerol YES YES NO NO NO NO D-L-Malic acid YES YES NO NO NO NO D-Glucosaminic acid NO NO YES NO NO NO D-Glucose-1-Phosphate NO YES NO NO NO NO m-Inositol NO YES NO NO NO NO L-Serine NO YES NO NO NO NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO NO D-Saccharic acid YES YES NO NO NO NO L-Fucose YES YES NO NO NO YES D-Ribose YES NO NO NO NO NO 1,2-Propanediol NO NO NO NO NO NO D-Fructose-6-Phosphate YES YES NO NO YES NO D-Threonine NO NO NO NO NO NO L-Threonine NO NO NO NO NO NO Tyramine YES NO NO NO NO NO Succinic acid NO NO NO NO NO NO D-Glucuronic acid NO NO NO NO NO NO Tween 20 NO NO NO NO NO NO Tween 40 NO NO NO NO NO NO Tween 80 NO NO YES YES NO YES Fumaric acid NO NO NO NO NO NO L-Alanine YES YES NO YES NO NO D-Psicose NO YES NO NO NO NO D-Galactose YES NO NO NO NO NO D-Gluconic acid NO YES NO NO NO NO L-Rhamnose YES YES NO NO NO NO a-Keto-Glutaric acid YES YES NO NO NO NO a-Hydroxy Glutaric acid-?- YES YES NO NO NO NO lactone Bromo succinic acid NO NO NO NO NO NO L-Alanyl-Glycine YES NO NO NO NO NO L-Lyxose YES YES NO NO NO NO L-Aspartic acid YES YES NO NO YES NO D-L-a-Glycerol phosphate NO NO NO NO NO NO D-Fructose YES YES NO NO NO NO a-Keto-Butyric acid NO NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO Propionic acid NO YES NO NO NO YES Acetoacetic acid NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO L-Proline YES NO NO NO NO NO D-Xylose YES YES YES NO NO NO Acetic acid YES YES NO NO NO NO a-Methyl-D-Galactoside NO YES NO NO NO YES -Methyl-D-glucoside YES YES NO NO NO NO Mucic acid YES YES YES NO NO YES N-acetyl--D-Mannosamine NO NO NO NO NO NO Pyruvic acid NO NO NO NO NO NO D-Alanine YES NO NO NO NO NO L-Lactic acid NO YES NO NO NO NO a-D-Glucose YES YES NO NO NO NO a-D-Lactose NO YES NO NO NO YES Adonitol YES YES NO NO NO NO Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate NO NO NO NO YES NO L-Galactonic-acid-?-lactone YES YES YES NO NO NO D-Trehalose NO YES NO NO NO NO Formic acid YES YES NO NO NO NO Maltose YES YES NO YES NO YES Lactulose NO YES NO NO NO YES Maltotriose YES YES NO YES NO YES Glyoxylic acid NO NO NO NO YES NO Methyl Pyruvate NO NO NO NO NO YES D-Galacturonic acid NO YES NO NO NO NO D-Mannose NO YES NO YES NO NO D-Mannitol NO YES NO NO NO NO D-Melibiose YES YES NO NO NO NO Sucrose NO NO NO NO NO NO 2-Deoxy adenosine YES NO NO NO NO NO D-Cellobiose NO YES NO YES NO NO D-Malic acid NO YES NO NO NO YES Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO NO NO NO NO YES L-Glutamic acid NO NO NO NO NO NO Thymidine NO NO NO NO NO YES Uridine YES NO YES NO NO NO Adenosine NO NO NO NO NO NO Inosine NO YES NO NO NO NO L-Malic acid NO YES NO NO NO NO 2-Aminoethanol NO NO NO NO NO NO Strain/Substrate SYM00978 SYM00982 SYM00987 SYM00991 SYM00999 D-Serine YES NO NO YES NO D-Glucose-6-Phosphate NO NO NO YES NO L-Asparagine NO NO NO NO NO L-glutamine NO NO NO NO NO Glycyl-L-Aspartic acid NO NO NO NO NO Glycyl-L-Glutamic acid NO NO NO NO NO Glycyl-L-Proline NO NO NO NO NO L-Arabinose NO NO YES NO YES D-Sorbitol NO NO NO NO NO D-Galactonic acid-?-lactone NO NO NO NO NO D-Aspartic acid NO NO NO NO NO m-Tartaric acid NO NO NO NO NO Citric acid NO NO NO NO NO Tricarballylic acid NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO YES NO NO N-Acetyl-D-Glucosamine NO NO YES NO NO Glycerol NO NO NO NO NO D-L-Malic acid NO YES NO NO NO D-Glucosaminic acid NO NO NO NO NO D-Glucose-1-Phosphate NO NO NO NO NO m-Inositol NO NO NO NO NO L-Serine NO NO NO NO NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO D-Saccharic acid NO NO YES NO YES L-Fucose YES NO NO NO NO D-Ribose NO NO NO NO NO 1,2-Propanediol NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO YES NO D-Threonine NO NO NO NO NO L-Threonine NO NO NO NO NO Tyramine NO NO NO NO NO Succinic acid NO NO NO NO NO D-Glucuronic acid NO NO NO NO NO Tween 20 NO NO NO NO NO Tween 40 NO NO NO NO NO Tween 80 NO NO YES NO NO Fumaric acid NO NO NO NO NO L-Alanine NO NO NO NO NO D-Psicose NO NO NO NO NO D-Galactose NO NO NO NO NO D-Gluconic acid NO NO NO NO NO L-Rhamnose NO NO NO NO NO a-Keto-Glutaric acid NO YES NO NO NO a-Hydroxy Glutaric acid-?- NO NO NO NO NO lactone Bromo succinic acid NO NO NO NO NO L-Alanyl-Glycine NO NO NO NO NO L-Lyxose NO NO NO NO NO L-Aspartic acid NO NO NO NO NO D-L-a-Glycerol phosphate NO NO NO NO NO D-Fructose NO NO NO NO NO a-Keto-Butyric acid NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO Propionic acid NO NO NO NO NO Acetoacetic acid NO NO NO NO NO Glucuronamide NO NO NO NO NO L-Proline NO NO NO NO NO D-Xylose NO NO NO NO NO Acetic acid NO YES NO NO NO a-Methyl-D-Galactoside NO NO NO NO NO -Methyl-D-glucoside NO NO NO NO NO Mucic acid NO NO YES NO YES N-acetyl--D-Mannosamine YES NO NO YES NO Pyruvic acid NO NO NO NO NO D-Alanine NO NO NO NO NO L-Lactic acid NO NO YES NO NO a-D-Glucose NO NO YES YES NO a-D-Lactose NO NO NO NO NO Adonitol NO NO NO NO NO Glycolic acid NO NO NO NO NO Mono Methyl Succinate NO NO NO NO YES L-Galactonic-acid-?-lactone NO NO YES NO NO D-Trehalose NO NO NO NO NO Formic acid NO NO NO NO NO Maltose NO NO NO YES NO Lactulose NO NO YES NO NO Maltotriose NO NO NO NO NO Glyoxylic acid NO NO NO NO YES Methyl Pyruvate NO NO NO NO YES D-Galacturonic acid NO NO NO NO NO D-Mannose NO NO NO NO NO D-Mannitol NO NO NO NO NO D-Melibiose NO NO NO NO NO Sucrose NO NO YES YES NO 2-Deoxy adenosine NO NO NO NO NO D-Cellobiose NO NO NO NO NO D-Malic acid NO NO NO NO NO Phenylethyl-amine NO NO NO NO NO Dulcitol NO NO NO NO NO L-Glutamic acid NO NO NO NO NO Thymidine NO NO NO NO NO Uridine NO NO NO NO NO Adenosine NO NO NO NO NO Inosine NO NO NO NO NO L-Malic acid NO NO NO NO NO 2-Aminoethanol NO NO NO NO NO
(458) TABLE-US-00022 TABLE M Substrate utilization as determined by BIOLOG PM2A MicroPlates by bacterial endophytes belonging to core OTUs. Strain/Substrate SYM00103 SYM01049 SYM00013 SYM00017A SYM00018 SYM00183 SYM00184 SYM00020 N-acetyl-D-Galactosamine NO NO NO YES NO YES YES NO Gentiobiose NO NO NO YES YES YES YES YES D-Raffinose NO NO NO YES NO NO NO NO Capric acid NO NO NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO NO NO Acetamide NO NO NO NO NO NO NO NO L-Ornithine YES NO YES YES YES NO YES YES Chondrointin sulfate C NO NO NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO NO NO L-glucose NO NO NO NO NO NO NO NO Salicin NO NO NO YES NO YES YES NO Caproic acid NO NO NO NO NO NO NO NO Malonic acid NO NO NO NO NO NO NO NO L-Alaninamide NO NO NO NO NO YES YES NO L-Phenylalanine NO NO YES NO NO NO NO NO a-Cyclodextrin NO NO NO NO NO NO NO NO -D-allose NO NO NO YES NO NO NO NO Lactitol NO NO NO YES NO YES YES NO Sedoheptulosan NO NO NO NO NO NO NO NO Citraconic acid NO NO YES NO NO NO NO NO Melibionic acid NO NO NO YES NO NO NO NO N-Acetyl-L-Glutamic acid YES NO NO YES NO NO YES NO L-Pyroglutamic acid YES NO YES YES YES YES YES YES -Cyclodextrin NO NO NO NO NO NO NO NO Amygdalin NO NO NO NO NO YES YES NO D-Melezitose NO NO NO NO NO NO NO NO L-Sorbose NO NO NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO NO L-Arginine NO NO NO YES NO NO NO NO L-Valine YES NO YES YES YES NO YES YES -Cyclodextrin NO NO NO NO NO NO NO NO D-arabinose NO NO NO NO NO NO NO NO Maltitol NO NO NO YES NO YES YES NO Stachyose NO NO NO NO NO NO NO NO D-Glucosamine YES YES YES YES YES YES YES YES Oxalomalic acid YES NO YES YES YES YES YES YES Glycine NO NO NO NO NO NO NO NO D,L-Carnitine YES YES YES YES YES NO NO NO Dextrin NO NO NO NO NO NO YES NO D-arabitol NO NO NO NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO NO NO NO NO NO D-Tagatose NO NO NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO NO NO L-Histidine NO YES NO NO NO NO NO NO Sec-Butylamine NO NO NO NO NO NO NO NO Gelatin NO NO NO NO NO YES YES NO L-arabitol NO NO NO NO NO NO NO NO -Methyl-D-Galactoside NO NO NO YES NO NO YES NO Turanose NO YES NO YES NO YES YES NO 4-Hydroxy benzoic acid NO NO NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO YES NO NO NO NO L-Homoserine NO NO NO NO NO NO NO NO D,L-Octopamine YES NO YES YES YES YES YES YES Glycogen NO NO NO NO NO NO NO NO Arbutin NO NO NO YES NO YES YES NO 3-Methyl Glucose NO NO NO NO NO NO NO NO Xylitol NO NO NO NO NO NO YES NO -Hydroxy butyric acid NO NO NO NO NO NO NO NO Sebacic acid YES NO NO NO NO NO NO NO Hydroxy-L-Proline NO NO NO NO NO NO NO NO Putrescine YES NO NO YES YES NO NO NO Inulin NO NO NO YES NO YES YES NO 2-Deoxy-D-Ribose NO NO NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO NO L-Isoleucine YES NO YES YES NO NO NO NO Dihydroxy acetone NO YES NO NO NO NO YES NO Laminarin NO NO NO NO NO NO NO NO i-Erythritol NO NO NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO NO NO -amino butyric acid YES YES YES YES YES NO NO NO a-Keto-valeric acid NO NO NO NO NO NO NO NO Succinamic acid NO YES NO NO NO NO NO NO L-Leucine YES NO YES YES NO NO NO NO 2,3-Butanediol NO NO YES NO NO NO NO NO Mannan NO NO NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO YES NO NO NO NO d-amino valeric acid NO NO NO NO NO NO NO NO Itaconic acid NO NO NO NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO NO NO L-Lysine NO NO NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO NO NO Pectin NO NO NO NO NO NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO NO NO NO NO NO arabinose Palatinose NO NO NO YES NO YES YES NO Butyric acid NO NO NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO YES NO NO YES L-Tartaric acid YES NO YES NO YES NO NO YES L-Methionine NO NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO NO Strain/Substrate SYM00207 SYM00212 SYM00219 SYM00234 SYM00236 SYM00248 SYM00249 N-acetyl-D-Galactosamine NO NO NO NO NO NO NO Gentiobiose NO YES YES YES NO YES YES D-Raffinose NO YES YES YES NO YES YES Capric acid YES NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO NO Acetamide NO NO NO NO NO NO NO L-Ornithine YES YES YES YES YES NO NO Chondrointin sulfate C NO NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO NO L-glucose NO NO NO NO NO YES NO Salicin NO YES YES YES NO NO YES Caproic acid YES NO NO NO NO NO NO Malonic acid NO NO NO NO NO NO NO L-Alaninamide NO NO NO NO YES NO YES L-Phenylalanine NO NO NO NO NO NO NO a-Cyclodextrin NO YES NO YES NO NO NO -D-allose NO NO NO NO NO NO NO Lactitol NO NO NO YES NO YES NO Sedoheptulosan NO NO NO NO NO NO NO Citraconic acid NO NO NO NO NO NO NO Melibionic acid NO YES YES NO NO YES NO N-Acetyl-L-Glutamic acid NO NO NO YES NO NO NO L-Pyroglutamic acid YES YES YES YES YES YES NO -Cyclodextrin NO NO YES YES NO NO YES Amygdalin NO YES NO YES NO YES YES D-Melezitose NO YES NO YES NO YES YES L-Sorbose NO NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO L-Arginine NO NO NO NO NO NO NO L-Valine NO YES YES YES NO NO NO -Cyclodextrin NO NO YES YES NO NO NO D-arabinose NO NO NO NO NO NO NO Maltitol NO YES NO YES NO YES YES Stachyose NO YES NO YES NO NO NO D-Glucosamine NO YES YES YES YES YES YES Oxalomalic acid NO NO NO YES YES YES YES Glycine NO NO NO NO NO NO YES D,L-Carnitine NO NO NO YES NO NO YES Dextrin NO NO YES YES NO NO NO D-arabitol YES NO NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO YES YES NO YES D-Tagatose NO NO NO NO NO NO YES 2-Hydroxy benzoic acid NO NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO NO L-Histidine YES YES NO NO NO NO NO Sec-Butylamine NO NO NO NO NO NO YES Gelatin YES NO NO YES NO NO YES L-arabitol NO NO NO NO NO NO NO -Methyl-D-Galactoside NO NO NO YES NO NO NO Turanose NO YES NO YES NO NO YES 4-Hydroxy benzoic acid NO NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO NO L-Homoserine YES NO NO NO NO NO NO D,L-Octopamine NO NO YES YES YES NO NO Glycogen NO NO NO YES NO NO NO Arbutin NO YES YES YES NO YES YES 3-Methyl Glucose NO NO NO NO NO NO NO Xylitol NO NO NO YES NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO Sebacic acid NO NO NO NO YES NO NO Hydroxy-L-Proline NO NO NO NO YES NO YES Putrescine NO YES NO NO NO NO NO Inulin NO NO YES NO NO YES YES 2-Deoxy-D-Ribose NO NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO L-Isoleucine YES YES NO YES NO NO NO Dihydroxy acetone NO NO NO NO NO NO NO Laminarin NO NO NO YES NO NO NO i-Erythritol YES NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO NO -amino butyric acid NO NO NO YES NO NO YES a-Keto-valeric acid NO NO NO NO NO NO NO Succinamic acid NO YES NO NO NO NO NO L-Leucine YES NO NO YES NO NO NO 2,3-Butanediol NO NO NO YES NO NO NO Mannan NO NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO YES NO NO NO d-amino valeric acid NO NO NO NO YES NO NO Itaconic acid YES YES NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO NO L-Lysine NO NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO NO Pectin NO NO NO YES NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO YES NO NO NO arabinose Palatinose NO YES YES YES NO NO NO Butyric acid YES NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO NO L-Tartaric acid NO NO NO NO NO NO NO L-Methionine NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO
(459) TABLE-US-00023 TABLE N Substrate utilization as determined by BIOLOG PM2A MicroPlates by bacterial endophytes belonging to core OTUs. Strain/Substrate SYM00260 SYM00290 SYM00292 SYM00003 SYM00043 SYM00050 SYM05066 SYM00508 N-acetyl-D-Galactosamine NO NO NO NO NO YES NO NO Gentiobiose YES YES YES NO YES YES NO YES D-Raffinose YES YES YES NO NO YES NO NO Capric acid NO NO NO NO NO NO NO NO D-laclic acid methyl ester NO NO NO NO NO YES NO NO Acetamide NO NO NO NO NO NO NO NO L-Ornithine YES NO NO YES NO YES NO NO Chondrointin sulfate C YES NO NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO NO NO L-glucose NO NO NO NO NO NO NO NO Salicin YES YES YES NO NO YES NO YES Caproic acid YES NO YES NO NO NO NO YES Malonic acid YES NO NO NO NO NO NO NO L-Alaninamide NO YES NO NO NO NO NO NO L-Phenylalanine YES NO NO YES NO NO NO NO a-Cyclodextrin NO YES YES NO NO NO NO NO -D-allose NO NO YES NO NO NO NO NO Lactitol NO YES YES NO NO NO NO NO Sedoheptulosan NO NO NO NO NO NO NO NO Citraconic acid NO NO NO YES NO NO NO NO Melibionic acid YES NO NO NO NO YES NO NO N-Acetyl-L-Glutamic acid YES NO YES NO NO YES NO NO L-Pyroglutamic acid YES NO YES YES NO NO NO YES -Cyclodextrin NO YES YES NO NO NO NO NO Amygdalin NO YES YES NO NO NO NO NO D-Melezitose NO YES YES NO NO NO NO NO L-Sorbose NO NO NO NO NO NO NO NO Citramalic acid YES NO YES NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO NO L-Arginine YES NO NO NO NO NO NO NO L-Valine YES NO YES YES NO NO NO NO -Cyclodextrin NO YES YES NO NO NO NO NO D-arabinose NO YES YES NO NO NO NO YES Maltitol NO YES YES NO NO NO NO NO Stachyose YES YES YES NO NO NO NO NO D-Glucosamine YES YES YES YES YES YES NO YES Oxalomalic acid YES YES YES YES YES NO YES NO Glycine NO NO NO NO NO NO NO NO D,L-Carnitine NO NO NO YES NO NO NO NO Dextrin YES YES YES NO NO NO NO YES D-arabitol NO NO YES NO NO NO NO YES a-Methyl-D-Glucoside NO YES YES NO NO NO NO NO D-Tagatose NO YES NO NO NO NO NO YES 2-Hydroxy benzoic acid NO NO NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO NO NO L-Histidine YES YES NO NO YES NO NO NO Sec-Butylamine NO NO NO NO NO NO NO NO Gelatin YES YES YES NO NO NO NO NO L-arabitol NO NO NO NO NO NO NO NO -Methyl-D-Galactoside NO YES YES NO NO NO NO YES Turanose NO YES YES NO NO NO NO NO 4-Hydroxy benzoic acid NO NO NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO NO NO L-Homoserine NO NO NO NO NO NO NO NO D,L-Octopamine NO NO NO YES NO NO YES NO Glycogen YES YES YES NO NO NO NO YES Arbutin NO YES YES NO NO YES NO YES 3-Methyl Glucose NO NO YES NO NO NO NO YES Xylitol NO NO YES NO NO NO NO NO -Hydroxy butyric acid YES NO NO NO NO YES NO YES Sebacic acid YES NO NO NO NO NO NO NO Hydroxy-L-Proline YES NO YES NO NO YES NO NO Putrescine YES NO NO NO NO YES NO NO Inulin YES YES YES YES YES NO NO NO 2-Deoxy-D-Ribose NO NO YES NO NO NO NO YES -Methyl-D-Glucuronic acid NO NO YES NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO NO -Hydroxy butyric acid YES NO NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO NO L-Isoleucine YES NO YES YES NO NO NO YES Dihydroxy acetone NO NO YES NO NO YES NO YES Laminarin NO YES YES NO NO NO NO NO i-Erythritol NO NO NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO NO NO -amino butyric acid YES NO NO YES YES NO NO NO a-Keto-valeric acid YES NO NO NO NO NO NO NO Succinamic acid NO NO NO NO NO NO NO NO L-Leucine NO NO YES YES NO NO NO NO 2,3-Butanediol YES NO NO NO NO NO NO NO Mannan NO NO NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO NO -Methyl-D-Xyloside NO YES YES NO NO NO NO NO d-amino valeric acid YES NO NO NO NO NO NO NO Itaconic acid YES NO YES NO NO YES NO YES D-Tartaric acid NO NO NO NO NO NO NO NO L-Lysine YES NO NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO NO NO Pectin NO YES YES NO NO NO NO YES 3-0--D-Galactopyranosyl-D- NO NO YES NO NO NO NO NO arabinose Palatinose NO YES YES NO NO NO NO NO Butyric acid YES NO NO YES NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO YES NO NO YES L-Tartaric acid NO NO NO NO YES NO NO YES L-Methionine NO NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO NO Strain/Substrate SYM00525 SYM00053 SYM00538A SYM00538B SYM00538i SYM00543 SYM00563 SYM00574 N-acetyl-D-Galactosamine NO YES NO NO NO NO NO NO Gentiobiose YES YES NO YES YES NO YES NO D-Raffinose NO YES NO YES NO NO NO NO Capric acid NO NO NO NO NO NO NO NO D-laclic acid methyl ester NO YES NO NO NO NO NO NO Acetamide NO NO NO NO NO NO NO YES L-Ornithine NO NO NO NO NO NO NO NO Chondrointin sulfate C NO NO NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO NO NO L-glucose NO NO NO NO NO NO NO NO Salicin YES YES NO YES YES NO YES NO Caproic acid NO NO NO NO NO NO NO NO Malonic acid YES NO NO NO NO NO NO NO L-Alaninamide YES NO YES NO YES NO NO YES L-Phenylalanine NO NO NO NO NO NO NO YES a-Cyclodextrin NO NO YES NO NO YES NO NO -D-allose NO NO NO NO NO NO NO NO Lactitol YES NO NO YES NO NO NO NO Sedoheptulosan NO NO NO NO NO NO NO NO Citraconic acid NO NO NO NO NO NO NO YES Melibionic acid NO YES NO NO NO NO NO NO N-Acetyl-L-Glutamic acid NO YES NO NO YES NO NO NO L-Pyroglutamic acid YES NO YES NO YES YES NO YES -Cyclodextrin NO NO YES YES NO NO NO NO Amygdalin YES NO NO YES YES NO YES NO D-Melezitose YES NO NO YES NO NO NO NO L-Sorbose NO NO NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO NO L-Arginine NO NO NO NO NO YES NO YES L-Valine NO NO NO NO NO NO NO NO -Cyclodextrin NO NO YES YES NO NO NO NO D-arabinose NO NO NO NO NO NO NO YES Maltitol YES NO NO YES NO NO NO NO Stachyose YES NO NO YES NO NO NO NO D-Glucosamine YES YES YES YES YES YES YES YES Oxalomalic acid YES NO YES YES YES YES YES YES Glycine NO NO NO NO NO NO NO NO D,L-Carnitine NO NO NO NO NO NO NO YES Dextrin YES NO YES YES NO YES NO NO D-arabitol NO NO NO NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO YES NO NO NO NO D-Tagatose NO NO NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO NO NO L-Histidine NO NO NO NO NO YES NO YES Sec-Butylamine NO NO NO NO NO NO NO NO Gelatin NO NO YES NO YES YES NO NO L-arabitol NO NO NO NO NO NO NO NO -Methyl-D-Galactoside YES NO NO YES NO NO NO YES Turanose YES NO NO YES NO NO NO NO 4-Hydroxy benzoic acid NO NO NO NO NO NO NO YES D-Ribono-1,4-Lactone NO NO NO NO NO NO NO YES L-Homoserine NO NO NO NO NO NO NO YES D,L-Octopamine NO NO NO NO NO NO NO NO Glycogen NO NO NO YES NO YES NO NO Arbutin YES YES YES NO YES NO YES NO 3-Methyl Glucose NO NO NO NO NO NO NO NO Xylitol YES NO NO NO NO NO NO YES -Hydroxy butyric acid NO YES NO NO NO NO NO YES Sebacic acid NO NO NO NO NO NO NO YES Hydroxy-L-Proline YES YES NO NO NO YES NO YES Putrescine NO YES NO NO NO NO NO NO Inulin NO NO YES YES YES NO NO YES 2-Deoxy-D-Ribose NO NO NO NO NO NO NO NO -Methyl-D-Glucuronic acid YES NO NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO NO L-Isoleucine NO NO NO NO NO NO NO NO Dihydroxy acetone NO YES NO NO NO NO NO YES Laminarin NO NO NO YES NO NO NO YES i-Erythritol NO NO NO NO NO NO NO NO a-Methyl-D-Mannoside YES NO NO NO NO NO NO NO -amino butyric acid NO NO NO NO NO NO NO YES a-Keto-valeric acid NO NO NO NO NO NO NO NO Succinamic acid NO NO NO NO NO NO NO NO L-Leucine NO NO NO NO NO NO NO NO 2,3-Butanediol NO NO NO YES NO NO NO NO Mannan NO NO NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO YES NO NO NO NO d-amino valeric acid NO NO NO NO NO NO NO NO Itaconic acid NO YES NO NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO NO YES L-Lysine NO NO NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO NO NO Pectin NO NO NO YES NO NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO YES NO NO NO NO arabinose Palatinose YES NO NO YES NO NO NO NO Butyric acid NO NO NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO NO YES L-Tartaric acid NO NO NO NO NO NO NO YES L-Methionine NO NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO NO
(460) TABLE-US-00024 TABLE O Substrate utilization as determined by BIOLOG PM2A MicroPlates by bacterial endophytes belonging to core OTUs. Strain/Substrate SYM00057B SYM00617 SYM00620 SYM00627 SYM00628 SYM00062C SYM00650 N-acetyl-D-Galactosamine NO NO NO NO YES NO NO Gentiobiose NO YES YES YES YES YES NO D-Raffinose NO NO YES YES YES YES NO Capric acid NO NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO NO Acetamide NO NO NO NO NO NO NO L-Ornithine NO NO NO NO NO NO NO Chondrointin sulfate C NO NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO YES NO NO NO NO L-glucose NO NO NO NO NO NO NO Salicin NO YES NO YES YES YES NO Caproic acid NO NO NO NO NO NO NO Malonic acid NO NO NO NO NO NO NO L-Alaninamide NO NO NO NO NO NO NO L-Phenylalanine NO NO NO NO NO NO NO a-Cyclodextrin NO NO NO NO NO NO NO -D-allose NO NO NO NO NO NO NO Lactitol NO NO NO NO NO YES NO Sedoheptulosan NO NO NO NO NO NO NO Citraconic acid NO NO NO NO NO NO NO Melibionic acid NO NO YES YES YES NO NO N-Acetyl-L-Glutamic acid NO NO NO NO NO YES NO L-Pyroglutamic acid NO NO NO NO NO YES NO -Cyclodextrin NO NO NO NO NO NO NO Amygdalin NO YES NO NO NO YES NO D-Melezitose NO YES NO NO NO YES NO L-Sorbose NO NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO L-Arginine NO NO NO NO NO NO NO L-Valine NO NO NO NO NO NO NO -Cyclodextrin NO NO NO NO NO NO NO D-arabinose NO NO NO NO YES NO YES Maltitol NO NO NO YES YES NO NO Stachyose NO NO NO NO NO YES NO D-Glucosamine YES YES NO YES YES YES NO Oxalomalic acid YES YES NO NO NO YES NO Glycine NO NO NO NO NO NO NO D,L-Carnitine NO NO NO NO NO NO NO Dextrin NO YES YES NO NO YES NO D-arabitol NO NO NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO YES YES NO NO D-Tagatose NO NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO NO L-Histidine YES NO YES NO NO NO YES Sec-Butylamine NO NO NO NO NO NO NO Gelatin NO NO NO NO NO NO NO L-arabitol NO NO NO NO NO NO NO -Methyl-D-Galactoside NO NO YES YES YES YES NO Turanose NO NO NO YES NO YES NO 4-Hydroxy benzoic acid NO NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO NO L-Homoserine YES NO NO NO NO NO NO D,L-Octopamine NO YES NO NO NO YES NO Glycogen NO NO NO NO NO NO NO Arbutin NO YES NO YES YES YES NO 3-Methyl Glucose NO NO NO NO YES NO NO Xylitol YES NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO Sebacic acid YES NO NO NO NO NO NO Hydroxy-L-Proline NO NO NO NO NO NO YES Putrescine NO NO NO NO YES NO NO Inulin YES NO NO NO NO YES NO 2-Deoxy-D-Ribose NO NO YES NO NO NO YES -Methyl-D-Glucuronic acid NO NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO L-Isoleucine NO NO NO NO NO YES NO Dihydroxy acetone YES NO NO YES YES NO YES Laminarin NO NO NO NO NO NO NO i-Erythritol NO NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO NO -amino butyric acid YES NO NO NO NO NO YES a-Keto-valeric acid NO NO NO NO NO NO NO Succinamic acid NO NO NO NO NO NO NO L-Leucine YES NO NO NO NO NO NO 2,3-Butanediol NO NO NO NO NO YES NO Mannan NO NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO YES NO d-amino valeric acid NO NO NO NO NO NO NO Itaconic acid NO NO NO NO NO NO NO D-Tartaric acid YES NO NO NO NO NO NO L-Lysine NO NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO NO Pectin NO NO NO NO NO NO NO 3-0--D-Galactopyranosyl- NO NO NO NO YES NO NO D-arabinose Palatinose NO NO NO YES YES YES NO Butyric acid NO NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO NO L-Tartaric acid NO NO NO NO NO NO NO L-Methionine NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO Strain/Substrate SYM00068 SYM00070 SYM00714 SYM00009 SYM00905 SYM00924 SYM00963 N-acetyl-D-Galactosamine NO NO YES NO YES NO NO Gentiobiose NO NO YES NO YES NO NO D-Raffinose NO NO YES NO NO NO NO Capric acid NO NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO NO Acetamide YES NO NO NO NO NO NO L-Ornithine YES YES NO YES NO NO NO Chondrointin sulfate C NO NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO NO L-glucose NO NO NO NO NO NO NO Salicin NO NO YES NO YES NO NO Caproic acid NO NO NO NO NO NO NO Malonic acid NO NO NO NO NO NO NO L-Alaninamide NO NO YES NO YES YES NO L-Phenylalanine YES NO NO YES NO NO NO a-Cyclodextrin NO NO NO NO NO NO NO -D-allose NO NO YES NO NO NO NO Lactitol NO NO YES NO YES NO NO Sedoheptulosan NO NO NO NO NO NO NO Citraconic acid YES NO NO YES NO YES NO Melibionic acid YES NO YES NO NO NO NO N-Acetyl-L-Glutamic acid NO NO NO NO NO NO NO L-Pyroglutamic acid YES YES YES YES NO NO NO -Cyclodextrin NO NO NO NO NO NO NO Amygdalin NO NO NO NO NO NO NO D-Melezitose NO NO YES NO NO NO YES L-Sorbose NO NO NO NO NO NO YES Citramalic acid NO NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO L-Arginine NO NO YES NO NO NO NO L-Valine YES YES YES YES NO NO NO -Cyclodextrin NO NO NO NO NO NO NO D-arabinose NO NO YES NO NO YES YES Maltitol NO NO YES NO YES NO YES Stachyose NO NO NO NO NO NO YES D-Glucosamine YES YES YES YES YES NO NO Oxalomalic acid YES YES YES YES YES NO NO Glycine NO NO NO NO NO NO NO D,L-Carnitine NO YES NO YES NO NO NO Dextrin NO NO NO NO NO NO NO D-arabitol NO NO NO NO NO NO NO a-Methyl-D-Glucoside NO NO YES NO NO NO YES D-Tagatose NO NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO NO Quinic acid NO NO NO NO NO NO NO L-Histidine NO YES YES NO NO NO NO Sec-Butylamine NO NO NO NO NO NO NO Gelatin NO NO NO NO YES NO NO L-arabitol NO NO NO NO NO NO NO -Methyl-D-Galactoside NO NO YES NO NO NO YES Turanose NO NO YES NO NO NO YES 4-Hydroxy benzoic acid NO NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO YES NO NO NO NO L-Homoserine NO NO NO NO NO NO NO D,L-Octopamine YES YES NO YES YES NO YES Glycogen NO NO NO NO NO NO NO Arbutin NO YES YES NO YES NO NO 3-Methyl Glucose NO NO NO NO NO NO NO Xylitol NO YES YES YES NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO NO Sebacic acid NO NO NO NO NO NO NO Hydroxy-L-Proline NO NO NO NO NO NO NO Putrescine NO YES NO NO NO NO NO Inulin NO NO NO NO NO NO NO 2-Deoxy-D-Ribose NO NO NO NO NO YES NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO YES NO Sorbic acid NO NO NO NO NO NO NO L-Isoleucine YES YES YES YES NO NO NO Dihydroxy acetone NO NO NO NO NO YES YES Laminarin NO NO NO NO NO NO NO i-Erythritol NO NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO NO -amino butyric acid NO YES YES NO NO NO NO a-Keto-valeric acid NO NO NO NO NO NO NO Succinamic acid NO NO NO NO NO YES NO L-Leucine NO NO YES YES NO NO NO 2,3-Butanediol NO NO NO NO NO NO NO Mannan NO NO NO NO NO NO NO D-Fucose NO NO YES NO NO NO NO -Methyl-D-Xyloside NO NO YES NO NO NO NO d-amino valeric acid NO NO NO NO NO NO NO Itaconic acid NO NO NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO NO L-Lysine NO NO NO NO NO NO NO 2,3-Butanone NO NO NO NO NO NO NO Pectin NO NO NO NO NO NO NO 3-0--D-Galactopyranosyl- NO NO NO NO NO NO NO D-arabinose Palatinose NO NO YES NO YES NO YES Butyric acid NO NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO NO L-Tartaric acid NO YES NO YES NO NO NO L-Methionine NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO Strain/Substrate SYM00978 SYM00982 SYM00987 SYM00991 SYM00999 N-acetyl-D-Galactosamine NO NO NO YES NO Gentiobiose NO NO NO NO NO D-Raffinose NO NO NO YES NO Capric acid NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO Acetamide NO NO NO NO NO L-Ornithine NO NO NO NO NO Chondrointin sulfate C NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO L-glucose NO NO NO NO NO Salicin NO NO NO YES NO Caproic acid NO NO NO NO NO Malonic acid NO NO NO NO NO L-Alaninamide NO NO NO NO NO L-Phenylalanine NO NO NO NO NO a-Cyclodextrin NO YES NO NO NO -D-allose NO NO NO NO NO Lactitol NO NO NO NO NO Sedoheptulosan NO NO NO NO NO Citraconic acid NO NO NO NO NO Melibionic acid YES NO NO NO NO N-Acetyl-L-Glutamic acid NO NO YES NO NO L-Pyroglutamic acid NO YES YES NO NO -Cyclodextrin NO YES NO NO NO Amygdalin NO NO NO YES NO D-Melezitose NO NO YES NO NO L-Sorbose NO NO YES NO NO Citramalic acid NO NO NO NO NO Oxalic acid NO NO NO NO NO L-Arginine NO NO NO NO NO L-Valine NO NO NO NO NO -Cyclodextrin NO NO NO NO NO D-arabinose NO NO NO NO NO Maltitol NO NO NO NO NO Stachyose NO NO NO NO NO D-Glucosamine YES NO YES YES YES Oxalomalic acid YES NO YES NO YES Glycine NO NO NO NO NO D,L-Carnitine NO NO NO NO NO Dextrin NO NO NO YES NO D-arabitol NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO NO NO D-Tagatose NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO Quinic acid NO NO NO NO NO L-Histidine NO NO NO NO NO Sec-Butylamine NO NO NO NO NO Gelatin NO YES NO NO NO L-arabitol NO NO NO NO NO -Methyl-D-Galactoside YES NO YES NO NO Turanose NO NO YES NO NO 4-Hydroxy benzoic acid NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO L-Homoserine NO NO NO NO NO D,L-Octopamine NO NO YES YES NO Glycogen NO NO NO NO NO Arbutin YES NO NO YES NO 3-Methyl Glucose NO NO NO NO NO Xylitol NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO Sebacic acid YES NO NO NO NO Hydroxy-L-Proline NO NO YES YES YES Putrescine NO NO NO NO NO Inulin NO NO YES NO YES 2-Deoxy-D-Ribose NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO Sorbic acid NO NO NO NO NO L-Isoleucine NO NO NO NO NO Dihydroxy acetone NO NO YES NO NO Laminarin NO YES NO NO NO i-Erythritol NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO -amino butyric acid NO NO NO NO NO a-Keto-valeric acid NO NO NO NO NO Succinamic acid NO NO NO NO NO L-Leucine NO NO NO NO NO 2,3-Butanediol NO NO NO NO NO Mannan NO NO NO NO NO D-Fucose NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO d-amino valeric acid NO NO NO NO NO Itaconic acid NO NO NO YES NO D-Tartaric acid NO NO NO NO NO L-Lysine NO NO NO NO NO 2,3-Butanone NO NO NO NO NO Pectin NO NO NO YES NO 3-0--D-Galactopyranosyl- NO NO YES NO NO D-arabinose Palatinose YES NO YES NO NO Butyric acid NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO L-Tartaric acid NO NO NO NO NO L-Methionine NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO
(461) TABLE-US-00025 TABLE P Substrate utilization as determined by BIOLOG PM1 MicroPlates by fungal endophytes belonging to core OTUs. Strain/Substrate SYM00120 SYM00122 SYM00123 SYM00124 SYM00129 SYM01300 D-Serine NO NO YES YES NO NO D-Glucose-6-Phosphate NO NO NO YES YES NO L-Asparagine NO NO NO YES NO YES L-glutamine NO NO NO YES YES YES Glycyl-L-Aspartic acid NO NO NO NO NO YES Glycyl-L-Glutamic acid NO NO NO YES NO YES Glycyl-L-Proline NO NO NO YES NO YES L-Arabinose YES NO NO NO YES NO D-Sorbitol NO NO YES YES YES YES D-Galactonic acid-?-lactone NO NO NO NO NO YES D-Aspartic acid NO NO YES YES NO NO m-Tartaric acid NO NO NO YES NO YES Citric acid NO NO NO YES NO YES Tricarballylic acid NO NO NO YES NO YES p-Hydroxy Phenyl acetic acid NO NO NO YES NO NO N-Acetyl-D-Glucosamine NO NO YES YES YES YES Glycerol YES NO NO YES YES YES D-L-Malic acid NO NO NO YES NO YES D-Glucosaminic acid NO NO NO YES NO YES D-Glucose-1-Phosphate NO NO YES YES NO YES m-Inositol NO NO NO YES NO YES L-Serine NO NO NO YES NO YES m-Hydroxy Phenyl Acetic acid NO NO NO YES NO YES D-Saccharic acid NO NO NO YES NO YES L-Fucose NO NO NO YES NO YES D-Ribose NO NO YES YES YES YES 1,2-Propanediol NO NO NO YES NO NO D-Fructose-6-Phosphate NO NO NO NO NO NO D-Threonine NO NO YES YES NO NO L-Threonine NO YES NO YES NO YES Tyramine YES NO NO YES NO YES Succinic acid NO NO NO YES NO YES D-Glucuronic acid NO NO YES YES YES YES Tween 20 NO NO NO YES YES YES Tween 40 NO NO YES YES YES YES Tween 80 NO NO YES NO YES YES Fumaric acid NO NO YES NO NO YES L-Alanine NO NO NO YES NO YES D-Psicose NO NO NO YES NO NO D-Galactose YES NO YES YES NO YES D-Gluconic acid NO NO NO YES YES YES L-Rhamnose NO NO NO YES YES YES a-Keto-Glutaric acid NO NO NO YES NO YES a-Hydroxy Glutaric acid-?- NO NO YES YES NO YES lactone Bromo succinic acid NO NO YES YES NO YES L-Alanyl-Glycine NO NO YES YES NO YES L-Lyxose NO NO NO YES NO NO L-Aspartic acid NO NO YES YES NO YES D-L-a-Glycerol phosphate NO NO NO YES NO NO D-Fructose NO NO NO YES YES YES a-Keto-Butyric acid NO NO NO YES NO NO a-Hydroxy Butyric acid NO NO NO YES NO NO Propionic acid NO NO YES YES NO YES Acetoacetic acid NO NO NO YES NO NO Glucuronamide NO NO NO NO NO NO L-Proline NO NO NO YES NO YES D-Xylose YES NO NO YES YES YES Acetic acid NO NO YES YES NO NO a-Methyl-D-Galactoside NO NO NO YES YES NO -Methyl-D-glucoside NO NO YES YES YES YES Mucic acid NO NO NO YES YES YES N-acetyl--D-Mannosamine NO NO YES YES NO NO Pyruvic acid NO NO YES YES YES YES D-Alanine NO NO YES YES NO YES L-Lactic acid NO NO YES NO NO YES a-D-Glucose NO NO NO YES YES YES a-D-Lactose NO NO YES YES YES YES Adonitol NO NO NO YES NO YES Glycolic acid NO NO YES YES NO NO Mono Methyl Succinate NO NO NO YES NO YES L-Galactonic-acid-?-lactone NO NO NO NO NO YES D-Trehalose NO NO NO YES YES YES Formic acid NO NO NO YES NO NO Maltose YES NO YES YES YES YES Lactulose YES NO NO YES NO YES Maltotriose NO NO YES YES YES YES Glyoxylic acid NO NO YES YES NO NO Methyl Pyruvate NO NO YES YES NO YES D-Galacturonic acid NO NO YES YES YES YES D-Mannose NO NO YES YES YES YES D-Mannitol NO NO YES YES YES YES D-Melibiose NO NO YES YES YES YES Sucrose NO NO YES YES YES YES 2-Deoxy adenosine NO NO NO NO NO NO D-Cellobiose NO NO YES YES NO YES D-Malic acid NO NO NO YES NO YES Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO NO YES YES YES YES L-Glutamic acid NO NO YES YES NO YES Thymidine NO NO NO YES NO NO Uridine NO NO YES YES NO YES Adenosine NO NO YES YES NO YES Inosine NO NO NO YES YES YES L-Malic acid YES NO NO YES NO YES 2-Aminoethanol NO NO YES YES NO YES Strain/Substrate SYM01310 SYM01311 SYM01314 SYM01315 SYM01325 SYM01326 D-Serine NO YES NO YES NO NO D-Glucose-6-Phosphate NO NO YES NO NO NO L-Asparagine YES YES YES NO YES YES L-glutamine YES YES YES NO YES YES Glycyl-L-Aspartic acid NO YES NO YES NO YES Glycyl-L-Glutamic acid YES YES YES YES NO NO Glycyl-L-Proline NO YES YES NO NO YES L-Arabinose YES YES YES YES YES YES D-Sorbitol YES YES YES YES YES YES D-Galactonic acid-?-lactone NO NO YES NO NO NO D-Aspartic acid NO YES NO NO NO NO m-Tartaric acid NO YES YES YES NO NO Citric acid YES YES YES YES NO YES Tricarballylic acid NO YES YES NO YES NO p-Hydroxy Phenyl acetic acid NO NO YES NO NO YES N-Acetyl-D-Glucosamine YES YES YES YES YES YES Glycerol YES YES NO YES YES NO D-L-Malic acid YES YES YES YES NO NO D-Glucosaminic acid NO NO YES NO NO YES D-Glucose-1-Phosphate NO NO YES NO NO NO m-Inositol YES YES YES YES YES YES L-Serine YES YES YES NO NO YES m-Hydroxy Phenyl Acetic acid NO NO NO YES NO NO D-Saccharic acid YES YES YES YES YES YES L-Fucose NO YES YES YES NO NO D-Ribose YES YES NO YES YES YES 1,2-Propanediol NO NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO NO NO NO D-Threonine NO YES NO NO NO NO L-Threonine NO YES NO NO NO YES Tyramine YES YES YES YES NO YES Succinic acid YES YES NO NO NO YES D-Glucuronic acid YES YES YES YES NO YES Tween 20 YES YES YES YES NO YES Tween 40 NO YES YES YES YES YES Tween 80 YES YES YES YES YES YES Fumaric acid YES YES YES YES YES YES L-Alanine YES YES YES YES YES YES D-Psicose NO NO NO NO NO NO D-Galactose YES YES YES YES YES YES D-Gluconic acid YES YES YES NO YES YES L-Rhamnose NO YES YES YES YES NO a-Keto-Glutaric acid YES YES YES NO NO YES a-Hydroxy Glutaric acid-?- YES YES YES NO NO NO lactone Bromo succinic acid YES YES YES NO YES YES L-Alanyl-Glycine YES YES YES NO NO YES L-Lyxose NO NO NO NO NO NO L-Aspartic acid YES YES YES YES NO YES D-L-a-Glycerol phosphate YES NO YES YES NO NO D-Fructose YES YES YES YES YES YES a-Keto-Butyric acid NO YES NO YES NO NO a-Hydroxy Butyric acid NO YES NO NO NO NO Propionic acid YES YES YES NO NO NO Acetoacetic acid NO NO NO YES NO NO Glucuronamide NO NO NO NO NO NO L-Proline YES YES YES YES YES NO D-Xylose YES YES YES NO YES NO Acetic acid NO YES NO NO NO NO a-Methyl-D-Galactoside YES YES NO NO YES YES -Methyl-D-glucoside YES YES YES NO YES YES Mucic acid YES YES YES YES NO YES N-acetyl--D-Mannosamine NO NO NO YES NO NO Pyruvic acid YES YES YES NO NO YES D-Alanine YES YES YES NO NO YES L-Lactic acid YES YES YES YES NO YES a-D-Glucose YES YES YES YES YES YES a-D-Lactose NO YES YES NO NO YES Adonitol YES YES YES YES YES NO Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate NO YES YES NO NO NO L-Galactonic-acid-?-lactone YES YES YES NO YES YES D-Trehalose YES YES YES YES YES YES Formic acid NO NO NO YES NO NO Maltose YES YES YES NO YES YES Lactulose NO YES NO YES NO NO Maltotriose NO YES YES YES YES YES Glyoxylic acid NO NO NO NO NO NO Methyl Pyruvate YES YES NO NO NO YES D-Galacturonic acid YES YES YES NO NO YES D-Mannose YES YES YES NO YES YES D-Mannitol YES YES YES YES YES YES D-Melibiose YES YES NO NO YES NO Sucrose YES YES YES NO YES YES 2-Deoxy adenosine NO YES NO NO NO NO D-Cellobiose YES YES YES NO YES YES D-Malic acid YES YES YES NO NO NO Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO YES NO NO NO NO L-Glutamic acid YES YES YES YES YES YES Thymidine NO NO NO NO NO NO Uridine YES YES YES NO NO YES Adenosine NO NO YES YES NO NO Inosine YES YES YES YES NO YES L-Malic acid YES YES YES YES YES YES 2-Aminoethanol YES YES YES NO YES NO Strain/Substrate SYM01327 SYM01328 SYM01333 SYM0135 SYM0136 D-Serine NO NO NO NO NO D-Glucose-6-Phosphate YES YES NO NO NO L-Asparagine YES YES YES NO NO L-glutamine YES NO YES YES NO Glycyl-L-Aspartic acid n/a NO NO NO NO Glycyl-L-Glutamic acid YES YES NO NO NO Glycyl-L-Proline YES YES NO NO NO L-Arabinose YES YES YES YES YES D-Sorbitol YES YES YES YES YES D-Galactonic acid-?-lactone YES NO YES NO NO D-Aspartic acid NO NO NO NO NO m-Tartaric acid NO NO NO NO NO Citric acid n/a NO YES NO NO Tricarballylic acid YES YES NO YES NO p-Hydroxy Phenyl acetic acid YES NO NO NO NO N-Acetyl-D-Glucosamine YES NO YES YES YES Glycerol YES YES YES NO NO D-L-Malic acid YES YES YES NO NO D-Glucosaminic acid YES NO NO NO NO D-Glucose-1-Phosphate YES NO NO NO NO m-Inositol n/a NO YES NO NO L-Serine YES NO YES NO NO m-Hydroxy Phenyl Acetic acid NO YES NO NO NO D-Saccharic acid YES NO YES NO NO L-Fucose YES NO NO NO NO D-Ribose YES YES NO YES NO 1,2-Propanediol NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO NO NO D-Threonine n/a YES NO NO NO L-Threonine NO YES NO NO NO Tyramine YES NO YES NO NO Succinic acid YES NO YES NO NO D-Glucuronic acid YES YES YES YES NO Tween 20 YES NO YES YES YES Tween 40 YES YES YES YES YES Tween 80 YES YES YES YES YES Fumaric acid n/a YES YES NO NO L-Alanine YES YES YES NO NO D-Psicose NO YES NO NO NO D-Galactose YES YES YES YES YES D-Gluconic acid YES YES YES YES YES L-Rhamnose YES NO NO NO NO a-Keto-Glutaric acid YES YES YES NO NO a-Hydroxy Glutaric acid-?- YES YES YES NO NO lactone Bromo succinic acid n/a NO NO NO NO L-Alanyl-Glycine YES YES YES NO NO L-Lyxose NO NO NO NO NO L-Aspartic acid YES YES YES NO NO D-L-a-Glycerol phosphate YES NO NO NO NO D-Fructose YES YES YES YES NO a-Keto-Butyric acid YES NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO Propionic acid n/a NO NO NO NO Acetoacetic acid NO NO NO NO NO Glucuronamide NO NO NO NO NO L-Proline YES YES YES YES NO D-Xylose YES NO YES YES NO Acetic acid YES NO NO NO NO a-Methyl-D-Galactoside YES YES NO YES YES -Methyl-D-glucoside NO YES NO YES YES Mucic acid n/a YES YES NO NO N-acetyl--D-Mannosamine NO YES NO NO NO Pyruvic acid YES NO YES NO NO D-Alanine YES NO YES NO NO L-Lactic acid YES NO YES NO NO a-D-Glucose YES YES YES YES YES a-D-Lactose YES YES YES NO NO Adonitol YES NO YES NO NO Glycolic acid n/a NO NO NO NO Mono Methyl Succinate YES NO NO NO NO L-Galactonic-acid-?-lactone YES NO YES YES NO D-Trehalose YES NO YES YES NO Formic acid NO YES NO NO NO Maltose YES YES YES YES YES Lactulose YES YES NO NO NO Maltotriose YES YES NO YES YES Glyoxylic acid n/a NO NO NO NO Methyl Pyruvate YES NO NO NO NO D-Galacturonic acid YES NO YES NO NO D-Mannose YES YES YES YES YES D-Mannitol YES NO YES YES YES D-Melibiose YES YES NO YES YES Sucrose YES YES YES YES YES 2-Deoxy adenosine NO NO NO NO NO D-Cellobiose n/a YES NO YES NO D-Malic acid YES NO NO NO NO Phenylethyl-amine NO NO NO NO NO Dulcitol NO YES NO NO NO L-Glutamic acid YES NO YES YES YES Thymidine YES YES NO NO NO Uridine YES NO YES NO YES Adenosine YES NO YES NO NO Inosine n/a NO YES NO NO L-Malic acid YES NO YES NO NO 2-Aminoethanol YES NO YES NO NO
(462) TABLE-US-00026 TABLE Q Substrate utilization as determined by BIOLOG PM1 MicroPlates by fungal endophytes belonging to core OTUs. Strain/Substrate SYM00151 SYM00154 SYM015811 SYM15820 SYM15825 SYM15828 SYM15831 SYM15837 D-Serine NO NO NO NO YES NO NO NO D-Glucose-6-Phosphate YES YES NO NO NO NO NO NO L-Asparagine YES NO YES YES YES YES YES YES L-glutamine YES NO NO YES YES YES YES YES Glycyl-L-Aspartic acid NO YES YES YES YES YES NO NO Glycyl-L-Glutamic acid NO YES NO YES YES YES NO YES Glycyl-L-Proline YES YES NO YES YES YES YES NO L-Arabinose YES YES NO YES YES YES YES YES D-Sorbitol YES YES YES YES YES YES YES YES D-Galactonic acid-?-lactone NO YES YES YES NO NO NO YES D-Aspartic acid NO YES NO NO NO NO NO YES m-Tartaric acid YES NO NO NO YES NO YES NO Citric acid YES YES YES YES YES YES YES YES Tricarballylic acid YES NO NO NO YES NO NO YES p-Hydroxy Phenyl acetic acid YES YES YES YES NO YES NO YES N-Acetyl-D-Glucosamine YES YES NO YES YES YES YES NO Glycerol YES YES YES YES YES YES YES NO D-L-Malic acid NO YES NO YES YES YES NO YES D-Glucosaminic acid NO YES YES NO NO NO NO NO D-Glucose-1-Phosphate NO NO NO NO NO NO NO NO m-Inositol YES YES NO YES YES YES NO YES L-Serine NO NO NO YES YES YES NO YES m-Hydroxy Phenyl Acetic acid NO NO NO NO NO NO NO NO D-Saccharic acid YES NO NO YES YES YES YES YES L-Fucose NO YES NO NO NO YES YES NO D-Ribose YES YES NO YES YES YES YES YES 1,2-Propanediol NO YES NO NO NO YES NO NO D-Fructose-6-Phosphate NO YES NO NO NO NO NO NO D-Threonine NO NO NO NO NO NO NO YES L-Threonine NO NO YES YES YES NO NO YES Tyramine YES YES NO NO YES YES NO YES Succinic acid YES YES NO YES YES YES NO YES D-Glucuronic acid NO YES NO YES YES YES NO NO Tween 20 YES YES YES YES YES YES YES YES Tween 40 YES YES YES YES YES YES YES YES Tween 80 YES YES NO YES YES YES YES YES Fumaric acid NO NO YES YES YES YES YES NO L-Alanine YES NO YES YES YES YES YES NO D-Psicose NO YES NO NO NO NO NO NO D-Galactose YES YES NO YES YES YES YES YES D-Gluconic acid YES YES YES YES YES YES YES YES L-Rhamnose YES YES NO NO YES NO NO YES a-Keto-Glutaric acid NO NO YES YES NO YES NO NO a-Hydroxy Glutaric acid-?- NO YES NO YES NO YES NO YES lactone Bromo succinic acid NO YES NO NO YES YES NO NO L-Alanyl-Glycine YES YES YES YES YES YES YES YES L-Lyxose NO NO NO NO NO NO NO NO L-Aspartic acid YES NO NO YES YES YES YES YES D-L-a-Glycerol phosphate NO YES YES YES NO YES NO YES D-Fructose YES YES YES YES YES YES YES YES a-Keto-Butyric acid NO YES NO NO YES NO NO NO a-Hydroxy Butyric acid NO YES NO NO YES NO NO NO Propionic acid NO YES NO NO YES YES YES YES Acetoacetic acid NO NO NO NO NO NO NO NO Glucuronamide NO NO YES NO NO NO NO YES L-Proline YES YES NO YES YES YES YES YES D-Xylose YES NO NO YES YES YES YES YES Acetic acid YES YES NO YES YES YES YES YES a-Methyl-D-Galactoside YES NO NO NO YES YES YES YES -Methyl-D-glucoside YES YES NO NO YES NO YES YES Mucic acid YES YES NO YES YES YES YES YES N-acetyl--D-Mannosamine NO YES NO NO NO YES NO YES Pyruvic acid YES YES NO YES YES YES YES NO D-Alanine YES NO YES YES NO YES YES YES L-Lactic acid YES NO NO YES YES YES YES NO a-D-Glucose YES YES YES YES YES YES YES YES a-D-Lactose YES NO NO NO YES NO NO YES Adonitol YES YES YES YES YES YES NO YES Glycolic acid NO YES NO NO YES NO NO NO Mono Methyl Succinate YES NO NO NO YES NO YES NO L-Galactonic-acid-?-lactone YES YES NO YES YES YES YES YES D-Trehalose YES YES NO YES YES YES YES YES Formic acid YES NO NO NO YES NO NO NO Maltose YES YES NO YES YES NO YES YES Lactulose YES YES NO NO YES NO YES YES Maltotriose YES NO NO YES YES YES YES YES Glyoxylic acid NO YES NO NO YES NO NO NO Methyl Pyruvate YES NO NO YES YES YES YES YES D-Galacturonic acid YES YES YES YES YES YES YES YES D-Mannose YES YES NO YES YES YES YES YES D-Mannitol YES YES YES YES YES YES YES YES D-Melibiose YES NO YES YES YES YES YES YES Sucrose YES YES NO YES YES YES YES YES 2-Deoxy adenosine YES NO NO NO YES NO NO NO D-Cellobiose YES YES NO YES YES NO YES YES D-Malic acid YES YES YES NO YES NO NO YES Phenylethyl-amine NO NO NO NO NO NO NO NO Dulcitol YES YES NO NO YES NO YES YES L-Glutamic acid YES YES YES YES YES YES YES YES Thymidine NO YES NO NO YES NO YES NO Uridine YES YES YES YES YES NO YES YES Adenosine NO YES YES YES NO YES YES YES Inosine YES NO YES YES NO YES YES YES L-Malic acid YES YES NO YES NO YES YES NO 2-Aminoethanol YES YES NO YES YES YES NO YES Strain/Substrate SYM15839 SYM15847 SYM15872 SYM15890 SYM15901 SYM15920 SYM15926 SYM15928 D-Serine YES YES NO NO NO YES NO NO D-Glucose-6-Phosphate NO NO NO NO NO NO NO NO L-Asparagine NO YES YES NO YES YES YES YES L-glutamine YES YES YES YES YES YES NO NO Glycyl-L-Aspartic acid NO NO NO NO NO YES NO NO Glycyl-L-Glutamic acid NO YES YES YES YES YES NO NO Glycyl-L-Proline NO YES YES NO YES YES NO YES L-Arabinose YES YES YES YES YES YES NO YES D-Sorbitol YES YES YES YES YES YES NO YES D-Galactonic acid-?-lactone YES NO NO NO NO YES YES NO D-Aspartic acid NO NO NO NO NO YES NO YES m-Tartaric acid YES NO YES NO YES YES NO NO Citric acid NO YES NO YES NO NO NO NO Tricarballylic acid YES YES YES YES YES YES NO NO p-Hydroxy Phenyl acetic acid YES NO NO NO NO YES NO NO N-Acetyl-D-Glucosamine YES YES YES YES YES YES YES YES Glycerol YES YES YES YES YES YES YES YES D-L-Malic acid YES NO YES YES YES YES NO NO D-Glucosaminic acid NO NO NO YES NO NO NO NO D-Glucose-1-Phosphate NO NO NO NO NO NO NO NO m-Inositol YES YES YES YES YES YES NO NO L-Serine NO NO YES NO YES YES NO NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO NO NO NO D-Saccharic acid YES NO YES YES YES YES NO YES L-Fucose NO NO NO NO NO NO NO NO D-Ribose YES YES YES NO YES YES NO YES 1,2-Propanediol NO NO NO NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO NO NO NO NO NO D-Threonine NO NO NO NO NO YES NO NO L-Threonine NO NO YES NO YES YES NO NO Tyramine YES YES YES NO YES YES YES NO Succinic acid NO NO NO YES YES YES NO NO D-Glucuronic acid NO YES YES YES YES YES YES YES Tween 20 YES YES YES NO YES YES YES YES Tween 40 YES NO YES YES YES YES NO YES Tween 80 YES YES YES YES YES YES NO YES Fumaric acid NO NO YES NO YES YES NO YES L-Alanine NO YES YES YES YES YES YES NO D-Psicose NO NO NO NO NO NO NO NO D-Galactose YES YES YES NO YES YES YES NO D-Gluconic acid YES YES YES YES YES YES NO YES L-Rhamnose YES YES YES NO YES YES NO NO a-Keto-Glutaric acid NO NO YES YES NO NO NO NO a-Hydroxy Glutaric acid-?- NO NO NO NO NO NO NO NO lactone Bromo succinic acid YES YES YES NO YES YES NO NO L-Alanyl-Glycine YES YES YES YES YES YES NO YES L-Lyxose NO NO NO NO NO YES YES NO L-Aspartic acid NO YES YES YES YES YES NO YES D-L-a-Glycerol phosphate YES NO YES NO NO NO YES NO D-Fructose YES YES YES YES YES YES NO NO a-Keto-Butyric acid NO YES YES NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO NO NO Propionic acid YES NO NO YES YES YES NO NO Acetoacetic acid NO NO NO NO NO YES NO NO Glucuronamide NO NO NO NO NO NO NO NO L-Proline YES YES YES YES YES YES YES YES D-Xylose YES YES YES NO YES YES NO YES Acetic acid YES YES YES NO YES YES YES NO a-Methyl-D-Galactoside YES YES YES NO YES YES NO NO -Methyl-D-glucoside YES YES YES NO YES YES NO YES Mucic acid YES YES YES YES YES YES NO NO N-acetyl--D-Mannosamine NO NO NO NO NO NO NO NO Pyruvic acid YES YES YES YES YES YES NO YES D-Alanine NO NO NO NO NO YES YES NO L-Lactic acid YES YES YES NO YES YES NO YES a-D-Glucose YES YES YES YES YES YES YES YES a-D-Lactose NO YES YES NO YES YES NO NO Adonitol NO NO YES NO YES YES NO NO Glycolic acid NO NO NO NO NO NO NO NO Mono Methyl Succinate NO NO NO YES NO NO NO YES L-Galactonic-acid-?-lactone YES YES YES YES YES YES YES YES D-Trehalose YES YES YES YES YES YES NO YES Formic acid NO NO YES YES YES NO NO NO Maltose YES YES YES YES YES YES YES YES Lactulose NO NO YES NO YES YES NO NO Maltotriose YES YES YES NO YES YES YES YES Glyoxylic acid NO NO YES NO YES NO NO NO Methyl Pyruvate YES YES YES YES YES YES NO YES D-Galacturonic acid YES YES YES NO YES YES YES NO D-Mannose YES YES YES YES YES YES NO YES D-Mannitol YES YES YES NO YES YES NO YES D-Melibiose YES YES YES NO YES YES NO YES Sucrose YES YES YES YES YES YES NO YES 2-Deoxy adenosine YES NO YES NO YES NO NO NO D-Cellobiose YES YES YES YES YES YES NO YES D-Malic acid YES NO YES NO YES YES NO NO Phenylethyl-amine NO NO NO NO NO NO NO NO Dulcitol YES YES YES NO YES YES NO YES L-Glutamic acid YES YES YES YES YES YES NO NO Thymidine NO NO YES NO YES NO NO NO Uridine NO YES YES YES YES NO NO NO Adenosine NO YES YES NO YES NO NO NO Inosine NO NO NO YES YES YES YES NO L-Malic acid NO YES YES NO YES YES NO YES 2-Aminoethanol NO YES YES NO YES YES YES YES
(463) TABLE-US-00027 TABLE R Substrate utilization as determined by BIOLOG PM1 MicroPlates by fungal endophytes belonging to core OTUs. Strain/Substrate SYM15932 SYM00160 SYM00034 SYM00566B SYM00577 SYM00590 D-Serine NO NO NO NO NO NO D-Glucose-6-Phosphate NO NO NO NO NO NO L-Asparagine NO NO YES NO YES YES L-glutamine NO YES YES YES YES NO Glycyl-L-Aspartic acid NO NO YES NO NO NO Glycyl-L-Glutamic acid NO NO NO NO NO NO Glycyl-L-Proline NO YES NO YES YES NO L-Arabinose YES NO YES NO YES YES D-Sorbitol NO NO YES NO YES YES D-Galactonic acid-?-lactone NO NO NO YES NO NO D-Aspartic acid NO NO NO NO NO NO m-Tartaric acid NO NO NO YES YES NO Citric acid NO NO NO YES YES NO Tricarballylic acid NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO NO YES YES NO N-Acetyl-D-Glucosamine NO NO YES YES YES YES Glycerol NO NO YES YES NO NO D-L-Malic acid NO YES NO NO YES NO D-Glucosaminic acid NO NO YES YES NO NO D-Glucose-1-Phosphate NO NO NO NO NO NO m-Inositol NO NO NO YES YES NO L-Serine NO NO NO YES YES NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO NO D-Saccharic acid NO NO NO YES YES NO L-Fucose NO NO NO NO NO NO D-Ribose NO NO YES YES YES YES 1,2-Propanediol NO NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO YES NO NO D-Threonine NO NO NO NO NO NO L-Threonine NO NO NO NO YES NO Tyramine YES NO NO NO YES NO Succinic acid NO NO YES NO NO NO D-Glucuronic acid YES NO NO NO YES NO Tween 20 NO NO YES NO YES YES Tween 40 NO YES YES YES YES NO Twecn 80 NO NO YES YES YES NO Fumaric acid NO YES YES YES NO NO L-Alanine NO NO NO NO YES YES D-Psicose NO NO NO NO NO NO D-Galactose NO NO YES NO YES NO D-Gluconic acid NO NO NO YES YES YES L-Rhamnose NO NO YES NO YES NO a-Keto-Glutaric acid NO NO YES NO NO NO a-Hydroxy Glutaric acid-?- NO NO NO YES YES NO lactone Bromo succinic acid NO NO YES NO NO NO L-Alanyl-Glycine NO NO NO NO NO NO L-Lyxose NO YES NO NO NO NO L-Aspartic acid NO NO YES YES YES NO D-L-a-Glycerol phosphate NO NO NO YES NO NO D-Fructose YES YES YES YES YES YES a-Keto-Butyric acid NO NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO NO Propionic acid NO NO NO NO NO NO Acetoacetic acid NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO L-Proline NO NO YES NO YES NO D-Xylose NO NO NO YES YES NO Acetic acid NO NO NO NO NO NO a-Methyl-D-Galactoside YES NO NO NO YES NO -Methyl-D-glucoside YES YES YES YES YES YES Mucic acid NO NO NO YES YES NO N-acetyl--D-Mannosamine NO NO NO NO NO NO Pyruvic acid NO NO NO NO YES NO D-Alanine NO NO NO YES YES NO L-Lactic acid NO NO NO NO NO NO a-D-Glucose YES YES YES YES YES YES a-D-Lactose NO NO NO NO NO NO Adonitol NO NO NO NO YES NO Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate YES NO NO NO YES NO L-Galaclonic-acid-?-lactone NO NO NO NO YES NO D-Trehalose YES NO YES YES YES YES Formic acid NO NO NO NO NO NO Maltose YES YES YES NO YES YES Lactulose NO NO NO NO NO NO Maltotriose YES YES YES NO YES YES Glyoxylic acid NO NO NO NO NO NO Methyl Pyruvate NO YES NO NO NO NO D-Galacturonic acid NO NO NO NO YES YES D-Mannose YES YES YES YES YES NO D-Mannitol YES NO YES YES YES YES D-Melibiose NO NO NO NO YES NO Sucrose YES YES YES YES YES NO 2-Deoxy adenosine NO NO NO NO YES NO D-Cellobiose YES YES YES NO YES YES D-Malic acid NO NO NO NO YES NO Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO NO YES YES YES YES L-Glutamic acid NO NO YES NO NO NO Thymidine NO NO NO NO NO NO Uridine NO NO NO NO YES NO Adenosine NO YES NO NO NO NO Inosine NO NO NO YES YES NO L-Malic acid NO NO YES NO YES YES 2-Aminoethanol NO NO NO NO YES NO Strain/Substrate SYM00603 SYM00061A SYM00622 SYM00629 SYM00066 SYM00663 D-Serine NO YES NO NO NO NO D-Glucose-6-Phosphate NO NO NO NO NO NO L-Asparagine YES YES YES YES NO YES L-glutamine YES YES YES YES NO YES Glycyl-L-Aspartic acid NO YES NO NO NO NO Glycyl-L-Glutamic acid YES YES NO NO YES NO Glycyl-L-Proline YES YES NO NO NO NO L-Arabinose YES YES YES NO NO NO D-Sorbitol YES YES YES YES NO NO D-Galactonic acid-?-lactone YES NO YES NO NO NO D-Aspartic acid NO NO NO NO NO YES m-Tartaric acid NO YES NO NO NO NO Citric acid YES YES YES YES NO YES Tricarballylic acid NO NO NO NO NO NO p-Hydroxy Phenyl acetic acid YES NO NO NO YES NO N-Acetyl-D-Glucosamine YES YES YES YES NO YES Glycerol YES YES NO YES YES YES D-L-Malic acid YES YES YES YES NO YES D-Glucosaminic acid YES NO NO NO YES NO D-Glucose-1-Phosphate NO NO NO NO YES NO m-Inositol YES YES YES YES NO NO L-Serine YES YES YES NO NO YES m-Hydroxy Phenyl Acetic acid NO NO NO NO YES NO D-Saccharic acid YES YES YES NO NO NO L-Fucose NO NO NO NO NO NO D-Ribose YES YES YES YES NO NO 1,2-Propanediol NO NO NO NO YES NO D-Fructose-6-Phosphate NO NO NO NO NO NO D-Threonine NO YES NO NO NO NO L-Threonine NO YES NO NO NO NO Tyramine YES NO YES YES NO NO Succinic acid YES YES YES YES YES NO D-Glucuronic acid YES YES YES YES NO YES Tween 20 YES YES NO YES NO NO Tween 40 YES YES YES YES NO YES Twecn 80 YES YES YES YES YES YES Fumaric acid YES YES YES YES NO NO L-Alanine YES YES YES NO YES YES D-Psicose NO YES NO NO YES NO D-Galactose YES YES YES NO NO NO D-Gluconic acid YES YES YES YES NO NO L-Rhamnose NO YES NO NO NO NO a-Keto-Glutaric acid YES NO NO YES NO YES a-Hydroxy Glutaric acid-?- YES YES YES NO NO NO lactone Bromo succinic acid YES YES NO NO NO NO L-Alanyl-Glycine YES YES YES YES NO YES L-Lyxose NO YES NO NO NO NO L-Aspartic acid YES YES YES YES NO YES D-L-a-Glycerol phosphate YES NO YES YES NO YES D-Fructose YES YES YES YES NO YES a-Keto-Butyric acid NO YES NO NO NO NO a-Hydroxy Butyric acid NO NO NO YES NO NO Propionic acid YES NO NO NO NO YES Acetoacetic acid NO NO NO NO NO NO Glucuronamide NO NO NO NO NO NO L-Proline YES YES YES YES NO YES D-Xylose YES YES YES YES NO NO Acetic acid NO NO NO NO NO NO a-Methyl-D-Galactoside NO YES NO NO NO NO -Methyl-D-glucoside NO YES NO NO YES NO Mucic acid YES YES YES YES NO YES N-acetyl--D-Mannosamine NO YES NO NO NO NO Pyruvic acid NO YES NO NO NO YES D-Alanine YES YES YES YES NO NO L-Lactic acid YES YES YES NO NO YES a-D-Glucose YES YES YES YES YES YES a-D-Lactose NO YES NO NO NO YES Adonitol YES YES YES YES NO YES Glycolic acid NO NO NO NO NO NO Mono Methyl Succinate NO YES NO NO NO NO L-Galaclonic-acid-?-lactone YES YES NO YES NO NO D-Trehalose YES YES YES YES NO NO Formic acid NO NO NO NO NO NO Maltose NO YES NO NO YES YES Lactulose NO YES NO NO NO YES Maltotriose NO YES NO NO YES YES Glyoxylic acid NO NO NO NO NO NO Methyl Pyruvate NO YES NO YES NO YES D-Galacturonic acid YES YES YES YES YES NO D-Mannose YES YES YES NO NO YES D-Mannitol YES YES NO YES YES NO D-Melibiose NO YES NO NO YES NO Sucrose YES YES YES YES NO YES 2-Deoxy adenosine NO YES NO NO NO NO D-Cellobiose NO YES YES NO YES YES D-Malic acid YES YES NO YES NO NO Phenylethyl-amine NO NO NO NO NO NO Dulcitol NO YES NO NO YES NO L-Glutamic acid YES YES YES YES NO YES Thymidine NO NO NO NO NO NO Uridine YES YES YES YES NO NO Adenosine YES NO YES YES NO NO Inosine YES YES YES YES NO YES L-Malic acid YES YES YES NO NO YES 2-Aminoethanol YES YES YES YES NO NO Strain/Substrate SYM00696 SYM00741A SYM00741B SYM00854 SYM00880 D-Serine NO NO NO NO NO D-Glucose-6-Phosphate NO NO NO NO NO L-Asparagine YES YES YES YES YES L-glutamine YES YES YES YES NO Glycyl-L-Aspartic acid NO NO NO NO NO Glycyl-L-Glutamic acid NO NO YES NO NO Glycyl-L-Proline NO NO YES NO NO L-Arabinose YES NO YES YES NO D-Sorbitol NO YES YES NO NO D-Galactonic acid-?-lactone NO NO YES NO NO D-Aspartic acid NO NO NO YES NO m-Tartaric acid NO NO NO NO NO Citric acid NO YES YES YES NO Tricarballylic acid NO NO NO NO NO p-Hydroxy Phenyl acetic acid NO NO YES NO NO N-Acetyl-D-Glucosamine NO NO YES YES NO Glycerol YES YES YES NO NO D-L-Malic acid NO NO YES YES YES D-Glucosaminic acid NO NO YES NO NO D-Glucose-1-Phosphate NO NO NO NO NO m-Inositol NO NO YES NO NO L-Serine NO YES YES YES NO m-Hydroxy Phenyl Acetic acid NO NO NO NO NO D-Saccharic acid YES NO YES YES NO L-Fucose NO NO NO NO NO D-Ribose NO NO YES NO NO 1,2-Propanediol NO NO NO NO NO D-Fructose-6-Phosphate NO NO NO NO NO D-Threonine NO NO NO NO NO L-Threonine NO NO NO NO NO Tyramine NO NO NO NO NO Succinic acid NO NO YES YES NO D-Glucuronic acid NO YES YES NO NO Tween 20 NO NO YES YES NO Tween 40 NO NO YES YES NO Twecn 80 NO NO YES YES NO Fumaric acid NO YES YES YES NO L-Alanine YES YES YES YES NO D-Psicose NO NO NO NO NO D-Galactose YES NO YES YES NO D-Gluconic acid NO YES YES YES NO L-Rhamnose NO NO NO YES NO a-Keto-Glutaric acid NO YES YES YES NO a-Hydroxy Glutaric acid-?- NO NO YES NO NO lactone Bromo succinic acid NO NO YES YES NO L-Alanyl-Glycine NO NO YES YES NO L-Lyxose NO NO NO YES NO L-Aspartic acid NO NO YES YES NO D-L-a-Glycerol phosphate NO NO YES NO NO D-Fructose YES NO YES YES NO a-Keto-Butyric acid NO NO NO NO NO a-Hydroxy Butyric acid NO NO NO NO NO Propionic acid NO NO YES NO NO Acetoacetic acid NO NO NO NO NO Glucuronamide NO NO NO NO NO L-Proline YES YES YES YES NO D-Xylose YES NO YES YES NO Acetic acid NO NO YES NO NO a-Methyl-D-Galactoside NO NO NO NO NO -Methyl-D-glucoside YES NO NO YES YES Mucic acid NO YES YES YES NO N-acetyl--D-Mannosamine NO NO NO NO NO Pyruvic acid NO NO YES NO NO D-Alanine NO NO YES YES NO L-Lactic acid YES NO YES NO NO a-D-Glucose YES YES YES YES NO a-D-Lactose YES NO NO YES NO Adonitol NO NO YES YES NO Glycolic acid NO NO NO NO NO Mono Methyl Succinate YES NO NO YES NO L-Galaclonic-acid-?-lactone YES NO YES YES NO D-Trehalose YES YES YES YES NO Formic acid NO NO NO NO NO Maltose YES YES NO YES YES Lactulose YES NO NO YES NO Maltotriose YES NO NO YES YES Glyoxylic acid NO NO NO NO NO Methyl Pyruvate NO NO YES NO NO D-Galacturonic acid YES NO YES YES NO D-Mannose YES NO YES YES NO D-Mannitol NO NO YES YES NO D-Melibiose YES NO NO YES NO Sucrose YES YES YES YES YES 2-Deoxy adenosine NO NO NO NO NO D-Cellobiose YES YES NO YES YES D-Malic acid NO NO NO YES NO Phenylethyl-amine NO NO NO NO NO Dulcitol YES NO NO YES NO L-Glutamic acid YES NO YES YES NO Thymidine NO NO NO NO NO Uridine NO NO YES YES NO Adenosine NO NO YES NO NO Inosine YES NO YES NO NO L-Malic acid YES YES YES YES NO 2-Aminoethanol NO NO YES NO NO
(464) TABLE-US-00028 TABLE S Substrate utilization as determined by BIOLOG PM2A MicroPlates by fungal endophytes belonging to core OTUs. Strain/Substrate SYM00120 SYM00122 SYM00123 SYM00124 SYM00129 SYM01300 SYM01310 SYM01311 N-acetyl-D-Galactosamine NO NO YES NO NO YES NO NO Gentiobiose NO NO YES YES YES NO NO YES D-Raffinose NO NO YES YES YES NO NO YES Capric acid NO NO NO NO NO YES NO NO D-lactic acid methyl ester NO YES YES NO NO NO NO NO Acetamide NO NO YES NO NO NO NO NO L-Ornithine NO YES YES YES YES YES YES YES Chondrointin sulfate C NO NO YES NO NO NO NO NO N-acetyl-neuraminic acid NO YES YES NO NO YES NO NO L-glucose NO YES NO NO NO NO NO NO Salicin YES NO NO YES NO NO NO YES Caproic acid NO NO NO NO NO YES NO NO Malonic acid NO NO YES YES NO YES NO NO L-Alaninamide NO NO YES NO NO YES NO NO L-Phenylalanine YES NO NO NO NO YES NO YES a-Cyclodextrin YES YES YES YES YES YES YES YES -D-allose NO NO YES NO NO NO NO NO Lactitol NO NO NO NO NO NO NO NO Sedoheptulosan YES YES NO YES NO NO NO NO Citraconic acid NO YES YES NO NO NO NO NO Melibionic acid NO NO NO NO NO NO NO NO N-Acetyl-L-Glutamic acid NO NO NO NO NO YES YES NO L-Pyroglutamic acid NO NO YES NO NO YES YES YES -Cyclodextrin NO YES YES NO NO NO NO NO Amygdalin NO NO NO YES NO NO NO YES D-Melezitose NO YES YES NO YES NO NO YES L-Sorbose NO NO YES NO YES NO NO NO Citramalic acid YES NO NO NO NO NO NO NO Oxalic acid NO NO YES YES NO NO NO NO L-Arginine NO NO NO YES NO YES YES YES L-Valine NO YES YES NO NO YES YES YES -Cyclodextrin NO NO YES YES NO NO NO NO D-arabinose NO NO NO YES NO NO NO NO Maltitol NO NO YES YES YES NO NO YES Stachyose NO NO NO YES NO NO NO YES D-Glucosamine NO NO NO NO NO YES NO NO Oxalomalic acid NO NO YES YES NO NO NO NO Glycine NO NO NO YES NO NO NO NO D,L-Carnitine NO YES NO NO NO YES NO NO Dextrin NO NO YES NO YES NO NO YES D-arabitol NO YES NO YES NO NO NO YES a-Methyl-D-Glucoside NO NO NO NO NO NO NO NO D-Tagatose NO NO NO YES NO NO NO NO 2-Hydroxy benzoic acid NO YES NO NO NO NO NO NO Quinic acid NO NO NO NO NO YES NO YES L-Histidine NO NO NO NO YES YES YES YES Sec-Butylamine NO NO NO NO NO NO NO NO Gelatin YES YES YES YES NO YES YES YES L-arabitol NO YES YES NO NO NO NO NO -Methyl-D-Galactoside NO NO YES NO NO NO NO YES Turanose NO YES YES YES YES NO YES YES 4-Hydroxy benzoic acid NO NO YES NO NO NO NO NO D-Ribono-1,4-Lactone NO YES YES NO NO NO NO NO L-Homoserine NO NO NO NO NO NO NO NO D,L-Octopamine NO NO YES NO NO YES YES YES Glycogen YES YES YES YES NO YES NO YES Arbutin NO NO YES YES NO NO NO YES 3-Methyl Glucose YES NO NO NO NO NO NO NO Xylitol NO NO YES NO NO NO NO NO -Hydroxy butyric acid NO NO YES NO NO YES NO YES Sebacic acid YES YES YES NO NO YES NO NO Hydroxy-L-Proline NO NO NO YES NO YES YES YES Putrescine NO YES NO YES YES YES YES YES Inulin NO YES YES NO NO NO NO NO 2-Deoxy-D-Ribose NO NO NO NO NO NO NO NO -Methyl-D-Glucuronic acid YES YES NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO YES YES NO NO NO NO NO -Hydroxy butyric acid NO YES YES NO NO NO NO NO Sorbic acid NO NO YES NO NO NO NO NO L-Isoleucine NO NO NO YES YES YES YES YES Dihydroxy acetone NO NO YES NO NO NO NO NO Laminarin NO NO NO NO NO NO NO NO i-Erythritol NO NO YES NO NO NO YES NO a-Methyl-D-Mannoside NO NO YES NO NO NO NO NO -amino butyric acid NO YES NO NO YES YES YES YES a-Keto-valeric acid NO NO YES NO NO NO NO NO Succinamic acid NO NO YES NO NO YES NO NO L-Leucine NO NO NO YES NO YES YES YES 2,3-Butanediol YES NO YES NO NO NO NO NO Mannan NO NO YES NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO NO -Methyl-D-Xyloside NO YES NO NO NO NO NO NO d-amino valeric acid NO YES YES NO NO NO NO YES Itaconic acid NO NO YES NO NO NO NO NO D-Tartaric acid NO YES NO NO NO NO NO NO L-Lysine NO NO YES NO NO NO NO YES 2,3-Butanone NO NO YES NO NO NO NO NO Pectin NO YES NO YES NO NO NO YES 3-0--D-Galactopyranosyl-D- NO NO YES NO NO NO YES NO arabinose Palatinose NO NO YES YES YES NO NO YES Butyric acid NO YES NO NO NO NO YES NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO NO YES L-Tartaric acid NO NO YES NO NO NO NO YES L-Methionine NO YES NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO NO NO Strain/Substrate SYM01314 SYM01315 SYM01324 SYM01325 SYM01326 SYM01327 SYM01333 N-acetyl-D-Galactosamine YES YES NO NO NO YES NO Gentiobiose NO YES YES YES NO NO NO D-Raffinose NO NO NO YES YES NO NO Capric acid YES NO NO NO YES YES YES D-lactic acid methyl ester NO NO NO NO NO NO NO Acetamide NO NO NO NO NO NO NO L-Ornithine YES YES NO YES YES YES YES Chondrointin sulfate C NO YES NO NO NO NO NO N-acetyl-neuraminic acid YES NO NO NO NO YES NO L-glucose NO NO NO NO NO NO NO Salicin NO NO NO YES YES NO NO Caproic acid NO NO NO NO YES NO NO Malonic acid NO NO NO NO NO NO NO L-Alaninamide YES NO NO YES YES YES YES L-Phenylalanine YES NO NO NO NO YES NO a-Cyclodextrin YES YES YES YES YES YES YES -D-allose NO YES NO NO NO NO NO Lactitol NO YES YES NO NO NO NO Sedoheptulosan NO NO NO NO NO NO NO Citraconic acid NO YES NO NO NO NO NO Melibionic acid YES YES NO NO NO NO NO N-Acetyl-L-Glutamic acid YES NO NO NO YES YES YES L-Pyroglutamic acid YES YES NO YES YES YES YES -Cyclodextrin NO NO NO NO NO NO NO Amygdalin NO NO NO YES NO NO NO D-Melezitose NO NO YES YES NO NO NO L-Sorbose NO NO NO NO NO NO NO Citramalic acid NO NO NO NO NO YES NO Oxalic acid NO NO NO NO NO NO NO L-Arginine YES YES NO YES YES YES YES L-Valine YES NO NO YES YES YES YES -Cyclodextrin NO YES NO YES NO NO YES D-arabinose NO YES NO NO NO NO NO Maltitol NO NO YES NO NO NO NO Stachyose NO NO YES YES NO NO NO D-Glucosamine YES NO NO NO NO YES NO Oxalomalic acid NO YES NO NO NO NO NO Glycine NO NO NO NO NO YES NO D,L-Carnitine YES NO NO NO YES YES NO Dextrin NO YES NO YES NO NO NO D-arabitol NO YES YES YES NO NO YES a-Methyl-D-Glucoside NO NO YES NO NO NO NO D-Tagatose NO NO NO NO NO NO NO 2-Hydroxy benzoic acid YES YES NO NO YES NO NO Quinic acid YES NO YES YES NO NO NO L-Histidine YES YES YES NO YES YES YES Sec-Butylamine NO NO NO NO NO NO NO Gelatin YES YES YES YES YES YES YES L-arabitol NO YES NO NO NO NO NO -Methyl-D-Galactoside NO NO NO NO NO NO NO Turanose NO NO NO NO NO NO NO 4-Hydroxy benzoic acid NO YES NO NO NO NO NO D-Ribono-1,4-Lactone NO YES NO NO YES NO NO L-Homoserine NO NO NO NO NO NO NO D,L-Octopamine YES NO NO NO YES YES YES Glycogen NO YES YES YES YES NO NO Arbutin NO YES YES YES NO NO NO 3-Methyl Glucose NO NO NO NO NO NO NO Xylitol NO YES NO NO NO NO NO -Hydroxy butyric acid NO YES YES YES NO YES YES Sebacic acid NO YES NO NO NO NO NO Hydroxy-L-Proline YES YES NO YES YES YES YES Putrescine NO YES NO YES NO NO NO Inulin NO YES NO NO YES NO NO 2-Deoxy-D-Ribose NO NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO YES NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO NO -Hydroxy butyric acid NO YES NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO L-Isoleucine YES NO NO YES YES YES YES Dihydroxy acetone NO NO NO NO NO NO NO Laminarin NO NO NO YES NO NO NO i-Erythritol NO YES NO NO NO NO YES a-Methyl-D-Mannoside NO YES NO NO NO NO NO -amino butyric acid YES YES YES YES YES YES YES a-Keto-valeric acid NO YES NO NO NO NO NO Succinamic acid YES YES NO YES YES YES NO L-Leucine YES YES NO NO YES YES YES 2,3-Butanediol NO NO NO NO NO NO NO Mannan NO NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO NO -Methyl-D-Xyloside NO YES NO NO NO NO NO d-amino valeric acid NO YES NO NO NO NO NO Itaconic acid NO YES NO NO NO NO NO D-Tartaric acid NO YES NO NO NO NO NO L-Lysine NO YES NO YES NO NO NO 2,3-Butanone NO YES NO NO NO NO NO Pectin NO YES NO NO NO NO NO 3-0--D-Galactopyranosyl-D- NO YES YES NO NO NO YES arabinose Palatinose NO YES YES YES NO NO NO Butyric acid NO NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO YES NO YES NO NO NO L-Tartaric acid NO NO NO NO NO NO NO L-Methionine NO NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO YES NO NO NO NO NO
(465) TABLE-US-00029 TABLE T Substrate utilization as determined by BIOLOG PM2A MicroPlates by fungal endophytes belonging to core OTUs. Strain/Substrate SYM00135 SYM00136 SYM00151 SYM00154 SYM15811 SYM15820 N-acetyl-D-Galactosamine NO NO NO NO NO NO Gentiobiose NO YES YES NO NO NO D-Raffinose YES YES YES YES YES NO Capric acid NO NO NO NO YES NO D-lactic acid methyl ester NO NO NO NO YES NO Acetamide NO NO NO NO NO NO L-Ornithine YES NO YES NO NO YES Chondrointin sulfate C NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO L-glucose NO NO NO NO NO NO Salicin NO NO YES NO YES NO Caproic acid NO NO NO NO YES NO Malonic acid NO NO YES NO NO NO L-Alaninamide NO NO YES NO YES NO L-Phenylalanine NO NO YES NO NO NO a-Cyclodextrin YES YES YES YES YES NO -D-allose NO NO NO NO NO NO Lactitol NO NO NO NO YES NO Sedoheptulosan NO NO NO NO NO NO Citraconic acid NO NO NO NO NO NO Melibionic acid NO NO NO NO NO NO N-Acetyl-L-Glutamic acid NO NO NO NO NO YES L-Pyroglutamic acid NO YES YES NO YES YES -Cyclodextrin NO NO NO NO NO NO Amygdalin NO NO YES NO NO NO D-Melezitose YES YES YES NO YES NO L-Sorbose NO YES YES NO NO NO Citramalic acid NO NO NO NO NO NO Oxalic acid NO YES NO NO NO NO L-Arginine NO NO YES NO NO YES L-Valine NO NO NO NO NO YES -Cyclodextrin NO YES NO NO NO NO D-arabinose NO NO NO NO NO NO Maltitol NO YES YES NO NO NO Stachyose YES YES YES NO NO NO D-Glucosamine NO NO NO NO NO NO Oxalomalic acid NO NO NO NO NO NO Glycine NO NO NO NO YES NO D,L-Carnitine NO NO NO NO NO NO Dextrin YES NO YES NO YES NO D-arabitol YES NO YES NO NO NO a-Methyl-D-Glucoside NO NO NO NO NO NO D-Tagatose NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO Quinic acid NO NO YES NO YES NO L-Histidine NO YES NO NO YES YES Sec-Butylamine NO NO NO NO NO NO Gelatin NO NO YES NO NO YES L-arabitol NO NO NO NO NO NO -Methyl-D-Galactoside NO YES NO NO NO NO Turanose YES YES YES YES NO NO 4-Hydroxy benzoic acid NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO YES NO L-Homoserine NO NO NO NO NO NO D,L-Octopamine NO NO NO NO YES YES Glycogen NO YES YES NO NO NO Arbutin NO YES YES NO NO NO 3-Methyl Glucose NO NO NO NO NO NO Xylitol NO NO NO NO YES NO -Hydroxy butyric acid NO NO YES NO NO NO Sebacic acid NO NO NO NO NO NO Hydroxy-L-Proline NO NO YES NO YES YES Putrescine YES YES YES NO NO NO Inulin NO NO NO NO NO NO 2-Deoxy-D-Ribose NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO YES NO Sorbic acid NO NO NO NO NO NO L-Isoleucine NO NO YES NO NO YES Dihydroxy acetone NO NO NO NO NO NO Laminarin NO NO YES NO NO NO i-Erythritol NO NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO -amino butyric acid NO YES YES NO YES NO a-Keto-valeric acid NO NO NO NO NO NO Succinamic acid NO NO NO NO NO NO L-Leucine NO NO YES YES NO NO 2,3-Butanediol NO NO NO NO NO NO Mannan NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO NO NO NO NO Itaconic acid NO NO NO NO YES NO D-Tartaric acid NO NO NO NO NO NO L-Lysine NO NO YES NO NO NO 2,3-Butanone NO NO NO NO NO NO Pectin NO NO YES NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO NO NO NO arabinose Palatinose YES YES YES NO YES NO Butyric acid NO NO NO NO YES NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO L-Tartaric acid NO NO YES NO YES NO L-Methionine NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO Strain/Substrate SYM15825 SYM15828 SYM15831 SYM15837 SYM15839 SYM15847 N-acetyl-D-Galactosamine NO NO NO NO NO NO Gentiobiose YES NO NO NO YES YES D-Raffinose YES NO YES YES YES YES Capric acid NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO Acetamide NO NO NO NO NO NO L-Ornithine YES YES YES YES YES YES Chondrointin sulfate C NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO L-glucose NO NO NO NO NO NO Salicin YES NO YES NO YES YES Caproic acid NO NO NO NO NO NO Malonic acid YES NO NO YES NO NO L-Alaninamide YES NO NO NO NO YES L-Phenylalanine YES NO NO NO YES YES a-Cyclodextrin NO YES YES YES YES YES -D-allose NO NO NO NO NO NO Lactitol NO NO NO NO NO NO Sedoheptulosan NO NO NO NO NO YES Citraconic acid NO NO NO NO NO NO Melibionic acid NO NO NO NO NO NO N-Acetyl-L-Glutamic acid NO YES NO YES NO NO L-Pyroglutamic acid YES YES YES YES YES YES -Cyclodextrin NO NO NO NO NO NO Amygdalin YES NO NO YES YES YES D-Melezitose YES NO YES YES YES YES L-Sorbose NO NO NO YES YES NO Citramalic acid NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO L-Arginine YES YES YES YES YES YES L-Valine YES YES NO YES YES NO -Cyclodextrin YES NO NO NO YES NO D-arabinose NO NO NO NO NO NO Maltitol YES NO NO NO NO NO Stachyose YES NO YES YES YES YES D-Glucosamine NO NO YES YES YES NO Oxalomalic acid NO NO NO NO NO NO Glycine YES NO NO NO NO YES D,L-Carnitine NO NO YES YES NO NO Dextrin YES NO YES YES YES NO D-arabitol YES NO NO NO NO NO a-Methyl-D-Glucoside NO NO NO NO YES NO D-Tagatose NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO Quinic acid YES NO NO NO YES NO L-Histidine YES YES NO NO YES NO Sec-Butylamine NO NO NO NO NO NO Gelatin YES YES NO YES YES YES L-arabitol NO NO NO NO NO NO -Methyl-D-Galactoside NO NO NO YES NO NO Turanose YES NO YES YES YES YES 4-Hydroxy benzoic acid NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO L-Homoserine NO NO NO NO NO NO D,L-Octopamine NO YES NO YES NO NO Glycogen YES NO YES YES YES YES Arbutin YES NO NO YES YES YES 3-Methyl Glucose NO NO NO NO NO NO Xylitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sebacic acid YES NO NO YES NO NO Hydroxy-L-Proline YES YES YES YES YES YES Putrescine YES YES NO NO YES YES Inulin NO NO NO YES NO NO 2-Deoxy-D-Ribose NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO L-Isoleucine YES YES YES YES YES YES Dihydroxy acetone NO NO NO NO NO NO Laminarin NO NO NO NO YES NO i-Erythritol NO NO NO YES NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO -amino butyric acid YES NO YES YES YES YES a-Keto-valeric acid NO NO NO YES NO NO Succinamic acid YES NO NO YES NO YES L-Leucine YES NO NO YES YES YES 2,3-Butanediol NO NO NO NO NO NO Mannan NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO NO NO NO YES Itaconic acid NO NO NO YES NO NO D-Tartaric acid NO NO NO NO NO NO L-Lysine YES NO YES YES NO YES 2,3-Butanone NO NO NO NO NO NO Pectin YES YES YES YES YES NO 3-0--D-Galactopyranosyl-D- YES NO NO NO NO NO arabinose Palatinose YES NO YES YES YES YES Butyric acid YES YES NO YES NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO L-Tartaric acid YES NO NO NO NO NO L-Methionine NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO Strain/Substrate SYM15872 SYM15890 SYM15901 SYM15920 SYM15926 N-acetyl-D-Galactosamine NO NO NO NO NO Gentiobiose YES NO YES YES NO D-Raffinose YES NO YES YES NO Capric acid NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO Acetamide NO NO NO NO NO L-Ornithine YES YES YES YES YES Chondrointin sulfate C YES NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO L-glucose NO NO NO NO NO Salicin YES NO YES YES NO Caproic acid NO NO NO NO NO Malonic acid YES NO NO NO NO L-Alaninamide YES NO NO NO NO L-Phenylalanine YES NO YES YES NO a-Cyclodextrin YES YES YES YES YES -D-allose NO NO NO NO NO Lactitol NO NO NO NO NO Sedoheptulosan YES NO NO NO NO Citraconic acid NO NO NO NO NO Melibionic acid NO NO NO NO NO N-Acetyl-L-Glutamic acid NO NO NO NO YES L-Pyroglutamic acid YES YES YES YES NO -Cyclodextrin NO NO NO NO NO Amygdalin YES NO YES YES NO D-Melezitose YES NO YES YES NO L-Sorbose NO NO YES NO NO Citramalic acid NO NO NO NO NO Oxalic acid YES NO NO NO YES L-Arginine YES NO YES YES NO L-Valine YES NO YES YES YES -Cyclodextrin YES NO YES YES NO D-arabinose YES NO NO NO NO Maltitol YES NO YES YES YES Stachyose YES NO YES YES NO D-Glucosamine NO NO NO NO NO Oxalomalic acid NO NO NO NO NO Glycine YES NO YES NO NO D,L-Carnitine NO NO NO NO NO Dextrin YES NO YES YES YES D-arabitol YES NO YES YES NO a-Methyl-D-Glucoside YES NO NO YES NO D-Tagatose NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO Quinic acid YES NO NO YES NO L-Histidine YES NO YES YES YES Sec-Butylamine NO NO YES NO NO Gelatin YES YES YES YES YES L-arabitol YES NO NO NO NO -Methyl-D-Galactoside YES NO NO NO NO Turanose YES NO YES YES NO 4-Hydroxy benzoic acid YES NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO L-Homoserine NO NO NO NO NO D,L-Octopamine YES YES NO NO NO Glycogen YES NO YES YES NO Arbutin YES NO YES YES NO 3-Methyl Glucose NO NO NO NO NO Xylitol YES NO NO NO NO -Hydroxy butyric acid NO YES YES YES NO Sebacic acid YES NO NO NO NO Hydroxy-L-Proline YES YES YES YES YES Putrescine YES NO YES YES NO Inulin NO YES NO NO NO 2-Deoxy-D-Ribose NO NO NO NO NO -Methyl-D-Glucuronic acid YES NO NO NO YES N-Acetyl-D-glucosaminitol NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO Sorbic acid NO NO NO NO NO L-Isoleucine YES NO YES YES NO Dihydroxy acetone NO NO NO NO NO Laminarin NO YES NO YES NO i-Erythritol NO NO NO NO NO a-Methyl-D-Mannoside NO NO NO NO NO -amino butyric acid YES NO YES YES YES a-Keto-valeric acid YES YES NO NO NO Succinamic acid YES NO YES NO NO L-Leucine YES NO YES YES NO 2,3-Butanediol YES NO NO NO NO Mannan NO NO NO NO NO D-Fucose NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO d-amino valeric acid YES NO YES NO YES Itaconic acid NO NO NO NO YES D-Tartaric acid NO NO NO NO NO L-Lysine YES NO YES NO NO 2,3-Butanone NO NO NO NO NO Pectin YES NO YES YES YES 3-0--D-Galactopyranosyl-D- YES NO NO NO NO arabinose Palatinose YES YES YES YES NO Butyric acid YES NO YES YES NO 5-Keto-D-Gluconic acid NO NO YES NO NO L-Tartaric acid YES NO YES YES NO L-Methionine NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO
(466) TABLE-US-00030 TABLE U Substrate utilization as determined by BIOLOG PM2A MicroPlates by fungal endophytes belonging to core OTUs. Strain/Substrate SYM15928 SYM15932 SYM00160 SYM00034 SYM00566B SYM00577 N-acetyl-D-Galactosamine NO NO NO NO NO NO Gentiobiose YES YES YES YES NO YES D-Raffinose YES YES YES NO NO YES Capric acid NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO Acetamide NO NO NO NO NO NO L-Ornithine YES YES NO YES NO YES Chondrointin sulfate C NO YES NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO L-glucose NO NO NO NO NO NO Salicin YES YES YES YES NO YES Caproic acid NO NO NO NO NO NO Malonic acid NO NO NO NO YES NO L-Alaninamide NO NO NO YES NO YES L-Phenylalanine NO NO NO NO NO YES a-Cyclodextrin YES YES YES YES YES NO -D-allose YES NO NO NO NO NO Lactitol NO NO NO NO NO NO Sedoheptulosan NO NO NO NO NO NO Citraconic acid NO NO NO NO NO NO Melibionic acid NO NO NO NO NO YES N-Acetyl-L-Glutamic acid NO NO NO NO NO NO L-Pyroglutamic acid YES NO NO YES YES YES -Cyclodextrin NO YES YES NO NO NO Amygdalin NO YES NO YES NO YES D-Melezitose YES YES YES YES NO YES L-Sorbose NO NO NO NO NO YES Citramalic acid NO NO NO NO NO NO Oxalic acid NO YES NO NO NO NO L-Arginine YES YES NO YES NO YES L-Valine NO NO NO YES NO YES -Cyclodextrin YES YES YES NO NO YES D-arabinose NO NO NO NO NO NO Maltitol YES YES YES NO NO YES Stachyose YES YES YES NO NO YES D-Glucosamine NO NO NO YES NO YES Oxalomalic acid NO NO NO NO NO NO Glycine NO NO NO NO NO NO D,L-Carnitine NO NO NO NO NO NO Dextrin YES YES YES YES NO YES D-arabitol YES NO NO YES NO YES a-Methyl-D-Glucoside YES NO YES NO NO NO D-Tagatose NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO Quinic acid NO YES NO YES NO NO L-Histidine NO NO NO NO YES YES Sec-Butylamine NO NO NO NO NO NO Gelatin YES YES NO YES NO YES L-arabitol NO YES NO NO NO NO -Methyl-D-Galactoside NO YES NO YES NO NO Turanose YES YES YES YES NO YES 4-Hydroxy benzoic acid NO NO NO NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO L-Homoserine NO NO NO NO NO NO D,L-Octopamine NO NO NO NO NO YES Glycogen YES YES YES YES NO YES Arbutin YES YES YES YES NO YES 3-Methyl Glucose NO NO NO NO NO NO Xylitol NO NO YES NO YES NO -Hydroxy butyric acid YES NO NO NO YES YES Sebacic acid NO NO NO NO NO NO Hydroxy-L-Proline NO NO NO NO YES YES Putrescine YES NO NO YES NO YES Inulin YES NO NO NO NO NO 2-Deoxy-D-Ribose NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO YES NO NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sorbic acid NO NO NO NO YES NO L-Isoleucine NO YES NO YES NO YES Dihydroxy acetone NO NO NO NO NO NO Laminarin NO NO NO YES NO NO i-Erythritol YES NO NO YES NO NO a-Methyl-D-Mannoside NO NO NO NO NO NO -amino butyric acid YES NO NO YES NO YES a-Keto-valeric acid NO YES NO NO YES NO Succinamic acid NO NO NO YES NO NO L-Leucine NO NO NO YES NO YES 2,3-Butanediol NO NO NO NO NO NO Mannan NO NO NO NO NO NO D-Fucose NO YES NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO NO NO NO YES Itaconic acid NO NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO L-Lysine NO NO NO YES YES NO 2,3-Butanone NO NO NO NO NO NO Pectin YES YES YES YES NO YES 3-0--D-Galactopyranosyl-D- NO NO NO NO NO YES arabinose Palatinose YES YES YES YES NO YES Butyric acid NO NO NO NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO L-Tartaric acid NO YES NO NO NO YES L-Methionine NO NO YES NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO Strain/Substrate SYM00590 SYM00603 SYM00061A SYM00622 SYM00629 SYM00066 N-acetyl-D-Galactosamine NO NO NO NO NO NO Gentiobiose YES NO YES NO NO NO D-Raffinose NO NO YES NO NO YES Capric acid NO YES NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO Acetamide NO NO NO NO NO NO L-Ornithine YES YES YES YES YES NO Chondrointin sulfate C NO NO NO NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO NO L-glucose NO NO NO NO NO NO Salicin YES NO YES NO NO NO Caproic acid NO NO NO NO NO NO Malonic acid NO NO YES NO NO NO L-Alaninamide NO YES YES NO NO NO L-Phenylalanine NO YES NO NO NO NO a-Cyclodextrin NO YES YES YES NO YES -D-allose NO NO NO NO NO NO Lactitol NO NO YES NO NO NO Sedoheptulosan NO NO NO NO NO NO Citraconic acid NO NO NO NO NO NO Melibionic acid NO NO YES NO NO NO N-Acetyl-L-Glutamic acid NO YES NO YES YES NO L-Pyroglutamic acid NO YES YES YES NO NO -Cyclodextrin NO NO NO NO NO NO Amygdalin NO NO NO NO NO NO D-Melezitose NO NO YES NO NO NO L-Sorbose NO NO NO NO NO NO Citramalic acid NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO L-Arginine NO YES YES YES YES NO L-Valine NO YES NO YES YES NO -Cyclodextrin NO NO YES NO NO NO D-arabinose NO NO NO NO NO NO Maltitol NO NO YES NO NO NO Stachyose NO NO YES NO NO NO D-Glucosamine NO YES NO YES NO NO Oxalomalic acid NO NO NO NO NO NO Glycine NO NO NO NO NO NO D,L-Carnitine NO YES NO YES NO NO Dextrin NO NO YES NO NO NO D-arabitol NO NO YES NO YES NO a-Methyl-D-Glucoside NO NO NO NO NO NO D-Tagatose NO NO NO NO NO NO 2-Hydroxy benzoic acid NO NO NO NO NO NO Quinic acid NO YES NO NO NO NO L-Histidine NO YES YES YES NO NO Sec-Butylamine NO NO NO NO NO NO Gelatin YES NO YES NO NO NO L-arabitol NO NO YES NO NO NO -Methyl-D-Galactoside NO NO YES NO NO NO Turanose NO NO YES NO NO NO 4-Hydroxy benzoic acid NO NO YES NO NO NO D-Ribono-1,4-Lactone NO NO NO NO NO NO L-Homoserine NO NO YES NO NO NO D,L-Octopamine NO YES YES YES YES NO Glycogen YES NO YES YES NO NO Arbutin YES NO YES NO NO NO 3-Methyl Glucose NO NO NO NO NO NO Xylitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO NO NO NO NO Sebacic acid NO NO YES YES NO NO Hydroxy-L-Proline YES YES YES YES YES NO Putrescine NO YES YES NO NO NO Inulin YES NO NO YES YES NO 2-Deoxy-D-Ribose NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO NO YES NO NO NO N-Acetyl-D-glucosaminitol NO NO NO NO NO NO -Hydroxy butyric acid NO NO YES NO NO NO Sorbic acid NO NO YES NO NO NO L-Isoleucine NO YES NO YES YES NO Dihydroxy acetone NO NO NO NO NO NO Laminarin NO NO YES NO NO NO i-Erythritol YES NO NO NO YES NO a-Methyl-D-Mannoside NO NO NO NO NO NO -amino butyric acid YES YES YES YES YES NO a-Keto-valeric acid NO NO YES NO NO NO Succinamic acid NO NO YES NO NO NO L-Leucine NO YES NO YES YES NO 2,3-Butanediol NO NO YES NO NO NO Mannan NO NO NO NO NO NO D-Fucose NO NO NO NO NO NO -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO YES NO NO NO Itaconic acid NO NO NO NO NO NO D-Tartaric acid NO NO NO NO NO NO L-Lysine NO NO YES NO NO NO 2,3-Butanone NO NO NO NO NO NO Pectin NO NO YES NO NO NO 3-0--D-Galactopyranosyl-D- NO NO NO NO NO NO arabinose Palatinose YES NO NO NO NO NO Butyric acid NO NO YES NO NO NO 5-Keto-D-Gluconic acid NO NO NO NO NO NO L-Tartaric acid NO NO YES NO NO NO L-Methionine NO NO NO NO NO NO 3-Hydroxy 2-Butanone NO NO NO NO NO NO Strain/Substrate SYM00663 SYM00696 SYM00741A SYM00741B SYM00854 SYM00880 N-acetyl-D-Galactosamine NO NO NO NO NO YES Gentiobiose NO YES YES NO NO NO D-Raffinose NO YES YES NO YES NO Capric acid NO NO NO NO NO NO D-lactic acid methyl ester NO NO NO NO NO NO Acetamide NO YES NO NO NO YES L-Ornithine YES YES YES YES NO NO Chondrointin sulfate C NO YES YES NO NO NO N-acetyl-neuraminic acid NO NO NO NO NO YES L-glucose NO NO YES NO NO NO Salicin NO YES NO NO NO NO Caproic acid NO YES NO NO NO NO Malonic acid NO NO NO NO NO NO L-Alaninamide NO YES NO YES NO YES L-Phenylalanine NO NO YES NO NO NO a-Cyclodextrin NO NO NO YES NO YES -D-allose NO YES NO NO NO YES Lactitol NO YES YES NO NO YES Sedoheptulosan NO NO YES NO NO YES Citraconic acid NO YES NO NO NO YES Melibionic acid NO NO YES NO NO NO N-Acetyl-L-Glutamic acid NO YES NO YES NO YES L-Pyroglutamic acid YES NO YES YES YES YES -Cyclodextrin NO NO YES NO NO YES Amygdalin NO NO YES NO YES YES D-Melezitose NO YES YES NO NO YES L-Sorbose NO NO YES NO NO NO Citramalic acid NO NO NO NO NO YES Oxalic acid NO YES NO NO NO YES L-Arginine YES YES YES YES YES YES L-Valine NO YES YES YES NO YES -Cyclodextrin NO YES NO NO YES NO D-arabinose NO YES NO NO NO NO Maltitol NO YES YES NO YES YES Stachyose NO YES YES NO YES YES D-Glucosamine NO NO NO NO NO NO Oxalomalic acid NO NO NO NO NO NO Glycine NO YES YES NO NO YES D,L-Carnitine NO NO NO YES NO NO Dextrin NO YES YES NO YES YES D-arabitol NO YES YES NO YES NO a-Methyl-D-Glucoside NO NO YES NO NO NO D-Tagatose YES NO NO NO NO NO 2-Hydroxy benzoic acid NO YES YES NO NO NO Quinic acid NO YES NO NO NO YES L-Histidine NO YES NO YES NO NO Sec-Butylamine NO NO NO NO NO NO Gelatin NO YES YES YES YES NO L-arabitol NO YES NO NO NO YES -Methyl-D-Galactoside NO YES NO NO NO NO Turanose NO YES NO NO YES YES 4-Hydroxy benzoic acid NO YES NO NO NO YES D-Ribono-1,4-Lactone YES YES NO NO YES YES L-Homoserine NO NO NO NO NO NO D,L-Octopamine NO NO YES YES YES NO Glycogen YES YES YES NO YES YES Arbutin NO YES YES YES YES YES 3-Methyl Glucose NO NO YES NO NO NO Xylitol NO NO NO NO NO YES -Hydroxy butyric acid NO YES YES NO NO NO Sebacic acid NO NO NO NO NO NO Hydroxy-L-Proline YES NO YES YES YES YES Putrescine NO YES YES NO NO YES Inulin NO YES YES YES NO YES 2-Deoxy-D-Ribose NO NO NO NO NO NO -Methyl-D-Glucuronic acid NO YES NO NO NO NO N-Acetyl-D-glucosaminitol NO YES NO NO NO YES -Hydroxy butyric acid NO YES NO NO NO NO Sorbic acid NO NO NO NO NO NO L-Isoleucine NO YES YES YES NO YES Dihydroxy acetone NO NO NO NO NO NO Laminarin NO NO NO NO NO NO i-Erythritol NO YES NO YES YES NO a-Methyl-D-Mannoside NO YES NO NO NO NO -amino butyric acid NO YES YES YES YES YES a-Keto-valeric acid NO YES NO NO NO YES Succinamic acid NO YES YES NO YES YES L-Leucine NO NO YES YES NO NO 2,3-Butanediol NO YES NO NO NO YES Mannan NO YES NO NO NO YES D-Fucose NO YES NO NO NO YES -Methyl-D-Xyloside NO NO NO NO NO NO d-amino valeric acid NO NO NO NO NO NO Itaconic acid NO YES NO NO NO NO D-Tartaric acid NO YES NO NO NO NO L-Lysine NO YES YES NO NO YES 2,3-Butanone NO NO NO NO NO NO Pectin NO YES YES NO YES YES 3-0--D-Galactopyranosyl-D- NO YES YES YES NO YES arabinose Palatinose YES YES YES NO YES YES Butyric acid NO NO NO NO YES NO 5-Keto-D-Gluconic acid NO YES NO NO NO NO L-Tartaric acid NO NO NO NO NO NO L-Methionine NO NO NO NO NO NO 3-Hydroxy 2-Butanone YES NO NO NO NO NO
Characterization of Culturable Microbes: Substrate Use
(467) Additional BIOLOG analyses were performed. For additional biolog analyses, microbes were cultivated in three biological replicates for each strain. Each bacterium was initially streaked on Reasoner's 2A (R2A) agar, distinct CFUs selected and cultured in 6 mL R2A broth for 4 days. Fungal strains were streaked on potato dextrose (PD) agar and individual plugs containing spores and mycelial tissues were used to initiate growth in 6 mL PD broth for 6 days. All strains were grown with agitation at room temperature. One mL liquid cultures of each sample were harvested by centrifugation for 15 minutes at 4500 RPM and subsequently washed at least four times with sterile distilled water to remove any traces of residual media. Additionally, fungal cultures were first sonicated to achieve homogeneity after the growth period. Microbes were resuspended in 500 L sterile distilled water and measurements of absorbance were taken using a SpectraMax M microplate reader (Molecular Devices, Sunnyvale, Calif.).
(468) Sole carbon substrate assays were done using BIOLOG Phenotype MicroArray (PM) 1 and 2A MicroPlates (Hayward, Calif.). An aliquot of each bacterial cell culture corresponding to a final absorbance of 0.2 were inoculated into 20 mL sterile IF-0a GN/GP Base inoculating fluid (IF-0), 0.24 mL 100 Dye B obtained from BIOLOG, and brought to a final volume of 24 mL with sterile distilled water in 50 mL Falcon tubes. Negative control PM1 and PM2A assays were done similarly for each dye minus bacterial cells to detect abiotic reactions. Fungal culture of each strain with a final absorbance of 0.2 (63% turbidity) was brought to a final volume of 24 mL with the FF-1F medium (BIOLOG). Microbial cell suspensions in tubes were gently shaken to achieve uniformity. One hundred microliters of the microbial cell suspension was added per well using a multichannel pipettor to the 96-well BIOLOG PM1 and PM2A MicroPlates that each contained 95 carbon sources and one water-only (negative control) well. All steps were performed under sterile conditions using biosafety cabinets.
(469) MicroPlates were sealed in paper surgical tape (Dynarex, Orangeburg, N.Y.) to minimize plate edge effects, and incubated stationary at 24 C. in an enclosed container for a minimum of 72 hours. Absorbance at 590 nm was measured for all MicroPlates at least every 24 hours or at a defined interval (72 hours post-assay) to determine carbon substrate utilization for each strain. Measurements were normalized relative to the negative control (water only) well of each plate (Garland and Mills, 1991; Barua et al., 2010; Siemens et al., 2012; Blumenstein et al., 2015). Bacterial MicroPlates were also visually examined for the irreversible formation of violet color in wells indicating the reduction of the tetrazolium redox dye to formazan that result from cell respiration (Garland and Mills, 1991), and assessed against the negative control (no cells) PM1 and PM2A MicroPlates to detect any abiotic color changes potentially introduced by the medium and/or dyes (Borglin et al., 2012). Normalized absorbance values that were negative were considered as zero for subsequent analysis (Garland and Mills, 1991; Blumenstein et al., 2015) and a threshold value of 0.1 and above was used to indicate the ability of a particular microbial strain to use a given carbon substrate (Barua et al., 2010; Blumenstein et al., 2015). Fungal PM tests were measured as growth assays and visual observation of mycelial growth in each well was made.
(470) TABLE-US-00031 TABLE V Substrate utilization as determined by BIOLOG PM1 MicroPlates by bacterial endophytes belonging to OTUs present in cereal seeds, fruit seeds, vegetable seeds, and oil seeds. Strain/Substrate SYM00021b SYM00044 SYM00057b SYM00074 SYM00091 SYM00092d 1,2-Propanediol NO NO NO NO NO NO 2-Aminoethanol NO NO NO NO NO NO 2-Deoxyadenosine YES YES YES YES YES YES a-D-Glucose YES YES YES YES YES YES a-D-Lactose YES YES YES YES YES YES a-Hydroxybutyric acid NO NO NO NO YES NO a-Hydroxyglutaric acid-g- NO NO NO NO YES NO Lactone a-Ketobutyric acid NO NO NO NO YES NO a-Ketoglutaric acid YES NO NO NO YES NO a-Methyl-D-Galactoside YES YES YES YES YES NO Acetic acid YES YES YES YES YES YES Acetoacetic acid NO NO NO NO NO NO Adenosine YES YES YES YES YES YES Adonitol YES YES YES YES YES NO Ala-Gly YES YES YES YES YES YES b-Methyl-D-Glucoside YES YES YES YES YES YES Bromosuccinic acid NO NO NO YES YES YES Citric acid YES YES YES YES YES YES D-Alanine YES YES YES YES YES YES D-Aspartic acid NO NO NO NO NO NO D-Cellobiose YES YES YES YES YES YES D-Fructose YES YES YES YES YES YES D-Fructose-6-Phosphate YES YES YES YES YES YES D-Galactonic acid-g- YES YES YES YES YES YES Lactone D-Galactose YES YES YES YES YES YES D-Galacturonic acid YES YES YES YES YES YES D-Gluconic acid YES YES YES YES YES YES D-Glucosaminic acid YES YES YES NO YES YES D-Glucose-1-Phosphate YES YES YES YES YES YES D-Glucose-6-Phosphate YES YES YES YES YES YES D-Glucuronic acid YES YES YES YES YES YES D-Malic acid NO NO NO NO YES NO D-Mannitol YES YES YES YES YES YES D-Mannose YES YES YES YES YES YES D-Melibiose YES YES YES YES YES YES D-Psicose YES NO NO NO YES YES D-Ribose YES YES YES YES YES YES D-Saccharic acid YES YES YES YES YES YES D-Serine NO NO NO NO NO NO D-Sorbitol YES YES YES YES YES NO D-Threonine NO NO NO NO NO NO D-Trehalose YES YES YES YES YES YES D-Xylose YES YES YES YES YES YES DL-a-Glycerol Phosphate YES YES YES YES YES YES DL-Malic acid YES YES YES YES YES YES Dulcitol YES YES YES YES NO YES Formic acid YES YES YES NO YES YES Fumaric acid YES YES YES YES YES YES Glucuronamide NO NO NO YES NO NO Gly-Asp NO YES YES YES NO YES Gly-Glu NO YES YES YES NO YES Gly-Pro NO YES YES YES YES YES Glycerol YES YES YES YES YES YES Glycolic acid NO NO NO NO YES NO Glyoxylic acid NO YES YES NO NO NO Inosine YES YES YES YES YES YES L-Alanine YES YES YES YES YES YES L-Arabinose YES YES YES YES YES YES L-Asparagine YES YES YES YES YES YES L-Aspartic acid YES YES YES YES YES YES L-Fucose NO NO NO NO YES NO L-Galactonic acid-g- YES YES YES YES YES YES Lactone L-Glutamic acid YES YES YES YES YES YES L-Glutamine YES YES YES YES YES YES L-Lactic acid YES YES YES YES YES YES L-Lyxose NO NO NO YES YES YES L-Malic acid YES YES YES YES YES YES L-Proline YES YES YES YES YES YES L-Rhamnose YES YES YES YES YES YES L-Serine YES YES YES YES YES YES L-Threonine NO NO NO YES YES NO Lactulose NO NO NO NO YES YES m-Hydroxyphenyl Acetic NO YES YES YES NO NO acid m-Inositol YES NO NO NO YES YES m-Tartaric acid YES NO NO NO YES YES Maltose YES YES YES YES YES YES Maltotriose YES YES YES YES YES YES Methylpyruvate YES YES YES YES YES YES Mono-Methylsuccinate NO NO NO NO YES NO Mucic acid YES YES YES YES YES YES N-Acetyl-D-Glucosamine YES YES YES YES YES YES N-Acetyl-D- NO NO NO NO NO NO Mannosamine Negative Control NO NO NO NO NO NO p-Hydroxyphenyl Acetic NO YES YES YES YES NO acid Phenylethylamine NO NO NO NO NO NO Propionic acid NO NO NO NO YES NO Pyruvic acid YES YES YES YES YES YES Succinic acid YES YES YES YES YES YES Sucrose YES YES YES YES YES YES Thymidine YES YES YES YES NO YES Tricarballylic acid NO NO NO NO NO NO Tween 20 NO NO NO YES YES YES Tween 40 YES NO NO YES YES YES Tween 80 YES NO NO YES YES YES Tyramine NO NO NO NO NO NO Uridine NO NO NO YES YES YES Strain/Substrate SYM00212 SYM00290 SYM00619 SYM00865 SYM00879 SYM00879b 1,2-Propanediol NO NO NO NO NO NO 2-Aminoethanol NO NO NO NO NO NO 2-Deoxyadenosine YES NO YES YES NO YES a-D-Glucose YES NO YES YES YES YES a-D-Lactose YES NO NO YES YES YES a-Hydroxybutyric acid NO YES NO NO NO YES a-Hydroxyglutaric acid-g- NO NO YES YES NO YES Lactone a-Ketobutyric acid NO YES YES NO NO YES a-Ketoglutaric acid NO NO YES YES YES YES a-Methyl-D-Galactoside YES NO NO YES YES YES Acetic acid YES YES YES YES YES YES Acetoacetic acid NO NO NO NO NO NO Adenosine YES NO YES YES NO YES Adonitol YES NO YES YES NO YES Ala-Gly YES NO YES YES NO YES b-Methyl-D-Glucoside YES YES YES YES YES YES Bromosuccinic acid YES YES YES YES YES YES Citric acid NO NO YES YES YES YES D-Alanine YES YES YES YES NO YES D-Aspartic acid NO NO NO NO NO NO D-Cellobiose YES NO YES YES YES YES D-Fructose YES YES YES YES YES YES D-Fructose-6-Phosphate YES NO NO YES NO YES D-Galactonic acid-g- NO NO NO NO NO NO Lactone D-Galactose YES YES NO YES NO YES D-Galacturonic acid YES NO YES YES YES YES D-Gluconic acid YES YES YES YES NO YES D-Glucosaminic acid NO NO YES YES NO YES D-Glucose-1-Phosphate YES NO NO YES NO YES D-Glucose-6-Phosphate YES YES NO YES YES YES D-Glucuronic acid YES NO YES YES NO YES D-Malic acid NO YES YES YES NO YES D-Mannitol YES NO YES YES YES YES D-Mannose YES YES NO YES YES YES D-Melibiose YES NO NO YES NO YES D-Psicose NO NO NO YES NO YES D-Ribose YES YES YES YES YES YES D-Saccharic acid YES YES NO YES YES YES D-Serine NO NO NO NO NO NO D-Sorbitol NO NO NO NO NO NO D-Threonine NO NO NO NO NO NO D-Trehalose YES YES YES YES YES YES D-Xylose YES YES YES YES NO YES DL-a-Glycerol Phosphate YES YES YES YES NO YES DL-Malic acid YES YES YES YES YES YES Dulcitol NO YES NO YES NO YES Formic acid NO NO NO YES YES YES Fumaric acid YES YES YES YES YES YES Glucuronamide NO NO NO NO NO NO Gly-Asp YES NO NO YES NO YES Gly-Glu YES YES YES YES YES YES Gly-Pro YES NO YES YES YES YES Glycerol YES YES YES YES NO YES Glycolic acid NO NO NO NO NO YES Glyoxylic acid NO NO NO NO NO NO Inosine YES NO YES YES NO YES L-Alanine YES YES NO YES NO YES L-Arabinose YES YES YES YES YES YES L-Asparagine YES YES YES YES NO YES L-Aspartic acid YES YES YES YES YES YES L-Fucose NO NO YES NO NO YES L-Galactonic acid-g- YES YES YES YES YES YES Lactone L-Glutamic acid YES YES YES YES NO YES L-Glutamine YES YES YES YES YES YES L-Lactic acid YES YES YES YES YES YES L-Lyxose YES YES NO NO YES NO L-Malic acid YES YES YES YES YES YES L-Proline YES YES YES YES YES YES L-Rhamnose YES NO NO NO NO YES L-Serine YES NO YES YES NO YES L-Threonine NO NO NO YES NO NO Lactulose YES NO YES YES YES YES m-Hydroxyphenyl Acetic YES NO YES YES NO YES acid m-Inositol NO NO NO YES NO YES m-Tartaric acid NO NO NO YES NO YES Maltose YES NO YES YES YES YES Maltotriose YES NO YES YES YES YES Methylpyruvate YES YES YES YES YES YES Mono-Methylsuccinate NO YES YES YES NO YES Mucic acid NO YES NO YES NO YES N-Acetyl-D-Glucosamine YES YES YES YES YES YES N-Acetyl-D- YES NO NO NO NO NO Mannosamine Negative Control NO NO NO NO NO NO p-Hydroxyphenyl Acetic YES NO YES NO NO YES acid Phenylethylamine NO NO NO NO NO NO Propionic acid NO NO NO YES YES YES Pyruvic acid YES YES YES YES YES YES Succinic acid YES YES YES YES YES YES Sucrose YES NO YES YES YES YES Thymidine YES NO NO YES NO YES Tricarballylic acid NO NO YES NO NO YES Tween 20 NO YES YES YES YES YES Tween 40 YES YES YES YES YES YES Tween 80 YES YES YES YES YES YES Tyramine NO NO NO NO NO NO Uridine YES YES YES YES YES YES Strain/Substrate SYM00906 SYM00965 SYM01004 SYM01022 SYM01158 1,2-Propanediol NO NO YES NO NO 2-Aminoethanol NO NO YES NO YES 2-Deoxyadenosine YES YES YES YES NO a-D-Glucose YES YES YES YES YES a-D-Lactose YES YES YES YES NO a-Hydroxybutyric acid YES YES NO NO YES a-Hydroxyglutaric acid-g- NO YES YES YES NO Lactone a-Ketobutyric acid YES YES NO NO YES a-Ketoglutaric acid YES YES YES YES YES a-Methyl-D-Galactoside YES YES YES YES NO Acetic acid YES YES YES YES YES Acetoacetic acid NO NO NO NO NO Adenosine YES YES YES YES NO Adonitol NO YES YES NO YES Ala-Gly YES YES YES YES YES b-Methyl-D-Glucoside YES YES YES YES NO Bromosuccinic acid YES YES YES YES YES Citric acid YES YES YES YES YES D-Alanine YES YES YES YES YES D-Aspartic acid NO NO NO NO NO D-Cellobiose YES YES YES YES YES D-Fructose YES YES YES YES YES D-Fructose-6-Phosphate YES YES YES YES NO D-Galactonic acid-g- NO YES YES YES YES Lactone D-Galactose YES YES YES YES YES D-Galacturonic acid NO YES YES YES NO D-Gluconic acid YES YES YES YES YES D-Glucosaminic acid NO YES YES YES YES D-Glucose-1-Phosphate NO YES YES YES NO D-Glucose-6-Phosphate NO YES YES YES NO D-Glucuronic acid YES YES YES YES YES D-Malic acid NO YES YES YES YES D-Mannitol YES YES YES YES NO D-Mannose YES YES YES YES YES D-Melibiose YES YES YES YES NO D-Psicose YES YES YES YES NO D-Ribose YES YES YES YES YES D-Saccharic acid NO YES YES YES NO D-Serine NO NO NO NO NO D-Sorbitol YES YES YES YES NO D-Threonine NO NO NO NO NO D-Trehalose YES YES YES YES YES D-Xylose YES YES YES YES YES DL-a-Glycerol Phosphate YES YES YES YES NO DL-Malic acid YES YES YES YES YES Dulcitol NO YES YES NO YES Formic acid NO YES YES YES NO Fumaric acid YES YES YES YES YES Glucuronamide NO NO NO NO NO Gly-Asp NO YES YES NO YES Gly-Glu YES YES YES YES YES Gly-Pro YES YES YES YES YES Glycerol YES YES YES YES NO Glycolic acid NO YES NO YES YES Glyoxylic acid NO YES NO NO NO Inosine YES YES YES YES NO L-Alanine YES YES YES YES YES L-Arabinose YES YES YES YES YES L-Asparagine YES YES YES YES YES L-Aspartic acid YES YES YES YES YES L-Fucose YES YES YES YES YES L-Galactonic acid-g- YES YES YES YES YES Lactone L-Glutamic acid YES YES YES YES YES L-Glutamine YES YES YES YES YES L-Lactic acid YES YES YES YES YES L-Lyxose YES YES YES NO NO L-Malic acid YES YES YES YES YES L-Proline YES YES YES YES YES L-Rhamnose NO YES YES NO YES L-Serine YES YES YES YES YES L-Threonine YES YES YES NO NO Lactulose YES YES YES YES NO m-Hydroxyphenyl Acetic YES YES YES YES NO acid m-Inositol NO YES YES YES YES m-Tartaric acid NO YES YES YES NO Maltose NO YES YES YES YES Maltotriose YES YES YES YES YES Methylpyruvate YES YES YES YES YES Mono-Methylsuccinate YES YES YES YES NO Mucic acid NO YES YES YES NO N-Acetyl-D-Glucosamine YES YES YES YES YES N-Acetyl-D- NO NO YES NO NO Mannosamine Negative Control NO NO NO NO NO p-Hydroxyphenyl Acetic YES YES NO YES NO acid Phenylethylamine NO YES NO YES NO Propionic acid YES YES YES YES YES Pyruvic acid YES YES YES YES YES Succinic acid YES YES YES YES YES Sucrose YES YES YES YES YES Thymidine NO YES NO YES NO Tricarballylic acid NO YES NO YES NO Tween 20 YES YES YES YES NO Tween 40 YES YES YES YES NO Tween 80 YES YES YES YES YES Tyramine NO YES NO NO NO Uridine YES YES YES YES YES
(471) TABLE-US-00032 TABLE W Substrate utilization as determined by BIOLOG PM1 MicroPlates by fungal endophytes belonging to OTUs present in cereal seeds, fruit seeds, vegetable seeds, and oil seeds. SYM00157 SYM00300 SYM00301 SYM00577 SYM01314 SYM01324 SYM01326 SYM01329 1,2-Propanediol YES YES NO YES YES NO NO YES 2-Aminoethanol YES YES YES YES YES YES YES NO 2-Deoxyadenosine YES YES YES YES YES YES YES YES a-D-Glucose YES YES YES YES YES YES YES YES a-D-Lactose YES YES YES YES YES YES YES YES a-Hydroxybutyric acid NO YES YES NO YES YES NO NO a-Hydroxyglutaric acid-g-Lactone YES NO NO NO YES YES YES NO a-Ketobutyric acid YES YES YES YES YES YES YES NO a-Ketoglutaric acid YES YES YES YES YES YES YES YES a-Methyl-D-Galactoside YES YES YES YES YES YES YES YES Acetic acid YES YES YES YES YES YES YES YES Acetoacetic acid YES NO YES NO YES NO YES NO Adenosine YES YES YES YES YES YES YES NO Adonitol YES YES YES YES YES YES YES YES Ala-Gly YES YES YES YES YES YES YES YES b-Methyl-D-Glucoside YES YES YES YES YES YES YES YES Bromosuccinic acid YES YES YES YES YES YES YES NO Citric acid YES YES YES YES YES YES YES YES D-Alanine YES YES YES YES YES NO YES NO D-Aspartic acid NO YES NO NO YES YES YES YES D-Cellobiose YES YES YES YES YES YES YES YES D-Fructose YES YES YES YES YES YES YES YES D-Fructose-6-Phosphate NO YES NO NO YES NO YES YES D-Galactonic acid-g-Lactone NO NO NO NO NO NO NO NO D-Galactose YES YES YES YES YES YES YES YES D-Galacturonic acid YES YES YES YES YES YES YES YES D-Gluconic acid YES NO YES NO YES YES YES YES D-Glucosaminic acid YES YES YES YES YES YES YES YES D-Glucose-1-Phosphate NO YES NO NO NO NO NO NO D-Glucose-6-Phosphate NO YES NO NO YES NO YES NO D-Glucuronic acid YES YES YES YES YES YES YES YES D-Malic acid NO YES YES YES YES YES YES YES D-Mannitol YES YES YES YES YES YES YES YES D-Mannose YES YES YES YES YES YES YES YES D-Melibiose YES YES YES YES YES YES YES YES D-Psicose YES YES YES NO NO YES YES YES D-Ribose YES YES YES YES YES YES YES YES D-Saccharic acid YES YES YES NO YES YES NO YES D-Serine YES YES YES YES YES YES YES NO D-Sorbitol YES YES YES YES YES YES YES YES D-Threonine YES NO NO NO YES NO YES YES D-Trehalose YES YES YES YES YES YES YES YES D-Xylose YES YES YES YES YES YES YES NO DL-a-Glycerol Phosphate NO NO NO NO YES NO YES NO DL-Malic acid YES YES YES YES YES YES YES YES Dulcitol YES YES YES YES YES YES YES YES Formic acid YES NO YES NO YES YES YES NO Fumaric acid YES YES YES YES YES YES YES YES Glucuronamide NO NO NO NO NO NO YES NO Gly-Asp YES YES YES YES YES YES YES YES Gly-Glu YES YES YES YES YES YES YES YES Gly-Pro YES YES YES YES YES YES YES YES Glycerol YES YES YES YES YES YES YES NO Glycolic acid NO NO NO NO YES YES NO NO Glyoxylic acid YES NO NO NO YES YES NO NO Inosine YES YES YES NO YES YES YES NO L-Alanine YES YES YES YES YES YES YES YES L-Arabinose YES YES YES YES YES YES YES YES L-Asparagine YES YES YES YES YES YES YES NO L-Aspartic acid YES YES YES YES YES YES YES NO L-Fucose YES YES YES YES YES YES YES YES L-Galactonic acid-g-Lactone YES YES YES YES YES YES YES YES L-Glulamic acid YES YES YES YES YES YES YES YES L-Glutamine YES YES YES YES YES YES YES YES L-Lactic acid YES YES YES YES YES YES YES NO L-Lyxose YES YES YES YES YES NO YES NO L-Malic acid YES YES YES YES YES YES YES YES L-Proline YES YES YES YES YES YES YES YES L-Rhamnose YES YES YES YES YES YES YES YES L-Serine YES YES YES YES YES YES YES YES L-Threonine YES YES YES YES YES YES YES YES Lactulose YES YES YES YES YES YES YES YES m-Hydroxyphenyl Acetic acid YES YES YES NO YES YES NO YES m-Inositol YES YES YES YES YES YES YES YES m-Tartaric acid YES YES YES NO YES YES YES YES Maltose YES YES YES YES YES YES YES YES Maltotriose YES YES YES YES YES YES YES YES Methylpyruvate YES YES YES YES YES YES YES NO Mono-Methylsuccinate YES YES YES YES YES YES YES NO Mucic acid YES YES YES NO YES YES NO YES N-Acetyl-D-Glucosamine YES YES YES YES YES YES YES YES N-Acetyl-D-Mannosamine NO YES NO NO YES NO YES NO Negative Control NO NO NO NO NO NO NO NO p-Hydroxyphenyl Acetic acid YES NO YES YES YES YES NO NO Phenylethylamine NO NO NO NO YES NO YES NO Propionic acid YES YES YES YES YES YES YES NO Pyruvic acid YES YES YES YES YES YES YES YES Succinic acid YES YES YES YES YES YES YES YES Sucrose YES YES YES YES YES YES YES YES Thymidine YES NO NO NO NO YES YES NO Tricarballylic acid NO NO YES YES YES YES NO NO Tween 20 YES YES YES YES YES YES YES NO Tween 40 YES YES YES YES YES YES YES YES Tween 80 YES YES YES YES YES YES YES YES Tyramine YES YES YES YES YES YES YES YES Uridine YES NO YES YES YES NO YES YES SYM01330 SYM01331 SYM12462 SYM15774 SYM15783 SYM15810 SYM15879 SYM15880 1,2-Propanediol NO NO YES NO NO YES YES NO 2-Aminoethanol NO NO NO NO YES YES YES YES 2-Deoxyadenosine NO NO NO YES YES YES YES YES a-D-Glucose YES YES YES YES YES YES YES YES a-D-Lactose YES YES YES YES YES YES YES YES a-Hydroxybutyric acid YES NO NO NO YES YES YES NO a-Hydroxyglutaric acid-g-Lactone YES NO YES YES YES NO YES NO a-Ketobutyric acid YES NO YES YES YES YES YES YES a-Ketoglutaric acid YES YES YES NO YES YES YES YES a-Methyl-D-Galactoside NO YES YES YES YES YES YES YES Acetic acid NO YES YES NO YES YES YES YES Acetoacetic acid NO NO YES YES YES NO YES NO Adenosine NO YES YES NO YES YES YES YES Adonitol NO YES YES YES YES YES YES YES Ala-Gly YES YES YES YES YES YES YES YES b-Methyl-D-Glucoside YES YES YES YES YES YES YES YES Bromosuccinic acid YES YES YES YES YES YES YES YES Citric acid YES NO YES NO YES NO YES YES D-Alanine NO NO NO NO NO YES YES YES D-Aspartic acid NO YES YES YES YES YES YES NO D-Cellobiose YES YES YES YES YES YES YES YES D-Fructose YES YES YES YES YES YES YES YES D-Fructose-6-Phosphate YES NO NO YES NO YES YES NO D-Galactonic acid-g-Lactone NO NO YES NO NO NO YES NO D-Galactose YES YES YES YES YES YES YES YES D-Galacturonic acid YES YES YES YES YES YES YES YES D-Gluconic acid YES YES YES YES YES YES YES YES D-Glucosaminic acid NO NO YES YES YES NO NO NO D-Glucose-1-Phosphate YES NO YES YES NO NO NO NO D-Glucose-6-Phosphate YES NO YES YES YES YES YES NO D-Glucuronic acid YES YES YES YES YES YES YES YES D-Malic acid NO YES NO NO YES YES YES YES D-Mannitol YES YES YES NO YES YES YES YES D-Mannose YES YES YES YES YES YES YES YES D-Melibiose YES YES YES YES YES YES YES YES D-Psicose NO YES NO NO YES YES YES YES D-Ribose YES YES YES YES YES YES YES YES D-Saccharic acid YES YES YES NO YES YES YES YES D-Serine NO NO NO NO YES YES YES NO D-Sorbitol YES YES YES NO YES YES YES YES D-Threonine NO YES YES YES YES NO YES NO D-Trehalose YES YES YES YES YES YES YES YES D-Xylose YES YES YES NO YES YES YES YES DL-a-Glycerol Phosphate YES NO NO YES YES YES YES YES DL-Malic acid NO YES YES YES YES YES YES YES Dulcitol NO YES YES NO YES YES YES YES Formic acid NO NO NO YES NO YES YES NO Fumaric acid NO YES YES YES YES YES YES YES Glucuronamide NO NO NO NO NO NO YES NO Gly-Asp NO YES YES YES YES YES YES YES Gly-Glu YES YES YES YES YES YES YES YES Gly-Pro YES YES YES YES YES YES YES YES Glycerol YES NO YES YES YES YES YES YES Glycolic acid YES NO NO YES YES YES NO YES Glyoxylic acid NO NO YES NO YES YES YES YES Inosine NO YES YES NO NO YES YES YES L-Alanine YES YES YES YES YES YES YES YES L-Arabinose YES YES YES NO YES YES YES YES L-Asparagine YES YES YES YES YES YES YES YES L-Aspartic acid NO YES YES YES YES YES YES YES L-Fucose YES YES NO YES NO YES YES NO L-Galactonic acid-g-Lactone YES YES YES YES YES YES YES YES L-Glulamic acid NO YES YES YES YES YES YES YES L-Glutamine YES YES YES YES YES YES YES YES L-Lactic acid NO YES YES YES YES YES YES YES L-Lyxose YES YES NO NO YES YES YES YES L-Malic acid YES YES YES YES YES YES YES YES L-Proline YES YES YES NO YES YES YES YES L-Rhamnose YES YES YES YES YES YES YES YES L-Serine YES YES YES YES YES YES YES YES L-Threonine NO NO YES YES YES YES YES YES Lactulose NO YES YES YES YES YES YES NO m-Hydroxyphenyl Acetic acid NO NO YES YES YES NO NO YES m-Inositol NO YES YES YES YES YES YES YES m-Tartaric acid NO YES NO NO YES YES YES NO Maltose YES YES YES YES YES YES YES YES Maltotriose YES YES YES YES YES YES YES YES Methylpyruvate YES YES YES YES YES YES YES YES Mono-Methylsuccinate YES YES YES YES YES YES YES YES Mucic acid NO YES YES YES YES YES YES YES N-Acetyl-D-Glucosamine YES YES YES YES YES YES YES YES N-Acetyl-D-Mannosamine YES NO NO YES YES NO NO NO Negative Control NO NO NO NO NO NO NO NO p-Hydroxyphenyl Acetic acid YES YES YES NO YES YES YES YES Phenylethylamine NO NO NO NO NO NO NO YES Propionic acid NO NO YES YES YES YES YES YES Pyruvic acid NO YES YES YES YES YES YES YES Succinic acid NO YES YES YES YES YES YES YES Sucrose YES YES YES YES YES YES YES YES Thymidine NO NO YES NO NO YES YES NO Tricarballylic acid NO NO NO YES YES YES NO NO Tween 20 YES YES YES YES YES YES YES YES Tween 40 YES YES YES YES YES YES YES YES Tween 80 YES YES YES YES YES YES YES YES Tyramine NO YES YES NO YES YES YES YES Uridine NO NO NO NO NO YES YES YES
(472) TABLE-US-00033 TABLE X Substrate utilization as determined by BIOLOG PM2 MicroPlates by bacterial endophytes belonging to OTUs present in cereal seeds, fruit seeds, vegetable seeds, and oil seeds. Substrate Strain SYM00021b SYM00044 SYM00057b SYM00074 SYM00091 SYM00092d SYM00212 SYM00290 SYM00619 2-Deoxy-D-Ribose NO YES YES YES YES NO YES YES YES 2-Hydroxybenzoic NO NO NO NO NO NO NO NO NO acid 2,3-Butanediol YES NO NO NO NO NO NO NO NO 2,3-Butanedione NO NO NO NO NO NO NO NO NO 3-Hydroxy-2- NO NO NO YES NO NO NO NO NO butanone 3-Methylglucose NO NO NO NO NO YES NO NO NO 3-O-b-D- YES YES YES YES YES YES NO YES NO Galactopyranosyl- D-Arabinose 4-Hydroxybenzoic NO NO NO NO YES NO NO NO NO acid 5-Keto-D-Gluconic YES YES YES NO NO YES YES YES NO acid a-Cyclodextrin NO NO NO YES YES YES NO NO YES a-Keto-Valeric acid NO NO NO NO NO NO NO YES NO a-Methyl-D- NO NO NO NO YES YES NO NO YES Glucoside a-Methyl-D- NO NO NO NO NO NO NO NO NO Mannoside Acetamide YES NO NO NO NO NO NO NO NO Amygdalin YES YES YES YES YES YES NO YES YES Arbutin YES YES YES YES YES YES YES NO NO b-Cyclodextrin NO NO NO NO YES YES NO YES YES b-D-Allose NO NO NO NO NO NO NO NO NO b-Hydroxybutyric YES NO NO NO YES NO NO YES NO acid b-Methyl-D- YES YES YES YES YES YES YES NO YES Galactoside b-Methyl-D- NO NO NO YES NO NO NO NO NO Glucuronic acid b-Methyl-D- NO NO NO NO NO NO NO NO NO Xyloside Butyric acid NO NO NO YES NO NO NO YES NO Capric acid NO NO NO NO NO NO NO NO NO Caproic acid NO NO NO NO NO NO NO YES NO Chondroitin Sulfate YES NO NO YES YES NO NO NO NO C Citraconic acid NO NO NO NO NO YES NO NO NO Citramalic acid YES NO NO NO NO NO NO NO NO d-Amino Valeric NO NO NO NO YES NO NO NO NO acid D-Arabinose NO NO NO NO YES YES YES YES NO D-Arabitol YES YES YES YES YES YES YES NO YES D-Fucose YES YES YES NO YES YES NO NO NO D-Glucosamine YES YES YES YES YES YES YES YES YES D-Lactic acid NO NO NO YES NO NO NO YES NO Methyl Ester D-Lactitol NO NO NO YES YES NO NO NO NO D-Melezitose NO NO NO NO NO NO YES NO NO D-Raffinose YES YES YES YES YES NO YES NO NO D-Ribono-1,4- YES NO NO NO NO YES NO NO NO Lactone D-Tagatose NO NO NO NO NO NO NO NO NO D-Tartaric acid YES NO NO YES NO NO NO NO NO D,L-Carnitine NO NO NO NO YES NO NO NO NO D,L-Octopamine NO NO NO NO NO NO NO NO NO Dextrin YES YES YES YES YES YES YES YES YES Dihydroxyacetone NO NO NO YES YES YES YES YES YES g-Amino-N-Butyric YES NO NO NO YES YES NO NO NO acid g-Cyclodextrin NO NO NO NO NO NO NO NO NO g-Hydroxybutyric NO NO NO NO NO NO NO NO NO acid Gelatin NO NO NO YES YES NO NO YES NO Gentiobiose YES YES YES YES YES YES YES NO YES Glycine NO NO NO YES NO NO NO NO NO Glycogen NO YES YES YES NO YES YES YES YES Hydroxy-L-Proline NO NO NO NO YES NO NO NO NO i-Erythritol YES NO NO NO YES YES YES NO NO Inulin NO NO NO NO NO NO NO NO NO Itaconic acid NO NO NO NO YES NO NO NO NO L-Alaninamide YES NO NO YES YES YES NO YES NO L-Arabitol NO NO NO NO YES YES NO NO NO L-Arginine YES YES YES YES YES YES NO NO NO L-Glucose NO NO NO NO NO NO NO NO NO L-Histidine YES NO NO YES YES YES YES NO NO L-Homoserine NO NO NO NO NO NO NO NO NO L-Isoleucine NO NO NO NO YES NO NO NO NO L-Leucine YES NO NO NO NO NO NO NO NO L-Lysine NO NO NO NO YES NO NO NO NO L-Methionine NO NO NO NO NO YES NO NO NO L-Ornithine YES YES YES YES YES YES YES YES NO L-Phenylalanine YES NO NO YES NO NO YES NO NO L-Pyroglutamic acid YES NO NO YES NO YES NO NO NO L-Sorbose NO NO NO NO NO NO NO NO NO L-Tartaric acid YES YES YES NO NO YES YES NO NO L-Valine NO NO NO NO NO NO NO NO NO Laminarin NO NO NO NO YES NO NO YES NO Malonic acid YES NO NO YES NO NO YES NO NO Maltitol YES NO NO NO YES NO NO NO NO Mannan NO NO NO YES NO YES YES YES NO Melibionic acid YES YES YES YES YES NO NO YES NO N-Acetyl-D- YES NO NO NO NO NO NO NO NO Galactosamine N-Acetyl-D- NO NO NO NO NO NO NO NO NO Glucosaminitol N-Acetyl-L- NO NO NO YES NO YES NO NO NO Glutamic acid N-Acetyl- NO YES YES YES NO NO YES NO NO Neuraminic acid Negative Control. 1 NO NO NO NO NO NO NO NO NO Oxalic acid NO NO NO NO NO NO NO NO NO Oxalomalic acid NO NO NO NO YES YES NO YES NO Palatinose YES NO NO NO YES NO NO NO YES Pectin YES YES YES YES YES YES YES YES NO Putrescine YES NO NO YES NO NO NO NO NO Quinic acid YES NO NO NO YES YES NO NO NO Salicin YES YES YES YES YES YES YES NO YES Sebacic acid YES NO NO NO NO NO NO YES YES sec-Butylamine NO NO NO NO NO NO NO NO NO Sedoheptulosan NO NO NO NO NO NO NO NO NO Sorbic acid NO NO NO NO NO NO NO YES NO Stachyose NO NO NO NO YES NO NO NO NO Succinamic acid YES YES YES YES YES YES YES YES NO Turanose YES NO NO NO YES YES NO NO YES Xylitol NO NO NO NO YES NO NO NO NO Substrate Strain SYM00865 SYM00879 SYM00879b SYM00906 SYM00965 SYM01004 SYM01022 SYM01158 2-Deoxy-D-Ribose YES YES YES YES YES NO YES YES 2-Hydroxybenzoic NO NO NO NO NO NO NO NO acid 2,3-Butanediol NO NO YES NO YES YES NO YES 2,3-Butanedione NO NO NO NO NO NO NO NO 3-Hydroxy-2- NO NO NO NO NO NO YES YES butanone 3-Methylglucose NO NO YES NO YES YES YES YES 3-O-b-D- YES YES YES YES YES YES YES YES Galactopyranosyl- D-Arabinose 4-Hydroxybenzoic NO NO NO NO NO YES NO YES acid 5-Keto-D-Gluconic YES YES YES NO YES YES YES YES acid a-Cyclodextrin YES NO YES NO YES YES YES NO a-Keto-Valeric acid NO NO NO NO YES NO YES YES a-Methyl-D- NO NO NO YES YES YES YES YES Glucoside a-Methyl-D- NO NO YES NO NO NO NO NO Mannoside Acetamide NO YES NO NO YES NO NO NO Amygdalin YES YES YES YES YES YES YES YES Arbutin YES YES YES YES YES YES YES YES b-Cyclodextrin NO NO YES NO YES YES YES NO b-D-Allose NO NO NO NO YES NO NO NO b-Hydroxybutyric NO YES YES YES YES YES YES YES acid b-Methyl-D- YES YES YES YES YES YES YES YES Galactoside b-Methyl-D- NO NO NO NO NO NO YES YES Glucuronic acid b-Methyl-D- NO NO YES NO YES YES NO YES Xyloside Butyric acid YES YES YES YES YES YES YES YES Capric acid NO NO NO NO NO NO NO NO Caproic acid NO NO NO NO NO NO NO YES Chondroitin Sulfate YES YES YES YES YES NO YES YES C Citraconic acid NO NO YES NO YES YES NO YES Citramalic acid NO NO YES NO YES YES YES YES d-Amino Valeric NO NO NO NO YES NO YES YES acid D-Arabinose NO YES YES YES YES YES NO YES D-Arabitol YES NO YES NO YES YES YES YES D-Fucose NO NO NO NO YES YES NO YES D-Glucosamine YES YES YES YES YES YES YES YES D-Lactic acid YES YES NO NO NO YES YES YES Methyl Ester D-Lactitol YES YES NO YES YES YES YES YES D-Melezitose NO NO YES YES YES YES YES YES D-Raffinose YES NO YES YES YES YES YES YES D-Ribono-1,4- NO NO YES YES YES YES NO YES Lactone D-Tagatose YES NO YES NO YES YES NO YES D-Tartaric acid NO NO NO NO NO YES NO YES D,L-Carnitine NO NO NO NO YES YES NO YES D,L-Octopamine NO NO NO NO NO NO YES NO Dextrin YES YES YES YES YES YES YES YES Dihydroxyacetone YES YES YES YES YES YES YES YES g-Amino-N-Butyric YES NO YES NO YES YES YES YES acid g-Cyclodextrin YES NO YES NO YES NO YES YES g-Hydroxybutyric NO YES YES NO YES YES YES YES acid Gelatin YES YES YES YES YES YES YES YES Gentiobiose YES YES YES YES YES YES YES YES Glycine NO NO NO NO YES NO YES YES Glycogen YES NO YES YES YES YES YES YES Hydroxy-L-Proline YES NO YES NO YES YES YES YES i-Erythritol NO YES NO NO YES YES NO YES Inulin YES NO NO NO NO NO YES YES Itaconic acid NO NO YES YES YES NO YES YES L-Alaninamide YES YES YES YES YES NO YES YES L-Arabitol NO NO YES NO YES YES NO YES L-Arginine YES NO YES NO YES YES YES YES L-Glucose NO NO NO NO NO NO NO NO L-Histidine YES NO YES YES YES YES YES YES L-Homoserine NO NO NO NO YES NO YES NO L-Isoleucine YES NO YES YES YES YES YES YES L-Leucine YES YES YES YES YES YES YES YES L-Lysine YES NO YES NO YES YES YES YES L-Methionine NO NO NO NO NO NO NO NO L-Ornithine YES NO YES YES YES YES YES YES L-Phenylalanine YES NO YES YES YES NO YES NO L-Pyroglutamic acid NO NO YES YES YES YES YES YES L-Sorbose NO NO NO NO NO NO NO NO L-Tartaric acid NO YES NO NO NO NO YES YES L-Valine YES NO YES YES YES NO YES YES Laminarin YES YES YES YES YES YES YES YES Malonic acid YES YES NO YES YES YES NO YES Maltitol YES YES NO YES YES YES YES YES Mannan NO NO NO YES YES YES NO YES Melibionic acid YES NO YES NO YES YES YES YES N-Acetyl-D- YES YES YES YES YES YES YES YES Galactosamine N-Acetyl-D- NO NO NO NO NO NO NO YES Glucosaminitol N-Acetyl-L- YES NO YES YES YES NO YES YES Glutamic acid N-Acetyl- NO NO YES YES YES NO NO YES Neuraminic acid Negative Control. 1 NO NO NO NO NO NO NO NO Oxalic acid NO YES NO NO NO YES NO NO Oxalomalic acid YES YES YES YES YES YES YES YES Palatinose YES YES YES YES YES YES YES YES Pectin YES YES YES YES YES YES YES YES Putrescine NO NO YES YES YES YES YES YES Quinic acid YES NO YES NO YES YES YES YES Salicin YES YES YES YES YES YES YES YES Sebacic acid NO NO YES NO YES NO YES YES sec-Butylamine NO NO NO NO NO NO NO NO Sedoheptulosan NO NO NO NO NO NO NO NO Sorbic acid YES NO YES YES YES NO YES YES Stachyose NO NO NO NO YES YES YES YES Succinamic acid YES YES YES YES YES YES YES YES Turanose YES YES YES YES YES YES YES YES Xylitol NO NO YES NO YES YES NO NO
(473) TABLE-US-00034 TABLE Y Substrate utilization as determined by BIOLOG PM2 MicroPlates by fungal endophytes belonging to OTUs present in cereal seeds, fruit seeds, vegetable seeds, and oil seeds. Substrate Strain SYM00157 SYM00300 SYM00301 SYM00577 SYM01314 SYM01324 SYM01326 SYM01329 2-Deoxy-D-Ribose YES NO NO NO YES NO NO NO 2-Hydroxybenzoic acid YES YES YES YES YES YES YES NO 2,3-Butanediol NO NO YES NO NO YES NO NO 2,3-Butanedione NO NO YES NO NO YES NO NO 3-Hydroxy-2-butanone NO NO NO NO NO YES NO NO 3-Methylglucose YES NO YES YES NO NO NO YES 3-O-b-D- YES YES YES YES YES YES NO YES Galactopyranosyl-D- Arabinose 4-Hydroxybenzoic acid YES YES YES YES YES YES YES YES 5-Keto-D-Gluconic acid NO NO YES NO YES YES YES NO a-Cyclodextrin YES YES YES YES YES YES YES YES a-Keto-Valeric acid YES YES YES YES YES YES YES YES a-Methyl-D-Glucoside YES YES YES YES YES YES YES YES a-Methyl-D-Mannoside YES NO YES NO NO YES YES NO Acetamide YES YES YES NO NO NO NO NO Amygdalin YES YES YES YES YES YES YES YES Arbutin YES YES YES YES YES YES YES YES b-Cyclodextrin YES YES YES NO NO YES YES NO b-D-Allose NO NO YES NO NO NO YES NO b-Hydroxybutyric acid YES YES YES YES YES YES YES YES b-Methyl-D-Galactoside YES YES YES YES YES YES YES YES b-Methyl-D-Glucuronic YES NO NO NO YES NO NO NO acid b-Methyl-D-Xyloside NO NO YES NO YES YES YES NO Butyric acid YES YES YES YES YES YES YES YES Capric acid NO NO NO NO NO NO NO NO Caproic acid NO YES YES YES YES YES YES NO Chondroitin Sulfate C YES NO YES NO YES YES NO NO Citraconic acid YES NO YES NO YES YES NO NO Citramalic acid YES NO NO NO YES YES NO YES d-Amino Valeric acid NO YES YES YES YES YES YES NO D-Arabinose YES YES YES YES YES YES YES YES D-Arabitol YES YES YES YES YES YES YES YES D-Fucose YES NO YES NO YES YES NO NO D-Glucosamine YES YES YES YES YES YES YES NO D-Lactic acid Methyl YES NO YES NO NO NO NO NO Ester D-Lactitol YES YES YES YES NO NO YES YES D-Melezitose YES YES YES YES YES YES YES YES D-Raffinose YES YES YES YES YES YES YES YES D-Ribono-1,4-Lactone YES NO YES YES YES NO YES NO D-Tagatose NO YES YES NO YES NO YES NO D-Tartaric acid YES NO NO NO YES NO NO NO D,L-Carnitine YES NO YES NO NO NO NO NO D,L-Octopamine YES NO YES NO YES YES NO NO Dextrin YES YES YES YES YES YES YES YES Dihydroxyacetone YES YES YES YES YES YES YES NO g-Amino-N-Butyric acid YES YES YES YES YES YES YES YES g-Cyclodextrin YES YES YES YES YES YES YES YES g-Hydroxybutyric acid YES YES YES YES YES YES YES YES Gelatin YES YES YES YES YES YES YES YES Gentiobiose YES YES YES YES YES YES YES YES Glycine YES YES YES YES YES YES YES NO Glycogen YES YES YES YES YES YES YES YES Hydroxy-L-Proline YES YES YES YES YES YES YES NO i-Erythritol YES YES YES YES YES YES YES YES Inulin YES YES YES YES YES NO NO NO Itaconic acid NO NO YES NO NO NO NO YES L-Alaninamide YES YES YES YES YES YES YES YES L-Arabitol YES YES YES YES YES YES YES YES L-Arginine YES YES YES YES YES YES YES YES L-Glucose NO NO YES NO NO NO YES NO L-Histidine YES YES YES YES YES YES YES NO L-Homoserine YES YES YES YES NO YES YES NO L-Isoleucine YES YES YES YES YES YES YES YES L-Leucine YES YES YES YES YES YES YES NO L-Lysine YES YES YES YES YES YES YES NO L-Methionine NO NO NO NO NO NO NO NO L-Ornithine YES YES YES YES YES YES YES YES L-Phenylalanine YES YES YES YES YES YES YES NO L-Pyroglutamic acid YES YES YES YES YES YES YES YES L-Sorbose NO YES YES YES YES YES YES NO L-Tartaric acid YES NO YES NO YES YES YES YES L-Valine YES YES YES YES YES YES YES YES Laminarin YES YES YES YES YES YES YES NO Malonic acid YES NO YES YES YES YES YES NO Maltitol YES YES YES YES YES YES YES YES Mannan YES NO YES NO YES NO NO NO Melibionic acid YES NO YES YES YES YES YES NO N-Acetyl-D- YES NO NO NO NO NO YES NO Galactosamine N-Acetyl-D- NO NO NO NO YES YES NO YES Glucosaminitol N-Acetyl-L-Glutamic NO NO YES NO NO YES NO NO acid N-Acetyl-Neuraminic NO NO NO NO NO NO NO NO acid Negative Control. 1 NO NO NO NO NO NO NO NO Oxalic acid YES YES YES YES YES YES YES NO Oxalomalic acid NO NO NO NO YES NO NO NO Palatinose YES YES YES YES YES YES YES YES Pectin YES NO YES NO YES YES YES YES Putrescine YES YES YES YES YES YES YES YES Quinic acid YES YES YES YES YES YES YES YES Salicin YES YES YES YES YES YES YES YES Sebacic acid YES YES YES YES YES YES YES NO sec-Butylamine NO YES YES NO NO NO NO NO Sedoheptulosan YES YES NO NO YES YES YES YES Sorbic acid YES YES YES YES YES YES YES NO Stachyose YES YES YES YES YES YES YES YES Succinamic acid YES YES YES YES YES YES NO YES Turanose YES YES YES YES YES YES YES YES Xylitol YES YES YES YES YES YES YES YES Substrate Strain SYM01330 SYM01331 SYM12462 SYM15774 SYM15783 SYM15810 SYM15879 SYM15880 2-Deoxy-D-Ribose NO NO NO NO YES YES YES NO 2-Hydroxybenzoic acid YES YES YES YES YES YES YES YES 2,3-Butanediol YES YES NO YES NO YES NO NO 2,3-Butanedione YES YES NO NO NO YES NO NO 3-Hydroxy-2-butanone YES NO NO NO NO NO NO NO 3-Methylglucose YES YES NO NO YES NO YES NO 3-O-b-D- NO YES YES YES YES YES NO YES Galactopyranosyl-D- Arabinose 4-Hydroxybenzoic acid YES YES NO YES YES YES YES YES 5-Keto-D-Gluconic acid YES YES YES YES YES YES YES YES a-Cyclodextrin YES YES YES YES YES YES YES YES a-Keto-Valeric acid YES YES YES YES YES YES YES YES a-Methyl-D-Glucoside YES YES NO YES YES YES YES YES a-Methyl-D-Mannoside YES YES NO NO YES YES YES NO Acetamide YES YES NO YES NO NO NO NO Amygdalin YES YES YES YES YES YES YES YES Arbutin YES YES YES YES YES YES YES YES b-Cyclodextrin NO YES YES YES YES YES YES YES b-D-Allose NO NO NO YES YES YES YES YES b-Hydroxybutyric acid YES YES YES YES YES YES YES NO b-Methyl-D-Galactoside YES YES YES YES YES YES YES YES b-Methyl-D-Glucuronic YES NO NO NO NO NO YES NO acid b-Methyl-D-Xyloside NO NO NO NO YES YES NO NO Butyric acid YES YES NO NO YES YES YES YES Capric acid NO NO NO NO NO NO NO NO Caproic acid NO YES NO NO YES YES YES YES Chondroitin Sulfate C YES YES YES NO NO YES YES NO Citraconic acid YES YES YES NO YES YES NO NO Citramalic acid YES YES NO NO YES YES YES YES d-Amino Valeric acid YES YES YES NO YES YES YES YES D-Arabinose NO YES YES YES YES YES YES YES D-Arabitol YES YES YES YES YES YES YES YES D-Fucose NO YES NO YES YES YES YES YES D-Glucosamine YES YES NO NO NO YES YES YES D-Lactic acid Methyl YES NO YES NO NO YES NO NO Ester D-Lactitol NO YES YES YES YES YES YES NO D-Melezitose YES YES YES YES YES YES YES YES D-Raffinose YES YES YES YES YES YES YES YES D-Ribono-1,4-Lactone YES YES NO NO YES NO NO YES D-Tagatose YES NO NO NO YES YES YES YES D-Tartaric acid YES NO NO YES YES NO YES NO D,L-Carnitine YES YES YES NO NO NO NO NO D,L-Octopamine NO YES NO YES YES YES YES NO Dextrin YES YES YES YES YES YES YES YES Dihydroxyacetone YES YES NO NO YES YES YES NO g-Amino-N-Butyric acid YES YES YES NO YES YES YES YES g-Cyclodextrin YES YES YES YES YES YES YES YES g-Hydroxybutyric acid YES YES YES YES YES YES NO NO Gelatin YES YES YES YES YES YES YES NO Gentiobiose YES YES YES YES YES YES YES YES Glycine YES YES YES NO YES YES YES YES Glycogen YES YES YES YES YES YES YES YES Hydroxy-L-Proline YES YES YES NO YES YES YES YES i-Erythritol YES YES YES NO YES YES NO YES Inulin YES NO YES YES NO YES YES YES Itaconic acid NO YES NO NO NO NO NO NO L-Alaninamide YES YES YES YES YES YES YES NO L-Arabitol YES YES YES NO YES YES YES YES L-Arginine YES YES YES YES YES YES YES YES L-Glucose NO YES NO NO YES YES YES NO L-Histidine YES NO YES YES YES YES YES YES L-Homoserine NO YES NO NO YES NO YES NO L-Isoleucine YES YES YES YES YES YES YES YES L-Leucine YES YES NO YES YES YES YES NO L-Lysine YES YES YES YES YES YES YES YES L-Methionine NO NO NO YES YES NO NO NO L-Ornithine YES YES YES YES YES YES YES YES L-Phenylalanine YES YES YES YES YES YES YES YES L-Pyroglutamic acid YES YES YES YES NO YES YES YES L-Sorbose YES NO YES NO YES YES YES YES L-Tartaric acid NO YES NO YES NO YES YES NO L-Valine YES YES NO NO YES YES YES YES Laminarin NO YES YES YES YES YES YES NO Malonic acid YES YES NO YES YES YES YES NO Maltitol YES YES NO YES YES YES YES YES Mannan YES NO YES YES NO NO NO NO Melibionic acid YES YES YES YES NO YES YES NO N-Acetyl-D- YES NO NO YES NO YES NO NO Galactosamine N-Acetyl-D- NO NO NO NO NO YES YES NO Glucosaminitol N-Acetyl-L-Glutamic YES YES NO YES NO NO NO NO acid N-Acetyl-Neuraminic NO NO NO NO NO NO NO NO acid Negative Control. 1 NO NO NO NO NO NO NO NO Oxalic acid YES YES YES NO YES YES YES NO Oxalomalic acid YES NO NO NO YES YES YES NO Palatinose YES YES YES YES YES YES YES YES Pectin YES YES YES YES YES YES YES YES Putrescine YES YES YES NO YES YES YES YES Quinic acid YES YES NO YES YES YES YES YES Salicin YES YES YES YES YES YES YES YES Sebacic acid YES YES YES NO YES YES YES YES sec-Butylamine NO NO NO NO NO NO NO NO Sedoheptulosan YES YES YES YES YES YES YES YES Sorbic acid YES YES NO NO YES YES YES NO Stachyose YES YES YES YES YES YES YES YES Succinamic acid YES YES YES YES YES YES YES NO Turanose YES YES YES YES YES YES YES YES Xylitol YES YES YES YES YES YES YES YES
(474) Seventeen (17) bacterial SYM strains and sixteen (16) fungal SYM strains were tested in biological triplicate for sole carbon substrate utilization using BIOLOG PM1 and PM2A MicroPlates. The most utilized substrates overall by these strains are a-D-Glucose, Arbutin, b-Methyl-D-Galactoside, b-Methyl-D-Glucoside, D-Arabitol, D-Cellobiose, Dextrin, D-Fructose, D-Galactose, D-Gluconic acid, D-Glucosamine, Dihydroxyacetone, DL-Malic acid, D-Mannitol, D-Mannose, D-Melezitose, D-Melibiose, D-Raffinose, D-Ribose, D-Trehalose, D-Xylose, g-Amino-N-Butyric acid, g-Cyclodextrin, Gelatin, Gentiobiose, Glycogen, i-Erythritol, L-Alanine, L-Arabinose, L-Galactonic acid-g-Lactone, L-Histidine, L-Proline, L-Rhamnose, Maltitol, Maltose, Maltotriose, N-Acetyl-D-Glucosamine, Palatinose, Pectin, Salicin, Stachyose, Sucrose, and Turanose. Overall, these strains did not utilize 2,3-Butanediol, 2,3-Butanedione, b-Methyl-D-Glucuronic acid, b-Methyl-D-Xyloside, Capric acid, D,L-Carnitine, Glucuronamide, Itaconic acid, L-Methionine, N-Acetyl-D-Glucosaminitol, N-Acetyl-Neuraminic acid, Phenylethylamine, or sec-Butylamine as sole carbon sources.
(475) The most utilized substrates by these seventeen bacterial endophytes are 2-Deoxy-D-Ribose, a-D-Glucose, a-Methyl-D-Galactoside, Arbutin, b-Methyl-D-Galactoside, b-Methyl-D-Glucoside, D-Arabitol, D-Cellobiose, Dextrin, D-Fructose, D-Galactose, D-Galacturonic acid, D-Gluconic acid, D-Glucosamine, Dihydroxyacetone, DL-Malic acid, D-Mannitol, D-Mannose, D-Melibiose, D-Raffinose, D-Ribose, D-Trehalose, D-Xylose, Gelatin, Gentiobiose, L-Arabinose, L-Aspartic acid, L-Galactonic acid-g-Lactone, L-Glutamic acid, L-Glutamine, L-Histidine, L-Ornithine, L-Proline, Maltose, Maltotriose, N-Acetyl-D-Glucosamine, Pyruvic acid, Salicin, Sucrose, and Turanose. These bacterial endophytes did not utilize 1,2-Propanediol, 2,3-Butanediol, 2,3-Butanedione, 2-Aminoethanol, 2-Hydroxybenzoic acid, 3-Hydroxy-2-butanone, 3-Methylglucose, 4-Hydroxybenzoic acid, Acetamide, Acetoacetic acid, a-Hydroxybutyric acid, a-Hydroxyglutaric acid-g-Lactone, a-Ketobutyric acid, a-Keto-Valeric acid, a-Methyl-D-Glucoside, a-Methyl-D-Mannoside, b-D-Allose, b-Methyl-D-Glucuronic acid, b-Methyl-D-Xyloside, Capric acid, Caproic acid, Citraconic acid, Citramalic acid, D,L-Carnitine, D,L-Octopamine, d-Amino Valeric acid, D-Aspartic acid, D-Melezitose, D-Serine, D-Tagatose, D-Tartaric acid, D-Threonine, g-Cyclodextrin, g-Hydroxybutyric acid, Glucuronamide, Glycine, Glycolic acid, Glyoxylic acid, Hydroxy-L-Proline, i-Erythritol, Inulin, Itaconic acid, L-Arabitol, L-Fucose, L-Glucose, L-Homoserine, L-Methionine, L-Sorbose, L-Threonine, L-Valine, m-Tartaric acid, N-Acetyl-D-Glucosaminitol, N-Acetyl-D-Mannosamine, N-Acetyl-Neuraminic acid, Oxalic acid, Phenylethylamine, Sebacic acid, sec-Butylamine, Sedoheptulosan, Stachyose, Tricarballylic acid, Tyramine, or Xylitol as sole carbon sources.
(476) The most utilized substrates by these sixteen fungal endophytes are a-D-Glucose, a-Methyl-D-Glucoside, Amygdalin, Arbutin, b-Methyl-D-Galactoside, b-Methyl-D-Glucoside, D-Arabitol, D-Cellobiose, Dextrin, D-Fructose, D-Galactose, D-Mannitol, D-Mannose, D-Melezitose, D-Melibiose, D-Raffinose, D-Trehalose, D-Xylose, g-Amino-N-Butyric acid, g-Cyclodextrin, Gentiobiose, Glycogen, i-Erythritol, L-Alanine, L-Arabinose, L-Arginine, L-Ornithine, L-Rhamnose, Maltitol, Maltose, Maltotriose, N-Acetyl-D-Glucosamine, Palatinose, Pectin, Putrescine, Quinic acid, Salicin, Stachyose, Sucrose, and Turanose. These fungal endophytes did not utilize 2,3-Butanediol, 2,3-Butanedione, 2-Deoxy-D-Ribose, b-Methyl-D-Glucuronic acid, b-Methyl-D-Xyloside, Capric acid, D,L-Carnitine, D-Galactonic acid-g-Lactone, D-Glucose-1-Phosphate, Glucuronamide, Itaconic acid, L-Methionine, N-Acetyl-D-Galactosamine, N-Acetyl-D-Glucosaminitol, N-Acetyl-L-Glutamic acid, N-Acetyl-Neuraminic acid, Phenylethylamine, or sec-Butylamine as sole carbon sources.
Example 5: Transcriptomic Characterization of Host Plant Response to Synthetic Compositions Comprising Plant Seeds and an Endophyte (Soy RNA-SEQ Experiments)
(477) This Example describes the ability of synthetic compositions comprising plant seeds a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example describe the ability of endophytes (e.g., endophytes described herein) to confer beneficial traits on a variety of host plants by modulating the transcriptome of the host plant. In some embodiments, host plants include, but are not limited to, dicots (e.g., soy, peanuts) and monocots (e.g., plants described herein, e.g., corn, soy, wheat, cotton, sorghum), and combinations thereof.
(478) Among other things, this Example describes surprising and unexpected modulations in the transcriptome of a host plant in response to synthetic compositions comprising plant seeds and a beneficial fungal endophyte strain, compared to a neutral fungal strain of the same genus.
(479) Plant Seedling
(480) Untreated soy seeds were surface sterilized using chlorine fumes. Briefly, Erlenmyer flasks containing seeds and a bottle with 100 mL of fresh bleach solution were placed in a desiccation jar located in a fume hood. Immediately prior to closing the lid of the desiccation jar, 3 mL hydrochloric acid was carefully pipetted into the bleach. Sterilization was done for 17 hours, and upon completion the flasks with seeds were removed, sealed in sterile foil, and opened in a sterile biosafety cabinet or laminar flow hood for subsequent work.
(481) Soy Seedling Assay
(482) Seeds were first coated with 3% sodium alginate, and gently shaken to obtain homogenous coverage. SYM strain fungal inoculum grown as described previously was added to the sodium alginate coated seeds and gently mixed. For every one gram of seeds, 10 L of sodium alginate and inoculum were applied. Formulation only soybean seeds were coated with 3% sodium alginate and fresh PDB.
(483) Ten seeds were placed on a 150 mm Petri plate that contained a single heavy germination paper (SD5-1/4 76# heavy weight seed germination paper, Anchor Paper Co., St. Paul, Minn.) added with 10 mL 8% polyethylene glycol (PEG 6000). Plates were incubated at 22 Celsius in dark and 60% relative humidity for five days. Seedlings were harvested at the end of the incubation period and stored in 80 C. until total RNA isolation using standard extraction method using TriReagent (Sigma-Aldrich, St. Louis, Mo., USA) and purification with RNeasy Mini Kit (Qiagen, Hilden, Germany). All experiments (beneficial, neural, formulation) were done in triplicate under sterile conditions resulting in a total of nine samples.
(484) Soy RNA-SEQ
(485) Initial quality control was performed using Agilent Bioanalyzer and Tapestation.
(486) PolyA cDNA Preparation
(487) For each of the 9 soybean RNAs, polyA cDNA was prepared using a Clontech cDNA synthesis kit. Briefly, after initial QC passed, 500 ng of total RNA was used to generate 1-2 ug of cDNA using Clontech SMARTer PCR cDNA kit (Clontech Laboratories, Inc., Mountain View, Calif. USA, catalog #634925). Manufacturer's instructions were strictly followed to perform polyA cDNA construction; 14 PCR cycles were performed.
(488) Fragmentation
(489) Briefly, cDNA was fragmented using Bioruptor (Diagenode, Inc., Denville, N.J. USA). Fragmented cDNAs were tested for size distribution and concentration using an Agilent Bioanalyzer 2100 or Tapestation 2200 and Nanodrop.
(490) DNA Library Construction
(491) For each the 9 soybean samples, Illumina libraries were made from qualified fragmented cDNA using Beckman Coulter SPRIworks HT Reagent Kit (Beckman. Coulter, Inc. Indianapolis, Ind. USA, catalog # B06938) on the Biomek FXp liquid handler.
(492) Beckman Biomek FXp (Biomek 6000, Beckman Coulter) fully automatic workstation and a Beckman HT library kit were used to generate fragment libraries. The instructions were strictly followed to perform library construction. Briefly, after fragmentation the ends were repaired and A bases were added to the 3 end of the fragments. Adapters were then ligated to both ends. The adaptor-ligated templates were further purified using Agencourt AMPure SPRI beads. The adaptor-ligated library was amplified by ligation-mediated PCR which consisted of 10 cycles of amplification, and the PCR product was purified using Agencourt AMPure SPRI beads again. After the library construction procedure was completed, QC was performed using a Nanodrop and Agilent Bioanalyzer to ensure the library quality and quantity.
(493) RNA Sequencing
(494) Sequencing was performed on an Illumina HiSeq 2500, using Rapid run v2.0 chemistry which generated paired-end reads of 106 nucleotides (nt.) according to Illumina manufacturer's instructions. The initial data analysis was started directly on the HiSeq 2500 System during the run. The HiSeq Control Software 2.2.58 in combination with RTA 1.18.64 (real time analysis) performed the initial image analysis and base calling. In addition, bcl2fastq1.8.4 generated and reported run statistics. Data was analyzed using FASTQC (Babraham Institute, Cambridge, UK) comprising the sequence information which was used for all subsequent bioinformatics analyses. Sequences were de-multiplexed according to the 6 bp index code with 1 mismatch allowed.
(495) Analysis
(496) Differential analysis of the soy transcriptome in the presence of neutral vs beneficial fungi was performed using standard RNA-seq analysis methods. Briefly, mapped reads overlapping with exon features were counted and aggregated by gene. These gene-level counts were analyzed with the DESeq2 R package, available through the Bioconductor software repository. All possible comparisons of the three groups (control, neutral, beneficial) were performed, and the false discovery rate method was used to adjust p-values for multiple testing. High- and low-confidence differential gene lists were created using false discovery rate thresholds of 0.1 and 0.05, and log 2 fold-change thresholds of 1 and 2, respectively. Set differences were extracted, e.g., genes differentially expressed in beneficial vs control but not in neutral vs control. Gene Ontology (GO) enrichment analysis was performed for all differential gene lists.
(497) TABLE-US-00035 TABLE 500 This table shows the genes that are up-regulated (negative log FC) or down-regulated (positive log FC) in soybean as a result of treatment with a beneficial endophyte, as compared to formulation control. SEQ Median Exp. Median Exp. ID Gene Annotation log FC Adj. p-value Beneficial Formulation 4127 GLYMA01G31730 GO:0006952, GO, defense response 1.369956983 3.89E08 12.63236736 3.673553109 4128 GLYMA01G31921 NA 1.238022219 1.45E06 8.528180493 2.738466863 4129 GLYMA01G38630 GO:0055114, GO, oxidation-reduction 1.099323189 0.000263359 4.903703783 1.347924708 process 4130 GLYMA01G41070 GO:0008150, GO, biological_process 1.568722399 1.04E14 13.25341979 3.395530442 4131 GLYMA01G43420 GO:0006355, GO, regulation of 1.253171009 1.81E09 22.27987154 8.177409896 transcription, DNA-dependent 4132 GLYMA01G44660 GO:0008150, GO, biological_process 1.163160876 1.25E05 7.245224059 1.797232944 4133 GLYMA02G01400 GO:0008152, GO, metabolic process 1.1051522 1.17E05 5.985185092 2.156679533 4134 GLYMA02G03420 GO:0019761, GO, glucosinolate 1.015176361 4.96E05 24.06891956 9.008550154 biosynthetic process 4135 GLYMA02G04000 GO:0080167, GO, response to karrikin 1.070349401 8.30E10 27.49585031 12.58063061 4136 GLYMA02G06150 GO:0008150, GO, biological_process 1.034377122 2.01E05 49.3568446 19.85942403 4137 GLYMA02G09750 GO:0006468, GO, protein 1.109501892 1.06E05 18.65539483 5.75161279 phosphorylation 4138 GLYMA02G14260 GO:0008150, GO, biological_process 1.251479824 4.10E10 30.38164301 12.49076896 4139 GLYMA02G36700 GO:0006457, GO, protein folding 1.234514786 1.70E08 5.983985525 17.25483837 4140 GLYMA02G40990 GO:0010200, GO, response to chitin 1.627009953 7.37E22 34.59243212 10.33408943 4141 GLYMA02G42251 NA 1.411718736 9.82E18 83.37686498 28.48614217 4142 GLYMA02G45420 GO:0006508, GO, proteolysis 1.424759326 7.78E14 51.01901733 15.27648003 4143 GLYMA03G00540 GO:0006468, GO, protein 1.349391458 2.98E07 9.405290859 1.803380617 phosphorylation 4144 GLYMA03G01820 GO:0008150, GO, biological_process 1.012023704 0.000952197 3.464573325 0.988478119 4145 GLYMA03G01835 NA 1.259097901 1.11E08 22.70628056 8.626718132 4146 GLYMA03G01840 GO:0008150, GO, biological_process 1.407747152 6.51E15 50.47616829 19.58983909 4147 GLYMA03G03480 GO:0009733, GO, response to auxin 1.008891294 3.93E06 14.00695871 5.543723171 stimulus 4148 GLYMA03G05220 GO:0006355, GO, regulation of 1.368776464 5.33E08 11.67294705 3.873928733 transcription, DNA-dependent 4149 GLYMA03G30410 GO:0006499, GO, N-terminal protein 1.076960853 0.000354785 4.230130817 1.068669995 myristoylation 4150 GLYMA03G34780 GO:0006979, GO, response to oxidative 1.536202396 9.85E09 0.576235643 3.953912477 stress 4151 GLYMA03G35950 GO:0005575, GO, cellular_component 1.037941628 6.65E05 5.718030613 2.27092374 4152 GLYMA03G35980 GO:0010150, GO, leaf senescence 1.093799446 2.45E08 27.18357532 9.618029959 4153 GLYMA03G36330 GO:0009870, GO, defense response 1.456183569 7.05E14 14.35544394 3.606761235 signaling pathway, resistance gene- dependent 4154 GLYMA03G42390 GO:0008270, GO, zinc ion binding 1.155489867 7.37E09 20.94734334 7.6919159 4155 GLYMA04G00490 GO:0008150, GO, biological_process 1.066752001 0.000134501 5.490016192 2.066817886 4156 GLYMA04G00890 GO:0009409, GO, response to cold 1.23197541 1.83E05 2.97009185 0.667918747 4157 GLYMA04G02280 GO:0008150, GO, biological_process 1.129891407 1.65E07 27.07697307 12.08932932 4158 GLYMA04G04760 GO:0006979, GO, response to oxidative 1.145087639 1.78E13 110.3884138 47.53681137 stress 4159 GLYMA04G09110 GO:0006108, GO, malate metabolic 1.023288707 6.87E08 62.46892211 27.71861586 process 4160 GLYMA04G09770 GO:0006810, GO, transport 1.067742926 9.20E06 7.225108449 2.785711064 4161 GLYMA04G11140 GO:0006810, GO, transport 1.034043016 0.000731927 3.411272197 0.667918747 4162 GLYMA04G12600 GO:0003824, GO, catalytic activity 1.311303393 8.14E10 40.34895396 12.12689444 4163 GLYMA04G12610 GO:0003824, GO, catalytic activity 1.283734962 9.78E06 1.652334971 0 4164 GLYMA04G17650 GO:0010193, GO, response to ozone 1.384727165 3.29E11 12.87039802 3.594465888 4165 GLYMA04G37530 GO:0008150, GO, biological_process 1.196382319 7.27E06 2.216290935 8.800660535 4166 GLYMA04G40700 NA 1.056299293 8.46E11 67.64119934 32.350193 4167 GLYMA04G40710 GO:0008150, GO, biological_process 1.564590555 2.15E18 24.55650356 7.278793424 4168 GLYMA04G40861 NA 1.006211746 7.60E06 19.61481513 7.146730595 4169 GLYMA04G41701 NA 1.201080148 1.28E05 5.170209424 1.247337714 4170 GLYMA05G03243 NA 1.226133282 7.41E08 14.53544951 5.476933727 4171 GLYMA05G22760 PF05678, PFAM, VQ motif 1.058133573 0.000138289 7.995169212 2.217489269 4172 GLYMA05G25920 GO:0008150, GO, biological_process 1.461542925 7.05E14 22.86618395 7.368655071 4173 GLYMA05G33340 GO:0008150, GO, biological_process 1.371586716 5.70E09 2.475076542 8.038398599 4174 GLYMA05G34760 GO:0010112, GO, regulation of systemic 1.093610202 3.89E08 18.28228693 8.348984339 acquired resistance 4175 GLYMA05G37690 GO:0006813, GO, potassium ion transport 1.152485783 4.56E13 64.84867276 29.1151737 4176 GLYMA06G02340 GO:0008150, GO, biological_process 1.000797368 1.73E07 50.90257732 23.63361322 4177 GLYMA06G10450 GO:0008150, GO, biological_process 1.442423906 2.55E11 10.54954485 2.771861586 4178 GLYMA06G10580 GO:0008150, GO, biological_process 1.333680454 9.34E11 13.65235216 3.774189183 4179 GLYMA06G13090 GO:0006355, GO, regulation of 1.099137285 0.000134501 7.195652291 2.938842487 transcription, DNA-dependent 4180 GLYMA06G14090 GO:0008150, GO, biological_process 1.147251562 5.98E13 143.6465402 58.94924057 4181 GLYMA06G45020 NA 1.262217964 3.80E15 53.83413936 18.7100657 4182 GLYMA06G45043 NA 1.138574305 3.09E10 3928.774615 8118.418788 4183 GLYMA07G06320 GO:0006355, GO, regulation of 1.006619206 2.17E07 33.46599312 13.89270994 transcription, DNA-dependent 4184 GLYMA07G11960 GO:0010200, GO, response to chitin 1.161974193 8.23E07 43.02133043 12.67049226 4185 GLYMA07G15800 GO:0008150, GO, biological_process 1.009903371 2.03E06 5127.965314 11633.54157 4186 GLYMA07G29730 GO:0006499, GO, N-terminal protein 1.193477886 7.29E05 2.437920029 0.400751248 myristoylation 4187 GLYMA08G01900 GO:0006813, GO, potassium ion transport 1.203154273 2.80E12 62.30901873 28.12669558 4188 GLYMA08G02580 GO:0006355, GO, regulation of 1.102088699 1.08E07 59.11095104 27.85221176 transcription, DNA-dependent 4189 GLYMA08G08360 GO:0006952, GO, defense response 1.107144375 4.96E05 6.556038754 1.870172492 4190 GLYMA08G10435 NA 1.27926219 6.52E06 1.305040358 4.642868156 4191 GLYMA08G11260 GO:0008150, GO, biological_process 1.031833196 3.58E09 51.55092715 23.63361322 4192 GLYMA08G16810 GO:0009061, GO, anaerobic respiration 1.153355774 1.13E09 32.75678002 14.02629369 4193 GLYMA08G17140 GO:0007275, GO, multicellular organismal 1.013378053 0.001635642 0.479710153 1.803380617 development 4194 GLYMA08G22630 GO:0009408, GO, response to heat 1.167051089 1.64E05 1.950336023 6.144852474 4195 GLYMA09G00720 GO:0008150, GO, biological_process 1.297617667 9.76E07 6.023027473 1.335837494 4196 GLYMA09G06840 NA 1.043842712 0.000230515 1.980061233 6.236688568 4197 GLYMA09G12440 GO:0008168, GO, methyltransferase 1.110391457 0.000138289 4.637198143 0.868294371 activity 4198 GLYMA09G21040 NA 1.129686949 0.000191718 3.015093242 0.449308236 4199 GLYMA09G30250 GO:0010200, GO, response to chitin 1.480411528 3.22E16 37.95040319 10.04799825 4200 GLYMA09G38930 GO:0009611, GO, response to wounding 1.114614822 3.43E05 5.809822961 2.00959965 4201 GLYMA09G41670 GO:0006355, GO, regulation of 1.282700181 1.93E09 17.21626437 5.127943934 transcription, DNA-dependent 4202 GLYMA10G04210 GO:0006355, GO, regulation of 1.021042996 1.99E05 9.380998542 4.672805655 transcription, DNA-dependent 4203 GLYMA10G22100 GO:0055114, GO, oxidation-reduction 1.184360983 7.75E05 1.595729473 0.179723294 process 4204 GLYMA10G37920 GO:0004497, GO, monooxygenase activity 1.440645295 3.88E10 13.27198089 3.339593736 4205 GLYMA10G39971 NA 1.199223405 2.01E05 5.223510552 1.87100657 4206 GLYMA10G44160 GO:0006355, GO, regulation of 1.469325378 1.70E11 28.40950127 8.549359964 transcription, DNA-dependent 4207 GLYMA11G06660 GO:0055114, GO, oxidation-reduction 1.013056688 6.65E05 40.40225509 14.96137994 process 4208 GLYMA11G13290 NA 1.186249968 1.08E06 34.87607854 13.47924708 4209 GLYMA11G13800 GO:0005975, GO, carbohydrate metabolic 1.212845405 8.71E11 32.35378475 12.62366432 process 4210 GLYMA11G13810 GO:0005975, GO, carbohydrate metabolic 1.025842415 0.000230184 5.330112808 2.204131866 process 4211 GLYMA11G16120 NA 1.343091922 6.61E11 16.52334971 4.313359066 4212 GLYMA11G21250 GO:0006468, GO, protein 1.06809702 0.000495067 2.77165866 0.718893178 phosphorylation 4213 GLYMA11G25670 GO:0010193, GO, response to ozone 1.137836997 1.03E05 8.634782749 2.695849416 4214 GLYMA11G33450 GO:0010200, GO, response to chitin 1.387745046 4.11E19 57.82678829 19.16926804 4215 GLYMA12G00460 GO:0006468, GO, protein 1.042089407 1.75E09 35.01739678 15.63592661 phosphorylation 4216 GLYMA12G00780 GO:0005975, GO, carbohydrate metabolic 1.075138028 0.000616457 0.443258187 1.536213118 process 4217 GLYMA12G01420 GO:0006952, GO, defense response 1.02645451 1.87E07 30.36318581 14.73731014 4218 GLYMA12G05770 GO:0005975, GO, carbohydrate metabolic 1.235797291 3.38E07 9.663028477 25.91524739 process 4219 GLYMA12G05800 GO:0005975, GO, carbohydrate metabolic 1.014997151 7.90E06 29.83592268 13.15799932 process 4220 GLYMA12G08020 GO:0006887, GO, exocytosis 1.088877462 8.78E06 7.18078263 2.494675427 4221 GLYMA12G09830 GO:0000289, GO, nuclear-transcribed 1.038592224 5.61E09 269.4683333 120.4146073 mRNA poly(A) tail shortening 4222 GLYMA12G12260 NA 1.305617284 9.36E18 48.29082204 15.69609056 4223 GLYMA12G15620 GO:0005975, GO, carbohydrate metabolic 1.21921729 2.12E08 28.83591029 10.41953246 process 4224 GLYMA12G36310 GO:0006814, GO, sodium ion transport 1.417198792 1.03E07 6.076328601 1.335837494 4225 GLYMA13G09690 GO:0006071, GO, glycerol metabolic 1.091584652 1.88E07 29.58212608 11.0874512 process 4226 GLYMA13G09840 GO:0006071, GO, glycerol metabolic 1.048336234 2.07E07 45.73236789 20.63868929 process 4227 GLYMA13G10010 GO:0006468, GO, protein 1.18204335 2.97E06 7.515459059 2.286785808 phosphorylation 4228 GLYMA13G19560 GO:0006355, GO, regulation of 1.2382138 5.37E07 6.870501899 2.078896189 transcription, DNA-dependent 4229 GLYMA13G22540 NA 1.055564007 1.97E08 31.66087008 13.47924708 4230 GLYMA13G35320 GO:0006952, GO, defense response 1.440915562 2.97E12 52.07520214 149.0804727 4231 GLYMA13G35710 GO:0008150, GO, biological_process 1.011655056 0.000625306 0.045001392 1.61750965 4232 GLYMA14G05710 PTHR10499:SF51, Panther, VON 1.079821764 0.000308777 1.935059842 0.138593079 WILLEBRAND FACTOR A3 4233 GLYMA14G06640 GO:0006979, GO, response to oxidative 1.215771987 1.16E08 20.25689915 6.791060885 stress 4234 GLYMA14G06900 GO:0009408, GO, response to heat 1.019854223 0.00021457 3.195098808 9.684821834 4235 GLYMA14G09571 NA 1.007062495 0.001249681 2.925090458 0.868294371 4236 GLYMA14G32430 GO:0009414, GO, response to water 1.002316095 1.01E06 10.62032843 22.59067192 deprivation 4237 GLYMA14G39300 GO:0010200, GO, response to chitin 1.134859314 4.96E09 71.15700599 29.02531205 4238 GLYMA14G39950 GO:0008150, GO, biological_process 1.057047859 1.33E08 19.72141739 7.553322821 4239 GLYMA15G11140 GO:0009651, GO, response to salt stress 1.008285337 1.31E05 28.83591029 14.15987744 4240 GLYMA15G13510 GO:0006979, GO, response to oxidative 1.4392098 9.46E11 19.88132077 5.543723171 stress 4241 GLYMA16G06520 GO:0008150, GO, biological_process 1.436684015 1.57E08 5.625173959 0.988478119 4242 GLYMA16G31401 NA 1.106530815 1.52E05 9.270286684 3.118344284 4243 GLYMA17G01530 GO:0008150, GO, biological_process 1.037614878 0.001129298 1.773032748 0.400751248 4244 GLYMA17G03340 GO:0006952, GO, defense response 1.220260866 1.01E10 372.1615091 135.9882569 4245 GLYMA17G05240 GO:0006355, GO, regulation of 1.407526282 2.79E13 17.00305986 5.8108931 transcription, DNA-dependent 4246 GLYMA17G11340 GO:0008150, GO, biological_process 1.27822077 1.25E09 20.03527005 7.368655071 4247 GLYMA17G11490 GO:0008150, GO, biological_process 1.298456505 3.81E06 3.411272197 0.623668857 4248 GLYMA17G35430 GO:0006979, GO, response to oxidative 1.083557924 1.71E10 130.7740442 53.1082335 stress 4249 GLYMA18G03066 NA 1.022521386 2.16E08 84.85539591 34.95618076 4250 GLYMA18G04770 GO:0010200, GO, response to chitin 1.328972157 1.26E22 78.45926054 28.58692238 4251 GLYMA18G20470 GO:0010193, GO, response to ozone 1.03304461 0.000267522 6.875845522 2.137339991 4252 GLYMA18G28830 GO:0015995, GO, chlorophyll biosynthetic 1.360956021 6.62E07 4.850402655 1.001878121 process 4253 GLYMA18G44030 GO:0006355, GO, regulation of 1.121912469 5.61E06 14.60450909 5.682316251 transcription, DNA-dependent 4254 GLYMA18G49158 NA 1.354034842 4.58E07 4.635143342 0.801502497 4255 GLYMA18G50691 NA 1.039325485 9.07E05 6.715942138 2.40450749 4256 GLYMA18G53250 GO:0008150, GO, biological_process 1.250925416 2.68E08 2.878260916 9.255749663 4257 GLYMA19G01440 GO:0009408, GO, response to heat 1.091071017 3.48E13 33.43603401 78.48045279 4258 GLYMA19G34490 NA 1.064397801 0.000164104 5.265162825 1.536213118 4259 GLYMA19G35740 GO:0006355, GO, regulation of 1.062085765 4.69E05 7.225108449 2.516126122 transcription, DNA-dependent 4260 GLYMA19G37161 NA 1.105970011 0.000101771 3.89098235 1.078339767 4261 GLYMA19G38570 GO:0010150, GO, leaf senescence 1.11397824 4.23E09 34.91223889 14.4677252 4262 GLYMA19G38590 GO:0010150, GO, leaf senescence 1.295108361 8.98E07 5.540727338 1.707371297 4263 GLYMA19G41410 GO:0005975, GO, carbohydrate metabolic 1.336821707 2.59E06 0.132977456 2.003756241 process 4264 GLYMA20G01170 GO:0006499, GO, N-terminal protein 1.124709392 4.41E06 6.715942138 2.156679533 myristoylation 4265 GLYMA20G03850 NA 1.027846502 0.000691549 4.05012525 1.247337714 4266 GLYMA20G25990 GO:0006499, GO, N-terminal protein 1.110406177 1.18E09 60.21186205 26.50918593 myristoylation 4267 GLYMA20G26600 GO:0006952, GO, defense response 1.008944076 7.29E07 46.74508933 17.03192805 4268 GLYMA20G27020 GO:0008150, GO, biological_process 1.092005979 2.85E10 42.46413432 18.10059805 4269 GLYMA20G35180 GO:0006355, GO, regulation of 1.034170042 9.83E09 21.94128026 9.751613708 transcription, DNA-dependent 4270 GLYMA03G37400 GO:0042545, GO, cell wall modification 1.646163821 2.88E09 0.213204512 2.426264 4271 GLYMA03G38840 GO:0005975, GO, carbohydrate metabolic 2.018195916 1.64E15 0.576235643 5.391699 process 4272 GLYMA07G15380 GO:0009693, GO, ethylene biosynthetic 1.14033694 9.07E05 0.900027833 4.133636 process 4273 GLYMA08G46450 GO:0005975, GO, carbohydrate metabolic 2.028493959 7.27E15 0.310280731 3.684328 process 4274 GLYMA09G35840 GO:0005975, GO, carbohydrate metabolic 3.395302467 6.40E68 1.152471286 24.89168 process 4275 GLYMA10G30340 GO:0008150, GO, biological_process 2.087505841 1.42E27 35.23204566 5.032252 4276 GLYMA11G02350 GO:0005975, GO, carbohydrate metabolic 2.628824882 2.44E30 1.012721434 13.47925 process 4277 GLYMA12G01510 GO:0005975, GO, carbohydrate metabolic 3.161170918 8.63E48 0.5400167 13.1198 process 4278 GLYMA13G30440 GO:0008150, GO, biological_process 2.347970113 7.37E22 7.195652291 0.467543 4279 GLYMA15G07700 PF00264, PFAM, Common central domain 0.824086029 0.018602054 3.102807309 19.05067 of tyrosinase 4281 GLYMA17G08400 GO:0006032, GO, chitin catabolic process 2.054291387 1.57E22 16.26757546 2.066818 4283 GLYMA17G14890 GO:0006869, GO, lipid transport 1.278386816 1.57E08 25.8419523 62.159 4284 GLYMA18G47390 GO:0009611, GO, response to wounding 2.306445262 6.24E19 3.900672046 0.089862 4285 GLYMA18G53440 GO:0008150, GO, biological_process 0.105360923 0.992007499 16.84315647 19.54162
The genes described in this table show significant (fdr adjusted p-value <=0.05) differences in expression in soybean seedlings treated with a Acremonium zea sp. with beneficial effects on soybean growth and soybean seedlings treated with a formulation (Beneficial v Formulation). Median Exp. Beneficial and Median Exp. Formulation represent the median expression value in cpm across biological replicates of soy seedlings treated with the beneficial Acremonium and formulation, respectively. Log FC represents the estimate of the log 2-fold-change of the contrast. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
(498) TABLE-US-00036 TABLE 501 This table shows the genes that are up-regulated (positive log FC) or down-regulated (negative log FC) in soybean as a result of treatment with a beneficial endophyte, as compared to a soybean treated with a reference microorganism. Median Exp. Median Exp. SEQ ID Gene Annotation log FC Adj. p-value Neutral Beneficial 4162 GLYMA04G12600 GO:0003824, GO, catalytic activity 1.206357 9.85E08 13.26698 40.34895 4201 GLYMA09G41670 GO:0006355, GO, regulation of transcription, DNA- 1.221864 1.58E06 5.909453 17.21626 dependent 4153 GLYMA03G36330 GO:0009870, GO, defense response signaling pathway, 0.856536 0.000672 6.648135 14.35544 resistance gene-dependent 4253 GLYMA18G44030 GO:0006355, GO, regulation of transcription, DNA- 0.998764 0.001135 5.793248 14.60451 dependent 4181 GLYMA06G45020 NA 0.657628 0.003708 31.22163 53.83414 4195 GLYMA09G00720 GO:0008150, GO, biological_process 0.90306 0.003708 2.788204 6.023027 4206 GLYMA10G44160 GO:0006355, GO, regulation of transcription, DNA- 0.819527 0.009033 13.67119 28.4095 dependent 4269 GLYMA20G35180 GO:0006355, GO, regulation of transcription, DNA- 0.663267 0.009033 13.62622 21.94128 dependent 4167 GLYMA04G40710 GO:0008150, GO, biological_process 0.829353 0.010992 12.55759 24.5565 4140 GLYMA02G40990 GO:0010200, GO, response to chitin 0.795223 0.01505 17.04244 34.59243 4183 GLYMA07G06320 GO:0006355, GO, regulation of transcription, DNA- 0.748416 0.015784 18.20323 33.46599 dependent 4142 GLYMA02G45420 GO:0006508, GO, proteolysis 0.894101 0.016107 21.73835 51.01902 4199 GLYMA09G30250 GO:0010200, GO, response to chitin 0.819331 0.017054 15.30126 37.9504 4250 GLYMA18G04770 GO:0010200, GO, response to chitin 0.787911 0.019874 39.88881 78.45926 4213 GLYMA11G25670 GO:0010193, GO, response to ozone 0.897841 0.02031 3.00749 8.634783 4150 GLYMA03G34780 GO:0006979, GO, response to oxidative stress 0.91553 0.022156 2.078494 0.576236 4222 GLYMA12G12260 NA 0.730565 0.02231 26.27596 48.29082 4184 GLYMA07G11960 GO:0010200, GO, response to chitin 0.881315 0.026957 16.19823 43.02133 4131 GLYMA01G43420 GO:0006355, GO, regulation of transcription, DNA- 0.792195 0.0384 11.50233 22.27987 dependent 4223 GLYMA12G15620 GO:0005975, GO, carbohydrate metabolic process 0.802313 0.040823 13.75344 28.83591 4270 GLYMA03G37400 GO:0042545, GO, cell wall modification 0.166032 NA 0.052762975 0.213204512 4271 GLYMA03G38840 GO:0005975, GO, carbohydrate metabolic process 0.91714 0.022324 1.793941164 0.576235643 4272 GLYMA07G15380 GO:0009693, GO, ethylene biosynthetic process 0.727432 0.132533 0.265339603 0.900027833 4273 GLYMA08G46450 GO:0005975, GO, carbohydrate metabolic process 0.44339 0.684951 0.844207607 0.310280731 4274 GLYMA09G35840 GO:0005975, GO, carbohydrate metabolic process 1.28626 1.70E05 4.047392811 1.152471286 4275 GLYMA10G30340 GO:0008150, GO, biological_process 0.531076 0.317217 17.04402084 35.23204566 4276 GLYMA11G02350 GO:0005975, GO, carbohydrate metabolic process 0.39592 0.826706 1.636260886 1.012721434 4277 GLYMA12G01510 GO:0005975, GO, carbohydrate metabolic process 0.84175 0.059336 1.503591084 0.5400167 4278 GLYMA13G30440 GO:0008150, GO, biological_process 0.559495 0.472633 2.564949496 7.195652291 4279 GLYMA15G07700 PF00264, PFAM, Common central domain of tyrosinase 0.458456 0.694846 1.618957124 3.102807309 4280 GLYMA15G12600 GO:0006869, GO, lipid transport 0.833553 0.064382 3.165778525 12.27825178 4281 GLYMA17G08400 GO:0006032, GO, chitin catabolic process 0.945666 0.000294 6.191257405 16.26757546 4282 GLYMA17G14860 GO:0006869, GO, lipid transport 0.776484 0.105214 5.711320967 15.77999146 4283 GLYMA17G14890 GO:0006869, GO, lipid transport 0.617561 0.305278 10.76364699 25.8419523 4284 GLYMA18G47390 GO:0009611, GO, response to wounding 1.018065 0.000747 1.618957124 3.900672046 4285 GLYMA18G53440 GO:0008150, GO, biological_process 2.04965 6.81E35 91.12165855 16.84315647
This table describes soybean genes differentially expressed in soybean seedlings treated with an Acremonium zea sp. with neutral effects on soybean growth and soybean seedlings treated with an Acremonium zea sp. with beneficial effects on soybean growth. Median Exp. Neutral and Median Exp. Beneficial represent the median expression value in cpm across biological replicates of soy seedlings treated with the neutral Acremonium and beneficial Acremonium, respectively. Log FC represents the estimate of the log 2-fold-change of the contrast. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
(499) TABLE-US-00037 TABLE 502 This table describes gene ontology terms which are significantly enriched or depleted in the set of genes differently expressed between soybean seedlings treated with an Acremonium zea sp. with neutral effects on soybean growth and soybean seedlings treated with a Acremonium zea sp. with beneficial effects on soybean growth. GO ID GO Description Gene ID SEQ ID GO: 0000014 single-stranded GLYMA15G07430, GLYMA15G07430 4286; 4286 DNA specific endodeoxyribonuclease activity GO: 0003700 sequence-specific GLYMA03G34730, GLYMA03G41750, GLYMA05G32040, 4288; 4295; 4292; 4296; 4297; 4201; DNA binding GLYMA06G11700, GLYMA08G16190, GLYMA09G41670, 4298; 4299; 4300; 4301; 4302; 4303; transcription factor GLYMA13G21350, GLYMA19G37410, GLYMA19G40650, 4304; 4305; 4288; 4306; 4292; 4307; activity GLYMA0041S00350, GLYMA01G41520, GLYMA01G44230, 4308; 4297; 4309; 4310; 4298; 4311; GLYMA02G00290, GLYMA03G33070, GLYMA03G34730, 4312; 4313; 4314; 4299; 4131; 4148; GLYMA04G35380, GLYMA05G32040, GLYMA06G20400, 4305; 4158; 4174; 4315; 4316; 4179; GLYMA08G14320, GLYMA08G16190, GLYMA08G18470, 4183; 4188; 4308; 4193; 4317; 4201; GLYMA13G18400, GLYMA13G21350, GLYMA15G00570, 4318; 4202; 4206; 4319; 4310; 4228; GLYMA17G06610, GLYMA18G43580, GLYMA19G34740, 4311; 4320; 4245; 4248; 4253; 4259; GLYMA19G37410, GLYMA01G43420, GLYMA03G05220, 4321; 4269 GLYMA03G33070, GLYMA04G04760, GLYMA05G34760, GLYMA05G36970, GLYMA06G04840, GLYMA06G13090, GLYMA07G06320, GLYMA08G02580, GLYMA08G14320, GLYMA08G17140, GLYMA09G08330, GLYMA09G41670, GLYMA10G04190, GLYMA10G04210, GLYMA10G44160, GLYMA13G17250, GLYMA13G18400, GLYMA13G19560, GLYMA15G00570, GLYMA15G19910, GLYMA17G05240, GLYMA17G35430, GLYMA18G44030, GLYMA19G35740, GLYMA19G35770, GLYMA20G35180 GO: 0003950 NAD+ ADP- GLYMA04G35560 4289 ribosyltransferase activity GO: 0004222 metalloendopeptidase GLYMA01G41750, GLYMA01G04350 4290; 4287 activity GO: 0006308 DNA catabolic GLYMA15G07430, GLYMA01G20900, GLYMA15G07430, 4286; 4322; 4286; 4322 process GLYMA01G20900 GO: 0006879 cellular iron ion GLYMA13G27300, GLYMA13G27300 4291; 4291 homeostasis GO: 0006970 response to osmotic GLYMA05G32040, GLYMA09G41670, GLYMA05G32040, 4292; 4201; 4292; 4148; 4201; 4253 stress GLYMA03G05220, GLYMA09G41670, GLYMA18G44030 GO: 0008237 metallopeptidase GLYMA01G41750, GLYMA01G04350 4290; 4287 activity GO: 0008270 zinc ion binding GLYMA01G41750, GLYMA01G04350, GLYMA03G33070, 4290; 4287; 4305; 4335; 4305; 4154; GLYMA09G26100, GLYMA03G33070, GLYMA03G42390, 4158; 4159; 4316; 4206; 4228; 4248; GLYMA04G04760, GLYMA04G09110, GLYMA06G04840, 4259; 4321 GLYMA10G44160, GLYMA13G19560, GLYMA17G35430, GLYMA19G35740, GLYMA19G35770 GO: 0009611 response to GLYMA06G45240, GLYMA06G45280, GLYMA06G45370, 4293; 4323; 4324; 4325; 4326; 4327; wounding GLYMA06G45410, GLYMA12G32750, GLYMA13G37720, 4328; 4284; 4329; 4293; 4324; 4325; GLYMA13G37770, GLYMA18G47390, GLYMA01G41290, 4326; 4330; 4331; 4332; 4327; 4333; GLYMA06G45240, GLYMA06G45370, GLYMA06G45410, 4328; 4311; 4334; 4284; 4158; 4316; GLYMA12G32750, GLYMA13G23680, GLYMA13G35820, 4200; 4221; 4311; 4248; 4284 GLYMA13G35850, GLYMA13G37720, GLYMA13G37750, GLYMA13G37770, GLYMA15G00570, GLYMA18G06810, GLYMA18G47390, GLYMA04G04760, GLYMA06G04840, GLYMA09G38930, GLYMA12G09830, GLYMA15G00570, GLYMA17G35430, GLYMA18G47390 GO: 0010120 camalexin GLYMA03G05220, GLYMA09G41670, GLYMA18G44030 4148; 4201; 4253 biosynthetic process GO: 0016891 endoribonuclease GLYMA15G07430, GLYMA15G07430 4286; 4286 activity, producing 5- phosphomonoesters GO: 0034605 cellular response to GLYMA03G05220, GLYMA09G41670, GLYMA18G44030 4148; 4201; 4253 heat GO: 0043765 T/G mismatch- GLYMA15G07430, GLYMA15G07430 4286; 4286 specific endonuclease activity GO: 0046592 polyamine oxidase GLYMA10G11700, GLYMA10G11700 4294; 4294 activity GO: 0050660 flavin adenine GLYMA04G12600, GLYMA10G11700, GLYMA10G11700, 4162; 4294; 4294; 4336; 4162; 4163; 4336 dinucleotide binding GLYMA19G44870, GLYMA04G12600, GLYMA04G12610, GLYMA19G44870 GO: 0070370 cellular heat GLYMA03G05220, GLYMA09G41670, GLYMA18G44030 4148; 4201; 4253 acclimation GO: 0071369 cellular response to GLYMA13G27300, GLYMA13G27300 4291; 4291 ethylene stimulus GO: 0071732 cellular response to GLYMA13G27300, GLYMA13G27300 4291; 4291 nitric oxide GO: 0072593 reactive oxygen GLYMA04G35560 4289 species metabolic process
Genome count represents the number of genes associated with the GO term that were found in the soybean genome. Observed DEG count represents the number of genes associated with the GO term that were differentially expressed in the Neutral v Beneficial contrast. Expected DEG count represents the number of genes associated with the GO term that are expected to be found by chance in a random set selection of that number of genes. Status represents whether genes with the GO term are over or under-represented in the set of DEGs. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
(500) Genes that are modulated in soybean in response to treatment with a beneficial endophyte include those involved in a variety of plant processes, such as plant defense (including responses to chitin and wounding), stress responses (including salt stress, water deprivation, cold, ozone, heat, osmotic), defense against oxidative stress (oxidation-reduction process, monooxygenase activity, oxidation-reduction process, ion binding, nitric oxide). For example, expression of genes involved in the following processes were modulated: cell wall modification, defense response, oxidation-reduction process, biological process, regulation of transcription, metabolic process, glucosinolate biosynthetic process, response to karrikin, protein phosphorylation, protein folding, response to chitin, proteolysis, response to auxin stimulus, DNA-dependent regulation of transcription, N-terminal protein myristoylation, response to oxidative stress, cellular component, leaf senescence, resistance gene-dependent defense response signaling pathway, zinc ion binding, response to cold, malate metabolic process, transport, catalytic activity, response to ozone, VQ motif, regulation of systemic acquired resistance, potassium ion transport, anaerobic respiration, multicellular organismal development, response to heat, methyltransferase activity, response to wounding, oxidation-reduction process, monooxygenase activity, oxidation-reduction process, carbohydrate metabolic process, exocytosis, nuclear-transcribed mRNA poly(A) tail shortening, sodium ion transport, glycerol metabolic process, response to water deprivation, response to salt stress, and chlorophyll biosynthetic process.
Example 6: Functional Characterization of Endophytes (Microbe RNA-SEQ Experiments)
(501) This Example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example provides exemplary characterization of modulations in a beneficial endophyte's transcriptome in response to host plant interactions, as compared to transcriptome changes in the transcriptome of a neutral (e.g., non-beneficial and non-pathogenic) microbe of the same genus.
(502) RNA sequencing was used to explore differences in mRNA expression of genes common to the two strains of Acremonium zeae.
(503) Among other things, this Example describe the ability of host plants (e.g., host plants described herein, e.g., dicots, e.g., soy, peanuts, and monocots, e.g., corn, soy, wheat, cotton, sorghum) to differentially modulate the transcriptome of a beneficial endophyte as compared to the transcriptome of a neutral microbe of the same genus. This Example describes surprising and unexpected modulations in the transcriptome of a beneficial endophyte in response to whole plant homogenate, compared to a neutral fungal strain of the same genus.
(504) In particular, this Example describes an exemplary transcriptomic comparison between the functional capacity of a beneficial fungal endophyte genome and the genome of a neutral fungal microbe of the same genus. Briefly, each set of microbial predicted genes was annotated with pathway and orthologous group information from the KEGG database. Pathways and ortholog groups appearing in one genome but not the other were extracted and manually explored for biological relevance to the phenotype differences.
(505) Fungal Biomass
(506) Beneficial (SYM00577) and neutral (SYM00300) fungal strains of Acremonium zeae were initially streaked onto PD agar and incubated at room temperature until colony formation. Distinct plugs consisting of spores and mycelia were used to inoculate 125 mL PD broth and cultured for 5 days at room temperature with agitation (200 RPM). Each strain was grown in three biological replicates in duplicates totaling 12 flasks.
(507) On day 5 of culture, 1 mL of total plant homogenate obtained from 6 day old soybean seedlings extracted with 50 mM Phosphate-buffered saline (PBS) at a ratio of 2 mL buffer/gram plant mass was added to the fungi. The plant homogenate solution was prepared in three replicates, and each replicate was applied to the corresponding beneficial and neutral fungal cultures. One mL of PBS solution was applied to each fungal biological replicate as the negative control.
(508) Fungal biomass was harvested 24 hours after the addition of either the plant homogenate or PBS only solutions by centrifuging at 4500 RPM for 20 minutes in 50 mL Falcon tubes to allow culture separation prior to the removal of supernatant. Fungal tissues were stored immediately in 80 C. until total RNA isolation using standard extraction method using TriReagent (Sigma-Aldrich, St. Louis, Mo., USA) and purification with RNeasy Mini Kit (Qiagen, Hilden, Germany).
(509) Fungal RNA-SEQ
(510) Initial quality control was performed using Agilent Bioanalyzer and Tapestation.
(511) rRNA Depletion
(512) 1 g of total RNA was subjected to rRNA depletion using the RiboZero Yeast kit (Epicentre Biotechnologies, Illumina.com, catalog # MRZY1306). Manufacturer's instructions were strictly followed to perform rRNA depletion.
(513) Stranded cDNA Preparation
(514) After rRNA depletion, depletedRNA was used to generate 1-2 ug of cDNA using: Illumina TruSeq Stranded Total RNA LT kit (Illumina.com, catalog # RS-122-2201). Manufacturer's instructions were strictly followed to perform cDNA construction; and library construction.
(515) RNA Sequencing
(516) Sequencing was performed on an Illumina HiSeq 2500, using Rapid run v2.0 chemistry which generated paired-end reads of 106 nucleotides according to Illumina manufacturer's instructions. The initial data analysis was started directly on the HiSeq 2500 System during the run. The HiSeq Control Software 2.2.58 in combination with RTA 1.18.64 (real time analysis) performed the initial image analysis and base calling. In addition, bcl2fastq1.8.4 generated and reported run statistics. Data was analyzed using FASTQC (Babraham Institute, Cambridge, UK) comprising the sequence information which was used for all subsequent bioinformatics analyses. Sequences were de-multiplexed according to the 6 bp index code with 1 mismatch allowed.
(517) Analysis
(518) Expression levels for each gene were quantified as transcripts per million (TPM) using Cufflinks. The Blast Best Reciprocal Hits (BRH) method was used to define orthologous groups for similar gene pairs across species. Expression was mapped directly to BRH groups to create an expression matrix and the limma method was used to uncover genes (1) differentially expressed with vs without plant homogenate within each species, (2) differentially expressed across species within each plant homogenate condition, and (3) responding differently to plant homogenate in the different species. The false discovery rate method was used to adjust p-values for multiple testing. In each case, significance was defined as adjusted p-value less than 0.05 and absolute log 2 fold change greater than 2.
(519) Functional and Comparative Genomics
(520) Prior to applying differential expression analysis, the functional capabilities of a beneficial and neutral Acremonium zeae, i.e., SYM00577 (beneficial) and SYM00300 (neutral), were contrasted at the gene function (GO) and pathway level. A shared goal of both the genome comparison and the transcriptome analyses was the construction of orthologous groups. In the case of comparative genomics, annotations of these orthologs provided an overview of shared capabilities, while for RNA-seq they provided anchors for comparison of expression data; i.e. rows in the expression matrix.
(521) Differential KEGG Orthology Groups
(522) The unique and shared orthology group (OG) terms were counted for SYM00577 and SYM00300. Most KO terms were shared by both strains, with 62 terms found in SYM00300 only, and 207 terms found in SYM00577 only, with 2,676 KO terms overlapping between both strains. This process was repeated for KEGG Pathways, and the total and shared number of pathways was again similar, with 324 of the pathways shared between strains. Unique pathways in SYM00577 that were not present in SYM00300, include, but are not limited to, indole diterpene alkaloid biosynthesis, biosynthesis of 12-, 14- and 16-membered macrolides, peptidoglycan biosynthesis, glycosphingolipid biosynthesislacto and neolacto series, indole alkaloid biosynthesis, type I polyketide structures, biosynthesis of siderophore group nonribosomal peptides, beta-Lactam resistance, sphingolipid signaling pathway, Vibrio cholera pathogenic cycle, central carbon metabolism in cancer, choline metabolism in cancer, and nicotinate and nicotinamide metabolism. Exemplary KEGG Pathway differences for SYM00577 are illustrated below in Table 600.
(523) TABLE-US-00038 TABLE 600 Exemplary KEGG Pathways present in SYM0577, but absent in SYM0300 Number KEGG Term KEGG Term Description of Genes ko00403 Indole diterpene alkaloid biosynthesis 1 ko00522 Biosynthesis of 12-, 14- and 1 16-memebered macrolides ko00550 Peptidoglycan biosynthesis 2 ko00601 Glycosphingolipid biosynthesis - 1 lacto and neolacto series ko00901 Indole alkaloid biosynthesis 1 ko01052 Type I polyketide structures 1 ko01053 Biosynthesis of siderophore 2 group nonribosomal peptides ko01501 Beta-Lactam resistance 7 ko04071 Sphingolipid signaling pathway 46 ko05111 Vibrio cholera pathogenic cycle 1 ko05230 Central carbon metabolism in cancer 29 ko05231 Choline metabolism in cancer 30
In the above example, the Sphingolipid signaling pathway included 46 genes. To determine whether all of the genes (i.e., orthologous groups) in the pathway were unique to only SYM00577, a query was performed to determine which of the Sphingolipid pathway genes in SYM00577 do not share any KEGG OG terms with SYM00300 genes.
(524) Interestingly, even though the Sphingolipid Signaling Pathway annotation is attached to 46 genes in SYM00577 but no genes in SYM00300, only one orthologous group from that pathway (sphingomyelin phosphodiesterase, annotating 4 genes) is not present in SYM300.
(525) Unique pathways in SYM00300 that were not present in SYM00577, include, but are not limited to, beta-Lactam resistance, DDT degradation, Flavone and flavonol biosynthesis, and ECM-receptor interaction. Exemplary KEGG Pathway differences for SYM00300 are illustrated below in Table 700.
(526) TABLE-US-00039 TABLE 601 Exemplary KEGG Pathways present in SYM0300, but absent in SYM0577 KEGG Term KEGG Term Description Number of Genes ko00312 Beta-Lactam resistance 4 ko00351 DDT degradation 3 ko00944 Flavone and flavonol biosynthesis 1 ko04512 ECM-receptor interaction 2
(527) Blast Best Reciprocal Hits (BBRH)
(528) The NCBI Blast+ software was installed and used to build blast databases from each set of amino acid sequences, then each transcriptome was blasted against the database created from the other. Best Reciprocal Hits (BRH) were calculated by filtering for high percent identity, gathering the best hits, and joining the targets from one output with the queries from the other. The result was a query-target-reciprocal trio, which was filtered for trios where the query was the same as its reciprocal. The e-value and bitscores from the two blast outputs were averaged (since they are asymmetric) for the BRH pairs, and an ortholog group identifier was created.
(529) Calculation of in-Paralogs
(530) In-paralogs are paralogs that are the result of speciation first, then duplication of the genes later. In-paralogs are more likely to retain the same function as the ortholog than out-paralogs, which represent duplication, followed by speciation. Considering the high proportion of SYM00300 genes that have BRH orthologs, along with the realization that SYM00577 has nearly twice as many transcripts, we considered the possibility of a major genome duplication event somewhere in the phylogenetic history of SYM00577, and extended the orthologous groups to include in-paralogs.
(531) An important step after BRH is, for each orthologous pair, to include same-species genes more similar to each member of the pair than the cross-species ortholog similarity. This was accomplished using all-versus-all Blast within the same species, to expand our orthologous groups.
(532) Another approach to building ortholog groups was to apply a threshold to the same-species hits for each member of the ortholog pairs. To find the best threshold, we explored the distribution of scores in these BRH/same-species tables described above, normalizing by the ortholog score.
(533) RNA-SEQ Cross-Species Comparison
(534) RNA-seq cufflinks FPKM values were generated for two species of fungus (Acremonium zeae), with three biological replicates each. An expression matrix was built using orthologouos groups, to explore the structure of the data, characterize data quality, and to elucidate pathway-level expression differences between SYM00577 and SYM00300.
(535) TABLE-US-00040 TABLE 602 Median Median SEQ ID SYM577 SEQ ID SYM300 Exp. Exp. t- Adj. p- SYM00577 gene SYM00300 gene Description SYM00577 SYM00300 Log FC B-statistic statistic value 694 g3058.t1 2499 g1604.t1 0 5.625962 5.651891 7.35527 14.19007 8.51E06 695 g3790.t1 2501 g2628.t1 K12486: SMAP 0 6.121031 5.983809 6.039604 11.33524 1.91E05 681 g4581.t1 3296 g4123.t1 K00574: E2.1.1.79, cfa 0.511902 7.31261 7.115847 5.836125 10.97939 2.24E05 682 g9772.t1 3297 g936.t1 K06874: K06874 1.832874 7.06298 5.150347 5.58339 10.56106 2.71E05 1454 g3066.t1 2510 g11773.t1 0 4.229364 4.33707 5.111231 9.840967 4.33E05 1455 g2768.t1 3298 g9143.t1 K03937: NDUFS4 0 3.159447 3.192054 5.100931 9.826062 4.35E05 1456 g21086.t1 2530 g6575.t1 6.213302 0 6.32587 4.86651 9.49529 5.53E05 1457 g13116.t1 2518 g7771.t1 0 4.229765 4.831879 4.862002 9.489083 5.54E05 1458 g900.t1 3299 g9375.t1 0 2.925165 2.991998 4.824313 9.437402 5.73E05 693 g2076.t1 2498 g2520.t1 3.957232 13.01167 9.729519 4.68583 9.250787 6.67E05 1459 g5141.t1 3300 g3839.t1 K06662: HRAD17, 1.158624 7.175348 6.392146 4.57545 9.105599 7.49E05 RAD24 1460 g10898.t1 2515 g5903.t1 0 2.733166 2.603795 4.241238 8.683922 0.000107 1461 g19933.t1 3301 g3124.t1 K10885: XRCC5, KU80, 0 2.454643 2.568635 4.162803 8.588628 0.000116 G22P2 685 g6380.t1 2492 g764.t1 K05857: PLCD 3.201415 9.359327 5.628694 3.892588 8.270189 0.000152 689 g849.t1 2496 g9453.t1 K06997: K06997 2.698993 7.96329 5.067599 3.750578 8.108628 0.000171 1462 g156.t1 3302 g5221.t1 0 2.981748 2.98057 3.513183 7.846843 0.000215 1463 g10541.t1 3303 g6687.t1 K17862: PPOC 0 2.880335 2.956642 3.496903 7.829254 0.000219 1464 g15671.t1 3304 g6482.t1 K11771: SWI1, ADR6 0 2.123699 2.319853 3.367017 7.690534 0.000246 1465 g5602.t1 2531 g7524.t1 K14774: UTP25, DEF 0 4.214818 5.146089 3.215759 7.532472 0.000282 1466 g4223.t1 3305 g1757.t1 2.289499 7.236816 5.448174 3.206971 7.523401 0.000284 684 g2536.t1 3306 g3569.t1 9.671862 2.518007 7.85736 3.098463 7.41238 0.000316 1467 g8228.t1 3307 g10052.t1 K01674: cah 5.638975 1.15932 4.58017 2.941341 7.25475 0.000366 1468 g10616.t1 3308 g4156.t1 K15562: BUR1, SGV1 0 4.260933 4.233331 2.939239 7.252662 0.000366 1469 g10359.t1 3309 g7715.t1 2.199706 9.30437 7.40778 2.907247 7.221016 0.000378 1470 g12048.t1 3310 g810.t1 0.205106 6.22836 5.696498 2.79987 7.11586 0.000412 1471 g7057.t1 3311 g6310.t1 K05610: UCHL5, UCH37 2.367427 6.390825 4.178102 2.772937 7.089735 0.000422 680 g1340.t1 2553 g523.t1 0 5.30819 5.122003 2.739527 7.057466 0.000434 1472 g5411.t1 3312 g8610.t1 0 5.724304 5.482331 2.691237 7.011091 0.000454 1474 g2755.t1 3314 g9155.t1 K13106: BUD13, 0 2.648734 2.611976 2.63723 6.959594 0.000475 CWC26 1473 g9212.t1 3313 g11325.t1 K03380: E1.14.13.7 0.695829 8.890455 7.737352 2.638623 6.960917 0.000475 1475 g7541.t1 3315 g7266.t1 K01230: MAN1 0.593738 3.991249 3.523245 2.589692 6.914582 0.000494 1476 g10543.t1 3316 g6689.t1 K11866: STAMBP, 0 2.512821 2.348519 2.557397 6.88417 0.000506 AMSH 1477 g1098.t1 3317 g4042.t1 0 8.363912 7.407417 2.550651 6.877834 0.000509 1478 g5757.t1 3318 g5200.t1 K16261: YAT 2.629263 6.731656 4.004055 2.491406 6.822441 0.000533 1479 g6616.t1 3319 g11275.t1 K00128: E1.2.1.3 14.15644 4.764987 7.9496 2.391867 6.73036 0.000579 676 g7741.t1 2557 g7091.t1 7.176506 3.981694 3.40286 2.312767 6.65805 0.000618 1480 g3094.t1 3320 g11797.t1 K02155: ATPeV0C, 0.181741 4.905207 4.139345 2.177837 6.536419 0.000699 ATP6L 1481 g4793.t1 3321 g3693.t1 0.802943 6.094219 5.125954 2.035034 6.409958 0.00079 1482 g4553.t1 3322 g4081.t1 1.09266 4.629 3.630404 1.987031 6.367956 0.000827 1483 g2790.t1 3323 g5023.t1 2.621767 6.913986 4.339207 1.945501 6.331819 0.000856 1484 g12353.t1 3324 g12077.t1 7.044527 1.163008 6.15638 1.883313 6.27805 0.0009 1485 g9391.t1 2535 g3643.t1 K12821: PRPF40, PRP40 3.337644 7.951706 4.079618 1.87347 6.269579 0.000908 1486 g501.t1 2522 g5516.t1 K11713: PGTB1 0.17786 7.158208 5.970183 1.860221 6.25819 0.000918 1487 g4315.t1 3325 g1973.t1 K00507: SCD, desC 2.439884 8.285639 5.723788 1.809797 6.215014 0.000956 1488 g9843.t1 3326 g9771.t1 K00799: GST, gst 8.277156 1.535981 6.40337 1.808206 6.21366 0.000956 1489 g11092.t1 3327 g7982.t1 2.025136 6.798845 4.871183 1.802892 6.209122 0.000958 1490 g11703.t1 3328 g6616.t1 K01785: galM, GALM 5.853172 0.587191 5.06599 1.752712 6.16645 0.001006 1491 g11062.t1 3329 g1580.t1 0 8.467134 6.867295 1.691984 6.115148 0.001064 1492 g13143.t1 3330 g4290.t1 K10878: SPO11 0 2.383986 2.169112 1.68932 6.112906 0.001065 1493 g10366.t1 2548 g5460.t1 0 4.099839 3.972778 1.675269 6.101093 0.001078 1494 g9622.t1 3331 g7240.t1 K01648: ACLY 0 2.029549 2.402941 1.580259 6.02172 0.00118 677 g13489.t1 2556 g8733.t1 4.049293 1.53096 2.39019 1.568038 6.01157 0.001191 1495 g11681.t1 3332 g10864.t1 K01081: E3.1.3.5 2.030435 5.800198 3.546964 1.557877 6.003149 0.001197 1496 g13112.t1 3333 g7720.t1 0 2.5721 2.197403 1.547012 5.99415 0.001208 1497 g6237.t1 2500 g7135.t1 4.217621 11.98228 7.390343 1.524373 5.975438 0.00123 1498 g5325.t1 2546 g2235.t1 K17794: TIM23 5.393638 9.737867 4.665515 1.490748 5.947736 0.001262 1499 g7356.t1 3334 g10411.t1 5.363476 2.004245 4.00808 1.46351 5.92537 0.001296 1500 g502.t1 2516 g5517.t1 6.13678 0.881592 5.04567 1.401059 5.87436 0.001355 1501 g8003.t1 3335 g3392.t1 1.075006 6.028587 4.451645 1.395621 5.869934 0.001362 691 g5563.t1 2493 g7478.t1 4.683265 9.926473 4.734657 1.388209 5.863907 0.00137 1502 g973.t1 3336 g8044.t1 K12733: PPIL1 0 4.446627 4.444962 1.37841 5.855946 0.001379 1503 g9616.t1 3337 g7246.t1 0 3.761644 3.227741 1.346391 5.829996 0.001416 1504 g2349.t1 3338 g9226.t1 K10865: MRE11 5.092776 8.748668 3.95033 1.335801 5.821433 0.001427 1505 g2683.t1 2507 g4140.t1 5.881648 1.482684 3.92467 1.322012 5.8103 0.001445 1506 g3045.t1 2533 g1615.t1 3.526626 10.01023 6.461973 1.267461 5.766418 0.00152 1507 g2056.t1 3339 g2541.t1 0 2.16783 2.561107 1.216459 5.725628 0.001583 521 g11059.t1 2317 g2900.t1 K01074: PPT 0 3.417929 3.812645 1.160246 5.680931 0.001668 1508 g7593.t1 3340 g7644.t1 K10577: UBE2I, UBC9 5.000466 0 4.49434 1.150461 5.67318 0.001683 1509 g1121.t1 3341 g220.t1 0.238182 9.960466 8.035072 1.140622 5.665391 0.00169 1510 g13554.t1 3342 g4591.t1 0 7.155818 7.18618 1.13793 5.663262 0.001694 1511 g10068.t1 3343 g4260.t1 3.254602 6.373357 2.860288 1.096613 5.630659 0.001757 1512 g3061.t1 3344 g11768.t1 0 2.736145 2.449758 1.082316 5.619411 0.001776 1513 g7120.t1 3345 g5585.t1 K01537: E3.6.3.8 6.177509 2.088352 4.42526 1.079268 5.61702 0.001776 1514 g1980.t1 3346 g6240.t1 4.780929 1.696677 3.47296 1.055478 5.59834 0.001816 1515 g15450.t1 3347 g6505.t1 0 3.663174 4.662175 1.041385 5.587303 0.001837 1516 g10937.t1 3348 g9861.t1 3.34381 8.292693 5.149782 1.007277 5.560652 0.001901 1517 g2104.t1 3349 g2481.t1 0 8.858449 6.876201 0.947423 5.514113 0.00201 1518 g1101.t1 3350 g4046.t1 0 4.4026 5.770884 0.936128 5.505363 0.002025 678 g2539.t1 2558 g3572.t1 2.326788 6.873537 4.818842 0.882431 5.463904 0.002121 1519 g3140.t1 3351 g5042.t1 0 2.321166 2.269216 0.871446 5.45545 0.002145 1520 g5369.t1 3352 g9557.t1 3.908588 6.910264 3.013639 0.855938 5.443533 0.002178 1521 g12261.t1 3353 g7374.t1 K00480: E1.14.13.1 0 8.154209 8.090694 0.846077 5.435964 0.002195 1522 g9519.t1 3354 g6593.t1 K03126: TAF12 0 9.766076 7.663496 0.828036 5.422137 0.002231 686 g857.t1 2491 g9451.t1 K01950: E6.3.5.1, 3.88692 0.53345 3.15682 0.77121 5.37875 0.002339 NADSYN1, QNS1, nadE 1523 g8434.t1 2550 g10211.t1 0 5.304746 5.464585 0.750938 5.363328 0.002378 1524 g6597.t1 3355 g10126.t1 0 4.518563 5.208532 0.74287 5.3572 0.002397 1525 g5093.t1 3356 g2950.t1 K14688: SLC30A1, ZNT1 0 2.409393 2.458919 0.737239 5.352927 0.0024 1526 g823.t1 3357 g8190.t1 3.431051 7.673807 3.935357 0.734868 5.351128 0.002404 1527 g839.t1 3358 g9466.t1 0 4.219241 4.683516 0.682084 5.311188 0.002522 1528 g13121.t1 3359 g11183.t1 0 6.54144 6.317655 0.656359 5.291798 0.002581 1529 g847.t1 3360 g9458.t1 8.023071 3.66916 3.61918 0.631424 5.27305 0.002636 1530 g4627.t1 3361 g6024.t1 0.792826 6.42714 5.759738 0.630803 5.272583 0.002636 1531 g10595.t1 3362 g10624.t1 K17987: NBR1 0 2.09236 2.123128 0.620131 5.264574 0.00266 1532 g12318.t1 3363 g7423.t1 K00166: BCKDHA, 0 2.598413 2.602354 0.593035 5.244275 0.002723 bkdA1 1533 g12695.t1 3364 g8902.t1 K10842: MNAT1 0 3.108472 2.951239 0.560072 5.219651 0.002803 1534 g14294.t1 3365 g4038.t1 K02980: RP-S29e, 5.882987 3.465017 2.42606 0.543504 5.2073 0.002847 RPS29 1535 g7862.t1 3366 g10519.t1 K13690: CMT1 4.585103 6.930322 2.588027 0.531605 5.198448 0.002873 1536 g2863.t1 3367 g11267.t1 0.167864 4.829719 5.552288 0.513015 5.184633 0.002917 1537 g1455.t1 2542 g6968.t1 4.374836 10.80524 6.455862 0.511076 5.183194 0.00292 1538 g2438.t1 3368 g6704.t1 9.091153 1.287615 7.87656 0.465153 5.14918 0.003038 1539 g667.t1 3369 g2708.t1 K10256: FAD2 0.327373 4.952806 4.589933 0.444695 5.134069 0.003073 1540 g4890.t1 3370 g4524.t1 K01530: E3.6.3.1 5.691668 0.913041 4.25594 0.443497 5.13319 0.003074 1542 g2756.t1 3372 g9154.t1 0 2.205609 2.199562 0.441939 5.132036 0.003074 1541 g20204.t1 3371 g9206.t1 K00274: MAO, aofH 0 6.517404 6.487337 0.442311 5.132311 0.003074 1543 g2398.t1 3373 g9298.t1 0 5.749657 5.429453 0.437917 5.12907 0.003085 1544 g9984.t1 3374 g9679.t1 0 7.061175 7.03614 0.33213 5.051456 0.003396 1545 g15304.t1 3375 g10452.t1 1.631174 5.484335 3.961905 0.302009 5.029495 0.00348 1547 g1470.t1 3377 g6945.t1 6.211143 0.601353 6.20846 0.295485 5.02475 0.003494 1546 g11003.t1 3376 g1982.t1 0 6.436399 5.197988 0.296732 5.025654 0.003494 1548 g142.t1 3378 g5823.t1 K09051: SKO1, ATF1, 2.033429 6.991069 5.119512 0.271682 5.007443 0.003566 PCR1 1549 g39.t1 3379 g2832.t1 K04450: ATF2, CREBP1 2.082302 6.377889 3.852174 0.21306 4.964987 0.003764 1550 g8675.t1 3380 g10949.t1 4.582792 1.158136 3.14557 0.202072 4.95705 0.003807 1551 g1012.t1 3381 g8081.t1 K01027: OXCT 5.414227 8.052451 2.663064 0.177006 4.938984 0.003878 1552 g2399.t1 3382 g9299.t1 1.458025 7.000976 4.992111 0.176335 4.938501 0.003878 1553 g6515.t1 3383 g2075.t1 K02950: RP-S12, 1.845883 4.922544 2.936732 0.153955 4.922403 0.003952 MRPS12, rpsL 1554 g6586.t1 2539 g10115.t1 5.631067 0.472025 4.60323 0.143733 4.91506 0.003983 1555 g8523.t1 3384 g6295.t1 0 7.66857 6.377663 0.128487 4.904122 0.004038 1556 g6667.t1 3385 g2221.t1 2.68424 6.205712 2.966025 0.118613 4.897045 0.00407 1557 g12827.t1 3386 g7851.t1 0 4.848962 3.8249 0.081084 4.870203 0.004213 1558 g5681.t1 3387 g2305.t1 0 5.574437 5.607999 0.076246 4.866749 0.004223 1559 g8598.t1 3388 g11593.t1 3.906492 6.364882 2.414039 0.063154 4.857409 0.004267 1560 g14604.t1 3389 g6507.t1 0.987454 5.421424 4.548644 0.028742 4.83291 0.004395 1561 g3926.t1 2519 g3966.t1 5.357872 3.212704 2.19688 0.01172 4.8042 0.00456 1562 g3438.t1 3390 g4707.t1 1.724857 6.502863 4.96045 0.02749 4.793029 0.004613 1563 g1922.t1 3391 g6158.t1 K08334: BECN1, VPS30, 0.398499 5.785388 4.960056 0.03595 4.787047 0.004637 ATG6 1564 g3435.t1 3392 g4711.t1 0 8.300404 6.565756 0.04588 4.780026 0.004676 1565 g11568.t1 3393 g4160.t1 K11322: EPC 2.908649 5.395163 2.502674 0.05175 4.775878 0.004698 1566 g4022.t1 3394 g3195.t1 6.571337 1.444687 5.93348 0.05319 4.77486 0.004702 1567 g1119.t1 3395 g218.t1 K15161: CCNC, SSN8 0 4.698233 4.08668 0.05414 4.774192 0.004703 1568 g5372.t1 3396 g9560.t1 5.009004 0.930924 4.29137 0.05628 4.77268 0.00471 1569 g8513.t1 3397 g6303.t1 K01417: E3.4.24. 2.66779 6.304272 3.371495 0.06746 4.764793 0.004752 1570 g10723.t1 3398 g4265.t1 K15078: SLX1 6.249677 1.09824 5.32732 0.07338 4.76062 0.004767 1571 g7955.t1 3399 g10265.t1 7.449289 0.568709 6.91497 0.08661 4.7513 0.004818 1572 g8436.t1 3400 g7726.t1 K08257: E3.2.1.101 0 5.100303 5.10056 0.1098 4.73499 0.004903 1573 g1465.t1 3401 g6950.t1 4.476144 0.61942 4.17994 0.11145 4.73383 0.004908 1574 g2407.t1 3402 g9484.t1 K13127: RNF113A, 7.768564 2.987939 3.79401 0.11976 4.728 0.00494 CWC24 1575 g2487.t1 3403 g3514.t1 K15192: BTAF1, MOT1 3.532261 7.801782 4.747107 0.1259 4.723684 0.00496 1576 g6309.t1 3404 g3004.t1 2.982283 6.81987 3.754204 0.13074 4.720289 0.004976 1577 g1705.t1 3405 g4639.t1 1.748524 7.933591 6.241738 0.13773 4.715388 0.005007 1578 g6321.t1 3406 g3017.t1 9.8442 5.01489 4.79374 0.14476 4.71045 0.005035 1579 g4284.t1 3407 g1936.t1 K18174: COA2 1.986154 6.571374 4.216021 0.15159 4.705676 0.005055 1580 g20937.t1 3408 g7417.t1 K01266: dmpA 1.071718 4.362008 3.114427 0.16727 4.694696 0.005126 1581 g6962.t1 3409 g6429.t1 5.332152 0.25936 5.40138 0.16906 4.69345 0.005132 1582 g18713.t1 3410 g4630.t1 K03083: GSK3B 1.333651 4.783178 4.745248 0.17254 4.69101 0.005148 1583 g8296.t1 3411 g5088.t1 5.102827 0.74787 5.06033 0.17731 4.68768 0.005171 1584 g1028.t1 3412 g8097.t1 K10352: MYH 0 5.91366 5.909517 0.18093 4.685146 0.005187 1585 g7984.t1 3413 g10232.t1 4.17451 0 3.96717 0.18723 4.68075 0.005215 1586 g2260.t1 3414 g10672.t1 0 11.59719 8.078404 0.20485 4.668452 0.005296 1587 g2057.t1 3415 g2540.t1 0 3.495725 2.912854 0.21761 4.659559 0.005358 1265 g16176.t1 2509 g5232.t1 4.464184 8.046322 3.412183 0.22053 4.657525 0.005368 1588 g710.t1 3416 g9945.t1 3.004512 5.305027 3.457727 0.26143 4.629086 0.005573 1589 g11909.t1 3417 g11960.t1 K00967: PCYT2 4.581714 0.355634 4.34247 0.2642 4.62716 0.005582 1590 g133.t1 3418 g5828.t1 0 6.458979 5.351051 0.2661 4.625846 0.005584 1591 g16811.t1 3419 g6747.t1 5.812564 0.429992 4.86386 0.27492 4.61972 0.005629 1592 g1007.t1 3420 g8077.t1 8.250805 2.385735 4.65062 0.27955 4.61651 0.005649 1593 g2691.t1 3421 g3101.t1 6.59247 0.374474 6.18721 0.28128 4.61531 0.005656 1594 g941.t1 3422 g9318.t1 K01067: E3.1.2.1, ACH1 1.499245 7.499861 6.073538 0.318 4.5899 0.005824 1595 g4067.t1 3423 g3251.t1 3.814933 6.244839 2.600899 0.32454 4.585383 0.005862 1596 g7999.t1 3424 g3379.t1 3.95884 1.293984 3.01927 0.36383 4.55828 0.006086 1597 g6280.t1 3425 g12254.t1 K13719: OTU1, YOD1 10.87548 3.850161 7.09783 0.38264 4.54533 0.006175 1598 g2441.t1 3426 g6710.t1 7.528783 1.563904 5.0227 0.39468 4.53706 0.006224 1599 g6940.t1 3427 g6448.t1 0 6.016039 5.937675 0.41441 4.523508 0.006341 1601 g5186.t1 3429 g3777.t1 K02934: RP-L6e, RPL6 4.28578 0 4.72311 0.41768 4.52127 0.006349 1600 g3254.t1 3428 g8225.t1 0 5.869262 5.544325 0.41746 4.521417 0.006349 1602 g2757.t1 3430 g9153.t1 K15053: CHMP7 0 2.528581 2.167777 0.42072 4.519182 0.006365 1603 g8191.t1 3431 g9716.t1 2.640244 5.393849 2.932616 0.42423 4.51677 0.006385 1604 g41.t1 2544 g2830.t1 K10740: RPA3 5.456896 1.684193 3.50612 0.43149 4.5118 0.006426 1605 g7930.t1 3432 g2853.t1 K01077: E3.1.3.1, phoA, 5.436852 2.710109 4.15755 0.43376 4.51024 0.006432 phoB 1606 g9899.t1 3433 g3476.t1 0 5.790708 5.501572 0.43434 4.509842 0.006432 1607 g6747.t1 3434 g4361.t1 K08793: STK32, YANK 1.640577 7.804707 6.025167 0.43912 4.506569 0.006449 1609 g3450.t1 3436 g4695.t1 K11319: ING3 7.793056 1.832762 5.3581 0.44607 4.50182 0.006476 1608 g13903.t1 3435 g687.t1 K01426: E3.5.1.4, amiE 2.308161 5.757553 3.146851 0.44596 4.501889 0.006476 1610 g4174.t1 3437 g1802.t1 K03164: TOP2 0 4.461914 4.257824 0.44926 4.499626 0.006485 1611 g1817.t1 3438 g1704.t1 K13941: folKP 1.569971 6.747653 4.234672 0.45137 4.498183 0.00649 1612 g16037.t1 3439 g4108.t1 K01744: aspA 4.664569 6.76341 2.175875 0.45455 4.496007 0.006508 1613 g10914.t1 3440 g5925.t1 1.756741 4.535424 3.244364 0.46789 4.486892 0.006589 1614 g138.t1 3441 g3729.t1 4.847226 0.925828 5.03041 0.47101 4.48476 0.006598 1615 g2936.t1 3442 g5964.t1 8.044894 0.248534 6.73944 0.47284 4.4835 0.006601 1616 g8866.t1 3443 g2108.t1 K13339: PEX6, PXAAA1 11.8966 2.107495 8.86497 0.48781 4.47329 0.006671 1617 g4740.t1 3444 g2014.t1 K02606: ORC4 4.269663 1.432791 2.74295 0.48799 4.47317 0.006671 1618 g17490.t1 3445 g10534.t1 K10777: LIG4, DNL4 1.37437 7.556488 5.810689 0.48948 4.472145 0.006674 1619 g6095.t1 3446 g7353.t1 10.01399 0.524763 9.03171 0.51858 4.45231 0.006833 1620 g1092.t1 3447 g4035.t1 1.619955 5.721483 3.640435 0.53362 4.442078 0.006907 1621 g12252.t1 3448 g235.t1 0.132439 3.243255 3.821541 0.53381 4.441948 0.006907 1622 g6796.t1 3449 g4421.t1 K03680: EIF2B4 5.126406 0.843849 4.22061 0.54287 4.43579 0.006966 1623 g797.t1 3450 g8161.t1 0 3.053206 2.866046 0.55063 4.430521 0.007005 1624 g5647.t1 3451 g1105.t1 5.271321 0.695521 5.99485 0.556 4.42687 0.007028 1625 g15866.t1 3452 g9844.t1 2.040941 8.117785 5.437517 0.57127 4.416512 0.007114 1626 g6617.t1 3453 g11274.t1 K13953: adhP 9.164416 5.669006 3.74273 0.57468 4.41419 0.007135 1628 g6780.t1 3455 g4396.t1 4.325036 1.1994 3.75976 0.57681 4.41275 0.007142 1627 g5153.t1 3454 g3822.t1 1.244336 5.595008 3.814632 0.57638 4.413043 0.007142 1629 g5834.t1 3456 g1171.t1 K04393: CDC42 5.842709 0.801203 4.48638 0.5775 4.41229 0.007142 1630 g5375.t1 3457 g9563.t1 6.246832 2.775505 3.21809 0.59214 4.40237 0.007231 1631 g10368.t1 3458 g5462.t1 K00826: E2.6.1.42, ilvE 0.323199 4.887494 4.532182 0.59353 4.401421 0.007232 1632 g2826.t1 3459 g9093.t1 5.715948 1.969325 4.3438 0.60813 4.39154 0.007312 1633 g8263.t1 3460 g10014.t1 K09540: SEC63 1.178199 4.647047 3.105882 0.60945 4.390652 0.007317 1634 g1996.t1 3461 g6244.t1 0 2.161944 2.537016 0.61338 4.387995 0.007343 1636 g565.t1 3463 g3893.t1 7.212095 4.016141 3.8261 0.62616 4.37935 0.007416 1635 g10532.t1 3462 g6657.t1 0 6.423209 4.950366 0.62535 4.379902 0.007416 1637 g9223.t1 3464 g6550.t1 K14402: CPSF2, CFT2 4.757601 1.422654 3.02304 0.63182 4.37553 0.007456 1638 g4375.t1 3465 g2132.t1 K17777: TIM9 6.581887 2.288969 5.04428 0.64088 4.36942 0.007514 1639 g3924.t1 3466 g3968.t1 K03854: KTR 4.507947 8.80016 3.527047 0.64187 4.368744 0.007517 1640 g5877.t1 3467 g10964.t1 1.237514 5.716716 4.577402 0.65497 4.359912 0.007609 1641 g7244.t1 3468 g10768.t1 1.270272 6.454926 4.671181 0.66639 4.35221 0.007694 1642 g3215.t1 3469 g6111.t1 6.28213 1.918338 4.18097 0.67385 4.34719 0.007746 1643 g2744.t1 3470 g8873.t1 12.4437 4.004642 6.34323 0.67665 4.3453 0.007764 1644 g10172.t1 3471 g8453.t1 1.719814 6.975262 4.867858 0.67848 4.34407 0.007769 1646 g11998.t1 3473 g2455.t1 K01792: E5.1.3.15 4.113876 1.68217 2.91764 0.68435 4.34012 0.007808 1645 g9935.t1 3472 g6028.t1 0 5.001669 5.050202 0.68376 4.340518 0.007808 1647 g9810.t1 3474 g10828.t1 6.142355 2.944412 3.12615 0.68611 4.33894 0.007817 1648 g2585.t1 3475 g1533.t1 1.186682 5.314928 4.416457 0.70324 4.327418 0.007953 1649 g5812.t1 3476 g7683.t1 0.086084 5.755875 5.49766 0.70639 4.3253 0.00797 1650 g7613.t1 3477 g7623.t1 K12177: COPS3, CSN3 6.832706 1.20583 6.6405 0.71007 4.32283 0.007995 1651 g21752.t1 3478 g11785.t1 9.138517 2.10622 5.18056 0.71052 4.32253 0.007995 1652 g8125.t1 3479 g7937.t1 K14829: IPI3 5.635984 8.165687 3.420929 0.71501 4.319512 0.008023 1653 g1265.t1 3480 g446.t1 0 2.255216 2.515104 0.72389 4.313556 0.008084 1654 g1851.t1 3481 g1893.t1 K14806: DDX31, DBP7 4.180789 6.833176 3.613285 0.72476 4.312968 0.008086 1655 g5970.t1 3482 g7911.t1 0.787727 4.745143 3.037594 0.72641 4.311862 0.00809 1656 g9210.t1 3483 g432.t1 0 5.395553 4.999741 0.72979 4.309594 0.008103 1657 g4885.t1 3484 g5284.t1 K00451: HGD, hmgA 2.711021 9.250394 4.936597 0.75813 4.290601 0.008322 1658 g9727.t1 3485 g1208.t1 0 2.707059 2.656284 0.77155 4.281622 0.008405 1659 g1852.t1 3486 g1892.t1 9.129284 5.622142 2.9499 0.77281 4.28078 0.008408 1661 g4708.t1 3488 g2052.t1 5.134526 2.604627 2.75857 0.77636 4.27841 0.008419 1662 g1264.t1 3489 g447.t1 K07975: K07975 0 3.433264 3.424199 0.77691 4.27804 0.008419 1660 g9176.t1 3487 g6513.t1 1.38307 7.023037 5.604965 0.77564 4.27889 0.008419 1663 g10978.t1 3490 g5642.t1 0 9.109111 6.49256 0.77811 4.277239 0.00842 1664 g7775.t1 3491 g849.t1 5.558934 1.67851 5.74356 0.78625 4.2718 0.008488 1665 g10472.t1 3492 g2156.t1 1.835908 10.72995 8.679924 0.80576 4.258766 0.008642 1666 g11361.t1 3493 g11673.t1 K01613: psd, PISD 5.614261 0.835332 3.65067 0.81024 4.25578 0.008666 1667 g5499.t1 3494 g4955.t1 4.580901 7.497146 2.894342 0.81895 4.249973 0.008726 1668 g8184.t1 3495 g5029.t1 K05607: AUH 3.031275 0 3.53658 0.84752 4.23094 0.008935 1669 g9878.t1 3496 g11628.t1 K05755: ARPC4 0 8.072633 7.232249 0.84945 4.229652 0.008948 1670 g10675.t1 3497 g8521.t1 K00688: E2.4.1.1, glgP, 0.169628 5.781937 5.478988 0.85152 4.228278 0.008956 PYG 1671 g9232.t1 3498 g3432.t1 K00545: COMT 7.296935 0.411124 6.22613 0.8545 4.2263 0.00898 1672 g9988.t1 3499 g9675.t1 K00130: betB, gbsA 0 2.553591 3.110324 0.86233 4.221089 0.009044 1673 g1414.t1 3500 g6284.t1 2.311758 6.717528 4.69322 0.86385 4.220079 0.009053 1674 g6733.t1 3501 g4345.t1 K09043: AP1F 0 5.001212 4.248888 0.86816 4.217209 0.00909 1675 g7043.t1 3502 g6332.t1 5.859345 10.2543 4.890605 0.88033 4.209124 0.009187 1676 g2705.t1 3503 g8367.t1 K00528: E1.18.1.2, fpr 7.551805 3.162022 5.08662 0.88328 4.20717 0.009204 1677 g10342.t1 3504 g51.t1 0 5.678545 5.567869 0.88506 4.205988 0.00921 1678 g5928.t1 3505 g11021.t1 K09885: AQPF 5.755454 0.419682 5.37723 0.89503 4.19937 0.009274 1679 g8175.t1 3506 g7987.t1 1.51165 7.320745 5.975986 0.89646 4.198423 0.009275 1680 g8032.t1 3507 g4282.t1 0 4.127275 3.299567 0.91209 4.188055 0.009398 1681 g9814.t1 3508 g10824.t1 K03062: PSMC1, RPT2 1.362902 5.056672 3.336585 0.91516 4.186022 0.009415 1682 g11969.t1 3509 g7462.t1 0.489568 5.568038 4.427228 0.91543 4.185844 0.009415 1683 g10790.t1 3510 g10663.t1 0.828146 4.846815 3.562604 0.92472 4.179692 0.009497 1684 g4805.t1 3511 g1632.t1 8.950015 5.163246 3.59682 0.93185 4.17497 0.009558 1685 g6554.t1 3512 g10090.t1 K15565: CTK3 5.222663 0.144855 4.83662 0.93476 4.17304 0.009576 1686 g1116.t1 3513 g4063.t1 1.005429 5.625694 3.855418 0.94482 4.16639 0.009663 1687 g8449.t1 3514 g2682.t1 K05954: FNTB 0 5.399599 4.115948 0.95049 4.162638 0.009697 1689 g6525.t1 3516 g2064.t1 K09493: CCT1, TCP1 9.538137 1.667123 6.73424 0.95515 4.15956 0.009725 1690 g5857.t1 3517 g1146.t1 K02320: POLA1 3.021693 6.891883 4.04023 0.95542 4.159376 0.009725 1688 g1274.t1 3515 g460.t1 0 6.05494 9.515249 0.95514 4.159568 0.009725 1691 g12431.t1 3518 g10686.t1 K07127: uraH, pucM, 0 5.825339 4.833292 0.95677 4.158489 0.009733 hiuH 1692 g5322.t1 3519 g2238.t1 K03426: E3.6.1.22, 5.48509 2.765673 3.98262 0.95893 4.15706 0.009743 NUDT12, nudC 1693 g10361.t1 3520 g7713.t1 2.118062 5.477606 3.633039 0.96411 4.153638 0.009765 1694 g2712.t1 3521 g8360.t1 6.902933 0.496994 4.89563 0.97385 4.1472 0.009833 1695 g6927.t1 3522 g6460.t1 K00485: FMO 9.696666 1.489752 6.7401 0.98605 4.13915 0.009945 1696 g6520.t1 3523 g2069.t1 7.419005 0.788997 5.06498 0.98929 4.13702 0.009974 1697 g15004.t1 3524 g3115.t1 4.410253 0.439607 3.37848 0.99169 4.13543 0.009991 1698 g13717.t1 3525 g9904.t1 K01426: E3.5.1.4, amiE 2.122753 4.721599 2.459777 0.99262 4.134823 0.009991 1699 g11731.t1 3526 g5851.t1 K00804: GGPS1 0.641201 8.014106 6.275604 0.99873 4.130792 0.010032 1700 g12319.t1 3527 g7427.t1 K06127: COQ5 0 3.18054 4.279183 1.0114 4.122445 0.010158 1037 g11120.t1 2520 g739.t1 K11309: RTT109, KAT11 4.245031 0.362852 4.44703 1.02232 4.11525 0.010262 1701 g10208.t1 3528 g11172.t1 K08737: MSH6 5.231935 0.620193 4.43745 1.02255 4.11511 0.010262 1702 g4510.t1 3529 g10815.t1 0.110413 4.81464 3.815621 1.03144 4.109255 0.010342 1703 g10697.t1 3530 g8542.t1 K01702: LEU1 0.263634 7.912518 6.023521 1.04447 4.100686 0.010463 1704 g15805.t1 3531 g2331.t1 K02154: ATPeV0A, 0 2.888609 4.034147 1.04529 4.100149 0.010465 ATP6N 1705 g5031.t1 3532 g9002.t1 K02830: HRAD1, RAD17 3.089916 5.598348 2.991585 1.04815 4.098268 0.010485 1706 g5436.t1 3533 g3139.t1 K16261: YAT 5.060429 1.262422 4.0977 1.04901 4.0977 0.010485 1707 g4238.t1 3534 g1742.t1 1.066099 4.155929 2.917914 1.053 4.09508 0.010521 1708 g10868.t1 3535 g125.t1 0 3.653087 3.440687 1.05442 4.094146 0.01053 1709 g6783.t1 3536 g4399.t1 6.220556 1.013936 4.77542 1.0556 4.09337 0.010537 1710 g3062.t1 3537 g11769.t1 0 2.560725 2.204735 1.06092 4.089879 0.010585 1711 g10221.t1 3538 g11208.t1 6.889613 0.40438 7.11534 1.06965 4.08415 0.010672 1712 g1829.t1 3539 g1715.t1 5.791735 1.495617 4.17043 1.08999 4.07081 0.010861 1713 g8326.t1 3540 g5128.t1 K00505: TYR 3.610494 6.260581 3.534926 1.09636 4.066632 0.010911 1714 g3155.t1 3541 g4991.t1 3.59858 7.647083 3.797219 1.11173 4.056562 0.011074 1715 g2222.t1 3542 g11603.t1 0.225549 4.813511 4.351037 1.12206 4.049805 0.011164 1716 g11759.t1 3543 g10216.t1 3.685926 0 4.53515 1.12292 4.04924 0.011168 1717 g8206.t1 3544 g8502.t1 3.420719 10.03021 6.493771 1.1248 4.048012 0.011183 679 g4287.t1 2759 g1939.t1 K00275: pdxH, PNPO 0.807563 3.090838 2.176492 1.13595 4.040719 0.011299 690 g7926.t1 2497 g8597.t1 6.166677 8.61834 2.778981 1.13847 4.039073 0.011322 1718 g4064.t1 3545 g3254.t1 K00002: AKR1A1, adh 6.100438 1.079083 4.91125 1.15384 4.02903 0.01147 1720 g5795.t1 3547 g4862.t1 K00451: HGD, hmgA 3.591089 6.8767 2.956306 1.15712 4.026889 0.011485 1719 g5609.t1 3546 g7533.t1 0.882686 5.320606 3.796705 1.15678 4.027112 0.011485 1721 g19766.t1 3548 g11689.t1 K08272: CAB39, MO25 4.724331 1.509326 3.78959 1.16405 4.02236 0.011549 1722 g7985.t1 3549 g10231.t1 0 4.06043 3.846952 1.16466 4.021964 0.01155 1723 g4377.t1 3550 g2134.t1 14.14762 6.168036 7.54239 1.1682 4.01966 0.01158 1724 g10842.t1 3551 g9831.t1 K15283: SLC35E1 3.417746 7.907833 4.552081 1.17777 4.013415 0.011665 1725 g3810.t1 3552 g5153.t1 K01539: ATP1A 5.831954 9.975934 4.809042 1.1815 4.010981 0.011698 1726 g4351.t1 3553 g2123.t1 2.978188 5.643247 2.777696 1.19302 4.003473 0.011817 1727 g12887.t1 3554 g7811.t1 K03868: RBX1, ROC1 0 6.027624 4.370298 1.19414 4.002739 0.011824 1728 g13707.t1 3555 g7796.t1 K04706: PIAS1 6.517298 4.766243 2.04941 1.20773 3.99389 0.011956 1729 g16831.t1 3556 g10344.t1 6.338633 1.444662 4.08292 1.20964 3.99265 0.011974 1731 g3916.t1 3558 g3976.t1 4.817018 0.75673 4.65895 1.22292 3.98401 0.012097 1730 g5660.t1 3557 g1082.t1 0 4.671882 3.638252 1.22213 3.984518 0.012097 1732 g9151.t1 3559 g6484.t1 6.278283 0.8931 5.76977 1.23184 3.9782 0.012199 1733 g12202.t1 3560 g9295.t1 0.672484 4.169208 2.907439 1.23665 3.975077 0.012241 1734 g5282.t1 3561 g2288.t1 4.202468 0.654126 3.30483 1.23744 3.97457 0.012244 1735 g7572.t1 3562 g7669.t1 3.978653 7.606234 3.70123 1.2385 3.973875 0.012244 1736 g3235.t1 3563 g8210.t1 4.470468 8.184527 5.15127 1.24494 3.969692 0.012307 697 g852.t1 2502 g9454.t1 K11824: AP2A 4.880882 7.286171 2.290375 1.24576 3.969158 0.012307 1737 g6716.t1 3564 g4321.t1 9.948221 2.821953 6.95531 1.25354 3.9641 0.012386 1738 g2067.t1 3565 g2530.t1 7.69826 4.922109 3.56419 1.26788 3.95479 0.012535 1739 g7743.t1 3566 g7093.t1 2.175372 4.617996 2.642137 1.27196 3.95215 0.0125706 1740 g5491.t1 3567 g9819.t1 9.301085 2.365816 5.52656 1.27566 3.94974 0.012619 1741 g10936.t1 3568 g2319.t1 8.259645 1.32013 5.22157 1.27719 3.94876 0.012632 939 g4598.t1 2528 g6014.t1 4.80428 1.524453 3.6354 1.2848 3.94382 0.012715 1742 g10549.t1 3569 g6695.t1 0 1.785939 2.000492 1.29585 3.936658 0.012829 527 g4985.t1 2324 g8953.t1 0.777528 7.11879 6.4966 1.30752 3.929102 0.012948 578 g8174.t1 2376 g7986.t1 1.469754 6.185503 4.308101 1.31185 3.926293 0.012985 1743 g2143.t1 3570 g11929.t1 K00772: E2.4.2.28, 4.8374 0.969878 3.56778 1.3345 3.91164 0.013284 mtaP 1744 g9848.t1 3571 g9777.t1 K06970: rlmF 9.547112 5.371618 3.97134 1.34065 3.90767 0.013349 1745 g12220.t1 3572 g11110.t1 K07870: RHOT1, ARHT1 3.884302 6.478847 3.518086 1.34423 3.905351 0.013393 1746 g2291.t1 3573 g10709.t1 5.385805 9.526471 4.775916 1.34937 3.902029 0.013444 1747 g2147.t1 3574 g11880.t1 K14789: NOP6 6.507448 1.977499 4.68012 1.35307 3.89964 0.013467 1748 g6355.t1 3575 g794.t1 K00236: SDHC, SDH3 0.536878 6.254053 4.787495 1.36034 3.894946 0.013558 1749 g2869.t1 3576 g11261.t1 0.327373 6.340001 4.80532 1.36591 3.891347 0.013632 1750 g2360.t1 3577 g9254.t1 K12200: PDCD6IP, ALIX, 3.801939 1.686361 2.17748 1.36819 3.88988 0.013658 RIM20 1751 g3560.t1 3578 g3325.t1 6.818439 0.789095 4.92675 1.37135 3.88784 0.013689 1752 g10589.t1 3579 g7032.t1 0 2.526539 3.338928 1.37427 3.885952 0.013716 1753 g16530.t1 3580 g8785.t1 4.610888 0.254363 4.08665 1.38154 3.88126 0.013816 1754 g5177.t1 3581 g3786.t1 K03321: TC.SULP 4.026352 0.667334 3.40117 1.38727 3.87757 0.013878 1755 g9386.t1 3582 g3647.t1 K01082: E3.1.3.7, cysQ, 7.430096 4.382531 3.00795 1.38737 3.8775 0.013878 MET22, BPNT1 1756 g6130.t1 3583 g7316.t1 K08657: TASP1 0.095949 5.575509 5.53383 1.38749 3.87743 0.013878 1757 g8530.t1 3584 g6289.t1 K05532: MNN11 0 5.816826 4.892278 1.38966 3.876025 0.013899 1758 g21699.t1 3585 g5541.t1 K03448: FEN2, LIZ1 0.735044 3.625342 2.870907 1.39176 3.874673 0.013906 1759 g9934.t1 3586 g6029.t1 K16575: ACTR1, ARP1 0 5.832405 5.597162 1.39893 3.870056 0.013978 1760 g4777.t1 3587 g3680.t1 3.32587 5.729749 2.411959 1.4021 3.868009 0.014015 1761 g11542.t1 3588 g4184.t1 7.517977 2.707186 4.47011 1.41398 3.86036 0.014171 1762 g2157.t1 3589 g11896.t1 3.702226 7.226007 3.353898 1.41467 3.859914 0.014174 1763 g16189.t1 3590 g1458.t1 K14454: GOT1 10.63207 6.499538 6.07526 1.41542 3.85943 0.014178 1764 g8348.t1 3591 g5159.t1 4.264457 6.507615 2.242904 1.41809 3.857714 0.014202 1765 g1259.t1 3592 g452.t1 2.440869 6.057593 3.423879 1.42343 3.854274 0.01426 1766 g2764.t1 3593 g9147.t1 K10745: RNASEH2C 0 2.695204 3.586065 1.42688 3.852056 0.014297 1767 g7927.t1 3594 g8596.t1 4.918651 7.912131 3.059833 1.4292 3.850562 0.014312 1768 g2676.t1 3595 g4133.t1 K00294: E1.2.1.88 0.612742 5.41036 4.447987 1.4294 3.850434 0.014312 1769 g7548.t1 3596 g7259.t1 0.649867 5.412471 4.266032 1.43441 3.847211 0.014366 1771 g5182.t1 3598 g3781.t1 9.026587 2.801517 6.79697 1.43708 3.84549 0.014391 1770 g7942.t1 3597 g9703.t1 2.085423 7.573442 5.338061 1.43698 3.845559 0.014391 1772 g4091.t1 3599 g3293.t1 K01687: ilvD 6.303323 0.815929 5.63696 1.43932 3.84405 0.014418 1773 g12310.t1 3600 g7399.t1 0 7.275303 5.468252 1.44443 3.840765 0.014489 1774 g3831.t1 3601 g2596.t1 K07005: K07005 0 4.871672 3.653881 1.4486 3.838085 0.014546 1776 g3521.t1 3603 g2212.t1 K10666: RNF5 4.087847 5.915388 2.294451 1.45392 3.834664 0.014606 1775 g22438.t1 3602 g4987.t1 5.797361 8.454162 3.989287 1.45372 3.834797 0.014606 1777 g4129.t1 3604 g1851.t1 3.118092 5.15901 2.22408 1.45469 3.834169 0.01461 1778 g12080.t1 3605 g7812.t1 5.157342 0.417205 5.18316 1.4566 3.83294 0.014632 1779 g18095.t1 3606 g931.t1 5.760364 1.160199 6.11966 1.45925 3.83124 0.014666 1780 g2261.t1 3607 g10673.t1 4.246251 8.170102 5.158696 1.46304 3.828806 0.014718 1781 g2951.t1 3608 g5953.t1 K11129: NHP2, NOLA2 4.43109 0.997175 3.38379 1.46821 3.82548 0.014759 1782 g2355.t1 3609 g9249.t1 K07192: FLOT 6.819585 1.646734 5.57734 1.47687 3.81992 0.014873 1783 g3075.t1 3610 g11781.t1 0 4.238844 3.140408 1.48663 3.813664 0.014988 1784 g9642.t1 3611 g6905.t1 0 4.384934 5.279139 1.48909 3.812083 0.015012 1786 g7748.t1 3613 g7098.t1 K12815: DHX38, PRP16 1.598146 5.454032 3.568819 1.49259 3.809836 0.015052 1785 g10300.t1 3612 g22.t1 0 4.950892 4.957814 1.49227 3.810047 0.015052 1787 g1381.t1 3614 g8684.t1 6.537476 0 5.14045 1.49524 3.80814 0.01508 1788 g3923.t1 3615 g3970.t1 5.651846 0.874231 4.49336 1.49537 3.80806 0.01508 1789 g2286.t1 3616 g10703.t1 K11362: HFI1, ADA1 1.780691 5.389549 3.610777 1.50303 3.803144 0.015181 692 g5169.t1 2506 g3798.t1 4.28203 6.198144 2.254081 1.50534 3.801665 0.01521 1790 g5917.t1 3617 g11006.t1 0.479676 3.343978 2.923854 1.5088 3.799443 0.01525 1791 g6287.t1 3618 g8349.t1 K11366: USP22_27_51, 7.027226 0 6.44608 1.51412 3.79604 0.01533 UBP8 1792 g6643.t1 3619 g10197.t1 5.091815 1.733439 3.47331 1.51828 3.79337 0.01539 1793 g12218.t1 3620 g11102.t1 2.315098 5.094179 2.505163 1.52401 3.789702 0.015468 1794 g7936.t1 3621 g11228.t1 K00232: E1.3.3.6, 4.459893 9.555022 5.227644 1.52659 3.788048 0.015503 ACOX1, ACOX3 1795 g5748.t1 3622 g5250.t1 1.632799 4.080474 2.918063 1.52796 3.787172 0.015518 1796 g9069.t1 3623 g8579.t1 0 6.161139 6.446955 1.53152 3.784889 0.01556 1797 g6312.t1 3624 g3007.t1 K05236: COPA 5.253098 7.43545 2.144029 1.54263 3.77778 0.0157 1799 g8177.t1 3626 g7989.t1 9.520565 3.609284 4.61836 1.54631 3.77543 0.015742 1798 g14196.t1 3625 g5807.t1 K01754: E4.3.1.19, ilvA, 5.027436 7.101036 2.225321 1.54586 3.775716 0.015742 tdcB 1800 g6471.t1 3627 g5309.t1 K11237: BEM1 8.657428 1.580264 5.3132 1.54781 3.77447 0.015759 1801 g8179.t1 3628 g7991.t1 K15450: TYW3 1.394748 4.160609 2.833287 1.55061 3.772678 0.015798 1802 g6447.t1 3629 g5339.t1 0.745984 4.49131 3.550615 1.55175 3.771949 0.015808 1803 g4305.t1 3630 g1960.t1 K07179: RIOK2 2.332881 9.808031 7.49955 1.56836 3.761323 0.016051 1804 g10921.t1 3631 g2051.t1 3.554471 15.34968 12.40633 1.5698 3.760406 0.016067 1805 g7453.t1 3632 g6882.t1 K11230: SSK2 6.592207 0.47792 6.24926 1.57242 3.75873 0.016095 1806 g4994.t1 3633 g8965.t1 4.95489 0.379021 5.0321 1.57389 3.75779 0.016103 1807 g13512.t1 3634 g8777.t1 K07047: K07047 0 1.953187 2.809714 1.57688 3.75588 0.016146 1808 g13145.t1 3635 g4288.t1 K12795: SUGT1, SGT1 0 3.863111 4.262765 1.57792 3.755218 0.016156 1809 g2403.t1 3636 g9304.t1 3.466706 5.880267 2.766617 1.58819 3.748658 0.0163 1810 g11546.t1 3637 g4179.t1 2.95634 4.859952 2.334894 1.59077 3.747012 0.016337 1811 g6245.t1 2545 g7144.t1 3.519044 0.986255 2.56971 1.59307 3.74554 0.016351 1812 g20527.t1 3638 g9499.t1 0 2.423781 3.298103 1.5938 3.745074 0.016355 1814 g485.t1 3640 g5481.t1 3.211934 0.513195 3.05545 1.59982 3.74123 0.016427 1813 g9589.t1 3639 g6640.t1 K14564: NOP56 0 4.752235 3.463157 1.59979 3.741252 0.016427 1815 g17338.t1 3641 g4825.t1 3.253347 11.98725 6.42899 1.60143 3.74021 0.016446 1816 g5556.t1 3642 g7468.t1 0.321853 8.712554 6.936626 1.60594 3.737329 0.0165 683 g9852.t1 3089 g9791.t1 0.93993 4.257415 3.235897 1.61117 3.733993 0.016567 1817 g9592.t1 3643 g6324.t1 0 3.24119 4.466041 1.61236 3.733234 0.01657 1818 g9909.t1 3644 g3464.t1 4.899061 0.389899 4.4519 1.61774 3.7298 0.016649 1819 g347.t1 3645 g8852.t1 K01619: deoC, DERA 5.001834 2.638493 2.09583 1.61831 3.72944 0.01665 1820 g3024.t1 3646 g8280.t1 K15183: ELL 4.940617 6.802739 2.356057 1.62092 3.727777 0.016675 1821 g3400.t1 3647 g10340.t1 4.574834 8.898182 4.895081 1.62268 3.726654 0.016684 1822 g5059.t1 3648 g8329.t1 K15544: SSU72 3.885616 1.04666 3.67463 1.62812 3.72318 0.016767 1823 g13701.t1 3649 g7800.t1 K00227: SC5DL, ERG3 3.52458 8.32101 6.721913 1.62826 3.723097 0.016767 1824 g7883.t1 3650 g8666.t1 K17871: ndh1 8.978821 4.745077 4.2343 1.62992 3.72204 0.016789 1825 g9357.t1 3651 g4026.t1 1.461054 4.608619 3.269834 1.64365 3.713291 0.017021 1826 g6504.t1 3652 g10649.t1 K01487: E3.5.4.3, guaD 3.115047 5.480797 3.226369 1.64905 3.709853 0.017102 1827 g996.t1 3653 g8065.t1 K03859: PIGC, GPI2 0 5.164011 5.152798 1.65445 3.70641 0.017175 1828 g12072.t1 3654 g7819.t1 7.465114 4.358481 4.43566 1.66028 3.7027 0.017256 1829 g8430.t1 3655 g6112.t1 0 3.595832 4.134153 1.664 3.700333 0.017293 1830 g1011.t1 3656 g8080.t1 1.836426 5.321783 3.474028 1.66832 3.697583 0.01736 1831 g7418.t1 2549 g7203.t1 K17497: PMM 4.250746 0.725203 3.91923 1.6743 3.69378 0.017427 1832 g9496.t1 3657 g5757.t1 0.783088 6.487481 4.380159 1.67836 3.691201 0.017484 1833 g9186.t1 3658 g6518.t1 4.151632 10.48721 6.043581 1.68184 3.688985 0.017532 1834 g7004.t1 3659 g6378.t1 K11229: BCK1 0 2.324218 2.253785 1.68839 3.684823 0.017638 1836 g8143.t1 3661 g7948.t1 4.054206 0.695466 3.66885 1.6899 3.68386 0.017639 1835 g11752.t1 3660 g9854.t1 K11086: SNRPB, SMB 5.274986 2.280814 3.12018 1.6896 3.68405 0.017639 1837 g17537.t1 3662 g9665.t1 4.57235 8.898002 4.283534 1.69297 3.681912 0.017688 1838 g5667.t1 3663 g1075.t1 4.489128 2.536094 2.39358 1.70341 3.67528 0.017868 1839 g6664.t1 3664 g2224.t1 K13525: VCP, CDC48 2.105221 5.652047 4.78303 1.70384 3.675005 0.017868 1840 g2801.t1 3665 g9129.t1 7.466543 0.556432 6.6491 1.70804 3.67233 0.017928 1841 g4812.t1 3666 g9598.t1 4.049291 6.42879 2.167629 1.70915 3.671628 0.017928 1843 g2466.t1 3668 g6718.t1 5.98403 0 5.16123 1.7182 3.66588 0.018067 1842 g249.t1 3667 g11056.t1 K00276: AOC3, AOC2, 5.423135 1.39377 3.95337 1.71813 3.66593 0.018067 tynA 1844 g13312.t1 3669 g4520.t1 K018GO: maiA, GSTZ1 0 2:734484 3.220496 1.71843 3.665736 0.018067 1845 g9893.t1 3670 g3483.t1 0 6.706192 4.9767S9 1.71907 3.665331 0.01807 1846 g17202.t1 3671 g3078.t1 5.68592 2.231786 3.83595 1.72034 3.66452 0.018076 1847 g5069.t1 3672 g8336.t1 K14521: NAT10, KRE33 0 3.583017 3.343135 1.72847 3.659364 0.018188 1848 g7275.t1 3673 g11843.t1 0.251195 5.321335 4.264195 1.7299 3.658459 0.018207 1849 g4877.t1 3674 g4496.t1 0.134441 10.17863 6.723251 1.73151 3.657431 0.018229 1850 g12737.t1 3675 g5715.t1 0 3.366893 5.496972 1.7331 3.656428 0.018251 1851 g3173.t1 3676 g11661.t1 3.672536 1.077381 2.65537 1.73393 3.6559 0.018258 1852 g4631.t1 3677 g2422.t1 2.311883 4.745023 2.541357 1.73959 3.652307 0.018351 1853 g601.t1 3678 g3857.t1 0 4.551928 4.659305 1.74334 3.649928 0.018406 1854 g4634.t1 3679 g2419.t1 5.63215 7.748538 2.895179 1.74706 3.647572 0.018445 1855 g13170.t1 3680 g1290.t1 K01620: ItaE 0 1.960601 3.162229 1.74722 3.647467 0.018445 1856 g3136.t1 3681 g5050.t1 0 2.474936 2.012582 1.75162 3.644677 0.018519 1857 g14953.t1 3682 g1391.t1 3.334724 6.021478 2.572465 1.75216 3.644334 0.018519 1858 g11237.t1 3683 g1362.t1 2.76252 5.104646 2.123089 1.76267 3.637676 0.018659 1859 g1833.t1 3684 g1913.t1 K03248: EIF3G 0 3.706133 3.037564 1.76489 3.636266 0.018694 1860 g6040.t1 3685 g11728.t1 K16368: DGK1 9.681271 2.587529 5.33304 1.7661 3.6355 0.018707 1861 g11936.t1 3686 g10365.t1 4.454058 0.327662 3.42743 1.76646 3.63527 0.018707 1862 g4010.t1 3687 g8176.t1 K15427: SIT4, PPH1 5.918167 1.131513 3.97297 1.77022 3.63289 0.018745 1864 g3458.t1 3689 g4687.t1 2.234014 5.975139 2.819321 1.77233 3.631552 0.018756 1865 g4936.t1 3690 g4576.t1 0.924146 3.716899 3.064721 1.77306 3.631089 0.018756 1866 g1815.t1 3691 g1702.t1 2.685797 6.479459 3.431879 1.77314 3.63104 0.018756 1863 g7697.t1 3688 g11510.t1 1.950115 6.128154 4.639048 1.77179 3.631893 0.018756 1867 g1592.t1 3692 g12245.t1 0 4.518156 4.414945 1.7816 3.62568 0.01888 1868 g9431.t1 3693 g10302.t1 5.228093 0.705484 5.82699 1.78382 3.62428 0.018915 1869 g10761.t1 3694 g12006.t1 K15082: RAD7 3.567408 6.390408 2.846424 1.7985 3.614981 0.01914 1870 g6898.t1 3695 g1355.t1 2.604143 5.101685 2.991821 1.80118 3.613286 0.019185 1871 g13109.t1 3696 g9757.t1 K01620: ItaE 0 2.071355 2.163561 1.80694 3.609643 0.019256 1872 g1060.t1 3697 g8133.t1 4.616756 0.514584 3.57327 1.81051 3.60738 0.019301 1873 g7618.t1 3698 g7618.t1 2.193329 5.285081 3.154401 1.81683 3.603386 0.019394 1874 g1395.t1 3699 g6218.t1 3.913913 7.425386 3.628307 1.82293 3.599533 0.019503 1875 g1934.t1 3700 g10921.t1 6.270225 2.041068 5.92102 1.82531 3.59803 0.01953 1876 g10864.t1 3701 g114.t1 1.463031 4.938665 3.973683 1.82564 3.59782 0.01953 1877 g10895.t1 3702 g5900.t1 0 4.186104 3.125415 1.8289 3.595755 0.019562 1878 g5532.t1 3703 g11340.t1 1.931855 7.130479 5.020293 1.83514 3.591812 0.019672 1879 g7251.t1 3704 g10776.t1 4.989318 0.254069 3.57371 1.85053 3.58209 0.019932 1880 g3894.t1 3705 g3998.t1 K00846: KHK 2.877684 5.230358 3.413778 1.86007 3.576066 0.020088 1881 g819.t1 3706 g8183.t1 3.722054 7.412978 4.05158 1.86516 3.572854 0.020168 1882 g5100.t1 3707 g2942.t1 K06688: UBE2C, UBC11 0 1.914572 2.214387 1.86814 3.570972 0.020216 1883 g5175.t1 3708 g3792.t1 K11498: CENPE 3.281173 0.222331 4.74201 1.88553 3.56 0.020535 1884 g6483.t1 3709 g5291.t1 K13728: MAD2L2 1.918177 10.9648 7.40681 1.89484 3.554125 0.020681 1885 g8029.t1 3710 g4279.t1 K01464: DPYS, dht, 3.138026 5.812027 3.152124 1.89915 3.551408 0.020756 hydA 1888 g1840.t1 3713 g1902.t1 4.350369 6.555403 3.614501 1.90291 3.549042 0.020781 1886 g5081.t1 3711 g8569.t1 K00505: TYR 0 4.71171 4.573953 1.9019 3.549673 0.020781 1887 g1692.t1 3712 g4651.t1 1.082713 6.142533 4.604924 1.90263 3.549214 0.020781 1889 g11007.t1 3714 g8699.t1 0 1.587767 2.088946 1.90951 3.544881 0.020897 1890 g1760.t1 3715 g1200.t1 0 3.246854 2.445799 1.91563 3.541022 0.021005 1891 g10371.t1 3716 g10538.t1 0 4.965362 5.078563 1.91874 3.539065 0.021065 1892 g7221.t1 3717 g5890.t1 5.661483 1.072226 3.76681 1.93127 3.53117 0.021281 1893 g6375.t1 3718 g771.t1 8.208151 3.648937 4.25444 1.93282 3.53019 0.021294 1896 g2909.t1 3721 g6002.t1 1.238494 4.449583 3.244239 1.93586 3.52828 0.021322 1894 g5154.t1 3719 g3823.t1 K17095: ANXA7_11 3.505958 9.283634 4.528734 1.93535 3.528604 0.021322 1895 g20345.t1 3720 g7516.t1 0 4.951177 4.852188 1.93559 3.528453 0.021322 1897 g12606.t1 3722 g1144.t1 0 2.337207 2.424768 1.94189 3.524487 0.02143 1898 g7465.t1 3723 g6869.t1 3.054874 8.104242 4.242867 1.94419 3.52304 0.021452 1899 g5267.t1 3724 g9694.t1 1.826832 5.783242 3.837809 1.9491 3.519947 0.021535 1900 g4664.t1 3725 g2382.t1 5.504862 1.603502 4.21381 1.95339 3.51725 0.021593 1901 g17749.t1 2523 g12099.t1 7.598291 9.839638 2.512479 1.95532 3.516031 0.021628 1902 g6418.t1 3726 g5371.t1 K03778: ldhA 2.853999 4.669676 2.946243 1.95976 3.513237 0.021721 1903 g10763.t1 3727 g12010.t1 K01209: E3.2.1.55, abfA 2.945033 0 3.29535 1.96318 3.51109 0.02177 1904 g666.t1 3728 g9881.t1 4.362664 0.664419 3.76077 1.96699 3.50869 0.021838 1906 g1908.t1 3730 g8731.t1 2.211455 0 3.68585 1.97784 3.50187 0.022044 1907 g3413.t1 3731 g4733.t1 K06902: UMF1 2.141863 7.189473 4.094946 1.97792 3.501818 0.022044 1905 g9155.t1 3729 g6487.t1 K02324: POLE1 4.234902 8.900666 4.422793 1.97738 3.502159 0.022044 1908 g10394.t1 3732 g10563.t1 0 5.322562 4.509387 1.9801 3.50045 0.022075 1909 g7696.t1 3733 g11509.t1 0.601935 3.107555 2.748423 1.98765 3.495705 0.022202 1910 g2535.t1 3734 g3567.t1 K05758: ARPC2 11.15766 3.882187 7.40548 1.99331 3.49215 0.022306 1911 g8186.t1 3735 g7993.t1 K01079: serB, PSPH 4.063757 0.499721 4.16492 1.99443 3.49144 0.022322 1912 g4471.t1 3736 g6834.t1 0.878562 4.743026 3.759323 1.99869 3.488764 0.022414 1913 g8237.t1 3737 g10043.t1 3.086194 5.293821 2.302039 1.99973 3.488113 0.022418 1914 g9619.t1 3738 g7243.t1 K11339: MORF4L1, 0 2.363574 3.497394 2.00042 3.487675 0.022424 MRG15, EAF3 1915 g1911.t1 3739 g6147.t1 K08334: BECN1, VPS30, 4.443069 1.325402 4.48934 2.0025 3.48637 0.022458 ATG6 1916 g7540.t1 3740 g7267.t1 K01179: E3.2.1.4 3.106323 7.044516 4.718377 2.0027 3.486247 0.022458 1917 g2857.t1 3741 g9061.t1 4.958463 1.63825 3.2435 2.00585 3.48427 0.022502 1918 g5306.t1 3742 g2255.t1 5.053243 1.769587 3.06328 2.00736 3.48332 0.022507 1919 g4916.t1 3743 g4552.t1 K13950: pabAB 0 4.100904 3.309752 2.00896 3.482311 0.022524 1920 g7255.t1 3744 g10781.t1 1.044041 5.343757 3.456906 2.0128 3.479902 0.022607 1921 g5468.t1 3745 g8430.t1 4.014859 1.728033 2.2011 2.02184 3.47423 0.022807 1922 g10379.t1 3746 g10546.t1 K03507: DPB11 0 2.887983 2.329258 2.02243 3.473857 0.02281 1923 g2332.t1 3747 g9197.t1 K09484: QUIB, qa-3 0.359609 4.730422 6.455702 2.04055 3.462484 0.023216 640 g12554.t1 2440 g3576.t1 K02953: RP-S13e, 6.593986 3.286592 3.5936 2.0451 3.45963 0.023319 RPS13 1924 g134.t1 3748 g5827.t1 6.48267 2.73113 3.87561 2.04641 3.4588 0.023339 1925 g6562.t1 3749 g10098.t1 K04627: STE3 6.840025 3.508287 3.0943 2.04677 3.45858 0.023339 1926 g835.t1 3750 g8204.t1 5.9061 3.739419 2.89332 2.05738 3.45193 0.023574 1927 g3961.t1 3751 g3929.t1 K15631: ABA3 4.682251 0.610791 4.20667 2.05917 3.4508 0.023606 1928 g9090.t1 3752 g8544.t1 9.042656 3.394564 4.42541 2.06054 3.44994 0.023622 1929 g8220.t1 3753 g10063.t1 K11380: NTO1 0.981794 5.762532 4.770402 2.06314 3.448316 0.023659 1930 g1688.t1 3754 g4655.t1 3.67154 6.41277 3.431308 2.06707 3.445853 0.02371 1931 g10593.t1 3755 g7036.t1 0 1.637191 2.310481 2.06843 3.444999 0.023734 1932 g7454.t1 3756 g6881.t1 K13237: DECR2 7.244054 3.351771 4.66071 2.07246 3.44247 0.023826 1933 g1006.t1 3757 g8076.t1 5.641821 1.01679 5.33245 2.07757 3.43927 0.023924 1934 g558.t1 3758 g6454.t1 5.468701 2.998081 3.81423 2.07899 3.43838 0.02395 1935 g8492.t1 3759 g3364.t1 2.17787 5.143839 3.198935 2.08565 3.434206 0.024077 1936 g3284.t1 3760 g8263.t1 K04567: KARS, lysS 0 3.096837 2.750146 2.09247 3.429933 0.024176 1937 g10375.t1 3761 g10542.t1 K18163: NDUFAF6 0 3.09048 3.372823 2.09383 3.429081 0.024189 1938 g9651.t1 3762 g6914.t1 8.216351 3.957187 3.97535 2.09941 3.42558 0.02429 1939 g6236.t1 3763 g7134.t1 1.92867 9.554801 7.372855 2.10264 3.423559 0.024364 1940 g5143.t1 3764 g3836.t1 2.580565 8.674743 4.091749 2.1038 3.422838 0.024383 1941 g11455.t1 3765 g7021.t1 0.596448 5.043975 4.462447 2.10687 3.420916 0.024452 1942 g5389.t1 3766 g2429.t1 4.873893 0 5.94573 2.11075 3.41849 0.024543 1943 g6232.t1 3767 g7130.t1 6.918168 0.488136 5.39134 2.11243 3.41743 0.024569 1944 g13866.t1 3768 g4613.t1 K15115: SLC25A32, 0.791928 5.833256 4.134026 2.11257 3.417341 0.024569 MFT 1945 g7546.t1 3769 g7261.t1 K06113: abnA_B 1.693461 6.005734 3.98049 2.11746 3.414282 0.024676 1946 g10144.t1 3770 g8474.t1 K17086: TM9SF2_4 6.358648 2.274685 5.01733 2.12573 3.40911 0.024862 1947 g8973.t1 3771 g11361.t1 K08496: GOSR2, BOS1 0 3.168015 2.664668 2.12811 3.407616 0.024915 1948 g5708.t1 3772 g2670.t1 3.903218 6.617966 3.389449 2.13389 3.403997 0.025048 1950 g6963.t1 3774 g6427.t1 K14408: CSTF3, RNA14 6.941008 0 5.14398 2.13547 3.40301 0.025067 1949 g15819.t1 3773 g6469.t1 6.143278 2.028742 3.66691 2.13542 3.40304 0.025067 1951 g9667.t1 3775 g4881.t1 K18757: LARP1 1.474494 5.026138 3.073674 2.13624 3.40253 0.025072 1952 g12694.t1 3776 g8901.t1 0 4.059599 3.514485 2.13747 3.401759 0.025087 1953 g3429.t1 3777 g4716.t1 K10755: RFC2_4 6.366861 3.029398 4.00095 2.13997 3.4002 0.02512 1954 g4582.t1 3778 g4118.t1 1.381451 5.626283 4.430383 2.14063 3.399781 0.025126 1955 g3157.t1 3779 g4989.t1 3.100887 8.957858 6.174002 2.15214 3.392585 0.025381 1956 g82.t1 3780 g2764.t1 K17422: MRPL41 0 6.458967 4.487087 2.15351 3.391728 0.025396 1957 g624.t1 3781 g11304.t1 0.779024 4.503237 2.584446 2.15576 3.390322 0.025427 1958 g1143.t1 3782 g253.t1 0 4.407125 4.086029 2.16257 3.38606 0.025587 1959 g6371.t1 3783 g780.t1 K08287: E2.7.12.1 2.726445 7.392615 5.376711 2.17655 3.377322 0.025905 1960 g1751.t1 3784 g9723.t1 2.795334 5.572355 3.187095 2.17894 3.375831 0.025959 1961 g4236.t1 3785 g1745.t1 4.004311 6.248441 2.562026 2.18036 3.374942 0.025987 1962 g8695.t1 3786 g11550.t1 4.911201 1.458168 3.1977 2.18135 3.37432 0.026004 859 g490.t1 2536 g5492.t1 K01230: MAN1 3.341994 5.830489 2.819683 2.18329 3.37311 0.026046 1963 g5421.t1 3787 g5085.t1 8.070442 0.46074 5.99862 2.18759 3.37042 0.026135 1964 g2502.t1 3788 g3530.t1 K13288: orn, REX2, 0 4.539539 4.217905 2.18823 3.370025 0.026138 REXO2 1965 g2567.t1 3789 g5735.t1 4.150469 7.075168 2.267847 2.19188 3.367744 0.026205 1966 g4811.t1 3790 g9600.t1 3.984392 2.169587 2.35064 2.19298 3.36706 0.026224 1967 g6775.t1 3791 g4391.t1 K18748: SSD1 7.196236 1.868572 5.15477 2.20272 3.36098 0.026429 1969 g10391.t1 3793 g10558.t1 0 5.449561 5.122671 2.21155 3.35546 0.026586 1968 g1041.t1 3792 g8112.t1 K11227: PBS2 0 5.802497 5.568864 2.2107 3.355987 0.026586 1971 g11559.t1 3795 g4170.t1 5.952815 2.501869 3.41726 2.21296 3.35458 0.026603 1970 g13704.t1 3794 g11109.t1 1.780391 5.388679 3.682525 2.21285 3.354646 0.026603 1972 g3779.t1 3796 g2656.t1 0 2.29459 3.055708 2.21449 3.353624 0.026623 1973 g2737.t1 3797 g9165.t1 8.111867 3.708757 3.11076 2.21608 3.35263 0.026657 1974 g6644.t1 3798 g10196.t1 0.529024 4.052835 2.69518 2.21902 3.350793 0.026706 1975 g9251.t1 3799 g10432.t1 6.615159 0.815708 4.57198 2.2196 3.35043 0.02671 1977 g5146.t1 3801 g3831.t1 1.613274 5.642097 3.424626 2.22255 3.348593 0.026759 1976 g7543.t1 3800 g7264.t1 1.778839 6.311218 3.7799 2.22228 3.348757 0.026759 1978 g7853.t1 3802 g10510.t1 K15306: RANBP1 0 1.987939 2.649547 2.22545 3.34678 0.026819 1979 g7747.t1 3803 g7097.t1 K14791: PWP1 1.814601 4.202941 2.631876 2.22599 3.346441 0.026823 1980 g3283.t1 3804 g8262.t1 K11400: ARP4 0 2.989351 3.88489 2.22752 3.345492 0.026855 1981 g3579.t1 3805 g3304.t1 K00472: E1.14.11.2 3.489594 9.820105 6.138885 2.22818 3.345078 0.026862 1982 g4997.t1 3806 g8967.t1 1.989279 5.409008 3.503902 2.2339 3.341506 0.026993 1983 g466.t1 3807 g8012.t1 4.101739 6.505153 2.812413 2.23476 3.34097 0.027006 1984 g3042.t1 3808 g1617.t1 K01638: E2.3.3.9, aceB, 4.286461 1.427891 2.69449 2.23709 3.33952 0.027061 glcB 1985 g2105.t1 3809 g2480.t1 K12189: VPS25, EAP20 5.392127 1.688441 3.98468 2.24246 3.33617 0.027171 1986 g10030.t1 3810 g3456.t1 K03952: NDUFA8 4.085114 0.317024 3.2909 2.24726 3.33317 0.027263 1987 g10020.t1 3811 g10918.t1 K01238: E3.2.1. 0 2.377597 3.865002 2.24806 3.332671 0.027274 1988 g6440.t1 3812 g9393.t1 1.856577 5.779447 3.68737 2.25497 3.328362 0.027454 1989 g10867.t1 3813 g124.t1 0 4.39728 4.400864 2.25581 3.32784 0.027467 1990 g3799.t1 3814 g863.t1 5.870835 2.857198 2.27046 2.25914 3.32576 0.027534 1991 g10346.t1 3815 g44.t1 K18328: DBR1 0 2.241769 3.604053 2.25968 3.325424 0.027534 1992 g9896.t1 3816 g3480.t1 0 5.417973 5.231502 2.25972 3.325396 0.027534 1993 g7695.t1 3817 g11508.t1 K01640: E4.1.3.4, 0.184849 4.606471 4.094707 2.26451 3.322414 0.02764 HMGCL, hmgL 1994 g851.t1 3818 g9450.t1 7.233882 2.603782 3.98752 2.26621 3.32135 0.027678 1995 g13873.t1 3819 g4607.t1 K14845: RAH, DOM3Z 1.75337 5.060998 3.620071 2.27209 3.317686 0.027818 1996 g5244.t1 3820 g2347.t1 K02877: RP-L15e, 4.414688 11.84847 5.818625 2.27366 3.316708 0.027853 RPL15 1997 g13106.t1 3821 g9753.t1 K01892: HARS, hisS 0 2.209128 2.453035 2.27519 3.315751 0.027886 1998 g11726.t1 3822 g5854.t1 5.938268 0.538037 5.1103 2.27837 3.31377 0.02796 1999 g2723.t1 3823 g9178.t1 4.416635 0.748978 3.32728 2.28414 3.31017 0.028107 2000 g5988.t1 3824 g11687.t1 6.638403 4.410083 2.22473 2.28525 3.30948 0.028129 2001 g6939.t1 3825 g6449.t1 K01560: E3.8.1.2 1.458794 5.793547 4.011947 2.29299 3.304659 0.028315 2003 g13415.t1 3827 g8381.t1 K00618: E2.3.1.1 5.219776 7.979734 3.470781 2.29519 3.303285 0.028357 2002 g37.t1 3826 g2834.t1 K02926: RP-L4, MRPL4, 1.828605 4.71647 4.723031 2.29519 3.303285 0.028357 rpID 2004 g3662.t1 3828 g651.t1 0.872427 6.371311 4.041603 2.29616 3.302681 0.028362 2005 g9235.t1 3829 g3428.t1 0 3.972927 4.57957 2.29616 3.302679 0.028362 2006 g7674.t1 3830 g7572.t1 5.466518 2.783883 4.32184 2.29711 3.30209 0.028368 2007 g4036.t1 3831 g3210.t1 4.501248 0.83444 3.4584 2.29717 3.30205 0.028368 2008 g5276.t1 3832 g2295.t1 4.938586 0.923903 3.91412 2.30002 3.30028 0.028406 2009 g11802.t1 3833 g12042.t1 3.076257 6.471818 3.398775 2.30107 3.299622 0.028426 2010 g9414.t1 3834 g3612.t1 6.623875 3.522539 4.17633 2.30173 3.29921 0.028434 656 g16181.t1 2457 g12075.t1 K08257: E3.2.1.101 5.57367 2.794291 3.13674 2.30477 3.29731 0.028477 2012 g10897.t1 3836 g5902.t1 0 2.586402 2.018878 2.30447 3.297501 0.028477 2011 g7210.t1 3835 g5874.t1 K09780: K09780 1.114388 3.993513 3.261747 2.30435 3.297579 0.028477 2013 g4453.t1 3837 g6809.t1 5.118903 0.695521 6.34745 2.31256 3.29247 0.028643 2014 g606.t1 3838 g3853.t1 K16261: YAT 3.858126 5.880152 2.075602 2.32021 3.287698 0.028843 2015 g4470.t1 3839 g6833.t1 1.147637 5.898161 3.859584 2.3248 3.284838 0.028961 2016 g6738.t1 3840 g7868.t1 5.417721 3.126867 3.45553 2.32976 3.28175 0.029069 2017 g9769.t1 3841 g939.t1 K15326: TSEN54 2.152088 5.841014 4.075185 2.33059 3.281231 0.029079 2018 g8609.t1 3842 g3035.t1 K11684: BDF1 5.659852 2.072019 3.03129 2.33159 3.28061 0.029098 2019 g7209.t1 3843 g5873.t1 1.535387 3.753918 2.595474 2.33355 3.279388 0.029145 2020 g9079.t1 3844 g7839.t1 3.237265 5.083271 2.50233 2.33749 3.276937 0.029238 2021 g488.t1 3845 g5490.t1 5.069028 0.661124 3.94585 2.33858 3.27626 0.02924 2022 g11121.t1 3846 g740.t1 1.095174 5.476241 3.763338 2.33866 3.276212 0.02924 2023 g7270.t1 3847 g11833.t1 K01649: leuA 0.794723 4.590596 3.756172 2.34295 3.27354 0.029292 2024 g8493.t1 3848 g3365.t1 3.869494 6.395043 2.369665 2.35653 3.265084 0.029712 2025 g9798.t1 3849 g10841.t1 K04564: SOD2 6.169922 3.581629 3.17615 2.35997 3.26294 0.029809 2026 g4827.t1 3850 g711.t1 3.138123 5.609277 2.266361 2.36209 3.261622 0.029865 2027 g7690.t1 3851 g7594.t1 K09705: K09705 6.512504 2.963367 3.48703 2.3645 3.26012 0.029917 2028 g6785.t1 3852 g4403.t1 K06111: EXOC4, SEC8L1 7.141887 3.434524 3.10329 2.36545 3.25954 0.029935 2029 g11719.t1 3853 g2321.t1 4.122011 2.09891 3.55772 2.36866 3.25754 0.030026 2030 g4828.t1 3854 g712.t1 5.692735 2.652303 3.51649 2.37281 3.25496 0.030122 2031 g942.t1 3855 g9313.t1 K09241: GAL4 1.854413 3.96608 2.304511 2.37691 3.252404 0.030229 2032 g11848.t1 3856 g8790.t1 2.601552 0.409353 2.22171 2.37796 3.25175 0.030251 2033 g21824.t1 3857 g7394.t1 0 5.23534 3.655249 2.38527 3.247202 0.030464 2034 g2821.t1 3858 g11279.t1 5.756117 3.458502 2.0711 2.3872 3.24601 0.030515 2035 g6696.t1 3859 g11145.t1 K09704: K09704 7.789281 2.074215 5.24082 2.38775 3.24566 0.03052 2036 g4155.t1 3860 g1823.t1 K18551: SDT1 5.022148 1.693257 2.97251 2.38832 3.2453 0.030526 2037 g9766.t1 3861 g942.t1 3.212965 8.164358 4.327837 2.39337 3.242162 0.030679 2039 g13908.t1 3863 g8736.t1 3.218518 0.78025 2.44992 2.39434 3.24156 0.030685 2038 g9809.t1 3862 g10829.t1 3.118004 5.544287 2.518375 2.39418 3.24166 0.030685 2040 g6787.t1 3864 g4405.t1 1.161527 5.099231 3.21425 2.39714 3.239817 0.030752 2041 g9405.t1 3865 g3622.t1 3.567627 5.477382 2.497615 2.40468 3.23513 0.030977 2042 g2509.t1 3866 g3539.t1 K11874: UBP16 1.872531 5.493777 3.650258 2.4068 3.233811 0.031035 2043 g5355.t1 3867 g9.t1 2.290026 0.356189 2.03022 2.40761 3.23331 0.031049 2044 g4497.t1 3868 g10803.t1 4.996184 7.333602 3.047979 2.4116 3.230832 0.031143 2045 g8224.t1 3869 g10058.t1 3.041354 5.822561 3.713464 2.41714 3.227386 0.031264 2046 g4940.t1 3870 g4580.t1 2.195152 8.603997 5.13217 2.41716 3.227371 0.031264 2047 g3634.t1 3871 g611.t1 K08331: ATG13 3.988422 0.822981 3.37249 2.42114 3.2249 0.031385 2048 g228.t1 3872 g11036.t1 K14833: NOC2 5.004033 8.298645 2.944132 2.43094 3.218805 0.031692 2049 g48.t1 3873 g2823.t1 K01433: purU 2.612144 5.741983 3.012018 2.43232 3.217947 0.031713 2050 g281.t1 3874 g11374.t1 9.37879 4.604117 4.12735 2.43274 3.21769 0.031713 2051 g12734.t1 3875 g5711.t1 K11662: ACTR6, ARP6 0 2.30116 2.840219 2.43365 3.217125 0.031718 2052 g10764.t1 3876 g12011.t1 K01581: E4.1.1.17, 5.248823 0.219074 4.66848 2.4346 3.21653 0.031737 ODC1, speC, speF 2053 g3828.t1 3877 g2599.t1 K00505: TYR 0.869044 5.111409 3.294953 2.43787 3.214499 0.031836 2054 g1137.t1 3878 g246.t1 5.271354 1.818388 3.65818 2.43939 3.21355 0.031875 2055 g4066.t1 3879 g3252.t1 3.515498 1.112324 2.46994 2.44069 3.21275 0.031906 2056 g10836.t1 3880 g9834.t1 0.621439 3.119334 2.691703 2.44409 3.210636 0.03201 2057 g5068.t1 3881 g8335.t1 K14685: SLC40A1, FPN1 0 7.218235 6.29332 2.44716 3.208723 0.032062 2058 g9620.t1 3882 g7242.t1 K01648: ACLY 0 3.90929 3.533252 2.45537 3.203626 0.032253 2059 g5229.t1 3883 g2363.t1 5.943001 0.548669 5.4291 2.46004 3.20072 0.032375 2060 g8605.t1 3884 g3038.t1 4.532655 1.818868 2.9624 2.46055 3.20041 0.032379 2061 g10730.t1 3885 g2912.t1 K01469: OPLAH, OXP1, 0 2.379516 2.107655 2.46555 3.1973 0.032541 oplAH 2062 g4774.t1 3886 g3677.t1 K15631: ABA3 9.027659 4.836111 4.01499 2.46683 3.1965 0.032572 2063 g4508.t1 3887 g10813.t1 0.165642 5.824528 5.711017 2.46786 3.195865 0.032595 2064 g2571.t1 3888 g5739.t1 0.293052 8.085137 4.840508 2.46935 3.194939 0.03262 2065 g5434.t1 3889 g3137.t1 5.143051 1.033474 3.99467 2.47101 3.19391 0.032665 2066 g1199.t1 3890 g353.t1 K02895: RP-L24, 6.44631 2.830134 5.33548 2.4716 3.19354 0.032672 MRPL24, rplX 2067 g7868.t1 3891 g10526.t1 K02915: RP-L34e, 5.849423 1.765368 4.55948 2.47674 3.19035 0.032826 RPL34 2068 g1161.t1 3892 g269.t1 5.46016 3.009009 2.38008 2.48667 3.18418 0.033056 2070 g4445.t1 3894 g6797.t1 4.844189 2.596249 3.82423 2.48854 3.18302 0.033082 2069 g10124.t1 3893 g92.t1 4.215995 9.33502 4.637226 2.48825 3.1832 0.033082 2071 g3873.t1 3895 g4021.t1 2.22259 5.09223 2.889394 2.49175 3.181028 0.033179 2072 g2508.t1 3896 g3536.t1 0 6.070724 4.543999 2.49201 3.18087 0.033179 2073 g8450.t1 3897 g2681.t1 0 2.871722 2.959236 2.4972 3.177646 0.033351 2074 g7865.t1 3898 g10523.t1 7.879406 5.602482 4.36688 2.51011 3.16963 0.033735 2075 g6937.t1 3899 g6455.t1 K13108: SNIP1 0.333353 7.112752 4.778096 2.51256 3.168111 0.033811 2076 g4596.t1 3900 g6012.t1 K12855: PRPF6, PRP6 1.297068 7.636161 5.013494 2.51413 3.167137 0.033854 2077 g16131.t1 3901 g11950.t1 K00616: E2.2.1.2, talA, 4.139806 0.380959 2.80605 2.51525 3.16644 0.033861 talB 2078 g465.t1 3902 g8013.t1 K14325: RNPS1 0.1118 6.347517 6.203301 2.51547 3.166303 0.033861 2079 g1164.t1 3903 g270.t1 0.318216 3.991449 5.225959 2.51682 3.165462 0.033883 2080 g2408.t1 3904 g9480.t1 K18550: ISN1 5.538089 8.86782 4.347478 2.51899 3.164117 0.033935 2082 g16130.t1 3906 g7073.t1 4.225688 6.146706 2.4124 2.52079 3.163002 0.033945 937 g8077.t1 2540 g7846.t1 6.655406 8.379386 2.917067 2.52044 3.163218 0.033945 2081 g5524.t1 3905 g1651.t1 1.597727 5.655543 3.534574 2.5205 3.163177 0.033945 2083 g13129.t1 3907 g7779.t1 3.365795 1.169273 2.39087 2.52343 3.16136 0.034028 2084 g10991.t1 3908 g5657.t1 K12627: LSM8 0 2.170848 3.541712 2.52601 3.159761 0.034109 2085 g1929.t1 3909 g6163.t1 K01930: FPGS 2.613598 6.785311 3.342673 2.52742 3.158884 0.034147 523 g10740.t1 2319 g11987.t1 0 2.813231 2.132602 2.52798 3.15854 0.034153 2086 g11974.t1 3910 g12283.t1 K01537: E3.6.3.8 4.46077 8.720128 4.497107 2.52922 3.15777 0.034185 2087 g2386.t1 3911 g9282.t1 2.552078 5.80107 2.857308 2.52973 3.157452 0.03419 2088 g11089.t1 3912 g1541.t1 2.958185 5.916026 3.473746 2.53269 3.155612 0.034271 549 g6123.t1 2346 g7324.t1 9.721609 0 6.70978 2.53776 3.15247 0.034417 2089 g2879.t1 3913 g9507.t1 1.588916 5.963453 4.232111 2.53843 3.152052 0.034428 2090 g13476.t1 3914 g8719.t1 4.855623 0.713258 4.14789 2.54165 3.15005 0.034492 2091 g10480.t1 3915 g1680.t1 5.35355 2.766663 3.30455 2.54237 3.1496 0.034504 2092 g8013.t1 3916 g3404.t1 5.049113 0.484288 4.63964 2.54362 3.14883 0.034537 2093 g4367.t1 3917 g3791.t1 K03448: FEN2, LIZ1 5.072018 0.779082 3.52579 2.54647 3.14707 0.034587 2094 g6987.t1 3918 g10858.t1 0.511756 5.093495 4.425198 2.54912 3.145416 0.034644 2095 g10431.t1 3919 g8407.t1 K14861: URB1 9.412961 2.402632 4.79559 2.55 3.14487 0.034663 2096 g8248.t1 3920 g10031.t1 K17424: MRPL43 1.653332 7.208956 3.793246 2.55139 3.144009 0.034701 2097 g9278.t1 3921 g112.t1 5.376359 0.900471 5.07129 2.5543 3.14221 0.034795 561 g1198.t1 2358 g352.t1 K04513: RHOA 2.185924 5.599431 3.115826 2.56335 3.136592 0.03508 2098 g7656.t1 3922 g7539.t1 9.484291 3.272208 4.44358 2.56665 3.13455 0.035163 2099 g9071.t1 3923 g8570.t1 0 4.308308 2.935063 2.5715 3.131534 0.035295 2100 g2276.t1 3924 g10693.t1 K12761: SNF1 5.01028 6.964651 2.286462 2.57593 3.128788 0.035431 2101 g14507.t1 3925 g11494.t1 K01187: malZ 7.827356 5.131373 2.97808 2.5835 3.12409 0.03565 2102 g4366.t1 3926 g2127.t1 3.108334 0.378977 3.23784 2.58635 3.12232 0.035746 2103 g5569.t1 3927 g7488.t1 2.55743 5.105776 2.804623 2.58922 3.120544 0.035842 2104 g12588.t1 3928 g2936.t1 5.341725 1.287142 4.50731 2.59295 3.11823 0.035935 2106 g192.t1 3930 g5819.t1 0 4.078839 3.742625 2.5932 3.118072 0.035935 2105 g935.t1 3929 g9324.t1 1.589025 6.970304 5.205593 2.59295 3.118226 0.035935 2107 g7460.t1 3931 g6874.t1 K18176: COA3 0.679443 8.132716 6.326235 2.59401 3.117572 0.035941 2108 g2807.t1 3932 g3734.t1 K01053: E3.1.1.17, gnl, 6.975277 3.879255 3.8776 2.59679 3.11585 0.036035 RGN 2109 g4435.t1 3933 g6774.t1 3.295348 5.340307 2.156098 2.59927 3.114308 0.036117 2110 g9401.t1 3934 g3633.t1 K12668: OST2, DAD1 5.100436 7.099716 3.045005 2.60147 3.112946 0.036176 2111 g1263.t1 3935 g448.t1 K17421: MRPL40 0 5.570752 4.940149 2.60151 3.112921 0.036176 2112 g3490.t1 3936 g2182.t1 K03350: APC3, CDC27 5.226216 7.504737 2.341709 2.60332 3.111795 0.036225 2113 g10916.t1 3937 g267.t1 3.408478 5.633464 3.418244 2.60479 3.110889 0.036225 2114 g921.t1 3938 g9342.t1 K18045: SIW14, OCA3 0 3.596272 3.808042 2.60499 3.11076 0.036225 2116 g7478.t1 3940 g6858.t1 4.55802 0.837774 3.42667 2.61758 3.10295 0.036604 2115 g1744.t1 3939 g9730.t1 K16261: YAT 2.444031 4.709166 2.258978 2.61755 3.102974 0.036604 2117 g10207.t1 3941 g11173.t1 K17866: DPH2 6.980775 0.764559 4.05418 2.62021 3.10133 0.036689 2118 g11843.t1 3942 g8773.t1 K00993: EPT1 3.000341 0.893639 2.21354 2.62048 3.10116 0.036689 2119 g3656.t1 3943 g636.t1 8.879204 5.164409 2.89019 2.62535 3.09814 0.03685 2120 g4331.t1 3944 g1983.t1 4.236756 1.896176 3.14722 2.62618 3.09762 0.036854 2121 g10256.t1 3945 g7194.t1 4.209344 0.708524 3.33023 2.62967 3.09546 0.036938 2122 g9189.t1 3946 g6521.t1 K05663: ABC.ATM 0.18774 5.583284 5.054504 2.63044 3.09498 0.036954 2123 g9587.t1 3947 g6638.t1 K02976: RP-S26e, 0 3.89404 2.743634 2.63219 3.093898 0.037009 RPS26 2124 g3483.t1 3948 g2152.t1 K00472: E1.14.11.2 0 4.019165 3.218586 2.63269 3.093584 0.037015 2125 g4515.t1 3949 g10820.t1 10.17358 3.683757 4.93347 2.6337 3.09296 0.03704 2126 g5855.t1 3950 g1148.t1 K12874: AQR 0 3.592743 3.462488 2.63616 3.091433 0.037124 2127 g11080.t1 3951 g1560.t1 K13303: SGK2 3.663667 5.639852 2.488524 2.63746 3.090627 0.03716 2128 g17161.t1 3952 g9655.t1 3.946776 6.251222 2.716762 2.63779 3.090423 0.03716 2129 g913.t1 3953 g9352.t1 3.761447 1.842695 2.6974 2.64185 3.08791 0.037284 2131 g4992.t1 3955 g8962.t1 5.568434 1.070393 4.64888 2.64356 3.08685 0.037304 2130 g5921.t1 3954 g11009.t1 0.726064 3.654951 2.376852 2.64348 3.086896 0.037304 2132 g10214.t1 3956 g11973.t1 4.391352 5.888419 2.232265 2.64574 3.085498 0.037377 2134 g1192.t1 3958 g2652.t1 7.331953 0 4.76693 2.64809 3.08404 0.037428 2133 g5409.t1 3957 g8611.t1 0.487121 6.397764 4.771873 2.64784 3.084192 0.037428 2135 g6619.t1 3959 g11272.t1 K11159: K11159 10.02313 7.677217 2.84367 2.64911 3.08341 0.037454 2136 g5978.t1 3960 g11675.t1 K01187: malZ 4.632559 1.508608 2.55697 2.65074 3.0824 0.037506 2137 g9539.t1 3961 g6568.t1 K05906: PCYOX1, FCLY 0 3.166553 5.702237 2.6513 3.082052 0.037513 2138 g13602.t1 3962 g10129.t1 K09579: PIN4 3.22586 7.700999 4.342095 2.65456 3.080031 0.037601 2139 g10588.t1 3963 g7031.t1 0 5.84847 4.399222 2.65698 3.078527 0.03767 2140 g8167.t1 3964 g7975.t1 4.268879 6.362638 3.264487 2.66061 3.076281 0.037775 2141 g6658.t1 3965 g10210.t1 1.079636 5.470349 3.827162 2.66129 3.07586 0.037784 2142 g1881.t1 3966 g4234.t1 K01725: cynS 4.230103 2.82032 2.77283 2.66619 3.07282 0.037943 2143 g11727.t1 3967 g5855.t1 3.728683 0.656698 2.85634 2.66698 3.07233 0.03796 2144 g3432.t1 3968 g4712.t1 K00505: TYR 0 3.109455 4.733726 2.67446 3.067691 0.038224 2145 g20186.t1 3969 g6363.t1 5.012816 7.163425 2.999714 2.68527 3.060993 0.038598 2146 g447.t1 3970 g8029.t1 K13431: SRPR 4.802134 1.949645 2.92415 2.69849 3.0528 0.039107 2147 g4444.t1 3971 g6795.t1 4.899102 2.093375 3.84401 2.69952 3.05216 0.039136 2148 g18374.t1 3972 g7684.t1 K12856: PRPF8, PRP8 4.95726 1.392127 3.87785 2.70169 3.05082 0.039186 2149 g8150.t1 3973 g7956.t1 K02959: RP-S16, 5.17122 2.06327 3.42667 2.70179 3.05076 0.039186 MRPS16, rpsP 2150 g1210.t1 3974 g364.t1 5.549737 1.972661 3.45578 2.70577 3.04829 0.039324 2151 g8164.t1 3975 g7965.t1 0.264932 6.326912 4.484822 2.71181 3.044544 0.039565 2153 g8665.t1 3977 g2654.t1 4.448871 0 4.40278 2.71535 3.04235 0.039644 2154 g6421.t1 3978 g5368.t1 3.418022 7.778884 4.446548 2.71542 3.04231 0.039644 2152 g7000.t1 3976 g6384.t1 K15109: SLC25A20_29, 0 5.827294 5.75825 2.71486 3.042655 0.039644 CACT, CACL, CRC1 2155 g3832.t1 3979 g2595.t1 1.491655 5.211867 3.871807 2.71908 3.040044 0.039755 2156 g10272.t1 3980 g2373.t1 6.233817 2.342297 5.51583 2.72027 3.03931 0.039778 2158 g4169.t1 3982 g1810.t1 2.732171 7.333986 3.584184 2.72283 3.037719 0.039793 2157 g10739.t1 3981 g11986.t1 0 3.441589 3.584342 2.72269 3.037804 0.039793 2159 g5894.t1 3983 g10982.t1 K03030: PSMD14, 5.235811 0 4.2666 2.72651 3.03544 0.039906 RPN11, POH1 2160 g3017.t1 3984 g8289.t1 4.253797 2.232303 2.01665 2.72969 3.03347 0.040028 2161 g2235.t1 3985 g10642.t1 0 8.944426 6.651699 2.73008 3.033226 0.040029 2162 g444.t1 3986 g8037.t1 5.926244 1.755078 4.43879 2.73748 3.02864 0.040289 2163 g8162.t1 3987 g7962.t1 2.242593 6.181948 2.975066 2.7414 3.026215 0.04044 2164 g3781.t1 3988 g2653.t1 0 5.388341 4.391813 2.74166 3.026051 0.04044 2165 g446.t1 3989 g8030.t1 1.248806 3.196143 2.232547 2.74479 3.024112 0.040546 2166 g8813.t1 3990 g11548.t1 4.479092 1.564747 2.31147 2.75228 3.01947 0.040844 2168 g484.t1 3992 g5480.t1 K01083: E3.1.3.8 6.104152 1.195312 3.75188 2.76953 3.00879 0.041524 2167 g6382.t1 3991 g762.t1 K11578: ZW10 4.043617 7.246112 3.318946 2.76929 3.008933 0.041524 2169 g13874.t1 3993 g4606.t1 2.192003 4.933315 3.081033 2.77099 3.007879 0.04156 2170 g9768.t1 3994 g940.t1 1.599958 5.142409 3.111563 2.77117 3.00777 0.04156 2171 g7100.t1 3995 g5567.t1 3.101236 4.623123 2.647789 2.77245 3.006974 0.041602 2172 g7685.t1 3996 g7577.t1 4.579641 1.059627 4.79509 2.77348 3.00633 0.041632 2174 g6166.t1 3998 g9581.t1 K10844: ERCC2, XPD 3.612569 6.046916 2.409001 2.77444 3.005738 0.041644 2173 g20840.t1 3997 g5601.t1 K09958: K09958 0 3.295785 3.355548 2.77424 3.005865 0.041644 2175 g4928.t1 3999 g4568.t1 K10752: RBBP4, HAT2, 0.721987 4.891137 3.366959 2.7761 3.004716 0.041686 CAF1, MIS16 2177 g4731.t1 4001 g2023.t1 3.62063 8.542099 3.637606 2.78256 3.000712 0.041947 2176 g13702.t1 4000 g7799.t1 1.507271 5.575516 5.445863 2.78244 3.000783 0.041947 2178 g6999.t1 4002 g6385.t1 0 5.909998 6.710453 2.78479 2.999326 0.041984 2179 g1200.t1 4003 g354.t1 K03189: ureG 3.906083 6.287127 3.500283 2.78517 2.999091 0.041985 2180 g894.t1 4004 g9381.t1 1.98344 3.689145 2.509227 2.78645 2.9983 0.042011 2181 g4606.t1 4005 g11246.t1 6.888917 0.934867 4.17521 2.7892 2.9966 0.04212 2182 g5836.t1 4006 g1169.t1 K01078: E3.1.3.2 4.897435 0.540874 3.08894 2.78981 2.99622 0.042132 2183 g6795.t1 4007 g4420.t1 K00620: argJ 1.412783 6.285553 3.554814 2.7905 2.995789 0.042148 2184 g13700.t1 4008 g7801.t1 K06666: TUP1 4.676696 9.110953 5.842219 2.79358 2.993881 0.042237 2185 g4127.t1 4009 g1853.t1 6.883091 3.151116 3.23591 2.79424 2.99347 0.042238 2186 g3498.t1 4010 g2189.t1 K00888: PI4K 4.387206 8.035595 3.806841 2.79735 2.991549 0.042365 2187 g922.t1 4011 g9339.t1 0.335414 5.594 3.51525 2.80783 2.985057 0.042832 2188 g2095.t1 4012 g2498.t1 2.312071 5.547566 3.491828 2.8095 2.984022 0.042893 2189 g3886.t1 4013 g4006.t1 0.369905 5.31491 3.411646 2.81293 2.981892 0.04302 2191 g2907.t1 4015 g4478.t1 K01361: E3.4.21.96 2.736066 5.91864 3.746675 2.81508 2.980564 0.043087 2190 g4132.t1 4014 g1848.t1 3.459488 8.742363 3.852241 2.8149 2.980673 0.043087 2192 g102.t1 4016 g2922.t1 K15628: PXA 4.533487 1.423633 3.06092 2.81692 2.97942 0.043124 2193 g22195.t1 4017 g11335.t1 5.038549 3.116899 3.18678 2.82113 2.97682 0.043256 2194 g6067.t1 4018 g11760.t1 2.556856 5.057211 2.182582 2.82589 2.973866 0.043414 2195 g7479.t1 4019 g6857.t1 6.476209 0.753273 5.14745 2.82832 2.97236 0.043492 2196 g6849.t1 4020 g1428.t1 K14312: NUP155 5.863337 2.74764 3.23983 2.8286 2.97218 0.043492 2197 g6740.t1 4021 g4353.t1 3.814661 6.39705 3.411605 2.83035 2.971099 0.043559 2198 g1017.t1 4022 g8086.t1 1.006221 4.462038 2.793294 2.83106 2.970664 0.043575 2199 g20453.t1 4023 g7824.t1 0 2.0793 2.784209 2.83156 2.970353 0.043583 2200 g1014.t1 4024 g8083.t1 K13577: SLC25A10, DIC 2.388955 4.532509 2.338145 2.83672 2.967153 0.04381 2201 g3487.t1 4025 g2179.t1 0 3.411165 3.277123 2.83823 2.966219 0.04385 2202 g3156.t1 4026 g4990.t1 3.806958 6.990748 5.291192 2.84227 2.963714 0.043975 2203 g21845.t1 4027 g8491.t1 0 2.721806 3.270562 2.84342 2.963002 0.044014 2204 g2266.t1 4028 g10682.t1 4.867023 3.323245 2.83067 2.84548 2.96173 0.044069 2205 g11688.t1 4029 g10852.t1 3.032144 0.893416 2.19305 2.85456 2.9561 0.044448 2206 g6381.t1 4030 g763.t1 5.116653 0.131962 3.22317 2.85525 2.95567 0.044464 2208 g10499.t1 4032 g1661.t1 4.339082 6.042177 2.559442 2.85649 2.954904 0.044491 2207 g17551.t1 4031 g8157.t1 K00558: DNMT1, dcm 2.888377 6.949835 3.089797 2.85616 2.955108 0.044491 2209 g5340.t1 4033 g9534.t1 0.545456 7.258622 4.798642 2.85837 2.953743 0.044548 2210 g5285.t1 4034 g2285.t1 2.96395 7.10547 3.24264 2.85885 2.953444 0.044555 2211 g7357.t1 4035 g10412.t1 5.528929 0.619143 3.97539 2.86359 2.95051 0.044734 2213 g726.t1 4037 g10236.t1 0.483715 2.68877 2.384127 2.86588 2.949088 0.044811 2212 g3514.t1 4036 g2206.t1 K11397: EAF1, VID21 1.206815 6.642767 4.853325 2.86574 2.949177 0.044811 2214 g7257.t1 4038 g10783.t1 1.642966 6.188124 2.989166 2.87117 2.945813 0.045035 2215 g10215.t1 4039 g11972.t1 2.58645 7.403204 4.385523 2.87151 2.945602 0.045035 2216 g12395.t1 4040 g9538.t1 5.861009 2.002652 3.8787 2.87539 2.9432 0.045174 2217 g341.t1 4041 g8842.t1 5.788696 9.05636 2.247676 2.87854 2.941243 0.045312 2218 g2488.t1 4042 g3515.t1 K06669: SMC3, CSPG6 1.945941 7.641363 3.740235 2.88255 2.938761 0.045473 2219 g713.t1 4043 g9934.t1 5.331222 0.664695 4.38202 2.88525 2.93708 0.045565 2220 g3763.t1 4044 g2673.t1 5.825851 3.254634 2.56829 2.88539 2.937 0.045565 2221 g7424.t1 4045 g7209.t1 5.373092 9.386519 3.006451 2.88618 2.93651 0.04557 2222 g5043.t1 4046 g10906.t1 K01426: E3.5.1.4, amiE 2.242898 6.456313 3.847076 2.89168 2.933101 0.045808 2223 g7402.t1 4047 g7184.t1 5.091428 2.484421 2.06938 2.89544 2.93077 0.045911 2224 g6538.t1 4048 g10076.t1 K12830: SF3B3, 0 3.092763 3.060265 2.90278 2.926225 0.046243 SAP130, RSE1 2225 g10909.t1 4049 g5917.t1 2.072461 4.929452 2.681301 2.90454 2.92513 0.046314 2226 g10722.t1 4050 g4266.t1 K12827: SF3A3, SAP61, 3.415338 6.31204 3.035059 2.90712 2.923532 0.046427 PRP9 2227 g4840.t1 4051 g4450.t1 3.23602 0.449458 3.90188 2.91106 2.92109 0.046537 2228 g1066.t1 4052 g8139.t1 K01922: PPCS, coaB 1.857534 4.106673 3.234378 2.91469 2.918841 0.046689 2229 g6576.t1 4053 g10109.t1 3.964575 0 4.86543 2.91615 2.91794 0.046745 2230 g107.t1 4054 g2928.t1 K03539: RPP1, RPP30 3.197967 0.803547 2.46999 2.92305 2.91366 0.047038 2231 g3425.t1 4055 g4720.t1 K02605: ORC3 6.578091 4.722727 2.20212 2.92326 2.91353 0.047038 2232 g1018.t1 4056 g8087.t1 K04565: SOD1 2.947764 8.680712 5.056988 2.92384 2.913169 0.04705 2234 g5391.t1 4058 g2427.t1 3.793826 0.942173 4.97661 2.92597 2.91185 0.047091 2233 g7764.t1 4057 g879.t1 3.456716 1.497029 2.42385 2.92569 2.91203 0.047091 506 g8644.t1 2302 g2276.t1 K01166: E3.1.27.1 0 10.03085 6.401697 2.92547 2.91216 0.047091 2236 g1094.t1 4060 g4037.t1 K02358: tuf, TUFM 7.685682 5.149397 2.8793 2.93139 2.90849 0.047263 2235 g712.t1 4059 g9943.t1 2.563775 7.171783 3.80414 2.93127 2.908563 0.047263 2237 g2419.t1 4061 g11542.t1 0.666287 3.962309 2.387936 2.93259 2.907749 0.047307 2238 g2608.t1 4062 g9643.t1 K00135: gabD 1.638785 4.294982 3.144001 2.93448 2.906575 0.047387 2239 g8147.t1 4063 g7952.t1 K11246: SHO1 6.066325 2.713104 3.95602 2.93607 2.90559 0.047433 2240 g5705.t1 4064 g10360.t1 0.642825 4.418076 3.166773 2.93679 2.905146 0.047433 2241 g1222.t1 4065 g374.t1 2.642618 5.883278 3.175464 2.93706 2.90498 0.047433 2242 g8664.t1 4066 g3812.t1 7.432168 1.550855 4.57283 2.93851 2.90408 0.04749 2243 g4764.t1 4067 g1994.t1 6.940047 1.130412 4.17201 2.93963 2.90338 0.047531 2244 g6851.t1 4068 g1427.t1 2.284011 3.932777 2.957195 2.94037 2.902925 0.047551 2245 g10946.t1 4069 g5078.t1 K11236: CDC24 4.982918 0.83865 3.5024 2.94195 2.90195 0.047598 2246 g1752.t1 4070 g9722.t1 2.831268 5.535026 2.675068 2.94838 2.897963 0.047896 2247 g566.t1 4071 g3892.t1 K14708: SLC26A11 0.609198 5.65481 3.423398 2.95146 2.896054 0.048021 2248 g3553.t1 4072 g3337.t1 5.206188 1.970138 6.17884 2.95714 2.89253 0.048268 2249 g383.t1 4073 g7452.t1 K03978: engB 3.305487 5.192025 2.780869 2.95719 2.892499 0.048268 2250 g7722.t1 4074 g3091.t1 K03014: RPB6, POLR2F 0 4.540834 4.042193 2.96294 2.888936 0.048493 2251 g5453.t1 4075 g3167.t1 4.7696 0.934559 3.55662 2.96747 2.88612 0.048686 2252 g9542.t1 4076 g6565.t1 K01381: E3.4.23.25 0 3.886173 3.681133 2.969 2.885177 0.048749 2254 g1347.t1 4078 g3449.t1 K01273: E3.4.13.19, 4.946987 0.532441 3.43411 2.972 2.88332 0.048837 DPEP1 2253 g4317.t1 4077 g1977.t1 2.161002 7.174394 3.592405 2.97197 2.883339 0.048837 2255 g5426.t1 4079 g3123.t1 K09539: DNAJC19 7.936931 3.022359 5.07555 2.97281 2.88282 0.048862 2256 g22408.t1 4080 g9317.t1 K05351: E1.1.1.9 0 5.279355 4.074546 2.97436 2.881852 0.048927 2257 g6391.t1 4081 g5410.t1 K00480: E1.14.13.1 10.39213 2.102041 5.87521 2.97645 2.88056 0.048977 2258 g4848.t1 4082 g4461.t1 5.837897 1.338468 3.27267 2.97698 2.88023 0.048977 2259 g5255.t1 4083 g2333.t1 5.719887 4.103219 2.31021 2.97885 2.87907 0.049041 2261 g10716.t1 4085 g11754.t1 4.124991 1.869399 2.24701 2.98266 2.87671 0.049173 2260 g5384.t1 4084 g9571.t1 K13099: CD2BP2, 0 5.725959 3.979521 2.98264 2.876724 0.049173 PPP1R59 2262 g2819.t1 4086 g9111.t1 K16066: ydfG 5.823181 2.29085 5.24434 2.98895 2.87281 0.049421 2265 g10820.t1 4089 g5705.t1 1.446801 4.641792 2.923813 2.99351 2.869978 0.049577 2263 g10158.t1 4087 g8462.t1 0 2.396169 3.866683 2.9926 2.870543 0.049577 2264 g844.t1 4088 g9461.t1 0 4.027461 4.070888 2.99313 2.870218 0.049577 2267 g2834.t1 4091 g9028.t1 4.114412 0.517908 3.11219 2.99494 2.8691 0.0496 2266 g10485.t1 4090 g1675.t1 0 4.900393 4.371976 2.99484 2.869153 0.0496 2268 g11904.t1 4092 g11956.t1 K00681: ggt 3.288998 0.166182 3.64625 2.99768 2.86739 0.049713 2269 g21731.t1 4093 g6097.t1 2.691539 0.619933 4.08621 3.00053 2.86563 0.049849 2270 g1202.t1 4094 g356.t1 K14768: UTP7, WDR46 1.026847 3.791611 2.583054 3.00301 2.864088 0.049957 2271 g9859.t1 4095 g11476.t1 0 4.020067 4.04691 3.00328 2.863921 0.049957
This table describes orthologous genes of Acremonium zea sp. with beneficial and neutral effects on soybean growth, these genes show significant changes in expression between the two genotypes when grown in culture with soybean homogenate. Median Exp. SYM00577 represents the median expression value in log 2 tpm across biological replicates of the beneficial Acremonium grown in media inoculated with soybean seedling homogenate extracted with 50 mM PBS. Median Exp. SYM00300 represents the median expression value in log 2 tpm across biological replicates of the neutral Acremonium grown in media inoculated with soybean seedling homogenate extracted with 50 mM PBS. Log FC represents the estimate of the log 2-fold-change of the contrast. B-statistic represents the log-odds that the gene is differentially expressed. t-statistic represents the moderated t-statistic. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
(536) TABLE-US-00041 TABLE 603 SEQ ID sym577 SEQ ID sym300 Median Exp. SYM00577 gene SYM00300 gene Description SYM00577 687 g13072.t1 2494 g9142.t1 0 700 g10575.t1 2526 g10634.t1 0 674 g5345.t1 2555 g9530.t1 K03510: POLI 5.845894518 688 g68.t1 2495 g909.t1 K00106: XDH 7.003820996 701 g12045.t1 2524 g804.t1 K12393: AP1M 6.653853259 702 g1230.t1 2527 g388.t1 0 703 g2767.t1 2559 g9144.t1 K02139: ATPeFF, ATP17 0 704 g7900.t1 2560 g8630.t1 6.140021427 686 g857.t1 2491 g9451.t1 K01950: E6.3.5.1, 3.802514601 NADSYN1, QNS1, nadE 675 g5348.t1 2554 g1.t1 0 705 g10859.t1 2552 g120.t1 K17842: carT, CAO-2 0 706 g8300.t1 2561 g5097.t1 K15136: SRB5, MED18 7.025134642 707 g2262.t1 2562 g10678.t1 K11205: GCLM 0 708 g8448.t1 2563 g2683.t1 K00966: GMPP 0 709 g10027.t1 2564 g3454.t1 0 517 g13099.t1 2313 g8761.t1 0 710 g1584.t1 2517 g2859.t1 7.332050712 690 g7926.t1 2497 g8597.t1 6.853860482 711 g9140.t1 2565 g6474.t1 K02434: gatB, PET112 7.89701243 558 g9065.t1 2355 g8585.t1 K03234: EEF2 0 712 g3334.t1 2566 g4792.t1 0 713 g3376.t1 2567 g10478.t1 0 714 g9.t1 2568 g3899.t1 0 692 g5169.t1 2506 g3798.t1 4.865818268 685 g6380.t1 2492 g764.t1 K05857: PLCD 5.073855922 696 g3920.t1 2508 g3972.t1 5.062011561 715 g10569.t1 2569 g8038.t1 0 716 g4884.t1 2570 g5157.t1 3.493672904 717 g12587.t1 2571 g2937.t1 5.143110791 718 g9196.t1 2572 g6530.t1 K01937: pyrG, CTPS 2.877811039 719 g5920.t1 2573 g11008.t1 K02894: RP-L23e, RPL23 2.351855506 720 g5591.t1 2547 g7515.t1 5.584485038 721 g7216.t1 2574 g5885.t1 4.657263756 722 g4371.t1 2575 g2128.t1 5.510282495 698 g657.t1 2503 g9863.t1 4.4628192 723 g5419.t1 2576 g5084.t1 8.315874976 724 g5712.t1 2577 g1012.t1 5.583909958 725 g5938.t1 2578 g8896.t1 0 726 g2504.t1 2579 g3532.t1 0 727 g7969.t1 2580 g10252.t1 K03639: MOCS1, moaA 4.758242645 728 g1770.t1 2581 g1188.t1 6.058400928 729 g815.t1 2582 g8179.t1 7.400064361 730 g3624.t1 2583 g600.t1 K14297: NUP98, ADAR2 5.106519345 731 g3218.t1 2584 g6107.t1 4.600691335 732 g6563.t1 2585 g10099.t1 7.052996504 733 g5058.t1 2586 g8328.t1 6.170884433 734 g2063.t1 2587 g2535.t1 K01426: E3.5.1.4, amiE 6.62697264 735 g7620.t1 2588 g9046.t1 1.469790922 737 g8108.t1 2590 g7917.t1 5.22299962 736 g13149.t1 2589 g4276.t1 0 738 g15293.t1 2591 g6106.t1 2.346160706 739 g10986.t1 2592 g5652.t1 K02141: ATPeFH, ATP14 0 740 g2758.t1 2593 g9152.t1 K10627: RAD18 0 741 g4882.t1 2594 g4502.t1 6.687936705 742 g1999.t1 2595 g6250.t1 0 743 g3555.t1 2596 g3333.t1 K01624: FBA, fbaA 4.536933474 744 g4741.t1 2597 g2013.t1 K03237: EIF2S1 6.043892772 745 g5254.t1 2598 g2334.t1 K02137: ATPeF0O, 5.144250658 ATP5O, ATP5 746 g5568.t1 2529 g7485.t1 2.950253937 747 g19199.t1 2599 g12080.t1 K01102: PDP 4.719048671 748 g4710.t1 2600 g6681.t1 K03457: TC.NCS1 5.545619928 749 g1003.t1 2601 g8072.t1 K03626: EGD2, NACA 9.544725129 750 g12699.t1 2602 g8909.t1 0 751 g3631.t1 2603 g607.t1 5.634764008 752 g10888.t1 2604 g176.t1 K00463: INDO 0 697 g852.t1 2502 g9454.t1 K11824: AP2A 5.513795279 753 g10211.t1 2605 g11976.t1 6.236601553 754 g158.t1 2606 g5219.t1 0 755 g6128.t1 2607 g7318.t1 K13953: adhP 0.559800663 691 g5563.t1 2493 g7478.t1 4.371792513 756 g5223.t1 2608 g3707.t1 K03515: REV1 7.079279048 680 g1340.t1 2553 g523.t1 5.657989905 757 g6031.t1 2609 g11529.t1 K01885: EARS, gltX 8.997952533 758 g5074.t1 2610 g2984.t1 0 759 g6741.t1 2611 g4354.t1 2.11282087 760 g829.t1 2612 g8197.t1 K13577: SLC25A10, 0 DIC 761 g7264.t1 2613 g11828.t1 5.499599524 762 g2074.t1 2614 g2522.t1 4.591860791 763 g9395.t1 2615 g3638.t1 K06116: GPP1 2.323291749 764 g9849.t1 2616 g9778.t1 9.223686565 765 g11803.t1 2617 g12043.t1 2.387616958 766 g11916.t1 2618 g661.t1 7.715759124 767 g1153.t1 2619 g5028.t1 4.692839925 768 g5373.t1 2620 g9561.t1 5.888238765 769 g7390.t1 2621 g7172.t1 7.350351967 770 g10732.t1 2622 g4256.t1 0 771 g10093.t1 2623 g9511.t1 4.296964996 772 g10839.t1 2624 g9837.t1 6.8729034 773 g10191.t1 2625 g11148.t1 6.023102414 774 g3013.t1 2626 g8294.t1 5.470261921 775 g7841.t1 2627 g10495.t1 4.614472875 776 g21528.t1 2512 g10587.t1 K01885: EARS, gltX 3.911232108 777 g9138.t1 2628 g6473.t1 4.198675014 778 g4873.t1 2629 g4492.t1 5.713341579 779 g7446.t1 2630 g6892.t1 7.48417852 780 g8021.t1 2631 g8248.t1 4.309793696 781 g100.t1 2632 g2920.t1 0 782 g1180.t1 2633 g337.t1 6.10473465 783 g14694.t1 2634 g6409.t1 9.825681474 784 g6706.t1 2521 g4310.t1 7.446014886 785 g14790.t1 2635 g5147.t1 1.686007548 786 g8676.t1 2636 g10948.t1 3.991647742 787 g4402.t1 2637 g2161.t1 0 788 g1963.t1 2638 g6215.t1 6.923009485 789 g132.t1 2639 g5829.t1 0 790 g11512.t1 2640 g4219.t1 6.309781587 791 g10280.t1 2641 g10638.t1 0 792 g796.t1 2642 g8160.t1 0.721237136 793 g15000.t1 2643 g3110.t1 K09658: DPM2 5.469156461 794 g7638.t1 2644 g7605.t1 0 795 g11518.t1 2645 g4213.t1 5.935642711 796 g85.t1 2646 g2767.t1 5.850559685 797 g489.t1 2647 g5491.t1 K05857: PLCD 5.789925493 798 g8243.t1 2648 g10036.t1 4.646855045 800 g4842.t1 2650 g4453.t1 K13120: FAM32A 5.230120767 799 g10374.t1 2649 g10541.t1 K15505: RAD5 0 801 g10174.t1 2651 g8450.t1 K11557: SPC24 1.118361424 803 g3427.t1 2653 g4718.t1 K12854: SNRNP200, 7.533706795 BRR2 802 g1849.t1 2652 g1896.t1 K00938: E2.7.4.2, mvaK2 8.103944385 804 g19694.t1 2654 g7947.t1 K02142: ATPeFJ, ATP18 4.724478914 805 g6500.t1 2655 g2087.t1 K11548: NUF2, CDCA1 4.167333488 808 g11718.t1 2657 g2320.t1 6.955332876 807 g2706.t1 2513 g8366.t1 K11649: SMARCC 5.407509356 806 g3663.t1 2656 g656.t1 K00632: E2.3.1.16, fadA 6.107648999 809 g4795.t1 2658 g3691.t1 2.814605061 810 g9159.t1 2659 g6490.t1 12.37001214 812 g7897.t1 2661 g8633.t1 K12191: CHMP2A 6.149239272 811 g4381.t1 2660 g2138.t1 K14846: RPF1 4.661983349 813 g15305.t1 2662 g10450.t1 K01915: glnA, GLUL 1.326818728 814 g12732.t1 2663 g5706.t1 0 815 g9791.t1 2664 g893.t1 4.682251788 816 g14760.t1 2665 g9241.t1 2.816496891 817 g5187.t1 2666 g3776.t1 K01277: E3.4.14.4, DPP3 5.729836476 818 g7634.t1 2667 g7610.t1 K10773: NTH 6.081778745 819 g13477.t1 2668 g8720.t1 K10295: FBXO9 5.178686522 820 g12592.t1 2669 g2931.t1 6.934534554 821 g10987.t1 2670 g5653.t1 0 822 g12590.t1 2671 g2934.t1 6.223414116 823 g10222.t1 2672 g11207.t1 4.643453596 825 g3983.t1 2674 g7058.t1 K01613: psd, PISD 5.451665752 824 g11510.t1 2673 g4221.t1 4.286646074 826 g9393.t1 2675 g3641.t1 8.751164208 827 g9881.t1 2676 g11623.t1 0 828 g13221.t1 2677 g672.t1 0 829 g3561.t1 2678 g3326.t1 4.733400818 830 g8670.t1 2679 g10955.t1 4.749528223 831 g708.t1 2680 g9946.t1 0.954625619 832 g11009.t1 2681 g5663.t1 K11121: SIR2 0 833 g7419.t1 2682 g7204.t1 K13754: SLC24A6, NCKX6 6.27610662 835 g3224.t1 2684 g6091.t1 3.344134063 834 g12947.t1 2683 g9800.t1 0 836 g6094.t1 2685 g7354.t1 6.09853587 837 g7427.t1 2686 g7212.t1 K01549: TIM11, ATP21 5.301910749 838 g6135.t1 2687 g7308.t1 K03844: ALG11 4.695297001 839 g5057.t1 2688 g8325.t1 K00326: E1.6.2.2 5.161405198 840 g3875.t1 2689 g4019.t1 1.368553327 841 g21658.t1 2690 g4834.t1 6.709472946 842 g7438.t1 2691 g7223.t1 4.971359373 843 g7605.t1 2692 g7631.t1 K06942: K06942 4.937065903 844 g6721.t1 2693 g4326.t1 1.642040135 845 g7857.t1 2694 g10514.t1 0 846 g3614.t1 2695 g588.t1 K12604: CNOT1, NOT1 6.72026689 847 g11968.t1 2696 g7463.t1 0 848 g6429.t1 2697 g5353.t1 5.059361503 849 g20508.t1 2698 g3950.t1 0 850 g7165.t1 2699 g555.t1 3.895318144 851 g4535.t1 2700 g4065.t1 8.36766264 852 g20378.t1 2701 g3507.t1 0 853 g8160.t1 2702 g11151.t1 7.072684453 854 g6555.t1 2703 g10091.t1 K00286: E1.5.1.2, proC 5.981191238 855 g5572.t1 2704 g7489.t1 6.099888984 856 g2329.t1 2543 g9194.t1 7.114801788 857 g1250.t1 2705 g434.t1 5.533904052 858 g11133.t1 2706 g753.t1 K06972: K06972 4.000597283 859 g490.t1 2536 g5492.t1 K01230: MAN1 4.455711732 860 g7575.t1 2707 g7666.t1 K11272: MRC1 7.443866007 861 g6402.t1 2708 g5392.t1 0 519 g31.t1 2315 g2840.t1 K02437: gcvH, GCSH 7.667805418 862 g11374.t1 2709 g5061.t1 K16803: CKAP5, 0 XMAP215 863 g6116.t1 2710 g7333.t1 K02258: COX11 0 864 g7600.t1 2711 g7636.t1 K17768: TOM70 5.478745927 865 g7609.t1 2712 g7627.t1 6.110778129 866 g670.t1 2713 g9895.t1 5.389860972 867 g3288.t1 2714 g8848.t1 0 868 g1739.t1 2715 g9739.t1 K01918: panC 1.723333708 869 g2853.t1 2716 g9055.t1 3.661150117 870 g11104.t1 2717 g718.t1 5.331556226 871 g2178.t1 2718 g11917.t1 4.412098474 872 g4449.t1 2719 g6805.t1 7.334855344 873 g5221.t1 2720 g3709.t1 K01240: URH1 4.395333747 874 g2815.t1 2721 g9114.t1 K01193: E3.2.1.26, sacA 6.290191463 875 g2269.t1 2722 g10685.t1 2.551428828 876 g2163.t1 2723 g11902.t1 5.298538589 877 g3515.t1 2724 g2207.t1 3.347586286 878 g6074.t1 2725 g3347.t1 6.324042809 879 g11929.t1 2726 g2071.t1 6.098181798 880 g6915.t1 2727 g1291.t1 K00505: TYR 6.540932521 881 g1756.t1 2728 g1207.t1 K15201: GTP3C3, TFC4 6.731005978 882 g6770.t1 2729 g4386.t1 5.731686881 883 g10376.t1 2730 g10544.t1 K02990: RP-S6, MRPS6, 0 rpsF 884 g9812.t1 2731 g10826.t1 K01899: LSC1 5.913334166 885 g9618.t1 2732 g7244.t1 0 886 g2442.t1 2733 g6711.t1 K10998: CSM3, SWI3 6.56163386 887 g17691.t1 2734 g559.t1 5.586773168 889 g10183.t1 2736 g11138.t1 K17878: NNT1 4.422235435 888 g7714.t1 2735 g3081.t1 K01070: frmB, ESD, fghA 4.789610997 890 g2359.t1 2737 g9253.t1 8.893941672 891 g4991.t1 2738 g8961.t1 K15901: CGI121, TPRKB 5.458778357 892 g106.t1 2739 g2927.t1 4.560793659 893 g7472.t1 2740 g6864.t1 K10839: RAD23, HR23 6.506527453 894 g4849.t1 2741 g4462.t1 6.018049911 895 g4668.t1 2742 g10566.t1 K01312: PRSS 9.271875621 896 g9585.t1 2743 g6636.t1 K06675: SMC4 0 897 g2963.t1 2744 g5934.t1 4.375328682 898 g7232.t1 2745 g10757.t1 K09313: CUTL 8.116353121 899 g19769.t1 2746 g11692.t1 4.972241584 900 g7022.t1 2747 g6357.t1 0 901 g9259.t1 2748 g10437.t1 6.69953931 902 g12328.t1 2749 g7434.t1 K01710: E4.2.1.46, rfbB, 3.685729613 rffG 903 g2849.t1 2750 g9051.t1 7.214498977 904 g17779.t1 2751 g662.t1 4.282054458 905 g8550.t1 2752 g5428.t1 K08838: STK24_25_MST4 5.000505255 906 g10940.t1 2753 g1025.t1 K00100: E1.1.1. 4.956194307 907 g11117.t1 2754 g735.t1 5.648961974 562 g1904.t1 2359 g5010.t1 K16261: YAT 2.226821689 908 g3804.t1 2755 g8748.t1 5.793251762 909 g3244.t1 2756 g8218.t1 K02838: frr, MRRF, RRF 0 910 g11369.t1 2757 g10756.t1 5.176727673 611 g7102.t1 2410 g5569.t1 4.138124976 911 g677.t1 2758 g9875.t1 K07140: K07140 5.281680888 679 g4287.t1 2759 g1939.t1 K00275: pdxH, PNPO 4.95193285 912 g7511.t1 2760 g10316.t1 K08286: E2.7.11. 6.009945831 913 g1830.t1 2761 g1716.t1 7.072977042 914 g6552.t1 2762 g10088.t1 K14572: MDN1, REA1 4.349948417 915 g74.t1 2763 g917.t1 K00480: E1.14.13.1 5.955742918 916 g5429.t1 2764 g3125.t1 4.987582363 917 g8498.t1 2765 g3370.t1 5.820660636 918 g7844.t1 2766 g10497.t1 5.848243945 919 g5407.t1 2767 g8613.t1 0 921 g4889.t1 2769 g4523.t1 K14209: SLC36A, PAT 5.82364098 920 g2118.t1 2768 g2464.t1 K01560: E3.8.1.2 3.940755827 922 g4577.t1 2770 g4105.t1 2.560658097 923 g6091.t1 2771 g7357.t1 K12193: VPS24, CHMP3 2.859023838 924 g4043.t1 2772 g3220.t1 5.096464748 925 g10590.t1 2773 g7033.t1 K01190: lacZ 0 926 g11987.t1 2774 g2441.t1 K15172: SUPT5H, SPT5 6.055881291 927 g7118.t1 2775 g5583.t1 K06670: SCC1, MCD1, 7.656991383 RAD21 928 g9841.t1 2776 g9760.t1 8.545788709 929 g10869.t1 2777 g134.t1 0 930 g8799.t1 2778 g9975.t1 4.851135285 931 g3513.t1 2779 g2205.t1 K12041: SLC9A6_7, 4.628300692 NHE6_7 932 g4464.t1 2780 g6823.t1 K00111: glpA, gtpD 4.913318358 933 g912.t1 2781 g9350.t1 6.681560463 934 g6047.t1 2482 g264.t1 5.833182512 935 g8273.t1 2782 g9995.t1 5.609052156 936 g8132.t1 2783 g7944.t1 K14526: POP7, RPP2 5.431104442 937 g8077.t1 2540 g7846.t1 6.924579829 938 g10164.t1 2784 g6116.t1 6.523454108 940 g8187.t1 2785 g7995.t1 K03325: TC.ACR3 8.04995065 939 g4598.t1 2528 g6014.t1 3.985835911 941 g10685.t1 2786 g8531.t1 4.755054229 942 g4368.t1 2787 g3790.t1 5.47962036 944 g5574.t1 2789 g7491.t1 K11370: AHC1 7.953609684 943 g10154.t1 2788 g8466.t1 K03661: ATPeV0B, ATP6F 2.459230154 945 g6618.t1 2790 g11273.t1 K14333: DHBD 8.223627165 946 g4717.t1 2791 g2039.t1 6.556761484 947 g3409.t1 2792 g6220.t1 6.131735085 948 g11995.t1 2793 g2451.t1 4.464464914 949 g2327.t1 2794 g9192.t1 4.697725891 950 g4993.t1 2795 g8964.t1 5.277688941 951 g9979.t1 2796 g9685.t1 K15148: MED7 0 952 g6193.t1 2797 g11718.t1 6.836216759 953 g4069.t1 2798 g3263.t1 4.437917777 954 g10250.t1 2799 g3606.t1 12.0823581 955 g5983.t1 2800 g11682.t1 5.452835216 957 g11115.t1 2802 g733.t1 6.202864972 956 g3228.t1 2801 g6074.t1 4.204057944 958 g9407.t1 2803 g3620.t1 4.931825845 959 g1828.t1 2804 g1714.t1 K13535: CLD1 4.463119082 960 g3944.t1 2805 g3947.t1 5.535649157 961 g7851.t1 2806 g10505.t1 5.044625434 962 g18788.t1 2807 g387.t1 6.532520126 963 g9384.t1 2808 g3650.t1 K02210: MCM7, CDC47 6.91078027 964 g1127.t1 2809 g226.t1 K13210: FUBP 7.124489061 965 g96.t1 2810 g2917.t1 0 966 g6648.t1 2811 g10192.t1 K12868: SYF2 0 967 g1350.t1 2812 g7381.t1 0 968 g13893.t1 2813 g6198.t1 K07034: K07034 6.848687422 969 g4507.t1 2814 g10812.t1 3.840346233 970 g3241.t1 2815 g8215.t1 0 971 g11754.t1 2816 g9856.t1 K01779: E5.1.1.13 5.221579117 972 g1351.t1 2817 g6327.t1 0 973 g2037.t1 2818 g2568.t1 K12659: ARG56 0 974 g1683.t1 2819 g4660.t1 K10625: UBR1 3.398274676 975 g12749.t1 2820 g12137.t1 0 976 g9482.t1 2821 g5768.t1 6.71765746 977 g11380.t1 2822 g5068.t1 0 978 g6127.t1 2823 g7319.t1 K07213: ATOX1, ATX1, 11.50816411 copZ 979 g270.t1 2824 g7700.t1 6.248619031 980 g6423.t1 2825 g5361.t1 3.403273853 981 g10729.t1 2826 g2908.t1 K03448: FEN2, LIZ1 0 982 g3774.t1 2827 g6851.t1 0 983 g8680.t1 2828 g10944.t1 K13621: BTA1 0 985 g11533.t1 2830 g4194.t1 K00928: lysC 8.670529213 984 g2060.t1 2829 g2537.t1 4.647437267 987 g6588.t1 2832 g10117.t1 5.93851127 986 g9187.t1 2831 g6519.t1 0.369867578 988 g2854.t1 2833 g4992.t1 3.667696129 989 g173.t1 2834 g5800.t1 K07119: K07119 9.370340141 545 g10561.t1 2342 g1546.t1 0 990 g5941.t1 2835 g2881.t1 0 991 g2978.t1 2836 g8309.t1 0 992 g1958.t1 2837 g6209.t1 9.099456694 993 g12003.t1 2838 g10167.t1 4.021343839 994 g18673.t1 2839 g8118.t1 1.798228538 996 g11700.t1 2841 g6614.t1 K03860: PIGQ, GPI1 4.969629765 997 g5957.t1 2842 g6229.t1 K01056: PTH1, pth, 0 spoVC 995 g21700.t1 2840 g5543.t1 3.167921414 998 g8304.t1 2843 g5092.t1 K10253: K10253 4.621044993 1000 g697.t1 2845 g9928.t1 K03941: NDUFS8 5.799554424 999 g10287.t1 2844 g36.t1 K15444: TRM9 0 1001 g2303.t1 2846 g10723.t1 K07441: ALG14 5.074009843 1002 g6384.t1 2847 g759.t1 6.12726441 1003 g7586.t1 2848 g7651.t1 5.043611275 1004 g8534.t1 2849 g6285.t1 0 1005 g5408.t1 2850 g8612.t1 K00276: AOC3, AOC2, 0 tynA 1006 g8194.t1 2851 g8514.t1 6.303747883 1007 g13118.t1 2852 g7773.t1 0 1008 g9153.t1 2853 g6485.t1 K18716: NUP42, RIP1 6.170706947 1009 g6545.t1 2854 g10082.t1 K03885: ndh 0 1010 g7749.t1 2855 g7099.t1 K01512: acyP 1.405819898 1011 g19631.t1 2856 g6634.t1 2.571565788 1012 g522.t1 2857 g889.t1 10.81615793 1013 g3484.t1 2858 g2151.t1 0 1014 g12598.t1 2859 g12.t1 5.489807798 1016 g2711.t1 2861 g8361.t1 K07195: EXOC7, EXO70 4.061048103 1015 g579.t1 2860 g3880.t1 K14826: FPR3_4 4.281193383 1017 g5304.t1 2862 g2266.t1 1.064282379 1018 g15818.t1 2863 g5620.t1 5.095758915 1019 g11541.t1 2864 g4185.t1 K15710: SHPRH 9.337717858 1020 g5073.t1 2865 g8342.t1 K08008: NOX, GP91 0 1022 g6955.t1 2867 g6434.t1 K14860: TMA16 5.89989351 1021 g6610.t1 2866 g10146.t1 9.37786699 1023 g11689.t1 2868 g10851.t1 K10405: KIFC1 3.582191481 1024 g4428.t1 2869 g6761.t1 7.515504705 1025 g3928.t1 2870 g3964.t1 7.606070252 1028 g4373.t1 2873 g2130.t1 K13501: TRP1 5.255678294 1027 g10552.t1 2872 g6698.t1 0 1026 g4264.t1 2871 g1718.t1 0 1029 g7551.t1 2874 g7255.t1 K14640: SLC20A, PIT 2.536552173 1030 g73.t1 2875 g914.t1 4.346084349 1031 g10225.t1 2876 g11203.t1 9.413047495 1032 g5522.t1 2877 g1649.t1 K11699: RDR, RDRP 5.864561275 1033 g7042.t1 2878 g6333.t1 4.730082423 1034 g4256.t1 2879 g1726.t1 K11254: H4 5.392555643 1036 g1108.t1 2881 g4055.t1 K11131: DKC1, NOLA4, 4.027072029 CBF5 1035 g8681.t1 2880 g10943.t1 K00237: SDHD, SDH4 0 1037 g11120.t1 2520 g739.t1 K11309: RTT109, KAT11 5.304552729 1038 g10725.t1 2882 g4263.t1 K01495: GCH1, folE 7.095909192 1039 g9660.t1 2883 g4874.t1 0.457027413 1040 g8820.t1 2884 g3030.t1 5.372767428 1041 g4065.t1 2885 g3253.t1 K03362: FBXW1_11, 3.768457818 BTRC, beta-TRCP 1042 g5448.t1 2886 g3163.t1 5.226224828 1043 g7588.t1 2887 g7649.t1 6.811316171 1044 g3582.t1 2888 g5074.t1 K00293: LYS9 3.263233452 1045 g6422.t1 2889 g5364.t1 2.147147382 483 g10693.t1 2485 g8538.t1 5.662368091 1046 g6032.t1 2890 g11214.t1 8.820793561 1047 g6561.t1 2891 g10097.t1 5.654687421 1048 g2191.t1 2892 g11582.t1 K03352: APCS 4.67408688 1049 g8669.t1 2893 g10956.t1 4.818547725 1050 g5585.t1 2894 g7506.t1 K14300: NUP133 5.450216932 1051 g6577.t1 2895 g2327.t1 8.791267353 1052 g4912.t1 2896 g4547.t1 0 1053 g5600.t1 2897 g7522.t1 K17787: AIMS 0 1054 g59.t1 2898 g2750.t1 K09529: DNAJC9 0 1055 g2459.t1 2899 g6731.t1 2.631378842 1056 g3841.t1 2900 g2574.t1 5.178143897 1058 g10928.t1 2902 g11230.t1 K09291: TPR 2.438636081 1057 g4517.t1 2901 g10822.t1 0 1059 g5642.t1 2903 g9240.t1 10.22312916 1060 g5649.t1 2904 g1103.t1 4.544636216 1061 g11163.t1 2905 g4845.t1 K00838: ARO8 0.832183706 1062 g5464.t1 2906 g8437.t1 K01487: E3.5.4.3, guaD 4.270772945 1063 g6448.t1 2907 g5337.t1 0.704996832 1064 g546.t1 2908 g5611.t1 5.264731099 1065 g970.t1 2909 g8041.t1 5.740601251 1066 g196.t1 2910 g5304.t1 4.777372465 1067 g1283.t1 2911 g473.t1 0 1068 g12044.t1 2912 g803.t1 5.498118982 1069 g9074.t1 2913 g8565.t1 0 1070 g10056.t1 2914 g2782.t1 K05351: E1.1.1.9 7.25059785 1071 g12237.t1 2915 g11133.t1 K17878: NNT1 4.149357354 1072 g4465.t1 2916 g6824.t1 5.086524971 1073 g1040.t1 2917 g8111.t1 0 1074 g8432.t1 2918 g2491.t1 0 1075 g9956.t1 2919 g11404.t1 0 1077 g4593.t1 2921 g6010.t1 6.800127858 1076 g449.t1 2920 g8027.t1 2.548177204 1078 g15695.t1 2922 g10590.t1 0 1079 g7238.t1 2923 g10763.t1 6.636516842 1080 g2270.t1 2924 g10687.t1 K01551: arsA, ASNA1 1.338776738 1081 g7667.t1 2925 g7562.t1 K01469: OPLAH, OXP1, 4.982517875 OplAH 1082 g5077.t1 2926 g4465.t1 K01193: E3.2.1.26, sacA 0 1083 g6226.t1 2927 g7123.t1 K12609: CAF120 5.821481969 1084 g5075.t1 2928 g2985.t1 0 1085 g13910.t1 2929 g8741.t1 3.759982388 1086 g8085.t1 2930 g7863.t1 7.812628972 1087 g10423.t1 2931 g8402.t1 K14327: UPF2, RENT2 5.380749971 1088 g11332.t1 2932 g11641.t1 4.160151798 1089 g7007.t1 2933 g6374.t1 K12600: SKI3, TTC37 0 1090 g2160.t1 2934 g11899.t1 2.646205187 1091 g3470.t1 2935 g2763.t1 K00140: mmsA, iolA, 6.130826774 ALDH6A1 1092 g10929.t1 2936 g11231.t1 K14805: DDX24, MAK5 4.672508797 1093 g5608.t1 2937 g7532.t1 0.756308574 1094 g7845.t1 2938 g10498.t1 K03434: PIGL 8.181737455 1095 g15860.t1 2939 g6739.t1 K09831: ERG5 5.065082896 1096 g584.t1 2940 g3874.t1 K01520: dut, DUT 4.447661542 1097 g5992.t1 2941 g11691.t1 K06276: PDPK1 4.323838023 1098 g9408.t1 2942 g3619.t1 6.248005823 1099 g12324.t1 2943 g7430.t1 K03936: NDUFS3 4.250138533 1100 g8165.t1 2944 g7972.t1 0.505090398 1101 g6804.t1 2945 g4428.t1 K15128: MED6 3.937924735 1102 g4151.t1 2946 g1828.t1 K03327: TC.MATE, 5.671937128 SLC47A, norM, mdtK, dinF 1103 g7170.t1 2947 g560.t1 5.705181185 1104 g8819.t1 2948 g3028.t1 K09252: E3.1.1.73 6.425640233 1105 g10490.t1 2949 g1671.t1 0.267350656 1106 g10438.t1 2950 g8414.t1 K11090: LA, SSB 4.175176818 1107 g7152.t1 2951 g11953.t1 4.892910278 1108 g7945.t1 2952 g9700.t1 K15272: SLC35A1_2_3 3.910911941 1110 g5482.t1 2954 g9825.t1 K03544: clpX, CLPX 5.959845259 1109 g9746.t1 2953 g1027.t1 0 1111 g7512.t1 2955 g10315.t1 K10268: FBXL2_20 5.036102597 1112 g9423.t1 2956 g10310.t1 K17678: MRH4 5.698279892 1113 g4358.t1 2957 g427.t1 K15394: ACE1 8.430767836 1114 g2440.t1 2958 g6709.t1 8.194390826 1115 g7412.t1 2959 g7196.t1 K17786: MOS2 4.719997185 1116 g7292.t1 2960 g11859.t1 K17267: COPG 5.289893047 479 g10141.t1 2484 g8477.t1 5.541093332 1117 g5887.t1 2961 g10973.t1 7.17403047 1119 g1144.t1 2963 g256.t1 4.804829552 1118 g6530.t1 2962 g10068.t1 K12345: SRD5A3 6.05975643 1120 g1388.t1 2964 g3922.t1 K11108: RCL1 0 660 g8547.t1 2461 g10270.t1 K02865: RP-L10Ae, 4.653519091 RPL10A 1121 g1443.t1 2965 g6990.t1 6.353729544 557 g5845.t1 2354 g1158.t1 K02985: RP-S3e, RPS3 6.78958802 1122 g1775.t1 2966 g1180.t1 2.44192219 1123 g5301.t1 2967 g2268.t1 4.832199777 1124 g5630.t1 2968 g1133.t1 K10808: RRM2 3.538433491 1125 g10024.t1 2969 g8702.t1 0 1126 g2219.t1 2970 g2626.t1 5.454955353 1127 g3982.t1 2971 g7057.t1 K07824: E1.14.13.12 4.476939292 1129 g8840.t1 2973 g1272.t1 3.816201878 1128 g9861.t1 2972 g11455.t1 K06101: ASH1L 0 1130 g4800.t1 2974 g676.t1 5.81071258 1131 g11654.t1 2975 g8005.t1 2.909017487 1132 g1136.t1 2976 g245.t1 10.59339274 1133 g7223.t1 2977 g5892.t1 5.576672157 1134 g3646.t1 2978 g623.t1 6.238451943 1135 g11372.t1 2979 g5059.t1 0 1138 g6590.t1 2982 g10119.t1 4.776549031 1136 g1968.t1 2980 g6227.t1 5.415945903 1137 g991.t1 2981 g8058.t1 4.169458418 1139 g14.t1 2983 g11312.t1 5.71723547 1140 g8611.t1 2984 g3033.t1 3.208304365 1141 g6942.t1 2985 g6445.t1 K00988: APA1_2 0.122356187 1142 g4972.t1 2986 g8937.t1 K13953: adhP 1.662757196 1143 g11708.t1 2987 g6617.t1 6.393154936 1144 g6627.t1 2988 g10177.t1 4.492307379 1145 g3793.t1 2989 g2622.t1 K00632: E2.3.1.16, 2.683933449 fadA 1146 g5362.t1 2990 g9549.t1 5.333486397 1147 g14458.t1 2991 g213.t1 K03417: prpB 5.793822468 1148 g3972.t1 2992 g7050.t1 K09274: K09274 4.82960772 1149 g9183.t1 2993 g6515.t1 1.762573342 1150 g3346.t1 2994 g4782.t1 0 1151 g15347.t1 2995 g9963.t1 5.425175011 1152 g610.t1 2996 g3850.t1 0 1153 g5842.t1 2997 g1161.t1 4.563717732 1154 g13891.t1 2998 g7379.t1 0 1155 g13895.t1 2999 g3474.t1 K07407: E3.2.1.22B, 6.607561086 galA, rafA 1156 g5991.t1 3000 g11690.t1 K11650: SMARCD 6.177996747 1157 g6045.t1 3001 g11733.t1 2.901234647 1158 g5636.t1 3002 g1113.t1 K08818: CDC2L 7.197842208 1159 g7137.t1 2541 g530.t1 K09702: K09702 5.111190124 1160 g2933.t1 3003 g5977.t1 6.559889482 1161 g505.t1 3004 g5519.t1 3.863129552 1162 g7769.t1 3005 g7721.t1 5.577160458 1163 g7156.t1 3006 g544.t1 6.758034692 1165 g930.t1 3008 g9329.t1 5.15713035 1164 g13110.t1 3007 g9758.t1 0 1166 g586.t1 3009 g3871.t1 3.781116872 577 g1391.t1 2375 g3917.t1 3.770913064 1168 g10165.t1 3011 g7723.t1 K01455: E3.5.1.49 5.879458438 1167 g2887.t1 3010 g10878.t1 K00102: E1.1.2.4, dld 4.602956869 689 g849.t1 2496 g9453.t1 K06997: K06997 3.120625144 1169 g7214.t1 3012 g5878.t1 4.495077603 1170 g18895.t1 3013 g5859.t1 K10845: TTDA, GTF2H5, 5.98025722 TFB5 1171 g8250.t1 3014 g10029.t1 4.39864019 1172 g2364.t1 3015 g9259.t1 9.213191896 1173 g560.t1 3016 g7760.t1 K07819: B3GALT1 0 1174 g5544.t1 3017 g11318.t1 K01874: MARS, metG 5.478905924 1175 g2772.t1 3018 g9139.t1 K14840: NOP53, 0 GLTSCR2 1176 g5248.t1 3019 g2343.t1 8.877204443 532 g27.t1 2329 g1583.t1 6.169854164 1177 g10546.t1 3020 g6691.t1 K12196: VPS4 0 1178 g12603.t1 3021 g1139.t1 K13201: TIA1, TIAL1 3.823455116 1179 g2082.t1 3022 g2515.t1 4.08648863 1180 g4868.t1 3023 g4487.t1 K18106: GAAA 5.341364148 666 g9261.t1 2467 g10439.t1 K01336: E3.4.21.48 4.328483282 1181 g4732.t1 3024 g2022.t1 3.266778123 1183 g8014.t1 3026 g3407.t1 K05994: E3.4.11.10 5.396879706 1182 g2889.t1 3025 g10880.t1 5.096458376 1184 g6241.t1 3027 g7141.t1 2.980899445 1185 g10185.t1 3028 g11141.t1 K12842: SR140 4.806643797 1186 g3181.t1 3029 g4963.t1 5.389590661 1187 g1146.t1 3030 g259.t1 0 1188 g3478.t1 3031 g4668.t1 K15118: SLC25A38 7.188127807 1189 g10812.t1 3032 g11469.t1 4.970990313 1190 g5729.t1 3033 g5268.t1 4.667119257 1191 g5773.t1 3034 g5183.t1 K18468: VPS35 2.974567603 1192 g8342.t1 3035 g5156.t1 7.147347587 1193 g2809.t1 3036 g9099.t1 8.970300194 1194 g3231.t1 3037 g6067.t1 5.450346027 1195 g15441.t1 3038 g27.t1 K02135: ATPeF1E, 0 ATP5E, ATP15 1196 g4098.t1 3039 g3297.t1 6.95311286 1197 g4149.t1 3040 g1830.t1 5.595722786 1198 g10768.t1 3041 g811.t1 K13281: uvsE, UVE1 6.312249915 1199 g6034.t1 3042 g11722.t1 3.569534287 1200 g7215.t1 3043 g5884.t1 K08141: MAL 4.164169033 1201 g8488.t1 3044 g3354.t1 3.054782379 1202 g8852.t1 3045 g1260.t1 0.276187354 1203 g17481.t1 3046 g6577.t1 K03457: TC.NCS1 4.118885089 1204 g6412.t1 3047 g5378.t1 0 1205 g5249.t1 3048 g2342.t1 4.593408785 1206 g4308.t1 3049 g1957.t1 K01934: E6.3.3.2 4.385816144 1207 g9497.t1 3050 g5756.t1 K12816: CDC40, PRP17 2.377976634 480 g3149.t1 2377 g4998.t1 K01213: E3.2.1.67 0 1208 g16357.t1 3051 g3292.t1 2.274644449 1209 g7653.t1 3052 g7536.t1 K02218: CSNK1, CK1 5.559496827 1210 g2461.t1 3053 g6733.t1 K17498: SPN1, IWS1 4.599947501 1211 g2212.t1 3054 g11601.t1 K15116: SLC25A33_36, 4.637281551 RIM2 1212 g10883.t1 3055 g172.t1 0 1213 g7108.t1 3056 g5573.t1 4.49020983 1214 g4692.t1 3057 g10596.t1 K00559: E2.1.1.41, 5.217966775 SMT1, ERG6 1215 g7001.t1 3058 g6383.t1 0 1217 g11520.t1 3060 g4211.t1 K01273: E3.4.13.19, 5.534704503 DPEP1 1216 g470.t1 3059 g8009.t1 K03235: EF3, TEF3 2.63960049 1218 g2297.t1 3061 g10716.t1 6.357052968 1219 g7855.t1 3062 g10512.t1 5.263495212 1221 g1216.t1 3064 g370.t1 7.767118225 1220 g15283.t1 3063 g10473.t1 0.148112638 1222 g5238.t1 3065 g2356.t1 8.469488529 1223 g16230.t1 3066 g10013.t1 6.19115729 1226 g14146.t1 3069 g3433.t1 5.134598916 1225 g882.t1 3068 g9407.t1 K12468: PAD1 5.834927879 1224 g10984.t1 3067 g5650.t1 0 1227 g6996.t1 3070 g6388.t1 K01104: E3.1.3.48 0 1228 g4042.t1 3071 g3218.t1 K10426: DCTN4 3.476006591 1229 g10440.t1 3072 g8416.t1 4.661283453 1230 g3798.t1 3073 g9469.t1 6.108299926 1233 g5250.t1 3076 g2341.t1 4.192956387 1231 g17491.t1 3074 g10533.t1 2.340628751 1232 g5149.t1 3075 g3828.t1 K11369: RTG2 2.742167769 1234 g10738.t1 3077 g11985.t1 K10798: PARP 0 1235 g188.t1 3078 g5816.t1 K18342: OTUD6 4.706797138 678 g2539.t1 2558 g3572.t1 8.765149435 1236 g9576.t1 3079 g6624.t1 K05355: hexPS, COQ1 0 1237 g7963.t1 3080 g10258.t1 6.877809835 1238 g2081.t1 3081 g2516.t1 3.748359597 1239 g4635.t1 3082 g2418.t1 4.337082348 1240 g1191.t1 3083 g351.t1 K14997: SLC38A11 0.860169772 1241 g3500.t1 3084 g2191.t1 1.215931569 1242 g1860.t1 3085 g1884.t1 5.590523487 1243 g7767.t1 3086 g891.t1 4.764291974 1244 g2268.t1 3087 g10684.t1 5.863717773 1245 g4613.t1 3088 g7741.t1 K00463: INDO 1.444624706 683 g9852.t1 3089 g9791.t1 7.876491011 1246 g4349.t1 3090 g2121.t1 1.532279358 1247 g8581.t1 3091 g6606.t1 K00558: DNMT1, dcm 4.21948707 1249 g9842.t1 3093 g9770.t1 K18576: XEG 6.122795741 1248 g2125.t1 3092 g2952.t1 K01480: E3.5.3.11, speB 4.351289056 1250 g10362.t1 3094 g5453.t1 4.153669397 1257 g12070.t1 3101 g7821.t1 K15356: VRG4, GONST1 4.864054909 1256 g4657.t1 3100 g2389.t1 5.666968159 1252 g6958.t1 3096 g6431.t1 K11968: ARIH1 3.357418226 1253 g19310.t1 3097 g9485.t1 5.087660505 1255 g10767.t1 3099 g12013.t1 K16833: PPP1R2, IPP2 3.101333549 1251 g11977.t1 3095 g12286.t1 5.145090044 1254 g8978.t1 3098 g11390.t1 0 1258 g21710.t1 3102 g9500.t1 1.238938387 1259 g7491.t1 3103 g10328.t1 3.324272702 1260 g7956.t1 3104 g10264.t1 6.737632146 1261 g7964.t1 3105 g10257.t1 6.468663015 1262 g7455.t1 3106 g6879.t1 7.133634176 1264 g7919.t1 3108 g8603.t1 7.707220525 1263 g6189.t1 3107 g9611.t1 3.290429112 1265 g16176.t1 2509 g5232.t1 3.961883001 1266 g8674.t1 3109 g10950.t1 4.335667589 1267 g9656.t1 3110 g4870.t1 K12844: PRPF31 1.499922726 1268 g7488.t1 3111 g10325.t1 K11240: MSG5 4.501108392 1269 g7672.t1 3112 g7571.t1 3.989155638 1270 g55.t1 3113 g2746.t1 K14567: UTP14 5.127910319 1272 g9412.t1 3115 g3614.t1 7.062307238 1271 g1753.t1 3114 g9720.t1 4.044374876 1273 g10977.t1 3116 g5641.t1 K10735: GINS4, SLD5 4.051828119 1274 g17737.t1 3117 g6552.t1 K01893: NARS, asnS 6.388427463 1275 g10487.t1 3118 g1673.t1 K17774: MDM10 2.164706382 1276 g6558.t1 3119 g10094.t1 K00643: E2.3.1.37, 6.31176497 ALAS 1277 g2287.t1 3120 g9659.t1 4.38553855 1278 g842.t1 3121 g9463.t1 0 1279 g2517.t1 3122 g3549.t1 5.937036867 1280 g3451.t1 3123 g4694.t1 K18803: HPM1 7.686438949 1281 g6141.t1 3124 g7301.t1 4.843357772 1282 g12211.t1 3125 g8489.t1 4.086552127 1283 g9200.t1 3126 g6534.t1 6.260040742 1284 g5321.t1 3127 g2239.t1 7.891730863 1285 g3577.t1 3128 g3306.t1 7.444698622 1286 g16033.t1 3129 g8312.t1 K14961: RBBP5, SWD1, 6.814335139 CPS50 1287 g370.t1 3130 g8886.t1 K05351: E1.1.1.9 2.495983173 1288 g11747.t1 3131 g5055.t1 5.579800871 1289 g307.t1 3132 g9470.t1 K00450: E1.13.11.4 0 1290 g4252.t1 3133 g1730.t1 K14554: UTP21, WDR36 5.046177386 1291 g13249.t1 3134 g7068.t1 K00101: E1.1.2.3, lldD 0 1292 g97.t1 3135 g2918.t1 K17550: PPP1R7, SDS22 6.872034629 1293 g11152.t1 3136 g4836.t1 K01736: aroC 4.537533205 1294 g277.t1 3137 g11370.t1 0 1296 g1874.t1 3139 g4227.t1 3.147814191 1295 g10285.t1 3138 g38.t1 0 1297 g7205.t1 3140 g5869.t1 K04712: DEGS 3.678254356 1298 g3975.t1 3141 g7052.t1 K03127: TAF13 5.226674743 1299 g6129.t1 3142 g7317.t1 K18584: ACTR3, ARP3 0.131743499 1300 g1071.t1 3143 g8144.t1 K15163: SRB8, MED12 9.338879184 1301 g9776.t1 3144 g933.t1 K18696: GDE1 4.318349985 1302 g9449.t1 3145 g10284.t1 K08286: E2.7.11. 0.930122123 1303 g8139.t1 3146 g11353.t1 5.695078874 1304 g3952.t1 3147 g3939.t1 3.467152816 1306 g4583.t1 3149 g3309.t1 1.533947618 1305 g20261.t1 3148 g5213.t1 K15918: GLYK 0 1307 g7529.t1 3150 g7276.t1 6.576826873 1308 g6754.t1 3151 g4367.t1 K02209: MCM5, CDC46 2.459200585 1311 g491.t1 3154 g5498.t1 6.698116368 1309 g7837.t1 3152 g8557.t1 6.106640364 1310 g987.t1 3153 g8056.t1 0 1313 g17939.t1 3156 g10899.t1 6.818707989 1312 g2164.t1 3155 g11903.t1 5.515137675 1314 g3906.t1 3157 g3985.t1 K03190: ureD, ureH 2.671010414 1315 g1097.t1 3158 g4041.t1 0.505695041 1317 g3623.t1 3160 g595.t1 K16466: CETN3 4.801115612 1316 g8411.t1 3159 g4430.t1 0 1318 g20530.t1 3161 g9496.t1 0 1319 g1348.t1 3162 g3450.t1 K10438: E1.14.13.63, 3.588175282 phacB 1320 g3797.t1 3163 g2615.t1 6.056986997 1321 g7399.t1 3164 g7182.t1 5.018202134 1322 g5488.t1 3165 g9822.t1 3.362985644 1323 g9157.t1 3166 g6488.t1 K02324: POLE1 1.973709427 1324 g14847.t1 3167 g1437.t1 K00641: metX 6.994074013 1325 g6957.t1 3168 g6432.t1 K10746: EXO1 6.131134701 1326 g3447.t1 3169 g4698.t1 4.987346272 1327 g9400.t1 3170 g3632.t1 4.819542549 1328 g10198.t1 3171 g11163.t1 5.978274196 1331 g7497.t1 3174 g10332.t1 5.769438155 1330 g7426.t1 3173 g7211.t1 K07151: STT3 6.089321429 1329 g8972.t1 3172 g11360.t1 K00949: thiN, TPK1, 0 THI80 1332 g11012.t1 3175 g5666.t1 0 1335 g2680.t1 3178 g4137.t1 K03305: TC.POT 4.251138075 1334 g12334.t1 3177 g7439.t1 4.832463772 1333 g4070.t1 3176 g3266.t1 K08502: VAM7 5.539846457 1336 g6026.t1 3179 g11719.t1 6.095844652 1337 g3846.t1 3180 g3215.t1 5.151000423 1338 g5774.t1 3181 g5182.t1 4.645161281 1339 g3929.t1 3182 g3963.t1 K08866: TTK, MPS1 6.449588576 1340 g2818.t1 3183 g9112.t1 5.23098229 1341 g4639.t1 3184 g3141.t1 4.295463374 1342 g7766.t1 3185 g886.t1 K00276: AOC3, AOC2, 3.696502907 tynA 1343 g5178.t1 3186 g3785.t1 K10732: GINS1, PSF1 3.205102409 1344 g6934.t1 3187 g8796.t1 5.750734244 1345 g1969.t1 3188 g6228.t1 3.400168294 1346 g172.t1 3189 g12085.t1 K01531: E3.6.3.2, 6.497766777 mgtA, mgtB 1347 g11564.t1 3190 g4163.t1 K00274: MAO, aofH 2.200547724 1348 g6920.t1 3191 g6466.t1 K05607: AUH 3.935782227 1349 g155.t1 3192 g5222.t1 K00129: E1.2.1.5 0 1351 g4054.t1 3194 g3233.t1 K00222: TM7SF2, 4.246709844 ERG24 1350 g259.t1 3193 g11071.t1 2.005826005 1352 g2113.t1 3195 g6610.t1 5.320518398 1353 g18993.t1 3196 g1481.t1 6.460112374 1354 g9213.t1 3197 g9107.t1 K01535: E3.6.3.6 0.221964669 1355 g8608.t1 3198 g3036.t1 6.171130211 1359 g559.t1 3202 g3897.t1 6.201870178 1357 g1111.t1 3200 g4058.t1 K17792: TIM54 5.442528526 1358 g2917.t1 3201 g5991.t1 5.742797006 1356 g13698.t1 3199 g7803.t1 K15015: SLC32A, 3.095824509 VGAT 1360 g3970.t1 3203 g9872.t1 K14455: GOT2 6.495895484 1361 g6219.t1 3204 g7117.t1 K15030: EIF3M 9.064552828 1362 g9425.t1 3205 g10308.t1 K08850: AURKX 4.730673883 1363 g7501.t1 3206 g10336.t1 K18160: NDUFAF2 5.345072335 1364 g859.t1 3207 g9445.t1 6.22964011 1365 g1915.t1 3208 g6151.t1 7.270928698 1366 g12217.t1 3209 g1989.t1 K00826: E2.6.1.42, 3.918920739 ilvE 1367 g4170.t1 3210 g1809.t1 0.622664993 1368 g9398.t1 2532 g3634.t1 4.794435739 1369 g11911.t1 3211 g11961.t1 4.426580032 1370 g1975.t1 3212 g6235.t1 K03676: grxC, GLRX, 5.422460166 GLRX2 1371 g8163.t1 3213 g7963.t1 K16261: YAT 4.292364721 1372 g7701.t1 3214 g5632.t1 K16261: YAT 3.918348151 1373 g9062.t1 3215 g8589.t1 0 1374 g21743.t1 3216 g11779.t1 K01969: E6.4.1.4B 3.581364482 1375 g5576.t1 3217 g7494.t1 8.893181528 1376 g3089.t1 3218 g11792.t1 K00914: PIK3C3, 6.7596142 VPS34 1377 g5685.t1 3219 g1056.t1 K13524: ABAT 0 1378 g4641.t1 3220 g2414.t1 K03685: rnc, DROSHA, 0.412316469 RNT1 1379 g2363.t1 3221 g9258.t1 6.486658248 1380 g21382.t1 3222 g5714.t1 K07734: paiB 6.462845057 1381 g6400.t1 3223 g5394.t1 0 1382 g10337.t1 3224 g56.t1 4.374119128 1383 g5528.t1 3225 g1657.t1 K02896: RP-L24e, RPL24 5.059362323 1384 g11343.t1 3226 g11653.t1 K10981: POL4 6.259801244 1385 g5150.t1 3227 g3827.t1 2.931671142 1386 g6763.t1 3228 g4378.t1 K02321: POLA2 8.302494784 1387 g5671.t1 3229 g1071.t1 K11853: USP34 0 1388 g11809.t1 3230 g12052.t1 K11364: SGF29 3.463947854 1389 g11797.t1 3231 g11951.t1 3.516751262 1390 g10681.t1 3232 g8527.t1 5.58963777 1391 g4325.t1 3233 g11437.t1 13.11970013 1392 g9381.t1 3234 g3653.t1 5.511774101 1393 g7852.t1 3235 g10509.t1 6.882721316 616 g5090.t1 2415 g2954.t1 K08486: STX1B_2_3 0 1394 g3829.t1 3236 g2598.t1 0.266144622 1395 g11535.t1 3237 g4192.t1 K17279: REEP5_6 0.360331706 1396 g6481.t1 3238 g5293.t1 K01886: QARS, glnS 5.748896345 1397 g3005.t1 3239 g8297.t1 4.660135675 1398 g4078.t1 3240 g3277.t1 3.936715366 1399 g2855.t1 3241 g9059.t1 K00627: DLAT, aceF, 5.436104451 pdhC 1400 g3918.t1 3242 g3974.t1 K00297: metF, MTHFR 5.369411331 1401 g7179.t1 3243 g566.t1 K09523: DNAJC3 0.627178139 1402 g12408.t1 3244 g8249.t1 6.349198309 1403 g9652.t1 3245 g6915.t1 4.964995182 1404 g7523.t1 3246 g7288.t1 K13704: ABHD12 1.294755574 1405 g14653.t1 3247 g2855.t1 5.738900905 1406 g4096.t1 3248 g3295.t1 K17362: ACOT13 4.848799761 1407 g18248.t1 3249 g2041.t1 4.35781588 1408 g1237.t1 3250 g7426.t1 5.683015328 1410 g3632.t1 3252 g608.t1 3.639980584 1409 g5562.t1 3251 g7477.t1 4.810359052 1411 g5477.t1 3253 g8419.t1 K01876: DARS, aspS 5.822436425 1412 g9515.t1 3254 g6599.t1 K10729: SLD2 5.470455054 1413 g10318.t1 3255 g72.t1 3.677226697 1414 g24.t1 3256 g12134.t1 2.224553826 1415 g8240.t1 3257 g10040.t1 K17784: MINOS1, MOS1 4.505441621 1416 g7496.t1 3258 g10330.t1 4.295198041 1418 g5019.t1 3260 g8992.t1 K00763: pncB, NAPRT1 5.789644312 1417 g9422.t1 3259 g10311.t1 K17678: MRH4 4.99116655 1419 g6947.t1 3261 g6439.t1 4.318049534 1420 g1449.t1 3262 g6978.t1 7.510804913 1421 g11952.t1 3263 g5425.t1 K11886: ECM29 3.293996124 1422 g4463.t1 3264 g6821.t1 K03441: GLP-F 5.769121905 1423 g4565.t1 3265 g4096.t1 0.919084112 1424 g5152.t1 3266 g3825.t1 3.965633731 1425 g5796.t1 3267 g4861.t1 4.412444745 1426 g2106.t1 3268 g2479.t1 K17877: NIT-6 4.442382018 1427 g2132.t1 3269 g9887.t1 6.595948877 1428 g2743.t1 3270 g8874.t1 10.26584456 1429 g3255.t1 3271 g8226.t1 0 1430 g2515.t1 3272 g3546.t1 K03935: NDUFS2 2.995934045 1431 g11846.t1 3273 g8779.t1 5.108325438 1432 g4309.t1 3274 g1956.t1 K15436: TRPO3, MTR10 3.512784384 1433 g342.t1 3275 g8843.t1 K14617: LMBRD1 5.048487126 1434 g10330.t1 3276 g65.t1 K10592: HUWE1, MULE, 0 ARF-BP1 1435 g12736.t1 3277 g5713.t1 0 1436 g3120.t1 3278 g11825.t1 0 1437 g6122.t1 3279 g7325.t1 3.73309277 1438 g7506.t1 3280 g1313.t1 K02510: hpaI, hpcH 5.681359113 1439 g4219.t1 3281 g1764.t1 5.026702428 1440 g5995.t1 3282 g11694.t1 K08501: STX8 5.459232545 1441 g10838.t1 3283 g9836.t1 4.87039805 626 g2308.t1 2425 g10725.t1 5.237036425 1442 g6039.t1 3284 g11727.t1 K14809: DDX55, SPB4 5.042634955 1443 g4021.t1 3285 g3194.t1 4.255555246 1444 g7825.t1 3286 g8668.t1 7.009481452 1445 g7886.t1 3287 g8663.t1 5.301291022 1446 g13691.t1 3288 g9725.t1 2.720405954 1447 g3039.t1 3289 g8267.t1 K14779: DDX52, ROK1 4.859751136 1448 g5768.t1 3290 g5189.t1 K02948: RP-S11, 3.223518382 MRPS11, rpsK 1449 g8149.t1 3291 g7955.t1 7.075631425 1450 g13905.t1 3292 g4807.t1 5.937192138 1451 g9050.t1 3293 g5712.t1 0 1452 g11913.t1 3294 g658.t1 K14264: BNA3 3.176589195 1453 g11806.t1 3295 g12049.t1 K17260: ACTR2, ARP2 3.412479141 SEQ ID Median Exp. Adj. p- SYM00577 SYM00300 Log FC B-statistic t-statistic value 687 8.254570732 8.205162 7.709718 15.19085 5.97E06 700 5.044729998 5.210069 5.708895 10.76568 2.93E05 674 0.825824927 4.70074 5.191774 9.95863 4.34E05 688 1.8413995 4.97725 5.089442 9.80948 4.75E05 701 0.902872062 5.9827 4.978805 9.65176 5.17E05 702 5.088279289 4.707624 4.928839 9.581698 5.38E05 703 2.891582245 2.883676 4.49609 9.003087 8.38E05 704 2.188447902 4.35168 4.123845 8.54179 0.000127 686 8.452816333 4.967614 4.058607 8.464065 0.000136 675 4.361478247 4.207187 3.745443 8.102858 0.000183 705 4.099415046 4.001025 3.630507 7.974961 0.000207 706 2.609740762 4.37343 3.601634 7.94321 0.000212 707 6.497290601 5.707041 3.4962 7.828495 0.000234 708 11.29461044 9.891677 3.448641 7.777378 0.000245 709 2.522819857 2.630813 3.252018 7.570029 0.00029 517 7.516860158 7.229 2.98496 7.298142 0.000373 710 1.763743187 5.35718 2.961709 7.27498 0.00038 690 1.736488111 4.94929 2.879288 7.19348 0.000407 711 1.054868326 8.62274 2.615828 6.93929 0.000517 558 1.996511676 2.075046 2.565361 6.891657 0.000539 712 2.790411134 2.620375 2.511141 6.840843 0.000565 713 2.519717879 2.387448 2.41189 6.748785 0.000619 714 4.899566565 4.139604 2.330919 6.674579 0.000663 692 0.928859379 3.94891 2.315037 6.66012 0.00067 685 0.295559632 4.51752 2.290181 6.63754 0.000686 696 0.848055404 4.26687 2.268441 6.61786 0.0007 715 2.348179343 2.481725 2.246454 6.598008 0.000711 716 7.387448493 4.164462 2.159094 6.519689 0.000767 717 1.384010569 3.67942 1.930876 6.31914 0.000935 718 6.539766193 3.910187 1.874559 6.270516 0.000984 719 0 2.24072 1.759813 6.17247 0.001088 720 0.894846762 4.42228 1.658568 6.08708 0.001189 721 1.441622985 3.3104 1.633153 6.0658 0.001218 722 0 4.44208 1.572778 6.01551 0.001275 698 1.558896118 3.19078 1.546359 5.99361 0.001305 723 0.383504801 6.22029 1.532513 5.98216 0.001318 724 0.874379809 5.05512 1.414511 5.88532 0.001468 725 3.178052882 3.1153 1.380226 5.857421 0.001515 726 2.743866247 2.530417 1.349556 5.832557 0.001563 727 8.67938655 4.03496 1.313775 5.803657 0.001613 728 1.675692023 4.12482 1.299312 5.79201 0.001627 729 4.320735935 3.01739 1.245211 5.74859 0.001712 730 1.117898542 4.15716 1.207594 5.71856 0.001762 731 0.295759975 4.21399 1.185637 5.70109 0.001799 732 3.472329984 3.5087 1.155325 5.67703 0.001844 733 0 5.05686 1.131697 5.65833 0.001884 734 2.303932777 4.90902 1.127765 5.65523 0.001886 735 4.894808598 3.487075 1.017153 5.568359 0.002056 737 2.496100539 2.7244 0.995641 5.55158 0.002086 736 3.748353789 3.251627 0.996266 5.552068 0.002086 738 0.097742219 2.19296 0.994155 5.55042 0.002087 739 4.494039562 5.038067 0.963629 5.526686 0.002143 740 4.883694275 4.299834 0.927171 5.498432 0.002209 741 3.543460499 3.27253 0.888456 5.46854 0.00228 742 3.201001736 3.227374 0.878381 5.460786 0.002292 743 1.134755003 3.43033 0.868413 5.45312 0.002307 744 1.31228389 4.40225 0.830737 5.42421 0.002375 745 2.18981705 3.00766 0.818268 5.41466 0.002395 746 7.105767696 4.126379 0.80081 5.401317 0.002438 747 1.219706529 3.83331 0.756008 5.36718 0.002518 748 1.014147489 4.86358 0.686637 5.31463 0.002646 749 5.108026741 4.51544 0.681969 5.3111 0.002652 750 6.189343256 5.968321 0.664673 5.298059 0.00269 751 1.594206545 4.0374 0.625713 5.26876 0.00276 752 4.02637883 3.250628 0.610465 5.257326 0.002793 697 2.276512626 3.03289 0.608594 5.25592 0.002796 753 2.916440322 3.19554 0.597045 5.24728 0.002823 754 5.582396377 5.11116 0.592518 5.243887 0.002833 755 7.127819277 5.646838 0.588484 5.24087 0.002836 691 0 4.207 0.547655 5.2104 0.002938 756 1.723275185 5.46022 0.54628 5.20937 0.00294 680 2.558100341 3.77627 0.53802 5.20322 0.002955 757 1.491025779 7.37296 0.51175 5.18369 0.003013 758 6.655679639 7.343952 0.499918 5.174915 0.003026 759 5.448500076 4.101199 0.496168 5.172135 0.003035 760 6.849405724 6.555104 0.494322 5.170766 0.003039 761 1.415264641 4.13804 0.465403 5.14936 0.003123 762 7.078833392 3.299493 0.45963 5.145095 0.003137 763 7.447835109 4.197994 0.459465 5.144973 0.003137 764 4.691855389 4.09505 0.428461 5.1221 0.003216 765 6.765913108 4.656261 0.394211 5.096913 0.003318 766 1.189911629 6.35022 0.3901 5.09389 0.003321 767 0.711873688 4.12247 0.378768 5.08558 0.003347 768 0.935705267 4.23339 0.376965 5.08426 0.00335 769 1.129748696 5.65043 0.372725 5.08115 0.00336 770 2.447676888 2.51643 0.360788 5.072408 0.003395 771 7.412793324 2.89405 0.344563 5.060539 0.003447 772 0 6.33439 0.32456 5.04593 0.003498 773 1.409452743 5.2232 0.315504 5.03933 0.00352 774 0 5.44413 0.305958 5.03237 0.003541 775 0.757799789 3.27057 0.251911 4.9931 0.003718 776 0.261005346 4.64558 0.221495 4.97108 0.003811 777 0.770128672 3.1553 0.143776 4.91509 0.004074 778 2.816941964 3.86408 0.10615 4.88812 0.004228 779 1.943606982 5.03828 0.095087 4.88021 0.004261 780 6.49982563 2.314873 0.091858 4.8779 0.004272 781 2.543445727 2.527428 0.077045 4.867319 0.00432 782 0.378277281 5.07738 0.074749 4.86568 0.004327 783 1.554052399 6.86013 0.073057 4.86447 0.004331 784 3.740313179 3.30861 0.057195 4.85316 0.004389 785 6.647954724 6.114271 0.049884 4.847953 0.004415 786 0.809756341 3.46435 0.037282 4.83898 0.004447 787 4.419507408 4.457627 0.01987 4.826605 0.004499 788 1.722062181 5.09666 0.004896 4.81597 0.004554 789 8.147623562 6.459604 0.00779 4.806976 0.004594 790 3.849786723 2.31991 0.01622 4.80101 0.004625 791 6.450195037 4.96722 0.02376 4.795666 0.00466 792 8.130353179 6.315026 0.03164 4.790094 0.004696 793 0.297925928 5.04598 0.03768 4.78582 0.004716 794 5.862148582 5.707939 0.06956 4.763314 0.004863 795 3.230236428 2.8374 0.10943 4.73525 0.005047 796 1.199045091 4.36726 0.11833 4.729 0.00509 797 0.871860339 7.01828 0.12739 4.72264 0.005126 798 0.330447252 5.92622 0.1483 4.70798 0.005219 800 1.098104153 4.19885 0.16955 4.6931 0.005312 799 2.933131491 3.290135 0.16944 4.69318 0.005312 801 6.021652199 4.83424 0.17145 4.691775 0.005318 803 2.002833589 5.05292 0.19244 4.67711 0.005407 802 3.578287021 4.08273 0.18889 4.67959 0.005407 804 0.648456799 3.72185 0.21394 4.66212 0.005504 805 2.020784202 2.43559 0.21784 4.6594 0.005514 808 0.580666117 6.38818 0.22369 4.65532 0.005525 807 2.809100574 2.35658 0.22257 4.65611 0.005525 806 4.097390482 2.23548 0.2214 4.65692 0.005525 809 5.263030629 2.68504 0.23653 4.646388 0.005581 810 1.906016093 7.95994 0.23905 4.64464 0.005585 812 3.374272912 2.55359 0.24971 4.63722 0.005633 811 2.229412642 2.2735 0.24919 4.63759 0.005633 813 5.191947 3.218252 0.25601 4.632846 0.005659 814 5.175711473 5.284348 0.27649 4.618638 0.005755 815 0.457571639 3.67907 0.28594 4.61209 0.0058 816 5.901553526 3.155387 0.2866 4.611627 0.0058 817 1.938854906 4.27181 0.29258 4.60749 0.005825 818 3.751441415 2.52835 0.29951 4.60269 0.005855 819 0.847940328 3.32137 0.32592 4.58442 0.006017 820 2.5557465 4.96282 0.34887 4.56858 0.006156 821 5.505094032 4.420758 0.36167 4.559767 0.006238 822 2.080339763 3.66131 0.36679 4.55624 0.006268 823 0.715469044 4.2781 0.38183 4.54589 0.006357 825 1.425755818 3.75003 0.3861 4.54296 0.006362 824 0.732571213 3.30399 0.38598 4.54303 0.006362 826 1.858084528 5.0271 0.39476 4.537 0.006412 827 5.108233831 5.231226 0.39838 4.534514 0.006433 828 2.220629054 2.40642 0.40728 4.528399 0.00648 829 0.999936795 4.02216 0.42399 4.51694 0.006569 830 0.956968472 3.3446 0.42698 4.51489 0.006581 831 7.666771535 4.889688 0.44251 4.504248 0.006673 832 4.462106061 3.362316 0.44719 4.501046 0.006692 833 0.798417819 5.95745 0.45635 4.49478 0.006748 835 0.745638707 2.59361 0.48058 4.47822 0.006877 834 2.039008683 2.449259 0.48038 4.478357 0.006877 836 1.272304701 4.60015 0.49143 4.47081 0.006946 837 3.138905614 2.18675 0.49273 4.46993 0.006946 838 0 3.96218 0.49789 4.46641 0.006961 839 0.441358118 4.38384 0.50196 4.46364 0.006974 840 4.07697119 2.537012 0.50227 4.463427 0.006974 841 3.744824974 2.67465 0.52217 4.44987 0.007097 842 0.658532988 3.53015 0.52453 4.44827 0.007102 843 0 4.46853 0.54372 4.43522 0.007224 844 5.483246572 3.820601 0.54429 4.434824 0.007224 845 4.218558155 3.368666 0.54552 4.433987 0.007229 846 0.531333536 5.80897 0.5699 4.41744 0.007352 847 5.125810617 4.200583 0.57194 4.416052 0.007359 848 1.508836141 4.45308 0.57862 4.41153 0.007396 849 4.196864651 4.108622 0.58006 4.410547 0.007402 850 0 4.14265 0.58148 4.40958 0.007408 851 2.386025864 6.90475 0.60002 4.39703 0.007531 852 7.391829386 7.341373 0.61198 4.388939 0.007608 853 0.280401415 6.23052 0.6128 4.38838 0.007609 854 0 5.84296 0.61807 4.38482 0.007637 855 10.89359383 4.483809 0.62462 4.380391 0.00768 856 3.574070188 2.75777 0.63106 4.37604 0.007723 857 3.185653977 2.63104 0.63216 4.3753 0.007727 858 0 3.93177 0.63567 4.37293 0.007745 859 0.821736911 3.64067 0.66191 4.35523 0.007924 860 1.513388401 5.92967 0.67062 4.34936 0.007991 861 5.288562871 5.164408 0.67364 4.347332 0.008003 519 2.153109228 5.17926 0.68969 4.33653 0.008113 862 2.924286464 3.494282 0.6901 4.33625 0.008113 863 4.831002225 5.170113 0.7042 4.326775 0.008209 864 0.350736603 4.55951 0.71336 4.32062 0.008262 865 0.897423937 5.14471 0.71421 4.32005 0.008264 866 3.02046933 2.23527 0.72773 4.31098 0.008362 867 4.148359441 4.700775 0.72891 4.310188 0.008367 868 7.241823447 4.71758 0.73179 4.308255 0.008388 869 0.362821722 3.21259 0.73646 4.30512 0.008418 870 1.94750928 2.81205 0.74858 4.297 0.008489 871 0 3.47396 0.75224 4.29455 0.00851 872 0.627760328 5.29907 0.7639 4.28674 0.008589 873 0.951987955 3.0524 0.76717 4.28455 0.008614 874 0.734008502 6.22448 0.77307 4.28061 0.008657 875 0.296780765 2.07634 0.77841 4.27704 0.008695 876 2.694353324 2.70682 0.79002 4.26927 0.008782 877 6.450463175 3.82448 0.79922 4.263133 0.008844 878 2.140747407 6.13606 0.81393 4.25332 0.008927 879 2.173954682 4.47826 0.81655 4.25157 0.00894 880 1.6914174 4.77307 0.81897 4.24996 0.008951 881 2.35645327 4.64979 0.83531 4.23907 0.009074 882 3.30963121 2.17414 0.83911 4.23654 0.009106 883 2.158000596 2.42587 0.84519 4.232488 0.00916 884 2.531678954 3.1414 0.84671 4.23148 0.009169 885 2.194869885 2.402679 0.84832 4.230406 0.009172 886 2.193043465 3.49995 0.85623 4.22514 0.009214 887 0.314001411 5.55798 0.86027 4.22245 0.009226 889 0.712887218 4.88085 0.86671 4.21817 0.009265 888 0.611123391 3.75978 0.86634 4.21842 0.009265 890 1.141019105 7.87059 0.88299 4.20736 0.009375 891 1.709043647 3.91338 0.8871 4.20463 0.009395 892 1.101158731 3.40776 0.88917 4.20326 0.009404 893 2.213804236 4.55459 0.90647 4.19178 0.00955 894 1.275657111 4.20948 0.91395 4.18682 0.009596 895 0.352165126 7.40328 0.918 4.18414 0.009626 896 2.683347982 2.354425 0.92977 4.176344 0.00973 897 0.740211298 2.9098 0.93127 4.17535 0.00974 898 2.395376228 4.44254 0.9342 4.17341 0.009764 899 0.686771667 4.62795 0.94048 4.16926 0.009812 900 4.469180465 6.919872 0.94401 4.166923 0.009837 901 2.882217215 4.44428 0.94674 4.16512 0.009859 902 0 2.81719 0.9494 4.16336 0.009881 903 3.486426657 4.11858 0.95426 4.16014 0.009921 904 1.24041635 3.15204 0.95549 4.15933 0.009928 905 0.925832893 3.77285 0.9583 4.15747 0.009945 906 1.938081563 3.28418 0.95965 4.15658 0.009953 907 0 5.52502 0.96997 4.14977 0.010045 562 8.926092537 4.673774 0.97066 4.149315 0.010046 908 1.081386438 4.42774 0.97346 4.14747 0.01007 909 4.33702816 4.270014 0.97624 4.14563 0.010094 910 2.524623108 3.0042 0.98484 4.13995 0.010182 611 2.196818636 2.56782 0.98876 4.13737 0.010206 911 0.559439018 3.98216 0.99896 4.13064 0.010292 679 2.335225171 2.22283 1.00489 4.12674 0.010332 912 1.511594622 3.89684 1.00716 4.12524 0.010351 913 1.544496353 5.26083 1.01212 4.12197 0.01038 914 6.391579804 2.423474 1.01251 4.121713 0.01038 915 1.714884516 3.78652 1.01346 4.12109 0.010382 916 1.729090589 4.13011 1.0233 4.11461 0.010466 917 0.413151614 5.47293 1.02797 4.11154 0.010506 918 1.578952778 4.16193 1.03098 4.10956 0.010524 919 5.534733082 4.711339 1.03102 4.109529 0.010524 921 0.611123391 5.50761 1.03508 4.10686 0.010547 920 0.663970885 2.81812 1.03464 4.10715 0.010547 922 5.985251291 3.589267 1.03779 4.105077 0.010566 923 6.502695672 3.091915 1.04093 4.103011 0.010586 924 1.443935828 4.5113 1.05361 4.09468 0.010703 925 2.243268623 3.095296 1.06313 4.088427 0.010784 926 2.362058349 3.85574 1.06897 4.0846 0.010834 927 0.390883076 7.66832 1.07595 4.08002 0.010905 928 2.867657374 4.92548 1.082 4.07604 0.010958 929 4.541052906 5.755119 1.09914 4.06481 0.011149 930 2.848977141 2.03413 1.10105 4.06356 0.011158 931 7.602958834 4.626855 1.10473 4.061149 0.011189 932 1.479604123 3.34305 1.1065 4.05999 0.011196 933 1.806751763 4.31686 1.1196 4.05142 0.011342 934 0.677369437 5.13698 1.12643 4.04694 0.011405 935 1.060347821 4.34904 1.14015 4.03798 0.011561 936 0.674479047 4.05357 1.14688 4.03357 0.011602 937 3.179764724 3.71311 1.15782 4.02643 0.011726 938 2.07702255 4.71124 1.17646 4.01427 0.011932 940 0.87529095 5.79877 1.18683 4.0075 0.012033 939 8.056156653 3.69429 1.18652 4.007708 0.012033 941 0.597731661 5.22216 1.18923 4.00594 0.012049 942 0.600445772 5.6468 1.19165 4.00436 0.012073 944 0 8.04647 1.19703 4.00086 0.012107 943 8.648411182 5.524738 1.19676 4.001038 0.012107 945 4.489647578 3.74758 1.20103 3.99825 0.012152 946 0.832520653 5.79326 1.2067 3.99456 0.012204 947 2.932298929 4.4842 1.21334 3.99024 0.012261 948 0.151188629 4.14283 1.21373 3.98998 0.012261 949 3.031852784 2.51819 1.22384 3.98341 0.01238 950 1.187953513 4.53745 1.225 3.98265 0.012388 951 5.949359522 6.520548 1.22659 3.981618 0.012402 952 0.250673031 7.32329 1.23434 3.97658 0.012461 953 1.954717425 2.12779 1.24126 3.97208 0.012532 954 5.349202675 5.14517 1.24396 3.97033 0.012561 955 1.46241328 3.94481 1.24535 3.96942 0.012564 957 1.546483629 4.74294 1.24702 3.96834 0.012572 956 1.75745979 2.38792 1.24691 3.96841 0.012572 958 2.242713995 2.80653 1.2614 3.959 0.012715 959 0.759418996 4.44127 1.27477 3.95032 0.012862 960 0 5.19232 1.288 3.94174 0.012985 961 2.009449375 2.88495 1.28967 3.94066 0.013001 962 0 5.41093 1.29136 3.93956 0.013009 963 1.571021615 4.64794 1.29234 3.93894 0.013015 964 2.229618353 5.13781 1.29958 3.93424 0.013094 965 5.492351766 4.171895 1.30404 3.931351 0.013134 966 3.516802163 3.256136 1.30608 3.930031 0.013156 967 3.889064314 4.850634 1.30889 3.928212 0.013188 968 0 6.40524 1.31197 3.92621 0.013224 969 0.671708995 3.61124 1.31998 3.92103 0.013315 970 5.467296488 6.060068 1.32773 3.916022 0.013403 971 2.774475816 2.73909 1.33008 3.9145 0.013416 972 1.545461152 2.309288 1.34311 3.906078 0.013561 973 2.389962015 2.943914 1.34345 3.905856 0.013561 974 0 4.674 1.35076 3.90114 0.013653 975 4.230324352 4.826237 1.35244 3.900048 0.013662 976 1.451437878 4.59504 1.36048 3.89485 0.013771 977 7.45098535 7.483026 1.3621 3.893807 0.013774 978 4.935645484 6.72817 1.37221 3.88728 0.013876 979 2.885761626 3.92892 1.37418 3.88601 0.013881 980 6.221604639 2.695089 1.38022 3.882118 0.013943 981 3.964745867 3.303213 1.38528 3.878855 0.014 982 3.457188398 2.664168 1.38842 3.876826 0.01404 983 5.217325652 5.065179 1.39706 3.871256 0.014155 985 3.613657545 5.20151 1.40566 3.86571 0.014246 984 0 3.66136 1.40528 3.86596 0.014246 987 1.623174665 4.60564 1.40762 3.86446 0.014246 986 6.089917916 7.049988 1.40678 3.864993 0.014246 988 8.241283975 5.523058 1.40977 3.863072 0.014268 989 4.321377749 3.96851 1.41225 3.86147 0.014299 545 4.450650367 6.044056 1.42629 3.852432 0.014477 990 2.254791406 2.038211 1.4329 3.848179 0.01457 991 10.62344924 7.901472 1.43469 3.847032 0.014582 992 1.119311238 6.95438 1.43536 3.8466 0.014585 993 0.753679573 3.29178 1.44029 3.84343 0.014654 994 5.146898574 3.430541 1.44724 3.838958 0.014756 996 0.352559564 4.46723 1.45227 3.83573 0.014818 997 1.976704664 2.01366 1.45267 3.835472 0.014818 995 5.319048056 2.74517 1.45215 3.835802 0.014818 998 0.255280379 3.70757 1.4678 3.82575 0.015036 1000 1.181054579 4.15809 1.4692 3.82485 0.015042 999 5.874305957 5.783803 1.46917 3.824872 0.015042 1001 1.567191477 3.7165 1.47258 3.82268 0.015079 1002 3.083653978 2.87756 1.48007 3.81787 0.015176 1003 1.963825039 3.6841 1.49291 3.80963 0.015336 1004 6.247010754 5.020519 1.52096 3.791656 0.015745 1005 8.151281431 5.76651 1.52222 3.790847 0.015749 1006 2.955946512 2.77841 1.52803 3.78712 0.015822 1007 2.046350551 2.429844 1.5376 3.781003 0.01595 1008 3.061140417 4.53758 1.53902 3.78009 0.015957 1009 3.860530568 3.48447 1.54576 3.775781 0.016064 1010 5.724724114 3.992675 1.56158 3.765662 0.01626 1011 0.506732919 2.42296 1.56584 3.76294 0.016307 1012 0 8.03958 1.5726 3.75861 0.016414 1013 3.773241919 4.603707 1.57385 3.757817 0.016422 1014 2.727386827 2.67853 1.57834 3.75495 0.016483 1016 0.82017382 4.30659 1.58513 3.75061 0.016586 1015 0.923209684 3.22546 1.58489 3.75076 0.016586 1017 6.276337463 4.132421 1.58843 3.748508 0.01663 1018 1.04393275 3.79971 1.60492 3.73798 0.016879 1019 3.868672254 4.98764 1.60709 3.73659 0.016905 1020 3.029525217 4.770622 1.60735 3.73643 0.016905 1022 1.267905318 6.51374 1.61151 3.73378 0.016916 1021 5.898480598 4.99071 1.61123 3.73396 0.016916 1023 0.519463263 3.48082 1.62299 3.72646 0.017089 1024 2.722287062 5.41187 1.62797 3.72328 0.017144 1025 2.558264062 4.77608 1.64316 3.7136 0.017342 1028 0.925732567 4.57859 1.64785 3.71061 0.017346 1027 2.63960419 2.31192 1.64604 3.711768 0.017346 1026 6.178156431 4.998374 1.64578 3.711931 0.017346 1029 0 2.40333 1.65666 3.705 0.017474 1030 0.493988199 4.09124 1.66098 3.70226 0.017537 1031 0.613538354 6.24471 1.66287 3.70106 0.017554 1032 1.938062923 3.04363 1.66588 3.69914 0.017592 1033 1.654400295 2.98841 1.67296 3.69463 0.017699 1034 3.344095815 2.53578 1.68387 3.68769 0.017848 1036 1.511031928 2.40023 1.68571 3.68653 0.017848 1035 8.70058704 7.017271 1.68454 3.687266 0.017848 1037 8.043114244 3.98187 1.68842 3.684801 0.017891 1038 1.607176292 5.94728 1.69053 3.68346 0.017922 1039 5.574517372 4.436765 1.69563 3.680219 0.018002 1040 0.370292524 4.05667 1.6974 3.67909 0.018007 1041 1.950585648 2.47011 1.69787 3.67879 0.018007 1042 3.242059589 2.42483 1.70473 3.67444 0.018122 1043 1.76280266 3.78597 1.7088 3.67185 0.018192 1044 1.316734534 2.09676 1.71032 3.67089 0.018202 1045 5.164303702 2.861711 1.71391 3.668603 0.018254 483 3.168076577 4.05295 1.71839 3.66576 0.018333 1046 3.54374382 7.9404 1.72085 3.6642 0.018372 1047 2.820296417 2.65197 1.7243 3.66201 0.018411 1048 1.782772866 3.29686 1.72886 3.65912 0.018482 1049 2.715853793 3.19505 1.73268 3.65669 0.018539 1050 2.124950228 3.36335 1.73378 3.656 0.018551 1051 3.370950467 4.38699 1.73587 3.65467 0.018573 1052 4.635965828 4.676103 1.73742 3.653682 0.018585 1053 3.93663278 3.907389 1.74421 3.649379 0.018705 1054 5.496293536 5.677194 1.75422 3.643028 0.018876 1055 1.157983737 2.10785 1.75717 3.64116 0.018906 1056 2.175433875 2.89829 1.7677 3.63449 0.019072 1058 5.135322312 2.167023 1.76965 3.633253 0.019092 1057 5.512328424 5.554663 1.7695 3.633348 0.019092 1059 5.571257573 3.6137 1.77777 3.62811 0.01922 1060 0.801147961 4.17727 1.77847 3.62766 0.019225 1061 5.305901271 4.234911 1.78279 3.624925 0.019305 1062 0.22548607 4.11742 1.79064 3.61996 0.019439 1063 4.000286115 4.304908 1.79379 3.617966 0.019484 1064 1.369172577 3.2191 1.79682 3.61605 0.019538 1065 1.557405801 3.67053 1.80007 3.61399 0.019576 1066 1.654308781 2.76658 1.80086 3.61349 0.019583 1067 3.842656586 6.802298 1.80742 3.609337 0.019702 1068 3.142019176 2.65907 1.80959 3.60797 0.019728 1069 5.223284374 5.133706 1.81049 3.607396 0.019737 1070 2.52330656 4.70108 1.82053 3.60105 0.019899 1071 1.472587157 3.10449 1.82085 3.60084 0.019899 1072 0.645587044 4.07666 1.82154 3.60041 0.019901 1073 5.890637103 5.870779 1.8259 3.597655 0.019975 1074 5.00001954 4.190313 1.82818 3.596214 0.020014 1075 6.541463318 5.35561 1.83034 3.594846 0.02005 1077 3.549959281 2.93876 1.83506 3.59186 0.020132 1076 6.213381276 3.478537 1.83504 3.591878 0.020132 1078 7.173454513 6.185129 1.83708 3.590587 0.020145 1079 0 4.81827 1.84088 3.58819 0.020217 1080 5.795884869 4.024342 1.84369 3.586412 0.020268 1081 0.932891826 3.4849 1.845 3.58558 0.020287 1082 2.960911198 3.374984 1.84621 3.584819 0.020303 1083 0.802806449 5.22139 1.85419 3.57978 0.020457 1084 4.80563983 3.713653 1.85653 3.578302 0.020488 1085 0.360268275 3.12849 1.87274 3.56807 0.020807 1086 1.145353766 4.97699 1.87917 3.56401 0.02092 1087 0.19444946 4.70673 1.88023 3.56334 0.020927 1088 2.045122287 2.26209 1.8804 3.56323 0.020927 1089 2.790129292 3.618279 1.88398 3.560979 0.020986 1090 0.257249951 3.58225 1.88632 3.5595 0.021018 1091 0.21865482 4.84924 1.88786 3.55853 0.021042 1092 1.17072715 3.01023 1.8894 3.55756 0.021066 1093 5.212354025 3.853227 1.88984 3.557283 0.021066 1094 1.583646888 6.91124 1.89564 3.55362 0.021156 1095 0.529768939 3.57805 1.89631 3.5532 0.02116 1096 0.440246825 4.18025 1.89957 3.55115 0.021224 1097 1.006472653 3.77529 1.90915 3.54511 0.021424 1098 2.598887614 2.71989 1.90919 3.54508 0.021424 1099 1.633961537 2.27784 1.91946 3.53861 0.021607 1100 5.931877819 3.973947 1.92982 3.532082 0.021785 1101 1.226226038 3.06025 1.93078 3.53148 0.021797 1102 3.119497464 2.69006 1.93393 3.5295 0.021849 1103 2.50956836 3.52997 1.93676 3.52772 0.021905 1104 2.167666125 4.21806 1.94078 3.52518 0.021957 1105 5.289400866 4.58514 1.94331 3.523591 0.021995 1106 0.564083606 3.119 1.94491 3.52258 0.022022 1107 0 4.28485 1.94745 3.52098 0.022069 1108 6.892708872 2.844791 1.94782 3.520755 0.022069 1110 3.962799023 2.6218 1.95044 3.5191 0.02211 1109 3.49762073 3.171806 1.95002 3.519371 0.02211 1111 1.924325269 2.88696 1.95351 3.51717 0.022172 1112 0.794188824 4.53867 1.95601 3.5156 0.02221 1113 2.590016536 4.22487 1.96125 3.5123 0.022313 1114 0.959769507 5.65514 1.96222 3.51169 0.022326 1115 0.149385666 4.56381 1.96848 3.50776 0.022424 1116 1.985649581 3.35694 1.96926 3.50726 0.022424 479 2.791373031 2.40723 1.9695 3.50711 0.022424 1117 0.786931333 5.65287 1.97046 3.50651 0.022436 1119 0.756889395 4.9479 1.97225 3.50539 0.022447 1118 0.765101758 4.56855 1.97188 3.50562 0.022447 1120 3.606104684 4.172772 1.97523 3.50351 0.022506 660 0.569101736 4.25142 1.97772 3.50195 0.022536 1121 3.715374057 2.42559 1.97777 3.50191 0.022536 557 3.97973657 3.61504 1.98019 3.50039 0.022571 1122 5.786705282 3.075249 1.98055 3.500163 0.022571 1123 1.450036735 4.59182 1.9812 3.49976 0.022576 1124 8.044277291 4.332171 1.98319 3.498506 0.022613 1125 4.379295342 4.698935 1.98525 3.497209 0.022641 1126 0.251432019 3.8457 1.99306 3.4923 0.02281 1127 1.319684937 2.77154 1.99439 3.49147 0.02281 1129 6.770081287 3.045058 1.99951 3.488248 0.022869 1128 4.633512356 4.527713 1.99917 3.488465 0.022869 1130 0.839736228 3.94597 2.00606 3.48413 0.022998 1131 6.248705968 3.378105 2.00904 3.482265 0.023049 1132 4.772886191 4.68428 2.01923 3.47586 0.02327 1133 1.870596878 3.72025 2.02093 3.4748 0.02329 1134 1.598186508 3.95284 2.02649 3.4713 0.023385 1135 3.180254596 2.748058 2.0306 3.468725 0.023466 1138 0 3.51612 2.03519 3.46585 0.023548 1136 1.846262242 2.98674 2.0347 3.46615 0.023548 1137 6.394078234 3.701135 2.03493 3.46601 0.023548 1139 2.200469261 2.90045 2.03611 3.46527 0.02356 1140 6.684869911 4.600843 2.03808 3.46403 0.023599 1141 4.223472162 3.719099 2.04026 3.462663 0.023643 1142 5.891631852 4.01311 2.04335 3.460725 0.023699 1143 0.574680488 5.63531 2.05038 3.45631 0.023866 1144 0 4.73854 2.05245 3.45502 0.023898 1145 0.762155863 2.33328 2.05833 3.45133 0.024039 1146 1.869084159 3.81693 2.06267 3.44861 0.02414 1147 0.460510026 4.53188 2.06694 3.44593 0.024224 1148 2.115464547 2.69328 2.07351 3.44181 0.024331 1149 7.079679643 4.155095 2.07513 3.440795 0.02435 1150 3.996837394 3.371635 2.07771 3.439177 0.024406 1151 3.445024571 3.15188 2.0797 3.43793 0.024436 1152 2.724738444 4.721844 2.07971 3.437925 0.024436 1153 6.156540077 2.037263 2.0869 3.433418 0.024569 1154 5.395995421 4.86386 2.08715 3.433268 0.024569 1155 4.158554252 2.60137 2.08937 3.43187 0.024609 1156 0.576104948 4.263 2.08984 3.43158 0.02461 1157 8.987765157 5.807638 2.09548 3.428044 0.024702 1158 1.025911245 5.25317 2.10189 3.42403 0.024838 1159 0.46928073 4.29408 2.10378 3.42285 0.024853 1160 1.898194519 3.99948 2.11649 3.41489 0.025137 1161 6.615728181 2.44593 2.12415 3.410093 0.025321 1162 1.98974677 3.2893 2.13007 3.40639 0.025436 1163 0.550773544 5.82435 2.13342 3.40429 0.025476 1165 2.062962464 2.56378 2.13372 3.4041 0.025476 1164 2.27010416 3.871956 2.13369 3.404124 0.025476 1166 0.130099531 3.60762 2.14382 3.39779 0.025688 577 1.227337296 2.68731 2.14399 3.39768 0.025688 1168 2.187241836 3.86391 2.15334 3.39184 0.025911 1167 2.179867653 2.46981 2.15315 3.39195 0.025911 689 0.692301308 2.11851 2.15658 3.38981 0.025968 1169 0 3.33078 2.16097 3.38706 0.026065 1170 0.117852324 4.59309 2.16486 3.38463 0.026138 1171 7.809600987 3.394989 2.17214 3.380082 0.026274 1172 3.489449551 5.38194 2.1741 3.37886 0.026289 1173 2.547125215 2.005488 2.17957 3.375436 0.026433 1174 1.205809707 3.53649 2.18062 3.37478 0.026451 1175 4.504187056 3.485223 2.18408 3.372617 0.026537 1176 2.997703245 4.70877 2.1848 3.37217 0.026545 532 4.284198791 2.89306 2.18645 3.37113 0.026568 1177 2.055350266 2.102813 2.18629 3.371236 0.026568 1178 1.065757314 2.74675 2.18876 3.3697 0.026622 1179 0.419218481 3.44889 2.19514 3.36571 0.026769 1180 1.56593075 3.25482 2.19916 3.3632 0.026846 666 2.215262412 2.51243 2.19953 3.36297 0.026846 1181 7.967784506 3.789697 2.20442 3.359911 0.026965 1183 0.439592246 4.17848 2.20633 3.35872 0.026993 1182 2.729262266 2.29259 2.20614 3.35884 0.026993 1184 5.57372668 2.99467 2.20671 3.35848 0.026993 1185 1.972250473 3.66739 2.20879 3.35718 0.027029 1186 3.444021927 2.6427 2.20945 3.35677 0.027036 1187 6.234452055 4.526416 2.21441 3.353674 0.027156 1188 0.666767656 5.89063 2.21606 3.35264 0.027187 1189 1.431805036 2.73708 2.21814 3.35135 0.027228 1190 1.758398652 2.50173 2.2199 3.35025 0.027267 1191 0 2.90432 2.22779 3.34532 0.027463 1192 4.289313069 2.89998 2.2316 3.34294 0.027563 1193 3.622997906 4.26489 2.23498 3.34083 0.027638 1194 0 4.96789 2.23666 3.33979 0.027676 1195 4.22621488 3.724809 2.238 3.338948 0.027703 1196 0.150996268 5.81014 2.24117 3.33697 0.027773 1197 9.860906704 3.915612 2.24474 3.334743 0.027867 1198 2.018280024 3.29096 2.24832 3.33251 0.02795 1199 0.521226153 2.51415 2.25484 3.32844 0.028085 1200 1.616753056 2.47644 2.26216 3.32387 0.028255 1201 8.26554451 3.678738 2.2697 3.319177 0.028434 1202 4.110227051 3.121435 2.2707 3.318549 0.028452 1203 0 3.46084 2.27203 3.31772 0.028471 1204 6.454245699 4.80025 2.27216 3.31764 0.028471 1205 2.333125085 2.29042 2.27289 3.31719 0.028481 1206 0.977864811 3.10874 2.27469 3.31607 0.028523 1207 6.369846039 3.969675 2.28074 3.312295 0.028645 480 4.972121854 5.052188 2.29031 3.306327 0.028891 1208 6.642495757 3.654868 2.29659 3.302412 0.029061 1209 1.609655567 3.10003 2.29822 3.3014 0.029099 1210 0.537444052 3.16588 2.3086 3.29493 0.0294 1211 2.751924072 2.41127 2.31001 3.29405 0.029419 1212 3.218252001 2.292182 2.31043 3.293789 0.029419 1213 1.428868948 5.17599 2.31348 3.29189 0.029502 1214 0 4.43958 2.3144 3.29132 0.029519 1215 3.269277905 3.250609 2.31504 3.29092 0.029526 1217 1.679588747 3.69176 2.31962 3.28807 0.029632 1216 0.413728279 3.66277 2.31946 3.28817 0.029632 1218 0.740815837 4.61457 2.32036 3.2876 0.029643 1219 2.246381404 2.56985 2.32321 3.28583 0.029721 1221 5.274857999 2.76524 2.326 3.28409 0.029784 1220 3.597680572 3.864568 2.32577 3.284235 0.029784 1222 1.842323775 6.58325 2.3311 3.28092 0.029895 1223 1.549847227 4.95006 2.3385 3.27631 0.030121 1226 0 3.69373 2.33977 3.27552 0.030123 1225 7.524019066 3.111951 2.33963 3.275605 0.030123 1224 3.058662563 3.407107 2.33921 3.275869 0.030123 1227 6.684739153 5.253925 2.34351 3.273191 0.030231 1228 0.824375553 2.8745 2.34446 3.2726 0.030248 1229 2.396963708 3.00648 2.34837 3.27017 0.030363 1230 1.801505479 3.74373 2.35226 3.26774 0.030434 1233 2.110417944 2.71795 2.35314 3.26719 0.030434 1231 5.104359936 3.343498 2.35272 3.267457 0.030434 1232 5.745670985 4.044872 2.35272 3.267456 0.030434 1234 6.207294428 5.059725 2.3571 3.264731 0.030488 1235 1.42083914 4.18554 2.35888 3.26362 0.030533 678 6.260432332 2.87811 2.35928 3.26338 0.030533 1236 2.554894937 3.221165 2.36306 3.26102 0.030604 1237 1.401061786 5.00254 2.36399 3.26044 0.030621 1238 0.609941541 2.61083 2.37166 3.25567 0.030835 1239 1.030670213 3.00281 2.37336 3.25461 0.030878 1240 4.900013294 2.978588 2.37713 3.252265 0.030977 1241 6.936301079 6.119258 2.37828 3.251549 0.031002 1242 2.5557465 2.92429 2.37869 3.25129 0.031002 1243 0.394275237 5.55384 2.38214 3.24915 0.031067 1244 0.278611595 4.4083 2.38343 3.24835 0.03108 1245 3.80329617 2.176605 2.38439 3.247751 0.031098 683 4.26909549 2.81084 2.39122 3.2435 0.031274 1246 7.011463446 4.872741 2.39865 3.238883 0.03147 1247 0.630336439 5.33079 2.40589 3.23438 0.031676 1249 1.361365172 6.17274 2.40937 3.23221 0.031754 1248 1.416547398 2.95902 2.40906 3.23241 0.031754 1250 1.595880592 2.66682 2.41506 3.22868 0.031908 1257 0.460510026 4.71756 2.4197 3.22579 0.031957 1256 0.321502083 4.36415 2.41953 3.2259 0.031957 1252 0.095701333 3.62143 2.41882 3.22634 0.031957 1253 2.997819493 2.41441 2.41917 3.22612 0.031957 1255 1.02165507 2.06684 2.41943 3.22596 0.031957 1251 8.173976979 2.420158 2.41811 3.226784 0.031957 1254 4.740307825 4.144828 2.41933 3.226023 0.031957 1258 3.734242323 3.209893 2.42554 3.222163 0.032104 1259 0.292287423 2.5088 2.42722 3.22112 0.032149 1260 0 4.52249 2.43476 3.21643 0.032321 1261 2.565678496 3.82371 2.43516 3.21619 0.032321 1262 2.350511691 4.46812 2.43579 3.21579 0.032322 1264 5.344305103 2.48556 2.43812 3.21434 0.032362 1263 6.571773343 2.859167 2.43769 3.214609 0.032362 1265 1.690859985 2.35469 2.43856 3.21407 0.032363 1266 1.644834875 2.29957 2.43968 3.21337 0.032377 1267 5.995240597 4.144522 2.44487 3.210148 0.032511 1268 0.613661381 3.60908 2.4515 3.20603 0.032688 1269 1.357471583 3.34293 2.45175 3.20587 0.032688 1270 6.999646309 2.571354 2.45654 3.2029 0.032843 1272 0.410055385 4.46156 2.45932 3.20117 0.0329 1271 5.846317087 2.751402 2.45908 3.201321 0.0329 1273 8.612393187 4.987555 2.47134 3.193707 0.03327 1274 4.460451965 2.16214 2.47597 3.19083 0.033354 1275 4.843319565 3.625833 2.47943 3.188681 0.033451 1276 2.48933491 3.18947 2.48208 3.18703 0.033532 1277 6.941829687 3.216688 2.4855 3.184907 0.033614 1278 4.044547142 3.952811 2.48774 3.18352 0.033652 1279 2.027078484 3.14005 2.49094 3.18153 0.033741 1280 4.233781072 2.70319 2.49375 3.17979 0.033786 1281 0.856838746 3.43 2.49677 3.17791 0.033868 1282 0.933666875 3.29049 2.4978 3.17727 0.033888 1283 2.764634545 2.90907 2.50672 3.17173 0.034162 1284 3.602558714 3.87368 2.50755 3.17122 0.034169 1285 1.243570464 4.43732 2.51028 3.16953 0.03425 1286 0 4.98563 2.51933 3.1639 0.034515 1287 0 2.61273 2.52005 3.16346 0.034527 1288 0 5.65729 2.52153 3.16254 0.034567 1289 4.296941509 3.379645 2.52502 3.160374 0.034684 1290 0 4.35342 2.52588 3.15984 0.034692 1291 2.243022049 2.361545 2.53745 3.152658 0.035035 1292 1.343604487 4.47691 2.53859 3.15195 0.035064 1293 12.27861396 6.435958 2.54243 3.149569 0.035195 1294 3.079036559 2.875716 2.54813 3.146033 0.035339 1296 5.126168567 2.979917 2.55508 3.141723 0.035531 1295 3.651708721 6.254533 2.55454 3.142055 0.035531 1297 0.752860849 2.40347 2.55623 3.14101 0.035546 1298 2.844506041 3.29814 2.56215 3.13733 0.035745 1299 5.532439821 3.976918 2.56833 3.133498 0.035969 1300 2.598174135 4.65483 2.57512 3.12929 0.036158 1301 2.568252231 2.16956 2.57518 3.12925 0.036158 1302 5.973997216 3.699965 2.57627 3.128576 0.036169 1303 3.389930558 2.65431 2.58118 3.12553 0.036322 1304 8.346322304 4.395715 2.58284 3.124498 0.036357 1306 4.292967522 2.896727 2.58921 3.120549 0.036563 1305 1.938193397 3.648685 2.58912 3.120602 0.036563 1307 2.083647571 4.58843 2.5904 3.11981 0.036595 1308 5.055158724 2.751377 2.5914 3.11919 0.036619 1311 3.721035259 3.28029 2.59415 3.11749 0.036659 1309 3.365204838 2.32578 2.59377 3.11772 0.036659 1310 3.027945316 3.671038 2.59389 3.117647 0.036659 1313 5.005569394 2.67236 2.60024 3.11371 0.036861 1312 2.685444972 2.26759 2.5999 3.11392 0.036861 1314 5.33593488 2.738302 2.60354 3.111663 0.036951 1315 3.969049246 4.485033 2.60467 3.110959 0.036981 1317 1.915084147 3.20944 2.60598 3.11015 0.036988 1316 2.810557222 2.579531 2.60547 3.110465 0.036988 1318 3.999056646 3.361046 2.60652 3.109816 0.036994 1319 1.235710845 2.25653 2.60816 3.1088 0.037045 1320 2.555508643 2.7468 2.61051 3.10734 0.037124 1321 2.232656771 2.93727 2.61149 3.10673 0.037149 1322 6.104316624 2.718614 2.61209 3.106356 0.037158 1323 4.469428234 3.333555 2.61992 3.101503 0.037412 1324 3.436994314 2.90018 2.63256 3.09366 0.037835 1325 0.388290481 4.29624 2.63704 3.09089 0.037954 1326 1.724391306 4.26254 2.63726 3.09075 0.037954 1327 7.125673734 3.137002 2.63773 3.09046 0.037954 1328 2.788975408 3.31916 2.6404 3.08881 0.038033 1331 2.358653046 3.94971 2.64303 3.08718 0.03808 1330 2.57287541 2.74784 2.64279 3.08733 0.03808 1329 4.277976912 2.876826 2.64269 3.087385 0.03808 1332 5.38381861 3.856589 2.6484 3.083847 0.038255 1335 0.905078368 3.52825 2.65137 3.08201 0.038301 1334 1.425823624 3.26532 2.65114 3.08215 0.038301 1333 2.546984577 2.7732 2.65099 3.08224 0.038301 1336 0.68430684 4.28462 2.66367 3.07438 0.038767 1337 1.006964699 3.90954 2.66555 3.07322 0.03883 1338 0 3.4513 2.66704 3.07229 0.038877 1339 3.278968193 3.36947 2.66843 3.07143 0.03892 1340 2.042748595 4.97039 2.67161 3.06946 0.038992 1341 0 3.88825 2.67162 3.06945 0.038992 1342 1.950100615 2.2513 2.67226 3.06906 0.039003 1343 0.465489204 2.9998 2.67294 3.06864 0.039016 1344 3.373972395 2.72485 2.67465 3.06758 0.039072 1345 1.126194748 2.65712 2.67603 3.06672 0.039115 1346 1.752973654 3.4052 2.67672 3.0663 0.039129 1347 5.983180821 3.284934 2.67943 3.064613 0.039212 1348 1.559896558 2.81933 2.68386 3.06187 0.039338 1349 2.038635734 2.662139 2.68959 3.058314 0.039519 1351 0.753125695 3.82499 2.6984 3.05285 0.039787 1350 6.702898665 4.844188 2.69807 3.053061 0.039787 1352 1.691648425 3.58956 2.70003 3.05185 0.039841 1353 2.188072612 3.62105 2.70385 3.04948 0.039958 1354 4.444533441 4.861882 2.70441 3.049135 0.039966 1355 2.686136331 2.9841 2.70848 3.04661 0.040111 1359 1.933937599 3.99892 2.71429 3.04301 0.040268 1357 1.477478055 3.04273 2.71355 3.04347 0.040268 1358 3.575636867 2.07424 2.71393 3.04323 0.040268 1356 6.420340227 3.453954 2.71294 3.043849 0.040268 1360 1.144303422 3.38447 2.71544 3.0423 0.040287 1361 7.245420142 3.3623 2.71784 3.04081 0.040375 1362 0.868742846 4.27344 2.72342 3.03735 0.040551 1363 0.733430789 4.13019 2.72367 3.03719 0.040551 1364 1.992693147 3.27148 2.72413 3.03692 0.040555 1365 4.976410906 2.43324 2.73052 3.03295 0.040756 1366 1.387924318 2.78762 2.73448 3.0305 0.040915 1367 6.671635624 3.839574 2.74399 3.024609 0.041257 1368 1.682112273 3.12889 2.74644 3.02309 0.041334 1369 0.838075179 3.7127 2.75198 3.01966 0.04155 1370 3.194829169 2.95272 2.75339 3.01878 0.041581 1371 2.128178192 2.1584 2.75419 3.01829 0.041601 1372 2.429142725 2.02558 2.76273 3.013 0.041938 1373 4.231781639 4.010053 2.76633 3.010768 0.042068 1374 0.847557335 4.15212 2.76857 3.00938 0.042138 1375 1.120853281 5.86159 2.77127 3.00771 0.042212 1376 1.576374675 4.25202 2.77342 3.00637 0.042277 1377 2.065375591 2.44012 2.78145 3.001401 0.042547 1378 4.991257678 3.332549 2.78404 2.999796 0.042649 1379 1.454471294 6.28212 2.79029 2.99592 0.042862 1380 2.264599961 3.14521 2.79042 2.99584 0.042862 1381 4.971894272 4.307014 2.7932 2.994118 0.042975 1382 0.945262194 2.67548 2.79768 2.99134 0.043133 1383 2.912712707 2.81694 2.80156 2.98894 0.043281 1384 1.648126626 4.35678 2.80503 2.98679 0.043411 1385 5.392109666 3.102784 2.81072 2.983263 0.043629 1386 5.13409511 2.44481 2.81189 2.98254 0.043667 1387 4.496504481 3.601192 2.81539 2.98037 0.043799 1388 6.116692885 2.833623 2.81691 2.979429 0.043837 1389 1.679255644 2.65677 2.82277 2.9758 0.044083 1390 3.099515857 2.57245 2.82433 2.97483 0.04413 1391 2.933682888 7.21408 2.82725 2.97302 0.044229 1392 1.012685905 3.81034 2.82909 2.97188 0.044293 1393 5.021376437 3.07319 2.8293 2.97175 0.044293 616 3.867535804 3.836476 2.8345 2.968529 0.044458 1394 4.669261532 3.50036 2.8361 2.967538 0.044518 1395 9.163288499 7.510402 2.83657 2.967251 0.044524 1396 1.179880874 5.49899 2.83881 2.96586 0.044606 1397 0.923693205 4.96111 2.83903 2.96573 0.044606 1398 2.213435275 2.83788 2.83933 2.96554 0.044606 1399 0.350451845 3.90005 2.84415 2.96255 0.044805 1400 6.805636855 2.484666 2.84783 2.960272 0.044957 1401 4.16165657 3.409315 2.84799 2.960173 0.044957 1402 4.267606287 4.36478 2.85278 2.9572 0.045157 1403 3.229940066 3.59518 2.85436 2.95623 0.045182 1404 5.275553403 5.591409 2.85471 2.95601 0.045182 1405 1.835542251 3.20682 2.86057 2.95238 0.045453 1406 1.091069648 3.86237 2.86465 2.94985 0.045602 1407 7.901252086 3.784351 2.86851 2.947457 0.045759 1408 2.488598283 2.99706 2.87184 2.94539 0.045853 1410 1.944176831 2.64596 2.87251 2.94498 0.045853 1409 9.131036427 4.168862 2.87246 2.945014 0.045853 1411 3.686550344 3.1569 2.87291 2.94473 0.045855 1412 2.40515865 2.98726 2.87443 2.94379 0.045909 1413 5.754668913 3.289688 2.88275 2.938638 0.046244 1414 7.898332502 4.242374 2.8828 2.938606 0.046244 1415 2.059214773 3.2426 2.88456 2.93751 0.046298 1416 0.62681007 4.62511 2.88616 2.93652 0.046343 1418 0 4.02631 2.88687 2.93608 0.046344 1417 2.76827123 2.74095 2.8868 2.93613 0.046344 1419 0.859611004 3.26378 2.89495 2.93107 0.046698 1420 5.552335444 3.23923 2.89616 2.93033 0.046742 1421 0.612527291 2.70149 2.90035 2.92773 0.046902 1422 0.957880078 3.49533 2.90325 2.92593 0.047032 1423 5.08912066 3.486226 2.90372 2.925643 0.047038 1424 9.790435178 4.134104 2.9047 2.925032 0.047071 1425 6.978987815 2.714293 2.9071 2.923548 0.047159 1426 1.795290638 2.90776 2.90858 2.92263 0.047216 1427 2.130028726 3.56948 2.91683 2.91752 0.047586 1428 3.775688511 5.63147 2.91883 2.91628 0.047669 1429 4.623799698 4.753278 2.91912 2.916098 0.047669 1430 5.779005536 2.983913 2.91952 2.915847 0.047672 1431 0.456052036 4.50763 2.91997 2.91557 0.047677 1432 0.746291622 3.75578 2.92157 2.91458 0.047742 1433 6.613903693 2.614424 2.92704 2.91119 0.047918 1434 6.217591133 4.494671 2.92903 2.909954 0.048004 1435 2.67764343 3.587796 2.93123 2.908589 0.048101 1436 2.782475712 2.382813 2.93213 2.908034 0.048112 1437 0 3.82204 2.93383 2.90698 0.048183 1438 2.954196465 4.30541 2.93555 2.90591 0.048255 1439 3.19824011 2.28706 2.93664 2.90523 0.048294 1440 0.507403584 3.61957 2.94175 2.90207 0.048544 1441 2.795973757 2.14792 2.94515 2.89996 0.048705 626 3.494277968 2.61152 2.94809 2.89814 0.048825 1442 2.144742508 3.54449 2.95453 2.89415 0.049112 1443 1.771901086 3.07477 2.95556 2.89351 0.049148 1444 4.830504535 2.37807 2.95614 2.89315 0.049161 1445 3.603605432 2.98612 2.95905 2.89135 0.049265 1446 4.969707656 2.361023 2.95911 2.891306 0.049265 1447 2.56647477 2.80026 2.95956 2.89103 0.049269 1448 6.638489334 3.700189 2.95986 2.890843 0.049269 1449 1.400206991 4.60509 2.96226 2.88936 0.049369 1450 4.105355745 2.28795 2.96241 2.88926 0.049369 1451 1.428557276 2.850041 2.96403 2.888256 0.049437 1452 0.818863118 2.7115 2.96755 2.88608 0.049608 1453 8.573811497 4.004772 2.96831 2.885605 0.049628
This table describes orthologous genes of Acremonium zea sp. with beneficial and neutral effects on soybean growth, these genes show significant changes in expression between the two genotypes when grown in culture without soybean homogenate. Median Exp. SYM00577 represents the median expression value in log 2 tpm across biological replicates of the beneficial Acremonium grown in media inoculated with 50 mM PBS buffer. Median Exp. SYM00300 represents the median expression value in log 2 tpm across biological replicates of the neutral Acremonium grown in media inoculated with 50 mM PBS buffer. Log FC represents the estimate of the log 2-fold-change of the contrast. B-statistic represents the log-odds that the gene is differentially expressed. t-statistic represents the moderated t-statistic. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
(537) TABLE-US-00042 TABLE 604 Median Exp. Median Exp. SEQ ID sym577 SEQ ID sym300 SYM00577 SYM00577 SYM00577 gene SYM00300 gene Description Plant Mock 685 g6380.t1 2492 g764.t1 K05857: PLCD 3.20141475 5.073855922 686 g857.t1 2491 g9451.t1 K01950: 3.886920369 3.802514601 E6.3.5.1, NADSYN1, QNS1, nadE 687 g13072.t1 2494 g9142.t1 0 0 675 g5348.t1 2554 g1.t1 5.703283097 0 674 g5345.t1 2555 g9530.t1 K03510: POLI 0 5.845894518 688 g68.t1 2495 g909.t1 K00106: XDH 6.788107371 7.003820996 689 g849.t1 2496 g9453.t1 K06997: K06997 2.698992601 3.120625144 690 g7926.t1 2497 g8597.t1 6.166677332 6.853860482 680 g1340.t1 2553 g523.t1 0 5.657989905 691 g5563.t1 2493 g7478.t1 4.68326473 4.371792513 692 g5169.t1 2506 g3798.t1 4.28203011 4.865818268 677 g13489.t1 2556 g8733.t1 4.049293359 0 694 g3058.t1 2499 g1604.t1 0 0 693 g2076.t1 2498 g2520.t1 3.957231552 3.655783096 695 g3790.t1 2501 g2628.t1 K12486: SMAP 0 0 676 g7741.t1 2557 g7091.t1 7.176505771 2.550284622 697 g852.t1 2502 g9454.t1 K11824: AP2A 4.880882459 5.513795279 696 g3920.t1 2508 g3972.t1 4.127763996 5.062011561 678 g2539.t1 2558 g3572.t1 2.326788417 8.765149435 699 g2257.t1 2504 g10668.t1 0 0 698 g657.t1 2503 g9863.t1 4.688200862 4.4628192 Median Exp. Median Exp. SEQ ID SYM00300 SYM00300 B- t- Adj. p- SYM00577 Plant Mock Log FC statistic statistic value 685 9.359327016 0.295559632 10.14621 4.342538 10.54136 0.005738 686 0.533450094 8.452816333 8.12443 3.977388 9.78835 0.005838 687 2.137400252 8.254570732 6.46147 3.201272 8.45884 0.009315 675 4.093445794 4.361478247 5.78572 2.800585 7.87932 0.009315 674 0.472127747 0.825824927 5.241458 2.780518 7.851832 0.009315 688 7.792433369 1.8413995 5.850131 2.994894 8.152802 0.009315 689 7.963289978 0.692301308 7.186104 2.979489 8.13062 0.009315 690 8.618339677 1.736488111 7.728272 2.846411 7.942614 0.009315 680 5.308190284 2.558100341 8.898276 3.336937 8.669616 0.009315 691 9.926472681 0 8.941653 2.765035 7.830714 0.009315 692 6.198143572 0.928859379 6.202992 2.4341 7.397597 0.014126 677 1.530959943 1.496465963 3.96529 2.150927 7.05207 0.018531 694 5.62596164 1.924786245 3.932304 2.090546 6.981083 0.018531 693 13.01166964 2.835668263 10.44786 2.127351 7.024242 0.018531 695 6.121031288 1.019511648 5.080878 1.93808 6.80576 0.021595 676 3.981693891 3.632045248 4.74363 1.718895 6.56295 0.02595 697 7.286171288 2.276512626 5.32327 1.68203 6.523118 0.02595 696 6.356788736 0.848055404 5.962067 1.696466 6.538681 0.02595 678 6.873536849 6.260432332 7.696947 1.344744 6.171118 0.039348 699 3.910887164 10.12999017 6.28123 1.22348 6.04968 0.042032 698 5.925534706 1.558896118 4.563314 1.235076 6.061179 0.042032
This table describes orthologous genes of Acremonium zea sp. with beneficial and neutral effects on soybean growth, these genes show significant genotype specific changes in expression when grown in culture with and without plant homogenate. Median Exp. SYM00577 Plant represents the median expression value in log 2 tpm across biological replicates of the beneficial Acremonium grown in media inoculated with soybean seedling homogenate extracted with 50 mM PBS. Median Exp. SYM00577 Mock represents the median expression value in log 2 tpm across biological replicates of the beneficial Acremonium grown in media inoculated with 50 mM PBS buffer. Median Exp. SYM00300 Plant seedling homogenate extracted with 50 mM PBS. Median Exp. SYM00300 represents the median expression value in log 2 tpm across biological replicates of the neutral Acremonium grown in media inoculated with soybean seedling homogenate extracted with 50 mM PBS. Median Exp. SYM00300 Mock represents the median expression value in log 2 tpm across biological replicates of the neutral Acremonium grown in media inoculated with 50 mM PBS buffer. Log FC represents the estimate of the log 2-fold-change of the contrast. B-statistic represents the log-odds that the gene is differentially expressed. t-statistic represents the moderated t-statistic. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
(538) TABLE-US-00043 TABLE 605 SEQ sym577 Median Exp. Median Exp. B- t- Adj. p- ID Description gene Plant Mock Log FC statistic statistic value 674 K03510: POLI g5345.t1 0 5.845894518 5.48202 5.274576 11.6138 0.002239 675 g5348.t1 5.703283097 0 5.589081 4.886533 10.76433 0.002344 677 g13489.t1 4.049293359 0 3.940048 4.438055 9.909633 0.002595 676 g7741.t1 7.176505771 2.550284622 5.088009 4.463602 9.955217 0.002595 678 g2539.t1 2.326788417 8.765149435 7.03125 3.150667 7.97247 0.014249 680 g1340.t1 0 5.657989905 5.64042 2.991613 7.77178 0.014249 679 K00275: pdxH, g4287.t1 0.807562533 4.95193285 4.19518 3.005051 7.78848 0.014249 PNPO 681 K00574: E2.1.1.79, g4581.t1 0.51190239 5.56764375 4.84984 2.75309 7.48306 0.017529 cfa 682 K06874: K06874 g9772.t1 1.832873801 5.323512963 3.59486 2.657715 7.37145 0.017819 683 g9852.t1 0.939929541 7.876491011 5.93834 2.189836 6.85242 0.030523 684 g2536.t1 9.671862421 2.653812149 6.993491 1.944631 6.59743 0.03853
This table describes genes of a Acremonium zea sp. with beneficial effects on soybean growth, these genes show significant changes in expression when grown in culture with and without plant homogenate. Median Exp. Plant represents the median expression value in log 2 tpm across biological replicates grown in media inoculated with soybean seedling homogenate extracted with 50 mM PBS. Median Exp. Mock represents the median expression value in log 2_tpm across biological replicates grown in media inoculated with 50 mM PBS buffer. Log FC represents the estimate of the log 2-fold-change of the contrast. B-statistic represents the log-odds that the gene is differentially expressed. t-statistic represents the moderated t-statistic. Adj. p-value represents the false discovery rate (Benjamini & Hochberg, 1995) adjusted p-values.
Example 7: Functional Characterization of Endophytes (Secreted Proteomics Experiments)
(539) This Example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example provides exemplary characterization of modulations in a beneficial endophyte's secretome, as compared to the secretome of a neutral microbe of the same genus.
(540) Mass spectrometry was used to explore differences in secreted proteins between beneficial endophytes and neutral microbes. Four genera were selected for the secreted proteomic analysis (two fungal and two bacterial): Acremonium, Phoma, Stenotrophomonas, and Agrobacterium. For each genus, a beneficial endophyte and neutral microbe were selected: SYM00577 (SEQ ID NO: 344) and SYM00300 (SEQ ID NO: 449); SYM15774 (SEQ ID NO: 447) and SYM01331 (SEQ ID NO: 450); SYM00906 (SEQ ID NO: 439) and SYM00865 (SEQ ID NO: 451); and SYM01004 (SEQ ID NO: 441) and SYM00091 (SEQ ID NO: 427).
(541) Microbes were cultivated in three biological replicates for each strain. Briefly, each bacterium was initially streaked on Reasoner's 2A (R2A) agar, distinct CFUs selected and cultured in 10 mL R2A broth for 4 days. Fungal strains were streaked on potato dextrose (PD) agar and individual plugs containing spores and mycelial tissues were used to initiate growth in 10 mL PD broth for 6 days. All strains were grown with agitation at room temperature. Microbial culture filtrate was harvested by centrifuging at 4500 RPM for 20 minutes in 15 mL Falcon tubes to allow culture separation and removal of the supernatant. Five mL of culture supernatant were used for secreted proteomics analysis. All steps were performed in sterile conditions. Culture filtrates were kept in dry ice after harvest at all times to preserve protein stability. Media only samples consisting of PDB and R2A were tested independently to ensure the absence of intact proteins that could potentially interfere with the secreted microbial peptides.
(542) Prior to mass spectrometry, samples were concentrated on a Pall 3 kD MWCO MicroSep Spin Column (VWR Cat #89132-006) and quantified at 1:10 dilution by Qubit fluorometry (Life Technologies). 12 g of each sample was separated 1.5 cm on a 10% Bis-Tris Novex mini-gel (Invitrogen) using the MES buffer system. The gel was stained with coomassie and each lane was excised into ten equally sized segments.
(543) Gel pieces were processed using a robot (ProGest, DigiLab) with the following protocol: Washed with 25 mM ammonium bicarbonate followed by acetonitrile. Reduced with 10 mM dithiothreitol at 60 C. followed by alkylation with 50 mM iodoacetamide at RT. Digested with trypsin (Promega) at 37 C. for 4 h. Quenched with formic acid and the supernatant was analyzed directly without further processing.
(544) Mass Spectrometry
(545) The digests were analyzed by nano LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive. Peptides were loaded on a trapping column and eluted over a 75 m analytical column at 350 nL/min; both columns were packed with Proteo Jupiter resin (Phenomenex). A 30 min gradient was employed (5 h total). The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM and 17,500 FWHM resolution, respectively. The fifteen most abundant ions were selected for MS/MS.
(546) Data were searched using a local copy of Mascot with the following parameters: Fixed modification: Carbamidomethyl (C); Variable modifications: Oxidation (M), Acetyl (Protein N-term), Pyro-Glu (N-term Q), Deamidation (NQ); Mass values: Monoisotopic; Peptide Mass Tolerance: 10 ppm; Fragment Mass Tolerance: 0.02 Da; Max Missed Cleavages: 2.
(547) Mascot DAT files were parsed into the Scaffold software for validation, filtering and to create a non-redundant list per sample. Data were filtered 1% protein and peptide level false discovery rate (FDR) and requiring at least two unique peptides per protein.
(548) Differential Secreted Protein Expression and Functional Enrichment Analysis
(549) Data Acquisition and Processing
(550) Protein sequence data, KEGG annotations and corresponding protein mass spectrometry spectral count data were provided to a vendor. Data were provided for beneficial (A) and non-beneficial (B) species pairs from two fungal and two bacterial genera. All data were converted into file formats and a local database suitable for subsequent processing, analysis and parallelization.
(551) Protein Ortholog Identification
(552) Pairs/groups of orthologous proteins were identified using a modified version of the OrthoMCL pipeline. Orthologs were identified as reciprocal best BLASTP hits, and then clusters of orthologous proteins were defined using the modified OrthoMCL pipeline. This process was done independently for the within genera and the between genera analyses. BLASTP was run in parallel on the Georgia Tech PACE HPC environment.
(553) Protein Functional Annotation
(554) KEGG annotations for individual proteins were provided to the vendor based on the whole genome sequence annotations. The program BLAST2GO was used to annotate proteins with gene ontology (GO) terms based on sequence similarity to previously annotated proteins.
(555) Protein Expression Quantification and Normalization
(556) Individual protein expression levels were taken as the number of observed spectra (i.e. the spectra count) corresponding to each protein. Protein spectra counts were retrieved across three replicates for each species. Missing counts for any given ortholog or replicate were assigned values of 0. Individual protein expression levels (spectra counts) were then normalized by the total number of observed spectra for each replicate. This process was done independently for the three replicates corresponding to each member of the A-B pair of every species. Fold-change (FC) values for orthologous pairs/groups were computed as log.sub.2 A/B spectra counts for the purpose of functional enrichment analysis
(557) Protein Differential Expression Analysis
(558) Differential protein expression analysis was done for a) pairs of orthologous proteins from the within genera analysis and b) groups of orthologous proteins from the between genera analysis. Differential expression was quantified by comparing the within group normalized spectra count variation to the between group normalized spectra count variation using the Students ttest. A Benjamini-Hochberg False Discover Rate threshold of 0.2 was used to identify differentially abundant orthologous proteins.
(559) Pathway and Functional Enrichment Analysis
(560) Enrichment analysis was done in parallel using both KEGG and GO annotations with the hypergeometric test and via Gene Set Enrichment Analysis (GSEA). For the hypergeometric test, for any given functional annotation category (i.e. KEGG pathway or GO term), the number of proteins up-regulated in the beneficial member of the orthologous pair (species A) was compared to the total number of proteins up-regulated in the complete set of orthologs. For GSEA analysis, orthologous protein pairs/groups were ranked by FC values and the distribution of FC values was evaluated for a shift using the clusterprofiler R package.
(561) SYM00577 Secreted Proteomic Analysis
(562) TABLE-US-00044 TABLE 700 25 most abundant proteins secreted by SYM00577; Median Abundance represents the median value across three biological replicates in units of spectra per hundred spectra SEQ Protein Median ID ID Abundance GO Terms KEGG Terms 477 1AXg13463.t1 1.171575 GO: 0008152: metabolic none process; GO: 0016798: hydrolase activity, acting on glycosyl bonds 478 1AXg10805.t1 1.042072 GO: 0004348: none glucosylceramidase activity; GO: 0005576: extracellular region; GO: 0005975: carbohydrate metabolic process; GO: 0006665: sphingolipid metabolic process; GO: 0030248: cellulose binding 479 1AXg10141.t1 0.63105 GO: 0005975: carbohydrate none metabolic process; GO: 0016787: hydrolase activity 480 1AXg3149.t1 0.581995 GO: 0005975: carbohydrate KEGG Orthology: K01213: E3.2.1.67: galacturan metabolic process; 1,4-alpha-galacturonidase [EC: 3.2.1.67]; KEGG GO: 0016798: hydrolase PATHWAY: ko00040: Pentose and glucuronate activity, acting on glycosyl interconversions:; KEGG PATHWAY: ko00500: bonds Starch and sucrose metabolism: 481 1AXg5293.t1 0.516427 GO: 0003723: RNA binding; KEGG Orthology: K01166: E3.1.27.1: GO: 0033897: ribonuclease ribonuclease T2 [EC: 3.1.27.1] T2 activity; GO: 0090502: RNA phosphodiester bond hydrolysis, endonucleolytic 482 1AXg10578.t1 0.498434 GO: 0004190: aspartic-type none endopeptidase activity; GO: 0006508: proteolysis 483 1AXg10693.t1 0.404474 GO: 0000328: fungal-type none vacuole lumen; GO: 0016020: membrane; GO: 0032366: intracellular sterol transport 484 1AXg11973.t1 0.336207 GO: 0005886: plasma none membrane; GO: 0005975: carbohydrate metabolic process; GO: 0016021: integral component of membrane; GO: 0016740: transferase activity; GO: 0016787: hydrolase activity; GO: 0031225: anchored component of membrane 485 1AXg1240.t1 0.322054 GO: 0003993: acid KEGG Orthology: K01078: E3.1.3.2: acid phosphatase activity; phosphatase [EC: 3.1.3.2]; KEGG PATHWAY: GO: 0016311: ko00627: Aminobenzoate degradation:; KEGG dephosphorylation; PATHWAY: ko00740: Riboflavin metabolism:; GO: 0046872: metal ion KEGG PATHWAY: ko05152: Tuberculosis: binding Tuberculosis, or TB, is an infectious disease caused by Mycobacterium tuberculosis. One third of the world's population is thought to be infected with TB. About 90% of those infected result in latent infections, and about 10% of latent infections develop active diseases when their immune system is impaired due to the age, other diseases such as AIDS or exposure to immunosuppressive drugs. TB is transmitted through the air and primarily attacks the lungs, then it can spread by the circulatory system to other parts of body. Once TB bacilli have entered the host by the respiratory route and infected macrophages in the lungs, they interfere with phagosomal maturation, antigen presentation, apoptosis and host immune system to establish persistent or latent infection. 486 1AXg4516.t1 0.315618 GO: 0005975: carbohydrate none metabolic process; GO: 0016740: transferase activity; GO: 0031224: intrinsic component of membrane 487 1AXg5358.t1 0.294999 GO: 0005976: KEGG Orthology: K01178: E3.2.1.3: polysaccharide metabolic glucoamylase [EC: 3.2.1.3]; KEGG PATHWAY: process; GO: 0016798: ko00500: Starch and sucrose metabolism: hydrolase activity, acting on glycosyl bonds; GO: 0030246: carbohydrate binding 488 1AXg9478.t1 0.283328 GO: 0044464: cell part none 489 1AXg3273.t1 0.275195 GO: 0008233: peptidase KEGG Orthology: K01312: PRSS: trypsin activity [EC: 3.4.21.4]; KEGG PATHWAY: ko04080: Neuroactive ligand-receptor interaction:; KEGG PATHWAY: ko04972: Pancreatic secretion: The pancreas performs both exocrine and endocrine functions. The exocrine pancreas consists of two parts, the acinar and duct cells. The primary functions of pancreatic acinar cells are to synthesize and secrete digestive enzymes. Stimulation of the cell by secretagogues such as acetylcholine (ACh) and cholecystokinin (CCK) causes the generation of an intracellular Ca2+ signal. This signal, in turn, triggers the fusion of the zymogen granules with the apical plasma membrane, leading to the polarised secretion of the enzymes. The major task of pancreatic duct cells is the secretion of fluid and bicarbonate ions (HCO3), which neutralize the acidity of gastric contents that enter the duodenum. An increase in intracellular cAMP by secretin is one of the major signals of pancreatic HCO3 secretion. Activation of the CFTR Cl channel and the CFTR-dependent Cl/HCO3 exchange activities is responsible for cAMP-induced HCO3 secretion.; KEGG PATHWAY: ko04974: Protein digestion and absorption: Protein is a dietary component essential for nutritional homeostasis in humans. Normally, ingested protein undergoes a complex series of degradative processes following the action of gastric, pancreatic and small intestinal enzymes. The result of this proteolytic activity is a mixture of amino acids and small peptides. Amino acids (AAs) are transported into the enterocyte (intestinal epithelial cell) by a variety of AA transporters that are specific for cationic (basic) AA, neutral AA, and anionic (acidic) AA. Small peptides are absorbed into enterocytes by the PEPT1 transporter. Inside enterocytes peptides are hydrolyzed, and the resulting amino acids are released together with those absorbed by AA transporters into blood via multiple, basolateral, AA transporters. Hydrolysis-resistant peptides, however, are transported out of the cells by a basolateral peptide transporter that has not been identified molecularly.; KEGG PATHWAY: ko05164: Influenza A: Influenza is a contagious respiratory disease caused by influenza virus infection. Influenza A virus is responsible for both annual seasonal epidemics and periodic worldwide pandemics. Novel strains that cause pandemics arise from avian influenza virus by genetic reassortment among influenza viruses and two surface glycoproteins HA and NA form the basis of serologically distinct virus types. The innate immune system recognizes invaded virus through multiple mechanisms. Viral non- structural NS1 protein is a multifunctional virulence factor that interfere IFN-mediated antiviral response. It inhibits IFN production by blocking activation of transcription factors such as NF-kappa B, IRF3 and AP1. NS1 further inhibits the activation of IFN-induced antiviral genes. PB1-F2 protein is another virulence factor that induce apoptosis of infected cells, which results in life-threatening bronchiolitis. 490 1AXg8115.t1 0.234864 GO: 0008152: metabolic none process; GO: 0016787: hydrolase activity 491 1AXg12530.t1 0.232187 GO: 0000103: sulfate KEGG Orthology: K03671: trxA: thioredoxin 1 assimilation; GO: 0005634: nucleus; GO: 0005829: cytosol; GO: 0006457: protein folding; GO: 0015035: protein disulfide oxidoreductase activity; GO: 0016671: oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor; GO: 0034599: cellular response to oxidative stress; GO: 0044281: small molecule metabolic process; GO: 0045454: cell redox homeostasis; GO: 0055114: oxidation- reduction process; GO: 0071704: organic substance metabolic process; GO: 1900429: negative regulation of filamentous growth of a population of unicellular organisms 492 1AXg9266.t1 0.218366 GO: 0016491: none oxidoreductase activity 493 1AXg12742.t1 0.214329 GO: 0004553: hydrolase none activity, hydrolyzing O- glycosyl compounds; GO: 0071704: organic substance metabolic process 494 1AXg6959.t1 0.213513 GO: 0004190: aspartic-type none endopeptidase activity; GO: 0006508: proteolysis 495 1AXg936.t1 0.208768 GO: 0008152: metabolic none process; GO: 0019239: deaminase activity 496 1AXg13882.t1 0.208427 GO: 0008152: metabolic KEGG Orthology: K01078: E3.1.3.2: acid process; GO: 0016788: phosphatase [EC: 3.1.3.2]; KEGG PATHWAY: hydrolase activity, acting on ko00627: Aminobenzoate degradation:; KEGG ester bonds PATHWAY: ko00740: Riboflavin metabolism:; KEGG PATHWAY: ko05152: Tuberculosis: Tuberculosis, or TB, is an infectious disease caused by Mycobacterium tuberculosis. One third of the world's population is thought to be infected with TB. About 90% of those infected result in latent infections, and about 10% of latent infections develop active diseases when their immune system is impaired due to the age, other diseases such as AIDS or exposure to immunosuppressive drugs. TB is transmitted through the air and primarily attacks the lungs, then it can spread by the circulatory system to other parts of body. Once TB bacilli have entered the host by the respiratory route and infected macrophages in the lungs, they interfere with phagosomal maturation, antigen presentation, apoptosis and host immune system to establish persistent or latent infection. 497 1AXg9750.t1 0.191554 GO: 0005576: extracellular none region; GO: 0030248: cellulose binding; GO: 0045493: xylan catabolic process; GO: 0046373: L-arabinose metabolic process; GO: 0046556: alpha-L- arabinofuranosidase activity 498 1AXg6573.t1 0.188047 GO: 0004568: chitinase none activity; GO: 0005975: carbohydrate metabolic process; GO: 0006032: chitin catabolic process 499 1AXg92.t1 0.186476 GO: 0016998: cell wall none macromolecule catabolic process; GO: 0052861: glucan endo-1,3-beta- glucanase activity, C-3 substituted reducing group; GO: 0052862: glucan endo- 1,4-beta-glucanase activity, C-3 substituted reducing group 500 1AXg9192.t1 0.167015 GO: 0005975: carbohydrate none metabolic process 501 1AXg11043.t1 0.1663 GO: 0003824: catalytic none activity; GO: 0044238: primary metabolic process; GO: 0071704: organic substance metabolic process
(563) SYM00577 Versus SYM00300
(564) TABLE-US-00045 TABLE 701 Differential secreted protein abundance between SYM00577 and SYM00300. SEQ ID SEQ ID Beneficial A.protein Neutral B.protein KEGG GO 502 1AXg1022.t1 2297 1BXg8091.t1 Biosynthesis of carbohydrate metabolic amino acids, process, cytosol, nucleus, Carbon pentose-phosphate shunt, metabolism, non-oxidative branch, E2.2.1.2, talA, sedoheptulose-7- talB, Pentose phosphate:D- phosphate glyceraldehyde-3- pathway phosphate glyceronetransferase activity 487 1AXg5358.t1 2298 1BXg9546.t1 E3.2.1.3, Starch carbohydrate binding, and sucrose hydrolase activity, acting on metabolism glycosyl bonds, polysaccharide metabolic process 503 1AXg8841.t1 2299 1BXg1271.t1 Cysteine and adenosylhomocysteinase methionine activity, cytosol, one-carbon metabolism, metabolic process, E3.3.1.1, ahcY phosphatidylcholine biosynthetic process, S- adenosylhomocysteine catabolic process, triglyceride metabolic process 504 1AXg20808.t1 2300 1BXg8757.t1 None carbohydrate metabolic process, hydrolase activity, acting on glycosyl bonds, hydrolase activity, hydrolyzing O-glycosyl compounds, metabolic process 505 1AXg10583.t1 2301 1BXg10631.t1 None cell wall macromolecule catabolic process, lysozyme activity, peptidoglycan catabolic process 506 1AXg8644.t1 2302 1BXg2276.t1 E3.1.27.1 cytoplasmic part, ribonuclease T2 activity, RNA binding, RNA phosphodiester bond hydrolysis, endonucleolytic, single-organism cellular process 507 1AXg360.t1 2303 1BXg8875.t1 None None 508 1AXg9960.t1 2304 1BXg11250.t1 Purine None metabolism, ylbA, UGHY 509 1AXg10066.t1 2305 1BXg2721.t1 None nuclease activity 510 1AXg9954.t1 2306 1BXg11402.t1 None hydrolase activity, metabolic process 511 1AXg11078.t1 2307 1BXg1562.t1 None None 512 1AXg7160.t1 2308 1BXg550.t1 Aminobenzoate None degradation, Folate biosynthesis, phoD, Two- component system 513 1AXg7978.t1 2309 1BXg10240.t1 None hydrolase activity 514 1AXg8599.t1 2310 1BXg3056.t1 None None 515 1AXg11864.t1 2311 1BXg8819.t1 None glucose metabolic process, L-xylulose reductase (NADP+) activity, mannitol 2-dehydrogenase (NADP+) activity, mitochondrion, oxidation-reduction process, protein homotetramerization, xylulose metabolic process 516 1AXg13464.t1 2312 1BXg8758.t1 None hydrolase activity, metabolic process 517 1AXg13099.t1 2313 1BXg8761.t1 None carbohydrate metabolic process, hydrolase activity, hydrolyzing O-glycosyl compounds, intracellular part 518 1AXg10728.t1 2314 1BXg4259.t1 None hydrolase activity, metabolic process 519 1AXg31.t1 2315 1BXg2840.t1 gcvH, GCSH, glycine cleavage complex, Glycine, serine glycine decarboxylation via and threonine glycine cleavage system, metabolism, mitochondrion, one-carbon Glyoxylate and metabolic process, dicarboxylate oxidation-reduction metabolism process, protein lipoylation 520 1AXg4476.t1 2316 1BXg5721.t1 None endonuclease activity, exonuclease activity, nuclease activity, nucleic acid phosphodiester bond hydrolysis 521 1AXg11059.t1 2317 1BXg2900.t1 Fatty acid endoplasmic reticulum, elongation, Fatty palmitoyl-(protein) acid metabolism, hydrolase activity, protein Lysosome, PPT depalmitoylation, vacuolar acidification, vacuole 522 1AXg10328.t1 2318 1BXg8689.t1 None None 523 1AXg10740.t1 2319 1BXg11987.t1 None cell part 524 1AXg18392.t1 2320 1BXg11664.t1 Adrenergic ascospore-type prospore- signaling in specific spindle pole body cardiomyocytes, remodeling, ATP hydrolysis Alcoholism, coupled proton transport, Alzheimer's barrier septum, calcium ion disease, binding, calcium-dependent Amphetamine protein binding, cell addiction, budding, cell division site, Calcium signaling cellular bud neck, cellular pathway, CALM, bud tip, central plaque of cAMP signaling spindle pole body, cytosol, pathway, cGMP- hydrogen ion PKG signaling transmembrane transporter pathway, activity, incipient cellular Circadian bud site, integral entrainment, component of membrane, Dopaminergic karyogamy involved in synapse, conjugation with cellular Estrogen fusion, lysosomal signaling microautophagy, pathway, Gastric maintenance of protein acid secretion, location in spindle pole Glioma, GnRH body, mating projection tip, signaling mitotic spindle assembly, pathway, mitotic spindle pole body, Inflammatory mycelium development, mediator new growing cell tip, NLS- regulation of TRP bearing protein import into channels, Insulin nucleus, nucleus, old signaling growing cell tip, pathway, Long- phosphatidylinositol term biosynthetic process, potentiation, proton-transporting V-type Melanogenesis, ATPase, V0 domain, Neurotrophin receptor-mediated signaling endocytosis, regulation of pathway, cell cycle, spitzenkorper, Olfactory spore germination, transduction, transcription factor import Oocyte meiosis, into nucleus, vacuole Oxytocin fusion, non-autophagic signaling pathway, Pertussis, Phosphatidylinositol signaling system, Phototransduction, Phototransduction - fly, Plant- pathogen interaction, Rap1 signaling pathway, Ras signaling pathway, Salivary secretion, Tuberculosis, Vascular smooth muscle contraction 525 1AXg3446.t1 2321 1BXg4699.t1 None None 526 1AXg3959.t1 2322 1BXg3931.t1 Amino sugar and hydrolase activity, nucleotide sugar hydrolyzing O-glycosyl metabolism, compounds, organic E3.2.1.14 substance metabolic process 494 1AXg6959.t1 2323 1BXg7026.t1 None aspartic-type endopeptidase activity, proteolysis 527 1AXg4985.t1 2324 1BXg8953.t1 None FMN binding, oxidation- reduction process, oxidoreductase activity 528 1AXg4291.t1 2325 1BXg1944.t1 E3.2.1.101 hydrolase activity 529 1AXg6728.t1 2326 1BXg4339.t1 ndk, NME, ATP binding, CDP Purine phosphorylation, cellular metabolism, response to DNA damage Pyrimidine stimulus, CTP biosynthetic metabolism process, cytosol, GTP biosynthetic process, identical protein binding, integral component of membrane, mitochondrial intermembrane space, nucleoside diphosphate kinase activity, nucleus, UTP biosynthetic process 530 1AXg10268.t1 2327 1BXg2378.t1 None hydrolase activity, acting on glycosyl bonds, metabolic process 531 1AXg3277.t1 2328 1BXg3155.t1 None hydrolase activity, membrane 532 1AXg27.t1 2329 1BXg1583.t1 None acid phosphatase activity, dephosphorylation 533 1AXg1627.t1 2330 1BXg7860.t1 None cell redox homeostasis, Golgi trans cisterna, integral component of plasma membrane, oligopeptide transport, oligopeptide transporter activity, peroxisome, positive regulation of monopolar cell growth, regulation of phospholipid translocation, regulation of vacuole organization, transmembrane transport, vacuole fusion, non- autophagic 534 1AXg5235.t1 2331 1BXg2358.t1 Antigen ATP binding, integral processing and component of membrane presentation, Endocytosis, Epstein-Barr virus infection, Estrogen signaling pathway, HSPA1_8, Influenza A, Legionellosis, MAPK signaling pathway, Measles, Protein processing in endoplasmic reticulum, Spliceosome, Toxoplasmosis 535 1AXg7693.t1 2332 1BXg9970.t1 None carbohydrate binding, carbohydrate catabolic process, hydrolase activity, hydrolyzing O-glycosyl compounds 536 1AXg7827.t1 2333 1BXg8670.t1 Ribosome, RP- ribosome, structural S16e, RPS16 constituent of ribosome, translation 537 1AXg9662.t1 2334 1BXg4876.t1 None integral component of membrane, transmembrane transport, transmembrane transporter activity 538 1AXg5289.t1 2335 1BXg2280.t1 Alanine, calmodulin binding, cellular aspartate and response to oxidative glutamate stress, cytoplasm, metabolism, glutamate catabolic beta-Alanine process, glutamate metabolism, decarboxylase activity, Butanoate pyridoxal phosphate metabolism, binding E4.1.1.15, gadB, gadA, GAD, GABAergic synapse, Taurine and hypotaurine metabolism, Type I diabetes mellitus 539 1AXg10486.t1 2336 1BXg1674.t1 SLC39A1_2_3, integral component of ZIP1_2_3 membrane, low-affinity zinc II ion transport, low-affinity zinc ion transmembrane transporter activity, plasma membrane, zinc II ion transmembrane transport, zinc ion transmembrane transporter activity 540 1AXg12100.t1 2337 1BXg7176.t1 Cell cycle, monooxygenase activity, Epstein-Barr oxidation-reduction virus infection, process, protein domain Hippo signaling specific binding pathway, Hippo signaling pathway - fly, Neurotrophin signaling pathway, Oocytemeiosis, PI3K-Akt signaling pathway, Viral carcinogenesis, YWHAE 541 1AXg5383.t1 2338 1BXg9570.t1 Alzheimer's glucose metabolic process, disease, glyceraldehyde-3- Biosynthesis of phosphate dehydrogenase amino acids, (NAD+) (phosphorylating) Carbon fixation activity, glycolytic process, in NAD binding, NADP binding, photosynthetic oxidation-reduction process organisms, Carbon metabolism, GAPDH, gapA, Glycolysis/ Gluconeogenesis, HIF-1 signaling pathway 542 1AXg10197.t1 2339 1BXg11161.t1 E3.1.4.46, glpQ, glycerophosphodiester ugpQ, phosphodiesterase activity, Glycerophospholipid lipid metabolic process metabolism 543 1AXg4433.t1 2340 1BXg6768.t1 E3.2.1.6 hydrolase activity, hydrolyzing O-glycosyl compounds, metabolic process 544 1AXg3932.t1 2341 1BXg3960.t1 FoxO signaling cytosol, identical protein pathway, PRMT1 binding, mRNA export from nucleus, negative regulation of DNA-templated transcription, termination, nucleus, peptidyl-arginine methylation, to asymmetrical-dimethyl arginine, positive regulation of transcription elongation from RNA polymerase II promoter, protein-arginine omega-N asymmetric methyltransferase activity, protein-arginine omega-N monomethyltransferase activity 545 1AXg10561.t1 2342 1BXg1546.t1 None oxidoreductase activity 546 1AXg3216.t1 2343 1BXg6110.t1 None lipid metabolic process, organic substance metabolic process, phosphoric diester hydrolase activity, primary metabolic process 547 1AXg7277.t1 2344 1BXg11845.t1 EEF1A, cytoplasm, GTP binding, Legionellosis, GTPase activity, translation RNA transport elongation factor activity, translational elongation 548 1AXg10803.t1 2345 1BXg2053.t1 None carbohydrate metabolic process, cellulose binding, extracellular region, hydrolase activity, hydrolyzing O-glycosyl compounds 549 1AXg6123.t1 2346 1BXg7324.t1 None None 550 1AXg4834.t1 2347 1BXg4445.t1 None carbohydrate metabolic process, hydrolase activity, hydrolyzing O-glycosyl compounds, integral component of membrane 551 1AXg13304.t1 2348 1BXg9661.t1 None carbohydrate metabolic process, hydrolase activity, hydrolyzing O-glycosyl compounds 552 1AXg3171.t1 2349 1BXg2692.t1 E3.2.1.4, Starch hydrolase activity, and sucrose hydrolyzing O-glycosyl metabolism compounds, polysaccharide catabolic process 553 1AXg7126.t1 2350 1BXg5592.t1 Amino sugar and ATP binding, canonical nucleotide sugar glycolysis, carbohydrate metabolism, phosphorylation, cellular Butirosin and glucose homeostasis, neomycin cytosol, fructokinase biosynthesis, activity, fructose 6- Carbohydrate phosphate metabolic digestion and process, fructose import, absorption, fructose metabolic process, Carbon glucokinase activity, glucose metabolism, 6-phosphate metabolic Central carbon process, glucose binding, metabolism in glucose import, cancer, Fructose mannokinase activity, and mannose mannose metabolic metabolism, process, mitochondrion, Galactose nucleus, regulation of metabolism, transcription by glucose, Glycolysis/ replicative cell aging Gluconeogenesis, HIF-1 signaling pathway, HK, Insulin signaling pathway, Starch and sucrose metabolism, Streptomycin biosynthesis, Type II diabetes mellitus 554 1AXg1749.t1 2351 1BXg9726.t1 None None 555 1AXg10973.t1 2352 1BXg5639.t1 K16330, cytoplasm, endonucleolytic Pyrimidine cleavage in 5-ETS of metabolism tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU- rRNA), endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU- rRNA), endonucleolytic cleavage to generate mature 5-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA), hydrolase activity, acting on glycosyl bonds, kinase activity, phosphorylation, pseudouridine synthesis, Pwp2p-containing subcomplex of 90S preribosome, small-subunit processome 556 1AXg2695.t1 2353 1BXg6589.t1 None None 557 1AXg5845.t1 2354 1BXg1158.t1 Ribosome, RP- cytoplasmic translation, S3e, RPS3 cytosolic small ribosomal subunit, DNA catabolic process, endonucleolytic, DNA-(apurinic or apyrimidinic site) lyase activity, preribosome, small subunit precursor, ribosomal small subunit export from nucleus, RNA binding, rRNA export from nucleus, structural constituent of ribosome 558 1AXg9065.t1 2355 1BXg8585.t1 AMPK signaling GTP binding, GTPase pathway, EEF2, activity, integral component Oxytocin of membrane, translation signaling elongation factor activity, pathway translational elongation 559 1AXg10539.t1 2356 1BXg6684.t1 None None 560 1AXg4683.t1 2357 1BXg10580.t1 E3.2.1.8, xynA D-xylose metabolic process, endo-1,4-beta-xylanase activity, xylan catabolic process 561 1AXg1198.t1 2358 1BXg352.t1 Adherens 1,3-beta-D-glucan synthase junction, Axon complex, actin cytoskeleton guidance, reorganization, budding cell Bacterial bud growth, cellular bud invasion of neck, cellular bud tip, Golgi epithelial cells, apparatus, GTP binding, cAMP signaling GTPase activity, incipient pathway, cGMP- cellular bud site, mating PKG signaling projection tip, peroxisome, pathway, positive regulation of Chemokine endocytosis, positive signaling regulation of protein kinase pathway, C signaling, protein Colorectal transport, regulation of cell cancer, size, regulation of cell wall Endocytosis, (1->3)-beta-D-glucan Focal adhesion, biosynthetic process, Leukocyte regulation of exocyst transendothelial localization, regulation of migration, MAPK fungal-type cell wall signaling organization, regulation of pathway - yeast, vacuole fusion, non- MicroRNAs in autophagic, small GTPase cancer, mediated signal Neurotrophin transduction signaling pathway, Oxytocin signaling pathway, Pancreatic secretion, Pathogenic Escherichia coli infection, Pathways in cancer, Pertussis, Platelet activation, Proteoglycans in cancer, Rap1 signaling pathway, Ras signaling pathway, Regulation of actin cytoskeleton, RHOA, Sphingolipid signaling pathway, T cell receptor signaling pathway, TGF- beta signaling pathway, Tight junction, Tuberculosis, Vascular smooth muscle contraction, Viral 562 1AXg1904.t1 2359 1BXg5010.t1 YAT amino acid transmembrane transport, amino acid transmembrane transporter activity, integral component of membrane 563 1AXg3176.t1 2360 1BXg4958.t1 HXT, Meiosis - integral component of yeast membrane, substrate- specific transmembrane transporter activity, transmembrane transport 564 1AXg10060.t1 2361 1BXg2790.t1 E3.2.1.8, xynA endo-1,4-beta-xylanase activity, xylan catabolic process 565 1AXg5709.t1 2362 1BXg9980.t1 2-Oxocarboxylic 3-isopropylmalate acid metabolism, dehydrogenase activity, ATP Biosynthesis of binding, ATP hydrolysis amino acids, C5- coupled proton transport, Branched dibasic ATP metabolic process, acid metabolism, cytosol, glyoxylate cycle, leuB, Valine, leucine biosynthetic leucine and process, magnesium ion isoleucine binding, NAD binding, biosynthesis oxidation-reduction process, proton- transporting ATPase activity, rotational mechanism, proton- transporting V-type ATPase, V1 domain 566 1AXg8275.t1 2363 1BXg5365.t1 None None 567 1AXg1909.t1 2364 1BXg6126.t1 None peptidase activity 568 1AXg4752.t1 2365 1BXg2001.t1 AMPK signaling ascospore-type prospore pathway, assembly, autophagy, Pancreatic cytosol, exocytosis, Golgi to secretion, plasma membrane RAB8A, MEL transport, GTP binding, GTPase activity, incipient cellular bud site, intracellular protein transport, membrane, membrane addition at site of cytokinesis, metabolic process, nucleocytoplasmic transport, nucleus, small GTPase mediated signal transduction, transport vesicle, vesicle fusion 569 1AXg3765.t1 2366 1BXg2666.t1 None catalytic activity, integral component of membrane, metabolic process 570 1AXg2891.t1 2367 1BXg10882.t1 None carboxypeptidase activity, metallocarboxypeptidase activity, proteolysis, zinc ion binding 478 1AXg10805.t1 2368 1BXg9667.t1 None carbohydrate metabolic process, cellulose binding, extracellular region, glucosylceramidase activity, sphingolipid metabolic process 571 1AXg5891.t1 2369 1BXg10979.t1 E5.2.1.8 apoptotic process, cytosol, mitochondrion, nucleus, peptidyl-prolyl cis-trans isomerase activity, protein folding, protein peptidyl- prolyl isomerization 572 1AXg10065.t1 2370 1BXg2722.t1 None None 573 1AXg19725.t1 2371 1BXg7679.t1 Ribosome, RP- ribosome L7e, RPL7 574 1AXg20723.t1 2372 1BXg2050.t1 None integral component of membrane, transmembrane transport, transmembrane transporter activity 575 1AXg21175.t1 2373 1BXg6238.t1 Ribosome, RP- large ribosomal subunit, L13Ae, RPL13A structural constituent of ribosome, translation 576 1AXg2292.t1 2374 1BXg10710.t1 ARN integral component of membrane, transmembrane transport 577 1AXg1391.t1 2375 1BXg3917.t1 None cytosol, nucleus, proteolysis, serine-type peptidase activity 578 1AXg8174.t1 2376 1BXg7986.t1 None catalytic activity, cell, cell redox homeostasis, glycerol ether metabolic process, integral component of membrane, membrane, oxidation-reduction process, protein disulfide oxidoreductase activity, single-organism cellular process, single-organism metabolic process, translation 480 1AXg3149.t1 2377 1BXg4998.t1 E3.2.1.67, carbohydrate metabolic Pentose and process, cell wall glucuronate organization, extracellular interconversions, region, hydrolase activity, Starch and acting on glycosyl bonds, sucrose polygalacturonase activity metabolism 579 1AXg4184.t1 2378 1BXg1792.t1 None integral component of membrane 580 1AXg5751.t1 2379 1BXg7894.t1 Carbohydrate alpha-amylase activity, digestion and carbohydrate metabolic absorption, process, cation binding, E3.2.1.1, amyA, oxidation-reduction malS, Starch and process, oxidoreductase sucrose activity, starch binding metabolism 581 1AXg10745.t1 2380 1BXg11993.t1 None None 582 1AXg8977.t1 2381 1BXg11388.t1 TC.POT integral component of membrane, oligopeptide transport, transporter activity 583 1AXg2503.t1 2382 1BXg3531.t1 Amino sugar and carbohydrate metabolic nucleotide sugar process, intramolecular metabolism, transferase activity, Galactose phosphotransferases, metabolism, magnesium ion binding, Glycolysis/ nucleus Gluconeogenesis, Pentose phosphate pathway, pgm, Purine metabolism, Starch and sucrose metabolism, Streptomycin biosynthesis 584 1AXg3358.t1 2383 1BXg4769.t1 None None 585 1AXg8317.t1 2384 1BXg5117.t1 None None 586 1AXg4278.t1 2385 1BXg1931.t1 AFG1, LACE1, ATP binding, cellular zapE response to oxidative stress, misfolded or incompletely synthesized protein catabolic process, mitochondrial inner membrane, protein import into peroxisome matrix 587 1AXg11050.t1 2386 1BXg2887.t1 None proteolysis, serine-type carboxypeptidase activity 588 1AXg8247.t1 2387 1BXg10032.t1 Biosynthesis of canonical glycolysis, amino acids, gluconeogenesis, Carbon fixation mitochondrion, nucleus, in pentose-phosphate shunt, photosynthetic triose-phosphate isomerase organisms, activity Carbon metabolism, Fructose and mannose metabolism, Glycolysis/ Gluconeogenesis, Inositol phosphate metabolism, TPI, tpiA 589 1AXg5531.t1 2388 1BXg11344.t1 E3.2.1.6 carbohydrate metabolic process, hydrolase activity, hydrolyzing O-glycosyl compounds 590 1AXg9521.t1 2389 1BXg6591.t1 None cellular aromatic compound metabolic process, ferric iron binding, integral component of membrane, oxidation-reduction process, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen 591 1AXg11377.t1 2390 1BXg307.t1 XEG carbohydrate etabolicm process, hydrolase activity, acting on glycosyl bonds, hydrolase activity, hydrolyzing O-glycosyl compounds 592 1AXg7658.t1 2391 1BXg7553.t1 Cysteine and cellular response to, methionine oxidative stress, cytoplasm, metabolism, methionine-R-sulfoxide E1.8.4.14 reductase activity, oxidation-reduction process 593 1AXg1255.t1 2392 1BXg439.t1 None None 594 1AXg11060.t1 2393 1BXg1582.t1 None integral component of membrane, transmembrane transport 595 1AXg6907.t1 2394 1BXg8642.t1 None None 596 1AXg1976.t1 2395 1BXg6237.t1 None intracellular ribonucleoprotein complex 597 1AXg10216.t1 2396 1BXg11971.t1 None cell redox homeostasis, cellular response to oxidative stress, glutathione peroxidase activity, mitochondrion, oxidation- reduction process, response to cadmium ion, thioredoxin peroxidase activity 598 1AXg8251.t1 2397 1BXg10028.t1 None hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, metabolic process 599 1AXg6457.t1 2398 1BXg5328.t1 None integral component of membrane, membrane, transmembrane transport 600 1AXg11201.t1 2399 1BXg8976.t1 None None 601 1AXg21445.t1 2400 1BXg11743.t1 Ribosome, RP- cytosolic small ribosomal SAe, RPSA subunit, ribosomal small subunit assembly, structural constituent of ribosome, translation 602 1AXg12610.t1 2401 1BXg3489.t1 None acid phosphatase activity, dephosphorylation, integral component of membrane 603 1AXg81.t1 2402 1BXg10975.t1 None None 604 1AXg3188.t1 2403 1BXg9954.t1 None None 605 1AXg7341.t1 2404 1BXg10389.t1 None None 606 1AXg8340.t1 2405 1BXg5140.t1 Oxidative aerobic respiration, cellular phosphorylation, metabolic process, ppa cytoplasm, inorganic diphosphatase activity, magnesium ion binding, mitochondrion, phosphate- containing compound metabolic process 607 1AXg6585.t1 2406 1BXg10114.t1 FTR, efeU high-affinity iron ion transmembrane transport, high-affinity iron permease complex, integral component of membrane, iron ion transmembrane transporter activity, metabolic process, transferase activity 608 1AXg1785.t1 2407 1BXg1175.t1 Amino sugar and beta-N- nucleotide sugar acetylhexosaminidase metabolism, activity, carbohydrate Glycosaminoglycan metabolic process degradation, Glycosphingolipid biosynthesis- ganglio series, Glycosphingolipid biosynthesis- globo series, HEXA_B, Lysosome, Other glycan degradation 609 1AXg2827.t1 2408 1BXg9091.t1 map aminopeptidase activity, fumagillin biosynthetic process, metal ion binding, metalloexopeptidase activity, proteolysis 610 1AXg3285.t1 2409 1BXg8264.t1 None cell part 611 1AXg7102.t1 2410 1BXg5569.t1 None None 612 1AXg9751.t1 2411 1BXg1036.t1 E3.6.3.6, ATP binding, ATP Oxidative biosynthetic process, phosphorylation hydrogen ion transmembrane transport, hydrogen-exporting ATPase activity, phosphorylative mechanism, integral component of membrane, metal ion binding 613 1AXg3114.t1 2412 1BXg11816.t1 None hydrolase activity, positive regulation of translation, positive regulation of translational elongation, positive regulation of translational termination, ribosome binding, RNA binding, translation elongation factor activity, translational elongation, translational frameshifting 614 1AXg2047.t1 2413 1BXg2549.t1 None carbohydrate metabolic process, cell wall, cell wall organization, hydrolase activity, hydrolyzing O- glycosyl compounds, transferase activity 615 1AXg524.t1 2414 1BXg8254.t1 None integral component of membrane, transmembrane transport 616 1AXg5090.t1 2415 1BXg2954.t1 SNARE integral component of interactions in membrane, vesicle- vesicular mediated transport transport, STX1B_2_3, Synaptic vesicle cycle 617 1AXg6524.t1 2416 1BXg2065.t1 Alzheimer's 2 iron, 2 sulfur cluster disease, Cardiac binding, aerobic respiration, muscle hydrogen ion contraction, transmembrane transport, Huntington's metal ion binding, disease, Non- mitochondrial electron alcoholic fatty transport, ubiquinol to liver disease cytochrome c, (NAFLD), mitochondrial respiratory Oxidative chain complex III, ubiquinol- phosphorylation, cytochrome-c reductase Parkinson's activity disease, Two- component system, UQCRFS1, RIP1, petA 618 1AXg9485.t1 2417 1BXg5765.t1 None ATP binding, ATPase activity, endoplasmic reticulum, integral component of membrane, metabolic process 619 1AXg3460.t1 2418 1BXg4685.t1 Biosynthesis of ATP amino acids, phosphoribosyltransferase hisG, Histidine activity, cytosol, histidine metabolism biosynthetic process, magnesium ion binding 620 1AXg3259.t1 2419 1BXg8229.t1 PMPCB, MAS1 metal ion binding, metalloendopeptidase activity, mitochondrial processing peptidase complex, protein processing involved in protein targeting to mitochondrion 621 1AXg7607.t1 2420 1BXg7629.t1 None integral component of membrane 622 1AXg3160.t1 2421 1BXg1334.t1 PHO84 inorganic phosphate transmembrane transporter activity, integral component of membrane, phosphate ion transport, transmembrane transport 623 1AXg459.t1 2422 1BXg8019.t1 E3.2.1.101 catalytic activity, membrane 624 1AXg11134.t1 2423 1BXg6417.t1 None cytoplasmic part, endomembrane system, integral component of membrane, intracellular membrane-bounded organelle, transmembrane transport 625 1AXg14833.t1 2424 1BXg6900.t1 Calcium signaling ADP transport, ATP:ADP pathway, cGMP- antiporter activity, DNA PKG signaling repair, integral component pathway, HTLV-I of membrane, kinetochore infection, assembly, mitochondrial Huntington's ATP transmembrane disease, transport, mitochondrial Parkinson's inner membrane disease, SLC25A4S, ANT 626 1AXg2308.t1 2425 1BXg10725.t1 None NAD(P)+ transhydrogenase activity, single-organism process 627 1AXg7369.t1 2426 1BXg10420.t1 SLC25A23S 3-phospho-5-adenylyl sulfate transmembrane transport, 3- phosphoadenosine 5- phosphosulfate transmembrane transporter activity, 5-adenylyl sulfate transmembrane transport, 5-adenylyl sulfate transmembrane transporter activity, integral component of membrane, intracellular ribonucleoprotein complex, mitochondrion, ribosome, structural constituent of ribosome, translation 628 1AXg1858.t1 2427 1BXg1886.t1 None intracellular part 629 1AXg8166.t1 2428 1BXg7974.t1 None membrane 630 1AXg2960.t1 2429 1BXg5945.t1 None None 631 1AXg4213.t1 2430 1BXg1766.t1 None membrane 632 1AXg4083.t1 2431 1BXg3283.t1 None integral component of membrane, plasma membrane, transport 633 1AXg3175.t1 2432 1BXg2690.t1 E3.2.1. carbohydrate metabolic process, cellulose binding, extracellular region, hydrolase activity, hydrolyzing O-glycosyl compounds 634 1AXg11576.t1 2433 1BXg11481.t1 None flavin adenine dinucleotide binding, oxidation- reduction process, oxidoreductase activity, acting on CHOH group of donors 635 1AXg511.t1 2434 1BXg3351.t1 None oxidoreductase activity 636 1AXg8734.t1 2435 1BXg11562.t1 None chitin binding, chitin catabolic process, chitinase activity, extracellular region, pathogenesis, polysaccharide catabolic process 637 1AXg6748.t1 2436 1BXg4362.t1 E3.2.1.58, Starch endoplasmic reticulum, and sucrose fungal-type cell wall beta- metabolism glucan biosynthetic process, glucan endo-1,6-beta- glucosidase activity, integral component of membrane, regulation of cell shape 638 1AXg10079.t1 2437 1BXg2701.t1 HSPA5, BIP, de novo posttranslational Prion diseases, protein folding, ATP Protein export, binding, ATPase activity, ER- Protein associated ubiquitin- processing in dependent protein endoplasmic catabolic process, Golgi reticulum, apparatus, karyogamy Thyroid involved in conjugation with hormone cellular fusion, luminal synthesis surveillance complex, nuclear membrane, posttranslational protein targeting to membrane, translocation, response to unfolded protein, SRP- dependent cotranslational protein targeting to membrane, translocation, unfolded protein binding 639 1AXg10129.t1 2438 1BXg8487.t1 None None 482 1AXg10578.t1 2439 1BXg12089.t1 None aspartic-type endopeptidase activity, proteolysis 640 1AXg12554.t1 2440 1BXg3576.t1 Ribosome, RP- cytoplasmic translation, S13e, RPS13 cytosolic small ribosomal subunit, maturation of SSU- rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA), mycelium development, small ribosomal subunit rRNA binding, structural constituent of ribosome 641 1AXg15417.t1 2441 1BXg6538.t1 Protein acid-amino acid ligase processing in activity, APC-Cdc20 complex endoplasmic activity, ATP binding, reticulum, cytosol, nuclear SCF UBE2D_E, UBC4, ubiquitin ligase complex, UBC5, Ubiquitin positive regulation of mediated mitotic proteolysis metaphase/anaphase transition, protein processing, protein ubiquitination involved in ubiquitin-dependent protein catabolic process, SCF-dependent proteasomal ubiquitin- dependent protein catabolic process, ubiquitin conjugating enzyme activity 642 1AXg4473.t1 2442 1BXg9969.t1 SLC39A1_2_3, cellular response to zinc ion ZIP1_2_3 starvation, endoplasmic reticulum, high-affinity zinc II ion transport, high-affinity zinc uptake transmembrane transporter activity, integral component of plasma membrane, regulation of transcription from RNA polymerase II promoter in response to iron ion starvation 643 1AXg13171.t1 2443 1BXg1289.t1 E3.2.1.28, treA, alpha,alpha-trehalase treF, Starch and activity, trehalose metabolic sucrose process metabolism 644 1AXg4544.t1 2444 1BXg4073.t1 Ribosome, RP- ribosome, rRNA binding, L9e, RPL9 structural constituent of ribosome, translation 645 1AXg13885.t1 2445 1BXg12241.t1 Ether lipid hydrolase activity, acting on metabolism, ester bonds, metabolic Glycerophospholipid process metabolism, Inositol phosphate metabolism, plcC, Thyroid hormone signaling pathway 646 1AXg8079.t1 2446 1BXg7852.t1 None hydrolase activity, metabolic process 647 1AXg1002.t1 2447 1BXg8071.t1 Alzheimer's ATP synthesis coupled disease, proton transport, ATPeFOD, mitochondrial proton- ATP5H, ATP7, transporting ATP synthase, Huntington's stator stalk, protein disease, complex assembly, proton- Oxidative transporting ATP synthase phosphorylation, activity, rotational Parkinson's mechanism, proton- disease transporting ATPase activity, rotational mechanism 648 1AXg14938.t1 2448 1BXg3779.t1 ARF1, Golgi apparatus, GTP Endocytosis, binding, hydrolase activity, Legionellosis, intracellular protein Vibrio cholerae transport, metabolic infection process, small GTPase mediated signal transduction 649 1AXg2148.t1 2449 1BXg11881.t1 Adherens ascospore formation, cell junction, division, conidium Amyotrophic formation, developmental lateral sclerosis pigmentation, (ALS), Axon endomembrane system, guidance, B cell fungal-type vacuole receptor membrane, GTP binding, signaling GTPase activity, intracellular pathway, protein transport, Bacterial metabolic process, invasion of nucleocytoplasmic epithelial cells, transport, pathogenesis, cAMP signaling plasma membrane, small pathway, GTPase mediated signal Chemokine transduction signaling pathway, Choline metabolism in cancer, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, Fc epsilon RI signaling pathway, Fc gamma R- mediated phagocytosis, Focal adhesion, Leukocyte transendothelial migration, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non- alcoholic fatty liver disease (NAFLD), Osteoclast differentiation, Pancreatic cancer, Pancreatic secretion, Pathways in cancer, Phagosome, PI3K-Akt signaling pathway, Proteoglycans in cancer, RAC1, Rap1 signaling pathway, Ras signaling 650 1AXg7481.t1 2450 1BXg6855.t1 None integral component of membrane, membrane, transmembrane transport 651 1AXg9624.t1 2451 1BXg7238.t1 None anchored component of membrane, carbohydrate metabolic process, fungal- type cell wall, hydrolase activity, plasma membrane, transferase activity 652 1AXg7771.t1 2452 1BXg7838.t1 None proteolysis, serine-type endopeptidase activity 653 1AXg1042.t1 2453 1BXg8113.t1 None membrane 654 1AXg10247.t1 2454 1BXg3602.t1 None None 493 1AXg12742.t1 2455 1BXg2905.t1 None hydrolase activity, hydrolyzing O-glycosyl compounds, mycelium development, organic substance metabolic process 655 1AXg15299.t1 2456 1BXg10457.t1 K07975 cellular bud, cytosol, establishment or maintenance of actin cytoskeleton polarity, establishment or maintenance of cell polarity regulating cell shape, GTP binding, GTPase activity, membrane, metabolic process, microtubule cytoskeleton organization, nucleus, positive regulation of exocytosis, positive regulation of formin- nucleated actin cable assembly, protein transport, regulation of cell separation after cytokinesis, small GTPase mediated signal transduction 656 1AXg16181.t1 2457 1BXg12075.t1 E3.2.1.101 carbohydrate catabolic process, hydrolase activity, mannan endo-1,6-alpha- mannosidase activity 657 1AXg4820.t1 2458 1BXg705.t1 None None 658 1AXg4879.t1 2459 1BXg4499.t1 Amoebiasis, cytosol, fungal-type vacuole Endocytosis, membrane, GTP binding, Phagosome, GTPase activity, intracellular RAB7A, protein transport, Salmonella mitochondrial outer infection, membrane, Tuberculosis nucleocytoplasmic transport, piecemeal microautophagy of nucleus, plasma membrane, positive regulation of vacuole fusion, non-autophagic, protein localization to vacuole, regulation of endocytosis, retrograde transport, endosome to Golgi, small GTPase mediated signal transduction, vacuolar acidification, vacuole inheritance, vesicle fusion with vacuole 659 1AXg5864.t1 2460 1BXg10898.t1 APRT, apt, adenine Purine phosphoribosyltransferase metabolism activity, adenine salvage, AMP salvage, cytosol 660 1AXg8547.t1 2461 1BXg10270.t1 Ribosome, RPL10Ae, large ribosomal subunit, RPL10A RNA binding, structural constituent of ribosome, translation 661 1AXg2128.t1 2462 1BXg11919.t1 None carboxypeptidase activity, membrane 662 1AXg7452.t1 2463 1BXg6885.t1 cdd, CDA, Drug cytidine deaminase activity, metabolism - cytidine deamination, other enzymes, cytoplasm, zinc ion binding Pyrimidine metabolism 663 1AXg4563.t1 2464 1BXg4094.t1 ribH, RIB4, 6,7-dimethyl-8- Riboflavin ribityllumazine synthase metabolism activity, mitochondrial intermembrane space, riboflavin binding, riboflavin biosynthetic process, riboflavin synthase complex, transferase activity 664 1AXg10907.t1 2465 1BXg5915.t1 None cytosol, GU repeat RNA binding, intracellular part, microsatellite binding, nucleus, RNA binding, sequence-specific DNA binding, single-stranded telomeric DNA binding 665 1AXg4299.t1 2466 1BXg1953.t1 Acute myeloid GTP binding, GTPase leukemia, activity, intracellular, Alcoholism, intracellular protein Aldosterone- transport, metabolic regulated process, nucleocytoplasmic sodium transport, plasma reabsorption, membrane, small GTPase Axon guidance, B mediated signal cell receptor transduction signaling pathway, Bladder cancer, Central carbon metabolism in cancer, Chemokine signaling pathway, Choline metabolism in cancer, Cholinergic synapse, Chronic myeloid leukemia, Colorectal cancer, Dorso- ventral axis formation, Endometrial cancer, ErbB signaling pathway, Estrogen signaling pathway, Fc epsilon RI signaling pathway, FoxO signaling pathway, Gap junction, Glioma, GnRH signaling pathway, Hepatitis B, Hepatitis C, HTLV-I infection, Insulin signaling pathway, KRAS, KRAS2, Long- term depression, Long-term potentiation, MAPK signaling pathway, MAPK signaling pathway - fly, Melanogenesis, Melanoma, MicroRNAs in cancer, Natural killer cell mediated 666 1AXg9261.t1. 2467 1BXg10439.t1 E3.4.21.48 dibasic protein processing, serine-type endopeptidase activity 667 1AXg9193.t1 2468 1BXg8760.t1 None chitosanase activity, extracellular region, polysaccharide catabolic process 668 1AXg4669.t1 2469 1BXg10567.t1 None hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, integral component of membrane, metabolic process 669 1AXg19989.t1 2470 1BXg9824.t1 glgB, Starch and 1,4-alpha-glucan branching sucrose enzyme activity, ATP metabolism binding, ATP hydrolysis coupled proton transport, ATP synthesis coupled proton transport, cation binding, cytoplasm, glycogen biosynthetic process, hydrolase activity, hydrolyzing O-glycosyl compounds, proton- transporting ATP synthase activity, rotational mechanism, proton- transporting ATP synthase complex, catalytic core F(1) 670 1AXg2882.t1 2471 1BXg10869.t1 Glycerophospholipid lysophospholipase activity, metabolism, phospholipid catabolic PLB process 671 1AXg5521.t1 2472 1BXg1647.t1 Ribosome, RPS4e, ribosome, rRNA binding, RPS4 structural constituent of ribosome, translation 672 1AXg2908.t1 2473 1BXg6003.t1 AXL2 None 673 1AXg6960.t1 2474 1BXg9737.t1 None aspartic-type endopeptidase activity, proteolysis SEQ ID Fold- Beneficial A.mean B.mean change absFC FDR q-value 502 0 0.37 8.5 8.5 0.03 487 0.3 0 8.2 8.2 0.02 503 0 0.24 7.9 7.9 0.01 504 0 0.24 7.9 7.9 0.02 505 0.16 0 7.4 7.4 0.05 506 0 0.13 7.1 7.1 0.02 507 0 0.12 6.9 6.9 0.01 508 0 0.12 6.9 6.9 0.02 509 0 0.12 6.9 6.9 0.03 510 0 0.12 6.9 6.9 0.04 511 0 0.1 6.7 6.7 0.02 512 0 0.1 6.7 6.7 0.02 513 0 0.09 6.6 6.6 0.02 514 0.1 0 6.6 6.6 0.02 515 0 0.1 6.6 6.6 0.02 516 0 0.09 6.6 6.6 0.02 517 0 0.09 6.5 6.5 0.02 518 0.09 0 6.5 6.5 0.05 519 0 0.08 6.4 6.4 0.02 520 0 0.09 6.4 6.4 0.02 521 0.08 0 6.3 6.3 0.02 522 0 0.06 6 6 0.01 523 0 0.24 6 6 0.02 524 0 0.06 6 6 0.03 525 0 0.06 6 6 0.03 526 0 0.06 6 6 0.04 494 0.23 0 5.9 5.9 0.02 527 0 0.06 5.9 5.9 0.04 528 0.05 0 5.8 5.8 0.02 529 0 0.06 5.8 5.8 0.02 530 0.05 0 5.8 5.8 0.02 531 0.06 0 5.8 5.8 0.03 532 0 0.05 5.8 5.8 0.04 533 0 0.05 5.7 5.7 0.02 534 0 0.05 5.7 5.7 0.02 535 0 0.05 5.7 5.7 0.03 536 0 0.05 5.6 5.6 0.02 537 0 0.05 5.6 5.6 0.02 538 0 0.05 5.6 5.6 0.02 539 0 0.05 5.6 5.6 0.03 540 0 0.05 5.6 5.6 0.03 541 0 0.05 5.5 5.5 0.02 542 0 0.04 5.4 5.4 0.01 543 0 0.04 5.4 5.4 0.04 544 0 0.04 5.4 5.4 0.04 545 0 0.04 5.3 5.3 0.02 546 0 0.04 5.3 5.3 0.05 547 0 0.04 5.2 5.2 0.02 548 0 0.04 5.2 5.2 0.02 549 0 0.04 5.2 5.2 0.02 550 0.03 0 5.1 5.1 0.02 551 0.01 0.19 5 5 0.01 552 0 0.03 5 5 0.02 553 0 0.03 5 5 0.04 554 0 0.03 4.9 4.9 0.02 555 0 0.03 4.9 4.9 0.02 556 0 0.03 4.9 4.9 0.03 557 0 0.03 4.9 4.9 0.04 558 0 0.03 4.9 4.9 0.04 559 0 0.03 4.8 4.8 0.02 560 0 0.03 4.8 4.8 0.02 561 0 0.03 4.8 4.8 0.04 562 0 0.03 4.7 4.7 0.02 563 0 0.02 4.6 4.6 0.02 564 0 0.02 4.5 4.5 0.02 565 0 0.02 4.5 4.5 0.02 566 0.02 0 4.5 4.5 0.02 567 0.02 0 4.5 4.5 0.03 568 0 0.02 4.5 4.5 0.03 569 0 0.02 4.4 4.4 0.02 570 0 0.02 4.4 4.4 0.03 478 0.98 0.05 4.4 4.4 0.04 571 0 0.02 4.4 4.4 0.05 572 0.36 0.02 4.3 4.3 0.02 573 0 0.02 4.3 4.3 0.02 574 0 0.02 4.3 4.3 0.02 575 0 0.02 4.3 4.3 0.04 576 0 0.02 4.2 4.2 0.01 577 0 0.02 4.2 4.2 0.05 578 0 0.02 4.1 4.1 0.03 480 0.55 0.03 4 4 0.02 579 0.02 0 4 4 0.03 580 0.02 0 4 4 0.03 581 0.02 0 4 4 0.03 582 0 0.02 4 4 0.04 583 0 0.02 4 4 0.05 584 0 0.07 3.9 3.9 0 585 0 0.07 3.9 3.9 0 586 0 0.01 3.9 3.9 0.02 587 0.06 0 3.9 3.9 0.03 588 0.01 0.09 3.9 3.9 0.04 589 0 0.01 3.8 3.8 0.02 590 0 0.01 3.8 3.8 0.02 591 0 0.01 3.8 3.8 0.03 592 0 0.01 3.8 3.8 0.04 593 0.14 0.01 3.8 3.8 0.04 594 0 0.01 3.7 3.7 0.02 595 0.01 0 3.7 3.7 0.02 596 0.01 0 3.7 3.7 0.02 597 0 0.01 3.7 3.7 0.02 598 0 0.01 3.7 3.7 0.03 599 0 0.01 3.7 3.7 0.03 600 0.2 0.01 3.7 3.7 0.05 601 0 0.01 3.6 3.6 0.03 602 0.05 0 3.6 3.6 0.04 603 0 0.01 3.6 3.6 0.04 604 0.01 0 3.5 3.5 0.02 605 0 0.01 3.5 3.5 0.03 606 0 0.01 3.5 3.5 0.04 607 0 0.01 3.5 3.5 0.04 608 0.02 0.17 3.4 3.4 0.01 609 0.01 0 3.4 3.4 0.02 610 0 0.01 3.4 3.4 0.02 611 0 0.01 3.4 3.4 0.02 612 0 0.01 3.4 3.4 0.02 613 0 0.01 3.4 3.4 0.03 614 0.05 0.46 3.3 3.3 0.02 615 0 0.01 3.3 3.3 0.02 616 0 0.01 3.3 3.3 0.02 617 0 0.01 3.3 3.3 0.03 618 0.01 0 3.3 3.3 0.04 619 0 0.05 3.2 3.2 0.01 620 0 0.01 3.2 3.2 0.02 621 0 0.01 3.2 3.2 0.02 622 0.01 0.1 3.1 3.1 0 623 0.03 0 3.1 3.1 0.01 624 0 0.01 3.1 3.1 0.02 625 0 0.01 3.1 3.1 0.02 626 0 0.01 3.1 3.1 0.02 627 0 0.01 3.1 3.1 0.04 628 0 0.01 3.1 3.1 0.05 629 0 0.01 3.1 3.1 0.05 630 0.13 0.02 3 3 0.01 631 0 0.01 3 3 0.02 632 0 0.01 3 3 0.02 633 0.01 0 3 3 0.03 634 0 0.01 3 3 0.04 635 0.1 0.01 2.9 2.9 0.01 636 0 0.01 2.9 2.9 0.02 637 0 0.01 2.9 2.9 0.05 638 0 0.01 2.8 2.8 0.02 639 0 0.01 2.8 2.8 0.05 482 0.53 0.08 2.7 2.7 0.02 640 0.01 0 2.7 2.7 0.02 641 0.01 0 2.7 2.7 0.02 642 0.01 0.06 2.6 2.6 0.01 643 0.03 0 2.6 2.6 0.02 644 0.01 0 2.6 2.6 0.02 645 0.06 0.36 2.5 2.5 0 646 0.01 0.05 2.5 2.5 0.02 647 0 0 2.4 2.4 0.02 648 0 0 2.4 2.4 0.02 649 0 0 2.4 2.4 0.02 650 0 0 2.4 2.4 0.02 651 0.01 0.06 2.4 2.4 0.03 652 0.11 0.02 2.4 2.4 0.03 653 0.02 0.1 2.3 2.3 0.01 654 0 0.02 2.3 2.3 0.02 493 0.21 1.08 2.3 2.3 0.02 655 0 0 2.3 2.3 0.02 656 0 0 2.3 2.3 0.02 657 0.19 0.95 2.3 2.3 0.02 658 0 0 2.3 2.3 0.02 659 0 0 2.3 2.3 0.02 660 0 0 2.3 2.3 0.02 661 0.02 0 2.2 2.2 0.01 662 0.09 0.02 2.2 2.2 0.03 663 0.02 0.08 2.2 2.2 0.04 664 0 0 2.1 2.1 0.02 665 0 0 2.1 2.1 0.02 666 0.01 0.03 2.1 2.1 0.02 667 0.17 0.04 2.1 2.1 0.02 668 0 0 2.1 2.1 0.03 669 0 0 2.1 2.1 0.05 670 0.06 0.01 2 2 0 671 0 0 2 2 0.02 672 0.02 0 2 2 0.02 673 0.1 0.03 2 2 0.05
This table describes the differential protein expression between pairs of orthologous proteins from a genus, where one member of the pair has a beneficial effect on plant growth and the other has a neutral effect. A.mean represents the average normalized spectral counts between biological replicates of the beneficial member of the pair. B.mean represents the average normalized spectral counts between biological replicates of the neutral member of the pair. Fold change represents the fold change difference between the two organisms. FDR q-value represents the false discovery rate corrected q-value.
(565) A total of 892 proteins were detected across all Acremonium samples with two or more unique peptides at the false discovery rates indicated above.
(566) SYM15774 Secreted Proteomic Analysis
(567) TABLE-US-00046 TABLE 702 25 most abundant proteins secreted by SYM15774; Median Abundance represents the median value across three biological replicates in units of spectra per hundred spectra SEQ Median ID Protein ID Abundance GO Terms KEGG Terms 4510 3AXg6236.t1 1.09684 GO: 0005576: extracellular region none 4511 3AXg9048.t1 1.031017 GO: 0000287: magnesium ion none binding; GO: 0006400: tRNA modification; GO: 0008193: tRNA guanylyltransferase activity; GO: 0016787: hydrolase activity 4512 3AXg678.t1 0.62687 GO: 0016787: hydrolase activity none 4513 3AXg934.t1 0.558301 GO: 0003735: structural constituent KEGG Orthology: K02927: RP-L40e, of ribosome; GO: 0005840: ribosome; RPL40: large subunit ribosomal GO: 0006412: translation protein L40e; KEGG PATHWAY: ko03010: Ribosome: 4514 3AXg7460.t1 0.527389 GO: 0005886: plasma membrane; none GO: 0005975: carbohydrate metabolic process; GO: 0016021: integral component of membrane; GO: 0016740: transferase activity; GO: 0016787: hydrolase activity; GO: 0031225: anchored component of membrane 4515 3AXg10862.t1 0.523646 GO: 0004650: polygalacturonase KEGG Orthology: K01213: activity; GO: 0005576: extracellular E3.2.1.67: galacturan 1,4-alpha- region; GO: 0005975: carbohydrate galacturonidase [EC: 3.2.1.67]; metabolic process; GO: 0071555: cell KEGG PATHWAY: ko00040: Pentose wall organization and glucuronate interconversions:; KEGG PATHWAY: ko00500: Starch and sucrose metabolism: 4516 3AXg8590.t1 0.400556 GO: 0008061: chitin binding KEGG Orthology: K00799: GST, gst: glutathione S-transferase [EC: 2.5.1.18]; KEGG PATHWAY: ko00480: Glutathione metabolism:; KEGG PATHWAY: ko00980: Metabolism of xenobiotics by cytochrome P450:; KEGG PATHWAY: ko00982: Drug metabolism - cytochrome P450:; KEGG PATHWAY: ko05204: Chemical carcinogenesis: It has been estimated that exposure to environmental chemical carcinogens may contribute significantly to the causation of a sizable fraction, perhaps a majority, of human cancers. Human carcinogens act through a variety of genotoxic and non-genotoxic mechanisms. Genotoxic carcinogens can attack biological macromolecules such as DNA and RNA either directly or indirectly through metabolism, resulting in the formation of adducts with these macromolecules. If DNA adducts escape cellular repair mechanisms and persist, they may lead to miscoding, resulting in permanent mutations. Non- genotoxic carcinogens act by the mechanisms such as induction of inflammation, immunosuppression, formation of reactive oxygen species, activation of receptors, and epigenetic silencing. Together, these genotoxic and non-genotoxic mechanisms can alter signal- transduction pathways that finally result in hypermutability, genomic instability, loss of proliferation control, and resistance to apoptosis - some of the characteristic features of cancer cells. 4517 3AXg5014.t1 0.375314 GO: 0004553: hydrolase activity, none hydrolyzing O-glycosyl compounds; GO: 0005975: carbohydrate metabolic process 4518 3AXg2998.t1 0.374684 GO: 0016614: oxidoreductase none activity, acting on CHOH group of donors; GO: 0018130: heterocycle biosynthetic process; GO: 0044550: secondary metabolite biosynthetic process; GO: 0050660: flavin adenine dinucleotide binding; GO: 0055114: oxidation-reduction process; GO: 1901362: organic cyclic compound biosynthetic process 4519 3AXg4073.t1 0.311962 GO: 0005975: carbohydrate none metabolic process; GO: 0016787: hydrolase activity 4520 3AXg3348.t1 0.291735 GO: 0006629: lipid metabolic none process; GO: 0008081: phosphoric diester hydrolase activity 4521 3AXg1507.t1 0.287808 GO: 0005886: plasma membrane; none GO: 0005975: carbohydrate metabolic process; GO: 0016021: integral component of membrane; GO: 0016740: transferase activity; GO: 0031225: anchored component of membrane 4522 3AXg2571.t1 0.275402 GO: 0008152: metabolic process; none GO: 0016787: hydrolase activity 4523 3AXg9962.t1 0.272744 GO: 0016020: membrane none 4524 3AXg965.t1 0.254561 GO: 0003723: RNA binding; none GO: 0004521: endoribonuclease activity; GO: 0016020: membrane; GO: 0090502: RNA phosphodiester bond hydrolysis, endonucleolytic 4525 3AXg5987.t1 0.252385 GO: 0004252: serine-type KEGG Orthology: K01279: TPP1, endopeptidase activity; GO: 0005576: CLN2: tripeptidyl-peptidase I extracellular region; GO: 0006508: [EC: 3.4.14.9]; KEGG PATHWAY: proteolysis; GO: 0008240: tripeptidyl- ko04142: Lysosome: Lysosomes are peptidase activity membrane-delimited organelles in animal cells serving as the cell's main digestive compartment to which all sorts of macromolecules are delivered for degradation. They contain more than 40 hydrolases in an acidic environment (pH of about 5). After synthesis in the ER, lysosomal enzymes are decorated with mannose-6-phosphate residues, which are recognized by mannose-6-phosphate receptors in the trans-Golgi network. They are packaged into clathrin-coated vesicles and are transported to late endosomes. Substances for digestion are acquired by the lysosomes via a series of processes including endocytosis, phagocytosis, and autophagy. 4526 3AXg8810.t1 0.232932 GO: 0004252: serine-type KEGG Orthology: K01279: TPP1, endopeptidase activity; GO: 0006508: CLN2: tripeptidyl-peptidase I proteolysis [EC: 3.4.14.9]; KEGG PATHWAY: ko04142: Lysosome: Lysosomes are membrane-delimited organelles in animal cells serving as the cell's main digestive compartment to which all sorts of macromolecules are delivered for degradation. They contain more than 40 hydrolases in an acidic environment (pH of about 5). After synthesis in the ER, lysosomal enzymes are decorated with mannose-6-phosphate residues, which are recognized by mannose-6-phosphate receptors in the trans-Golgi network. They are packaged into clathrin-coated vesicles and are transported to late endosomes. Substances for digestion are acquired by the lysosomes via a series of processes including endocytosis, phagocytosis, and autophagy. 4527 3AXg1658.t1 0.226403 GO: 0016614: oxidoreductase none activity, acting on CHOH group of donors; GO: 0050660: flavin adenine dinucleotide binding; GO: 0055114: oxidation-reduction process 4528 3AXg2961.t1 0.220484 GO: 0016491: oxidoreductase KEGG Orthology: K00505: TYR: activity; GO: 0046872: metal ion tyrosinase [EC: 1.14.18.1]; KEGG binding; GO: 0055114: oxidation- PATHWAY: ko00350: Tyrosine reduction process metabolism:; KEGG PATHWAY: ko00740: Riboflavin metabolism:; KEGG PATHWAY: ko00950: Isoquinoline alkaloid biosynthesis: Isoquinoline alkaloids are tyrosine- derived plant alkaloids with an isoquinoline skeleton. Among them benzylisoquinoline alkaloids form an important group with potent pharmacological activity, including analgesic compounds of morphine and codeine, and anti-infective agents of berberine, palmatine, and magnoflorine. Biosynthesis of isoquinoline alkaloids proceeds via decarboxylation of tyrosine or DOPA to yield dopamine, which together with 4- hydroxyphenylacetaldehyde, an aldehyde derived from tyrosine, is converted to reticuline, an important precursor of various benzylisoquinoline alkaloids.; KEGG PATHWAY: ko00965: Betalain biosynthesis: Betalains are water- soluble nitrogen-containing pigments that are present in plants belonging to the order Caryophyllales (such as cactus and amaranth families) and in higher fungi. They contain betalamic acid as the chromophore and are classified into two types: betacyanins and betaxanthins. Betacyanins contain a cyclo-DOPA residue and exhibit red/violet coloration, while betaxanthins contain different amino acids or amino side chains and exhibit a yellow/orange coloration. The condensation of betalamic acid with amino acids (including cyclo- DOPA or amines) in plants is a spontaneous reaction, not an enzyme-catalyzed reaction.; KEGG PATHWAY: ko04916: Melanogenesis: Cutaneous melanin pigment plays a critical role in camouflage, mimicry, social communication, and protection against harmful effects of solar radiation. Melanogenesis is under complex regulatory control by multiple agents. The most important positive regulator of melanogenesis is the MC1 receptor with its ligands melanocortic peptides. MC1R activates the cyclic AMP (cAMP) response-element binding protein (CREB). Increased expression of MITF and its activation by phosphorylation (P) stimulate the transcription of tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and dopachrome tautomerase (DCT), which produce melanin. Melanin synthesis takes place within specialized intracellular organelles named melanosomes. Melanin-containing melanosomes then move from the perinuclear region to the dendrite tips and are transferred to keratinocytes by a still not well- characterized mechanism. 4529 3AXg1976.t1 0.215291 GO: 0004190: aspartic-type none endopeptidase activity; GO: 0006508: proteolysis 4530 3AXg11128.t1 0.213705 GO: 0005619: ascospore wall; none GO: 0005783: endoplasmic reticulum; GO: 0030476: ascospore wall assembly 4531 3AXg4486.t1 0.20608 GO: 0008152: metabolic process; none GO: 0016491: oxidoreductase activity; GO: 0016787: hydrolase activity; GO: 0046872: metal ion binding 4532 3AXg6046.t1 0.205931 GO: 0005975: carbohydrate none metabolic process; GO: 0008810: cellulase activity 4533 3AXg3384.t1 0.192121 GO: 0003824: catalytic activity none 4534 3AXg2856.t1 0.187827 GO: 0006508: proteolysis; none GO: 0008236: serine-type peptidase activity
(568) SYM15774 Versus SYM01331
(569) TABLE-US-00047 TABLE 703 Differential secreted protein abundance between SYM15774 and SYM01331. SEQ ID SEQ ID Fold- FDR q- Beneficial A. protein Neutral B. protein KEGG GO A. mean B. mean change value 4535 3AXg4278.t1 4337 3BXg6074.t1 E3.1.1.73 carboxylic ester 0.136 0 7.1 1.20E02 hydrolase activity 4536 3AXg230.t1 4338 3BXg7469.t1 Axon guidance, CFL, Fc actin cortical patch, 0.041 0 5.4 1.20E02 gamma R-mediated actin filament phagocytosis, Pertussis, binding, actin Regulation of actin filament cytoskeleton depolymerization, actin filament severing, ATP binding, cell division site, cell tip, endocytosis, Golgi to plasma membrane protein transport, integral component of membrane, protein refolding 4537 3AXg6225.t1 4339 3BXg6585.t1 Arginine and proline oxidation-reduction 0.028 0 4.9 1.20E02 metabolism, beta- process, Alanine metabolism, oxidoreductase MPAO, PAO1 activity 4538 3AXg8418.t1 4340 3BXg7838.t1 None flavin adenine 0.015 0 4 1.20E02 dinucleotide binding, oxidation-reduction process, oxidoreductase activity, acting on CHOH group of donors, phosphatidylinositol binding 4539 3AXg6767.t1 4341 3BXg3303.t1 None cell wall, cell wall 0.045 0.003 3.4 1.20E02 modification, hydrolase activity, acting on ester bonds, metabolic process, pectinesterase activity 4519 3AXg4073.t1 4342 3BXg8531.t1 None carbohydrate 0.297 0.054 2.4 1.20E02 metabolic process, hydrolase activity 4540 3AXg10237.t1 4343 3BXg1101.t1 XEG cellulase activity, 0.127 0.03 2 1.20E02 polysaccharide catabolic process 4541 3AXg6263.t1 4344 3BXg11238.t1 None None 0.204 0.049 2 1.20E02 4542 3AXg5745.t1 4345 3BXg6273.t1 None fungal-type cell wall, 0.054 0.246 2.2 1.20E02 fungal-type vacuole, metallopeptidase activity, proteolysis 4543 3AXg10791.t1 4346 3BXg9786.t1 bglX, Cyanoamino acid beta-glucosidase 0.003 0.094 4.4 1.20E02 metabolism, activity, Phenylpropanoid carbohydrate biosynthesis, Starch metabolic process and sucrose metabolism 4544 3AXg7602.t1 4347 3BXg11695.t1 None aspartic-type 0 0.06 5.9 1.20E02 endopeptidase activity, proteolysis 4545 3AXg8955.t1 4348 3BXg2490.t1 None None 0 0.132 7.1 1.20E02 4546 3AXg1865.t1 4349 3BXg9015.t1 None carbohydrate 0 0.145 7.2 1.20E02 metabolic process, hydrolase activity, hydrolyzing O- glycosyl compounds 4547 3AXg10977.t1 4350 3BXg7338.t1 None None 0.062 0.009 2.6 1.30E02 4548 3AXg8244.t1 4351 3BXg2216.t1 E3.4.11.10 aminopeptidase 0 0.003 2 1.30E02 activity, extracellular region, metal ion binding, nuclear pore, nucleocytoplasmic transport, proteolysis, structural constituent of nuclear pore 4549 3AXg2047.t1 4352 3BXg7322.t1 E3.1.1.73 hydrolase activity, 0 0.007 3 1.30E02 metabolic process 4550 3AXg2487.t1 4353 3BXg4014.t1 CTSA, Lysosome, proteolysis, serine- 0 0.018 4.2 1.30E02 Renin- type angiotensin system carboxypeptidase activity 4551 3AXg3683.t1 4354 3BXg679.t1 None metallocarboxypeptidase 0 0.054 5.8 1.30E02 activity, proteolysis, zinc ion binding 4552 3AXg5735.t1 4355 3BXg6263.t1 E3.4.21.48 dibasic protein 0 0.07 6.2 1.30E02 processing, serine- type endopeptidase activity 4553 3AXg8371.t1 4356 3BXg11001.t1 E4.2.2.10 extracellular region, 0 0.171 7.4 1.30E02 pectin lyase activity, polysaccharide catabolic process 4554 3AXg8798.t1 4357 3BXg4519.t1 None integral component 0.041 0 5.4 1.40E02 of membrane, membrane, negative regulation of G2/M transition of mitotic cell cycle 4555 3AXg3404.t1 4358 3BXg4400.t1 None choline 0.169 0.004 5 1.40E02 dehydrogenase activity, flavin adenine dinucleotide binding, oxidation- reduction process 4556 3AXg3735.t1 4359 3BXg4453.t1 None membrane 0.023 0 4.6 1.40E02 4557 3AXg9146.t1 4360 3BXg2444.t1 None integral component 0.017 0 4.2 1.40E02 of membrane 4558 3AXg10088.t1 4361 3BXg1846.t1 None endonuclease 0.075 0.009 3 1.40E02 activity, exonuclease activity, integral component of membrane, nucleic acid phosphodiester bond hydrolysis 4559 3AXg10485.t1 4362 3BXg821.t1 Amino sugar and beta-N- 0.027 0.156 2.5 1.40E02 nucleotide sugar acetylglucosaminidase metabolism, activity, Glycosaminoglycan carbohydrate degradation, metabolic process, Glycosphingolipid extracellular region, biosynthesis - ganglio N-acetylglucosamine series, catabolic process Glycosphingolipid biosynthesis - globo series, HEXA_B, Lysosome, Other glycan degradation 4560 3AXg8514.t1 4363 3BXg7997.t1 None choline 0.074 0.551 2.9 1.40E02 dehydrogenase activity, flavin adenine dinucleotide binding, oxidation- reduction process 4561 3AXg8930.t1 4364 3BXg5868.t1 None integral component 0 0.008 3.2 1.40E02 of membrane 4562 3AXg6329.t1 4365 3BXg3212.t1 E1.1.99.1, betA, CHDH, alcohol metabolic 0.039 0.388 3.3 1.40E02 Glycine, serine and process, choline threonine metabolism dehydrogenase activity, DNA binding, flavin adenine dinucleotide binding, metal ion binding, oxidation-reduction process, regulation of transcription, DNA-templated 4563 3AXg9850.t1 4366 3BXg11232.t1 None catalytic activity, 0 0.023 4.6 1.40E02 chromatin silencing by small RNA, cytosol, endoplasmic reticulum unfolded protein response, nucleus 4564 3AXg1923.t1 4367 3BXg9196.t1 None hydrolase activity, 0 0.033 5.1 1.40E02 metabolic process 4565 3AXg6350.t1 4368 3BXg12502.t1 None proteolysis, serine- 0.015 0.67 5.4 1.40E02 type peptidase activity 4566 3AXg9423.t1 4369 3BXg390.t1 Betalain biosynthesis, ion binding, 0 0.048 5.6 1.40E02 Isoquinoline alkaloid metabolic process, biosynthesis, metal ion binding, Melanogenesis, oxidation-reduction Riboflavin metabolism, process, TYR, Tyrosine oxidoreductase metabolism activity 4567 3AXg5033.t1 4370 3BXg7845.t1 None cellular process, 0 0.098 6.6 1.40E02 membrane, metabolic process, single-organism process 4568 3AXg4645.t1 4371 3BXg8440.t1 None None 0 0.121 6.9 1.40E02 4527 3AXg1658.t1 4372 3BXg6710.t1 None flavin adenine 0.219 0 7.8 1.50E02 dinucleotide binding, oxidation-reduction process, oxidoreductase activity, acting on CHOH group of donors 4569 3AXg8951.t1 4373 3BXg5043.t1 None hydrolase activity, 0.169 0 7.4 1.50E02 acting on ester bonds, nucleic acid metabolic process 4570 3AXg3962.t1 4374 3BXg2058.t1 None flavin adenine 0.098 0 6.6 1.50E02 dinucleotide binding, oxidation-reduction process, oxidoreductase activity, acting on CHOH group of donors 4571 3AXg9121.t1 4375 3BXg2385.t1 E3.1.1.11, Pentose and aspartyl esterase 0.098 0 6.6 1.50E02 glucuronate activity, cell wall, cell interconversions, wall modification, Starch and sucrose extracellular region, metabolism pectin catabolic process, pectinesterase activity 4572 3AXg6312.t1 4376 3BXg3233.t1 None flavin adenine 0.059 0 5.9 1.50E02 dinucleotide binding, oxidation-reduction process, oxidoreductase activity, acting on CHOH group of donors 4573 3AXg4810.t1 4377 3BXg1560.t1 E3.2.1.4, Starch and carbohydrate 0.049 0 5.7 1.50E02 sucrose metabolism metabolic process, hydrolase activity, hydrolyzing O- glycosyl compounds 4574 3AXg1577.t1 4378 3BXg3030.t1 None hydrolase activity, 0.026 0 4.8 1.50E02 metabolic process 4575 3AXg5120.t1 4379 3BXg10267.t1 EEF1B cytosol, eukaryotic 0.015 0 4 1.50E02 translation elongation factor 1 complex, guanyl- nucleotide exchange factor activity, maintenance of translational fidelity, negative regulation of actin filament bundle assembly, positive regulation of GTPase activity, regulation of translational termination, translation elongation factor activity, translational elongation 4576 3AXg2881.t1 4380 3BXg6431.t1 msrA cellular response to 0.005 0 2.7 1.50E02 hydrogen peroxide, cytosol, integral component of membrane, L- methionine biosynthetic process from methionine sulphoxide, L- methionine-(S)-S- oxide reductase activity, nucleus, oxidation-reduction process, peptide- methionine (S)-S- oxide reductase activity, protein repair 4577 3AXg2995.t1 4381 3BXg8638.t1 Influenza A, proteolysis, serine- 0.071 0.01 2.7 1.50E02 Neuroactive ligand- type endopeptidase receptor interaction, activity Pancreatic secretion, Protein digestion and absorption, PRSS 4578 3AXg6701.t1 4382 3BXg7716.t1 Epstein-Barr virus cytosol, GTP binding, 0.005 0 2.7 1.50E02 infection, HTLV-I GTPase activity, infection, RAN, intracellular'protein Ribosome biogenesis in transport, eukaryotes, RNA membrane, transport metabolic process, negative regulation of G2/M transition of mitotic cell cycle, nuclear pore, nucleocytoplasmic transport, small GTPase mediated signal transduction, structural constituent of nuclear pore 4579 3AXg10558.t1 4383 3BXg10095.t1 None None 0.005 0 2.6 1.50E02 4580 3AXg9106.t1 4384 3BXg2351.t1 None cytoplasm 0.004 0 2.3 1.50E02 4581 3AXg573.t1 4385 3BXg5286.t1 None aspartic-type 0.044 0.009 2.2 1.50E02 endopeptidase activity, membrane, proteolysis 4525 3AXg5987.t1 4386 3BXg5319.t1 Lysosome, TPP1, CLN2 extracellular region, 0.261 0.057 2.2 1.50E02 proteolysis, serine- type endopeptidase activity, tripeptidyl- peptidase activity 4582 3AXg10624.t1 4387 3BXg1050.t1 None choline 0.172 0.038 2.1 1.50E02 dehydrogenase activity, flavin adenine dinucleotide binding, integral component of membrane, oxidation-reduction process, transmembrane transport, transporter activity 4520 3AXg3348.t1 4388 3BXg5195.t1 None lipid metabolic 0.286 0.065 2.1 1.50E02 process, phosphoric diester hydrolase activity 4583 3AXg1574.t1 4389 3BXg791.t1 None ATP binding, 0.003 0 2 1.50E02 calmodulin binding, calmodulin- dependent protein kinase activity, cytosol, glucose catabolic process, manganese ion binding, negative regulation of calcineurin-NFAT signaling cascade, negative regulation of G2/M transition of mitotic cell cycle, negative regulation of transcription by transcription factor localization, negative regulation of transcription from RNA polymerase II promoter, nucleus, phosphoglycerate mutase activity, protein phosphorylation, regulation of nuclear division 4584 3AXg3704.t1 4390 3BXg4116.t1 None None 0.04 0.176 2.1 1.50E02 4585 3AXg7050.t1 4391 3BXg10636.t1 E3.2.1.101 catalytic activity, 0.014 0.064 2.1 1.50E02 hydrolase activity 4586 3AXg11147.t1 4392 3BXg3457.t1 None defense response to 0.01 0.065 2.6 1.50E02 bacterium, defense response to fungus, spore wall 4587 3AXg809.t1 4393 3BXg9916.t1 None acetyltransferase 0 0.016 4.1 1.50E02 activity, metabolic process, transferase activity 4588 3AXg1606.t1 4394 3BXg8171.t1 Betalain biosynthesis, metabolic process, 0 0.038 5.3 1.50E02 Isoquinoline alkaloid N-acetyltransferase biosynthesis, activity, oxidation- Melanogenesis, reduction process, Riboflavin metabolism, oxidoreductase TYR, Tyrosine activity, transferase metabolism activity, transferring acyl groups 4589 3AXg5600.t1 4395 3BXg3227.t1 None None 0 0.086 6.4 1.50E02 4590 3AXg676.t1 4396 3BXg6951.t1 None None 0 0.319 8.3 1.50E02 4591 3AXg8215.t1 4397 3BXg2453.t1 None None 0.002 0.054 4.3 1.70E02 4592 3AXg4581.t1 4398 3BXg7071.t1 None hydrolase activity, 0.076 0 6.3 1.80E02 metabolic process 4593 3AXg3000.t1 4399 3BXg8643.t1 None flavin adenine 0 0.042 5.4 1.80E02 dinucleotide binding, oxidation-reduction process, oxidoreductase activity, oxidoreductase activity, acting on CHOH group of donors 4594 3AXg3931.t1 4400 3BXg1983.t1 None choline 0.081 0 6.4 1.90E02 dehydrogenase activity, flavin adenine dinucleotide binding, oxidation- reduction process 4595 3AXg3946.t1 4401 3BXg1965.t1 None copper ion binding, 0.025 0 4.7 1.90E02 oxidation-reduction process, oxidoreductase activity 4596 3AXg1894.t1 4402 3BXg9149.t1 None carbohydrate 0.016 0 4 2.00E02 metabolic process, catalytic activity 4597 3AXg3686.t1 4403 3BXg689.t1 None copper ion binding, 0.022 0.166 2.9 2.00E02 oxidation-reduction process, oxidoreductase activity 4598 3AXg9632.t1 4404 3BXg8688.t1 None beta-N- 0 0.026 4.8 2.00E02 acetylhexosaminidase activity, carbohydrate metabolic process, integral component of membrane 4599 3AXg7875.t1 4405 3BXg925.t1 E3.1.3.25, IMPA, suhB, DNA binding, integral 0 0.031 5 2.00E02 Inositol phosphate component of metabolism, membrane, Phosphatidylinositol phosphatidylinositol signaling system, phosphorylation Streptomycin biosynthesis 4600 3AXg6708.t1 4406 3BXg7541.t1 None membrane 0 0.036 5.2 2.00E02 4601 3AXg7523.t1 4407 3BXg2252.t1 None hydrolase activity, 0.029 0.007 2 2.10E02 metabolic process 4602 3AXg9481.t1 4408 3BXg11985.t1 Amino sugar and carbohydrate 0.059 0.345 2.5 2.10E02 nucleotide sugar metabolic process, metabolism, E3.2.1.14 chitin catabolic process, chitinase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, organic substance metabolic process, transferase activity, transferring glycosyl groups 4603 3AXg11091.t1 4409 3BXg13016.t1 None hydrolase activity, 0 0.007 3 2.10E02 hydrolyzing O- glycosyl compounds, metabolic process 4604 3AXg505.t1 4410 3BXg6843.t1 Amino sugar and ATP binding, 0 0.011 3.6 2.10E02 nucleotide sugar carbohydrate metabolism, Butirosin phosphorylation, and neomycin cellular glucose biosynthesis, homeostasis, cytosol, Carbohydrate digestion fructokinase activity, and absorption, Carbon fructose 6-phosphate metabolism, Central metabolic process, carbon metabolism in glucokinase activity, cancer, Fructose and glucose 6-phosphate mannose metabolism, metabolic process, Galactose metabolism, glucose binding, Glycolysis/ glycolytic Gluconeogenesis, HIF-1 fermentation, signaling pathway, HK, glycolytic process, Insulin signaling integral component pathway, Starch and of membrane, sucrose metabolism, mannokinase Streptomycin activity, mannose biosynthesis, Type II metabolic process, diabetes mellitus nuclear pore, nucleocytoplasmic transport, structural constituent of nuclear pore 4605 3AXg671.t1 4411 3BXg6947.t1 None FMN binding, 0 0.015 4 2.10E02 membrane, oxidation-reduction process, oxidoreductase activity 4606 3AXg907.t1 4412 3BXg10711.t1 None None 0 0.048 5.6 2.10E02 4607 3AXg10465.t1 4413 3BXg14385.t1 E3.2.1.58, Starch and carbohydrate 0 0.235 7.9 2.10E02 sucrose metabolism metabolic process, hydrolase activity, hydrolyzing O- glycosyl compounds, integral component of membrane, transmembrane transport 4608 3AXg1008.t1 4414 3BXg9515.t1 None choline 0.068 0 6.1 2.20E02 dehydrogenase activity, flavin adenine dinucleotide binding, oxidation- reduction process 4609 3AXg2591.t1 4415 3BXg1833.t1 Betalain biosynthesis, metal ion binding, 0.126 0.023 2.4 2.20E02 Isoquinoline alkaloid oxidation-reduction biosynthesis, process, Melanogenesis, oxidoreductase Riboflavin metabolism, activity TYR, Tyrosine metabolism 4610 3AXg4824.t1 4416 3BXg1527.t1 None None 0.04 0 5.4 2.30E02 4518 3AXg2998.t1 4417 3BXg8641.t1 None flavin adenine 0.37 0.038 3.3 2.30E02 dinucleotide binding, heterocycle biosynthetic process, organic cyclic compound biosynthetic process, oxidation-reduction process, oxidoreductase activity, acting on CHOH group of donors, secondary metabolite biosynthetic process 4611 3AXg8768.t1 4418 3BXg429.t1 None hydrolase activity, 0.011 0.145 3.6 2.30E02 metabolic process 4612 3AXg11131.t1 4419 3BXg7381.t1 None None 0 0.021 4.5 2.30E02 4613 3AXg3576.t1 4420 3BXg5515.t1 None None 0 0.063 6 2.30E02 4614 3AXg10565.t1 4421 3BXg10107.t1 None metallocarboxypeptidase 0.016 0 4.1 2.50E02 activity, proteolysis, zinc ion binding 4615 3AXg4536.t1 4422 3BXg3121.t1 Galactose metabolism, carbohydrate 0.047 0.003 3.8 2.50E02 malZ, Starch and binding, sucrose metabolism carbohydrate metabolic process, cellular process, glucosidase activity, hydrolase activity, hydrolyzing O- glycosyl compounds, integral component of membrane 4616 3AXg4165.t1 4423 3BXg6890.t1 bglX, Cyanoamino acid hydrolase activity, 0 0.01 3.4 2.50E02 metabolism, hydrolyzing O- Phenylpropanoid glycosyl compounds, biosynthesis, Starch integral component and sucrose of membrane, metabolism polysaccharide catabolic process 4617 3AXg8420.t1 4424 3BXg7817.t1 yteR, yesR hydrolase activity, 0.007 0.147 4.3 2.50E02 metabolic process 4618 3AXg6634.t1 4425 3BXg5671.t1 None acid phosphatase 0.004 0.022 2.1 2.60E02 activity, dephosphorylation 4619 3AXg5462.t1 4426 3BXg503.t1 None carbohydrate 0 0.03 5 2.60E02 metabolic process, hydrolase activity 4620 3AXg9660.t1 4427 3BXg10410.t1 None copper ion binding, 0 0.032 5 2.60E02 oxidation-reduction process, oxidoreductase activity 4621 3AXg736.t1 4428 3BXg7066.t1 None biosynthetic process, 0 0.062 6 2.60E02 carbohydrate metabolic process, cellulose binding, extracellular region, hydrolase activity, hydrolyzing O- glycosyl compounds, positive regulation of GTPase activity, pyridoxal phosphate binding, regulation of Rho protein signal transduction, Rho guanyl-nucleotide exchange factor activity 4622 3AXg3304.t1 4429 3BXg5239.t1 None None 0.07 0 6.1 2.70E02 4511 3AXg9048.t1 4430 3BXg11565.t1 None hydrolase activity, 0.974 0.079 3.6 2.70E02 magnesium ion binding, tRNA guanylyltransferase activity, tRNA modification 4623 3AXg2688.t1 4431 3BXg10864.t1 AMPK signaling 6-phosphofructo-2- 0.01 0 3.5 2.70E02 pathway, Fructose and kinase activity, ATP mannose metabolism, binding, HIF-1 signaling carbohydrate pathway, PFKFB phosphorylation, cytosol, dephosphorylation, fructose 2,6- bisphosphate metabolic process, fructose metabolic process, fructose- 2,6-bisphosphate 2- phosphatase activity 4624 3AXg9670.t1 4432 3BXg5175.t1 CTSA, Lysosome, fungal-type vacuole, 0.005 0.046 3 2.70E02 Renin- nuclear pore, angiotensin system nucleocytoplasmic transport, phytochelatin biosynthetic process, proteolysis, serine- type carboxypeptidase activity, structural constituent of nuclear pore 4625 3AXg2904.t1 4433 3BXg6481.t1 E3.2.1.58, Starch and carbohydrate 0 0.021 4.5 2.70E02 sucrose metabolism metabolic process, hydrolase activity, hydrolyzing O- glycosyl compounds, membrane part 4626 3AXg10815.t1 4434 3BXg9780.t1 None heme binding, 0.125 0 7 2.90E02 oxidation-reduction process, peroxidase activity, response to oxidative stress 4627 3AXg2002.t1 4435 3BXg2128.t1 CNBP nucleic acid binding, 0.026 0 4.8 3.10E02 zinc ion binding 4628 3AXg3713.t1 4436 3BXg4131.t1 None hydrolase activity, 0.026 0 4.7 3.10E02 metabolic process 4629 3AXg3872.t1 4437 3BXg4226.t1 COPB1, SEC26 COPI vesicle coat, 0.022 0 4.5 3.10E02 cytosol, ER to Golgi transport vesicle, ER to Golgi vesicle- mediated transport, intracellular protein transport, kinase activity, phosphorylation, structural molecule activity 4630 3AXg6318.t1 4438 3BXg3226.t1 None hydrolase activity, 0.012 0 3.7 3.10E02 hydrolase activity, acting on glycosyl bonds, organic substance metabolic process, oxidoreductase activity, primary metabolic process, single-organism metabolic process 4631 3AXg10010.t1 4439 3BXg11186.t1 None dephosphorylation, 0 0.088 6.5 3.10E02 phosphatase activity 4632 3AXg1263.t1 4440 3BXg1724.t1 None chitin binding, 0.03 0 4.9 3.20E02 copper ion binding, oxidation-reduction process, oxidoreductase activity 4633 3AXg8122.t1 4441 3BXg9830.t1 None None 0.024 0 4.6 3.20E02 4515 3AXg10862.t1 4442 3BXg9632.t1 E3.2.1.67, Pentose and carbohydrate 0.552 0.095 2.5 3.20E02 glucuronate metabolic process, interconversions, cell wall Starch and sucrose organization, metabolism extracellular region, polygalacturonase activity 4634 3AXg5813.t1 4443 3BXg1361.t1 Ascorbate and aldarate hydrolase activity, 0 0.12 6.9 3.40E02 metabolism, metabolic process Caprolactam degradation, Carbon metabolism, Degradation of aromatic compounds, E3.1.1.17, gnl, RGN, Pentose phosphate pathway 4635 3AXg2285.t1 4444 3BXg5413.t1 None heme binding, 0.045 0 5.5 3.60E02 integral component of membrane, oxidation-reduction process, peroxidase activity, response to oxidative stress 4636 3AXg3048.t1 4445 3BXg8570.t1 None copper ion binding, 0 0.01 3.5 3.60E02 endoplasmic reticulum, ferrous iron import into cell, metal ion binding, oxidation-reduction process, oxidoreductase activity 4637 3AXg3573.t1 4446 3BXg5567.t1 None None 0 0.019 4.4 3.60E02 4638 3AXg457.t1 4447 3BXg2952.t1 gcvH, GCSH, Glycine, glycine cleavage 0.039 0 5.3 3.90E02 serine and threonine complex, glycine metabolism, Glyoxylate decarboxylation via and dicarboxylate glycine cleavage metabolism system, mitochondrion, one- carbon metabolic process, oxidation- reduction process, protein lipoylation 4639 3AXg2903.t1 4448 3BXg6482.t1 None None 0 0.017 4.1 3.90E02 4640 3AXg10837.t1 4449 3BXg9608.t1 None cellular process, 0 0.043 5.5 3.90E02 membrane part, pectin catabolic process, pectin lyase activity 4641 3AXg10151.t1 4450 3BXg10552.t1 None 1,3-beta- 0.058 0 5.9 4.10E02 glucanosyltransferase activity, anchored component of membrane, ascospore wall assembly, carbohydrate metabolic process, endoplasmic reticulum, hydrolase activity, integral component of membrane, plasma membrane 4642 3AXg9889.t1 4451 3BXg7932.t1 None extracellular region, 0.009 0 3.4 4.10E02 mannan catabolic process, mannan endo-1,4-beta- mannosidase activity 4643 3AXg6766.t1 4452 3BXg3304.t1 None integral component 0.061 0 6 4.20E02 of membrane, transmembrane transport 4644 3AXg9025.t1 4453 3BXg3854.t1 None carbon-nitrogen 0.015 0 4 4.20E02 ligase activity, with glutamine asamido- N-donor, metabolic process, transferase activity 4645 3AXg9960.t1 4454 3BXg7994.t1 ABC.MR ATP binding, ATPase 0 0.041 5.4 4.20E02 activity, coupled to transmembrane movement of substances, integral component of membrane, isomerase activity, metabolic process, mitochondrion, transmembrane transport 4646 3AXg8755.t1 4455 3BXg86.t1 None acid phosphatase 0.011 0 3.6 4.30E02 activity, dephosphorylation, heme binding, integral component of membrane, iron ion binding, membrane, oxidation-reduction process, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen 4647 3AXg1998.t1 4456 3BXg2125.t1 None aminopeptidase 0 0.019 4.3 4.30E02 activity, integral component of membrane, metallopeptidase activity, proteolysis, zinc ion binding 4648 3AXg4651.t1 4457 3BXg12484.t1 Nicotinate and hydrolase activity, 0.031 0 5 4.40E02 nicotinamide integral component metabolism, Purine of membrane, metabolism, Pyrimidine metabolic process, metabolism, surE substrate-specific transmembrane transporter activity, transmembrane transport 4649 3AXg1281.t1 4458 3BXg5746.t1 Antigen processing and ATP binding 0.027 0 4.8 4.50E02 presentation, Endocytosis, Epstein- Barr virus infection, Estrogen signaling pathway, HSPA1_8, Influenza A, Legionellosis, MAPK signaling pathway, Measles, Protein processing in endoplasmic reticulum, Spliceosome, Toxoplasmosis 4650 3AXg2954.t1 4459 3BXg10202.t1 None cutiriase activity, 0.02 0 4.4 4.50E02 extracellular region, metabolic process 4651 3AXg8116.t1 4460 3BXg9765.t1 E3.2.1.8, xynA endo-1,4-beta- 0 0.047 5.6 4.50E02 xylanase activity, polysaccharide catabolic process 4652 3AXg9229.t1 4461 3BXg511.t1 None cell cycle, cell 0.02 0 4.4 4.60E02 division, cyclin- dependent protein serine/threonine kinase regulator activity, integral component of membrane, regulation of protein kinase activity 4653 3AXg5237.t1 4462 3BXg5596.t1 Aminobenzoate metabolic process, 0.067 0 6.1 4.70E02 degradation, Folate oxidation-reduction biosynthesis, phoD, process Two-component system 4654 3AXg9949.t1 4463 3BXg5805.t1 None None 0.061 0 6 5.00E02 4655 3AXg11247.t1 4464 3BXg648.t1 None integral component 0.009 0 3.3 5.00E02 of membrane 4656 3AXg9208.t1 4465 3BXg534.t1 None integral component 0.011 0.168 3.8 5.00E02 of membrane, membrane 4657 3AXg7858.t1 4466 3BXg1035.t1 None flavin adenine 0 0.076 6.3 5.00E02 dinucleotide binding, membrane, oxidation-reduction process, oxidoreductase activity, acting on CHOH group of donors
This table describes the differential protein expression between pairs of orthologous proteins from a genus, where one member of the pair has a beneficial effect on plant growth and the other has a neutral effect. A.mean represents the average normalized spectral counts between biological replicates of the beneficial member of the pair. B.mean represents the average normalized spectral counts between biological replicates of the neutral member of the pair. Fold change represents the fold change difference between the two organisms. FDR q-value represents the false discovery rate corrected q-value.
(570) A total of 697 proteins were detected across all Phoma samples with two or more unique peptides at the false discovery rates indicated above.
(571) SYM01004 Secreted Proteomic Analysis
(572) TABLE-US-00048 TABLE 704 25 most abundant proteins secreted by SYM01004; Median Abundance represents the median value across three biological replicates in units of spectra per hundred spectra SEQ Protein Median ID ID Abundance GO Terms KEGG Terms 4742 5AYg748.t1 0.999348 GO: 0005198: structural KEGG Orthology: K02406: fliC: flagellin; KEGG molecule activity; PATHWAY: ko02020: Two-component system: GO: 0005576: extracellular Two-component signal transduction systems region; GO: 0009420: enable bacteria to sense, respond, and adapt to bacterial-type flagellum changes in their environment or in their filament; GO: 0071973: intracellular state. Each two-component system bacterial-type flagellum- consists of a sensor protein-histidine kinase (HK) dependent cell motility and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription.; KEGG PATHWAY: ko02040: Flagellar assembly:; KEGG PATHWAY: ko04626: Plant-pathogen interaction: Plants lack animal- like adaptive immunity mechanisms, and therefore have evolved a specific system with multiple layers against invading pathogens. The primary response includes the perception of pathogens by cell-surface pattern-recognition receptors (PRRs) and is referred to as PAMP- triggered immunity (PTI). Activation of FLS2 and EFR triggers MAPK signaling pathway that activates defense genes for antimictobial compounds. The increase in the cytosolic Ca2+ concentration is also a regulator for production of reactive oxygen species and localized programmed cell death/hypersensitive response. The secondary response is called effector-triggered immunity (ETI). Pathogens can acquire the ability to suppress PTI by directly injecting effector proteins into the plant cell through secretion systems. In addition, pathogens can manipulate plant hormone signaling pathways to evade host immune responses using coronatine toxin. Some plants possess specific intracellular surveillance proteins (R proteins) to monitor the presence of pathogen virulence proteins. This ETI occurs with localized programmed cell death to arrest pathogen growth, resulting in cultivar-specific disease resistance.; KEGG PATHWAY: ko05132: Salmonella infection: Salmonella infection usually presents as a self-limiting gastroenteritis or the more severe typhoid fever and bacteremia. The common disease-causing Salmonella species in human is a single species, Salmonella enterica, which has numerous serovars.; KEGG PATHWAY: ko05134: Legionellosis: Legionellosis is a potentially fatal infectious disease caused by the bacterium Legionella pneumophila and other legionella species. Two distinct clinical and epidemiological syndromes are associated with Legionella species: Legionnaires' disease is the more severe form of the infection, which may involve pneumonia, and Pontiac fever is a milder respiratory illness. 4743 5AYg747.t1 0.973878 GO: 0005198: structural KEGG Orthology: K02406: fliC: flagellin; KEGG molecule activity; PATHWAY: ko02020: Two-component system: GO: 0005576: extracellular Two-component signal transduction systems region; GO: 0009420: enable bacteria to sense, respond, and adapt to bacterial-type flagellum changes in their environment or in their filament; GO: 0071973: intracellular state. Each two-component system bacterial-type flagellum- consists of a sensor protein-histidine kinase (HK) dependent cell motility and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription.; KEGG PATHWAY: ko02040: Flagellar assembly:; KEGG PATHWAY: ko04626: Plant-pathogen interaction: Plants lack animal- like adaptive immunity mechanisms, and therefore have evolved a specific system with multiple layers against invading pathogens. The primary response includes the perception of pathogens by cell-surface pattern-recognition receptors (PRRs) and is referred to as PAMP- triggered immunity (PTI). Activation of FLS2 and EFR triggers MAPK signaling pathway that activates defense genes for antimictobial compounds. The increase in the cytosolic Ca2+ concentration is also a regulator for production of reactive oxygen species and localized programmed cell death/hypersensitive response. The secondary response is called effector-triggered immunity (ETI). Pathogens can acquire the ability to suppress PTI by directly injecting effector proteins into the plant cell through secretion systems. In addition, pathogens can manipulate plant hormone signaling pathways to evade host immune responses using coronatine toxin. Some plants possess specific intracellular surveillance proteins (R proteins) to monitor the presence of pathogen virulence proteins. This ETI occurs with localized programmed cell death to arrest pathogen growth, resulting in cultivar-specific disease resistance.; KEGG PATHWAY: ko05132: Salmonella infection: Salmonella infection usually presents as a self-limiting gastroenteritis or the more severe typhoid fever and bacteremia. The common disease-causing Salmonella species in human is a single species, Salmonella enterica, which has numerous serovars.; KEGG PATHWAY: ko05134: Legionellosis: Legionellosis is a potentially fatal infectious disease caused by the bacterium Legionella pneumophila and other legionella species. Two distinct clinical and epidemiological syndromes are associated with Legionella species: Legionnaires' disease is the more severe form of the infection, which may involve pneumonia, and Pontiac fever is a milder respiratory illness. 4744 5AYg746.t1 0.393566 GO: 0005198: structural KEGG Orthology: K02406: fliC: flagellin; KEGG molecule activity; PATHWAY: ko02020: Two-component system: GO: 0005576: extracellular Two-component signal transduction systems region; GO: 0009420: enable bacteria to sense, respond, and adapt to bacterial-type flagellum changes in their environment or in their filament; GO: 0071973: intracellular state. Each two-component system bacterial-type flagellum- consists of a sensor protein-histidine kinase (HK) dependent cell motility and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription.; KEGG PATHWAY: ko02040: Flagellar assembly:; KEGG PATHWAY: ko04626: Plant-pathogen interaction: Plants lack animal- like adaptive immunity mechanisms, and therefore have evolved a specific system with multiple layers against invading pathogens. The primary response includes the perception of pathogens by cell-surface pattern-recognition receptors (PRRs) and is referred to as PAMP- triggered immunity (PTI). Activation of FLS2 and EFR triggers MAPK signaling pathway that activates defense genes for antimictobial compounds. The increase in the cytosolic Ca2+ concentration is also a regulator for production of reactive oxygen species and localized programmed cell death/hypersensitive response. The secondary response is called effector-triggered immunity (ETI). Pathogens can acquire the ability to suppress PTI by directly injecting effector proteins into the plant cell through secretion systems. In addition, pathogens can manipulate plant hormone signaling pathways to evade host immune responses using coronatine toxin. Some plants possess specific intracellular surveillance proteins (R proteins) to monitor the presence of pathogen virulence proteins. This ETI occurs with localized programmed cell death to arrest pathogen growth, resulting in cultivar-specific disease resistance.; KEGG PATHWAY: ko05132: Salmonella infection: Salmonella infection usually presents as a self-limiting gastroenteritis or the more severe typhoid fever and bacteremia. The common disease-causing Salmonella species in human is a single species, Salmonella enterica, which has numerous serovars.; KEGG PATHWAY: ko05134: Legionellosis: Legionellosis is a potentially fatal infectious disease caused by the bacterium Legionella pneumophila and other legionella species. Two distinct clinical and epidemiological syndromes are associated with Legionella species: Legionnaires' disease is the more severe form of the infection, which may involve pneumonia, and Pontiac fever is a milder respiratory illness. 4745 5AYg329.t1 0.208236 GO: 0004519: endonuclease KEGG Orthology: K00940: ndk, NME: activity; GO: 0004550: nucleoside-diphosphate kinase [EC: 2.7.4.6]; nucleoside diphosphate KEGG PATHWAY: ko00230: Purine metabolism:; kinase activity; KEGG PATHWAY: ko00240: Pyrimidine GO: 0005524: ATP binding; metabolism: GO: 0005737: cytoplasm; GO: 0006165: nucleoside diphosphate phosphorylation; GO: 0006183: GTP biosynthetic process; GO: 0006228: UTP biosynthetic process; GO: 0006241: CTP biosynthetic process; GO: 0046872: metal ion binding; GO: 0090305: nucleic acid phosphodiester bond hydrolysis 4746 5AYg1483.t1 0.204231 GO: 0015288: porin activity; none GO: 0016020: membrane; GO: 0055085: transmembrane transport 4747 5AYg1901.t1 0.201732 GO: 0004970: ionotropic KEGG Orthology: K02030: ABC.PA.S: polar glutamate receptor activity; amino acid transport system substrate-binding GO: 0006810: transport; protein GO: 0016020: membrane; GO: 0030288: outer membrane-bounded periplasmic space; GO: 0035235: ionotropic glutamate receptor signaling pathway 4748 5AYg2621.t1 0.184662 GO: 0003735: structural KEGG Orthology: K02884: RP-L19, MRPL19, rplS: constituent of ribosome; large subunit ribosomal protein L19; KEGG GO: 0005840: ribosome; PATHWAY: ko03010: Ribosome: GO: 0006412: translation 4749 5AYg1882.t1 0.177 GO: 0003735: structural KEGG Orthology: K02879: RP-L17, MRPL17, constituent of ribosome; rplQ: large subunit ribosomal protein L17; KEGG GO: 0005840: ribosome; PATHWAY: ko03010: Ribosome: GO: 0006412: translation 4750 5AYg89.t1 0.175201 GO: 0000049: tRNA binding; KEGG Orthology: K02992: RP-S7, MRPS7, rpsG: GO: 0003735: structural small subunit ribosomal protein S7; KEGG constituent of ribosome; PATHWAY: ko03010: Ribosome: GO: 0006412: translation; GO: 0015935: small ribosomal subunit; GO: 0019843: rRNA binding 4751 5AYg1281.t1 0.167696 GO: 0006935: chemotaxis; KEGG Orthology: K10546: ABC.GGU.S, chvE: GO: 0042597: periplasmic putative multiple sugar transport system space substrate-binding protein; KEGG PATHWAY: ko02010: ABC transporters: The ATP-binding cassette (ABC) transporters form one of the largest known protein families, and are widespread in bacteria, archaea, and eukaryotes. They couple ATP hydrolysis to active transport of a wide variety of substrates such as ions, sugars, lipids, sterols, peptides, proteins, and drugs. The structure of a prokaryotic ABC transporter usually consists of three components; typically two integral membrane proteins each having six transmembrane segments, two peripheral proteins that bind and hydrolyze ATP, and a periplasmic (or lipoprotein) substrate-binding protein. Many of the genes for the three components form operons as in fact observed in many bacterial and archaeal genomes. On the other hand, in a typical eukaryotic ABC transporter, the membrane spanning protein and the ATP-binding protein are fused, formirig a multi-domain protein with the membrane- spanning domain (MSD) and the nucleotide- binding domain (NBD). 4752 5AYg777.t1 0.156177 GO: 0000413: protein KEGG Orthology: K03768: PPIB, ppiB: peptidyl- peptidyl-prolyl prolyl cis-trans isomerase B (cyclophilin B) isomerization; GO: 0003755: [EC: 5.2.1.8] peptidyl-prolyl cis-trans isomerase activity; GO: 0006457: protein folding 4753 5AYg1692.t1 0.155178 GO: 0003677: DNA binding; KEGG Orthology: K03704: cspA: cold shock GO: 0005737: cytoplasm; protein (beta-ribbon, CspA family) GO: 0006355: regulation of transcription, DNA- templated 4754 5AYg1247.t1 0.152662 GO: 0006865: amino acid KEGG Orthology: K01999: livK: branched-chain transport amino acid transport system substrate-binding protein; KEGG PATHWAY: ko02010: ABC transporters: The ATP-binding cassette (ABC) transporters form one of the largest known protein families, and are widespread in bacteria, archaea, and eukaryotes. They couple ATP hydrolysis to active transport of a wide variety of substrates such as ions, sugars, lipids, sterols, peptides, proteins, and drugs. The structure of a prokaryotic ABC transporter usually consists of three components; typically two integral membrane proteins each having six transmembrane segments, two peripheral proteins that bind and hydrolyze ATP, and a periplasmic (or lipoprotein) substrate-binding protein. Many of the genes for the three components form operons as in fact observed in many bacterial and archaeal genomes. On the other hand, in a typical eukaryotic ABC transporter, the membrane spanning protein and the ATP-binding protein are fused, forming a multi-domain protein with the membrane- spanning domain (MSD) and the nucleotide- binding domain (NBD). 4755 5AYg2256.t1 0.149078 GO: 0016021: integral KEGG Orthology: K16079: omp31: outer component of membrane membrane immunogenic protein 4756 5AYg208.t1 0.14751 GO: 0003735: structural KEGG Orthology: K02986: RP-54, rpsD: small constituent of ribosome; subunit ribosomal protein S4; KEGG PATHWAY: GO: 0006412: translation; ko03010: Ribosome: GO: 0015935: small ribosomal subunit; GO: 0019843: rRNA binding 4757 5AYg1876.t1 0.146416 GO: 0000049: tRNA binding; KEGG Orthology: K02931: RP-L5, MRPL5, rplE: GO: 0003735: structural large subunit ribosomal protein L5; KEGG constituent of ribosome; PATHWAY: ko03010: Ribosome: GO: 0005840: ribosome; GO: 0006412: translation; GO: 0019843: rRNA binding 4758 5AYg998.t1 0.145775 GO: 0004801: KEGG Orthology: K00616: E2.2.1.2, talA, talB: sedoheptulose-7- transaldolase [EC: 2.2.1.2]; KEGG PATHWAY: phosphate: D- ko00030: Pentose phosphate pathway: The glyceraldehyde-3- pentose phosphate pathway is a process of phosphate glucose turnover that produces NADPH as glyceronetransferase reducing equivalents and pentoses as essential activity; GO: 0005737: parts of nucleotides. There are two different cytoplasm; GO: 0005975: phases in the pathway. One is irreversible carbohydrate metabolic oxidative phase in which glucose-6P is process; GO: 0006098: converted to ribulose-5P by oxidative pentose-phosphate shunt decarboxylation, and NADPH is generated [MD: M00006]. The other is reversible non- oxidative phase in which phosphorylated sugars are interconverted to generate xylulose-5P, ribulose-5P, and ribose-5P [MD: M00007]. Phosphoribosyl pyrophosphate (PRPP) formed from ribose-5P [MD: M00005] is an activated compound used in the biosynthesis of histidine and purine/pyrimidine nucleotides. This pathway map also shows the Entner-Doudoroff pathway where 6-P-gluconate is dehydrated and then cleaved into pyruvate and glyceraldehyde-3P [MD: M00008].; KEGG PATHWAY: ko01200: Carbon metabolism: Carbon metabolism is the most basic aspect of life. This map presents an overall view of central carbon metabolism, where the number of carbons is shown for each compound denoted by a circle, excluding a cofactor (CoA, CoM, THF, or THMPT) that is replaced by an asterisk. The map contains carbon utilization pathways of glycolysis (map00010), pentose phosphate pathway (map00030), and citrate cycle (map00020), and six known carbon fixation pathways (map00710 and map00720) as well as some pathways of methane metabolism (map00680). The six carbon fixation pathways are: (1) reductive pentose phosphate cycle (Calvin cycle) in plants and cyanobacteria that perform oxygenic photosynthesis, (2) reductive citrate cycle in photosynthetic green sulfur bacteria and some chemolithoautotrophs, (3) 3- hydroxypropionate bi-cycle in photosynthetic green nonsulfur bacteria, two variants of 4- hydroxybutyrate pathways in Crenarchaeota called (4) hydroxypropionate-hydroxybutyrate cycle and (5) dicarboxylate-hydroxybutyrate cycle, and (6) reductive acetyl-CoA pathway in methanogenic bacteria.; KEGG PATHWAY: ko01230: Biosynthesis of amino acids: This map presents a modular architecture of the biosynthesis pathways of twenty amino acids, which may be viewed as consisting of the core part and its extensions. The core part is the KEGG module for conversion of three-carbon compounds from glyceraldehyde-3P to pyruvate [MD: M00002], together with the pathways around serine and glycine. This KEGG module is the most conserved one in the KEGG MODULE database and is found in almost all the completely sequenced genomes. The extensions are the pathways containing the reaction modules RM001, RM033, RM032, and RM002 for biosynthesis of branched-chain amino acids (left) and basic amino acids (bottom), and the pathways for biosynthesis of histidine and aromatic amino acids (top right). It is interesting to note that the so-called essential amino acids that cannot be synthesized in human and other organisms generally appear in these extensions. Furthermore, the bottom extension of basic amino acids appears to be most divergent containing multiple pathways for lysine biosynthesis and multiple gene sets for arginine biosynthesis. 4759 5AYg1162.t1 0.144833 GO: 0006006: glucose KEGG Orthology: K00134: GAPDH, gapA: metabolic process; glyceraldehyde 3-phosphate dehydrogenase GO: 0016620: [EC: 1.2.1.12]; KEGG PATHWAY: ko00010: oxidoreductase activity, Glycolysis/Gluconeogenesis: Glycolysis is the acting on the aldehyde or process of converting glucose into pyruvate and oxo group of donors, NAD generating small amounts of ATP (energy) and or NADP as acceptor; NADH (reducing power). It is a central pathway GO: 0050661: NADP that produces important precursor metabolites: binding; GO: 0051287: NAD six-carbon compounds of glucose-6P and binding; GO: 0055114: fructose-6P and three-carbon compounds of oxidation-reduction process glycerone-P, glyceraldehyde-3P, glycerate-3P, phosphoenolpyruvate, and pyruvate [MD: M00001]. Acetyl-CoA, another important precursor metabolite, is produced by oxidative decarboxylation of pyruvate [MD: M00307]. When the enzyme genes of this pathway are. examined in completely sequenced genomes, the reaction steps of three-carbon compounds from glycerone-P to pyruvate form a conserved core module [MD: M00002], which is found in almost all organisms and which sometimes contains operon structures in bacterial genomes. Gluconeogenesis is a synthesis pathway of glucose from noncarbohydrate precursors. It is essentially a reversal of glycolysis with minor variations of alternative paths [MD: M00003].; KEGG PATHWAY: ko00710: Carbon fixation in photosynthetic organisms:; KEGG PATHWAY: ko01200: Carbon metabolism: Carbon metabolism is the most basic aspect of life. This map presents an overall view of central carbon metabolism, where the number of carbons is shown for each compound denoted by a circle, excluding a cofactor (CoA, CoM, THF, or THMPT) that is replaced by an asterisk. The map contains carbon utilization pathways of glycolysis (map00010), pentose phosphate pathway (map00030), and citrate cycle (map00020), and six known carbon fixation pathways (map00710 and map00720) as well as some pathways of methane metabolism (map00680). The six carbon fixation pathways are: (1) reductive pentose phosphate cycle (Calvin cycle) in plants and cyanobacteria that perform oxygenic photosynthesis, (2) reductive citrate cycle in photosynthetic green sulfur bacteria and some chemolithoautotrophs, (3) 3-hydroxypropionate bi-cycle in photosynthetic green nonsulfur bacteria, two variants of 4-hydroxybutyrate pathways in Crenarchaeota called (4) hydroxypropionate- hydroxybutyrate cycle and (5) dicarboxylate- hydroxybutyrate cycle, and (6) reductive acetyl- CoA pathway in methanogenic bacteria.; KEGG PATHWAY: ko01230: Biosynthesis of amino acids: This map presents a modular architecture of the biosynthesis pathways of twenty amino acids, which may be viewed as consisting of the core part and its extensions. The core part is the KEGG module for conversion of three-carbon compounds from glyceraldehyde-3P to pyruvate [MD: M00002], together with the pathways around serine and glycine. This KEGG module is the most conserved one in the KEGG MODULE database and is found in almost all the completely sequenced genomes. The extensions are the pathways containing the reaction modules RM001, RM033, RM032, and RM002 for biosynthesis of branched-chain amino acids (left) and basic amino acids (bottom), and the pathways for biosynthesis of histidine and aromatic amino acids (top right). It is interesting to note that the so-called essential amino acids that cannot be synthesized in human and other organisms generally appear in these extensions. Furthermore, the bottom extension of basic amino acids appears to be most divergent containing multiple pathways for lysine biosynthesis and multiple gene sets for arginine biosynthesis.; KEGG PATHWAY: ko04066: HIF-1 signaling pathway: Hypoxia-inducible factor 1 (HIF-1) is a transcription factor that functions as a master regulator of oxygen homeostasis. It consists of two subunits: an inducibly-expressed HIF-1alpha subunit and a constitutively- expressed HIF-1beta subunit. Under normoxia, HIF-1 alpha undergoes hydroxylation at specific prolyl residues which leads to an immediate ubiquitination and subsequent proteasomal degradation of the subunit. In contrast, under hypoxia, HIF-1 alpha subunit becomes stable and interacts with coactivators such as p300/CBP to modulate its transcriptional activity. Eventually, HIF-1 acts as a master regulator of numerous hypoxia-inducible genes under hypoxic conditions. The target genes of HIF-1 encode proteins that increase O2 delivery and mediate adaptive responses to O2 deprivation. Despite its name, HIF-1 is induced not only in response to reduced oxygen availability but also by other stimulants, such as nitric oxide, or various growth factors.; KEGG PATHWAY: ko05010: Alzheimer's disease: Alzheimer's disease (AD) is a chronic disorder that slowly destroys neurons and causes serious cognitive disability. AD is associated with senile plaques and neurofibrillary tangles (NFTs). Amyloid-beta (Abeta), a major component of senile plaques, has various pathological effects on cell and organelle function. The extracellular Abeta oligomers may activate caspases through activation of cell surface death receptors. Alternatively, intracellular Abeta may contribute to pathology by facilitating tau hyper- phosphorylation, disrupting mitochondria function, and triggering calcium dysfunction. To date genetic studies have revealed four genes that may be linked to autosomal dominant or familial early onset AD (FAD). These four genes include: amyloid precursor protein (APP), presenilin 1 (PS1), presenilin 2 (PS2) and apolipoprotein E (ApoE). All mutations associated with APP and PS proteins can lead to an increase in the production of Abeta peptides, specfically the more amyloidogenic form, Abeta42. FAD-linked PS1 mutation downregulates the unfolded protein response and leads to vulnerability to ER stress. 4760 5AYg287.t1 0.138824 GO: 0003677: DNA binding; KEGG Orthology: K03530: hupB: DNA-binding GO: 0030261: chromosome protein HU-beta condensation 4761 5AYg677.t1 0.137328 GO: 0005524: ATP binding; KEGG Orthology: K04077: groEL, HSPD1: GO: 0005737: cytoplasm; chaperonin GroEL; KEGG PATHWAY: ko03018: GO:0016491: RNA degradation: The correct processing, oxidoreductase activity; quality control and turnover of cellular RNA GO: 0042026: protein molecules are critical to many aspects in the refolding; GO: 0051082: expression of genetic information. In unfolded protein binding; eukaryotes, two major pathways of mRNA GO: 0055114: oxidation- decay exist and both pathways are initiated by reduction process poly(A) shortening of the mRNA. In the 5 to 3 pathway, this is followed by decapping which then permits the 5 to 3 exonucleolytic degradation of transcripts. In the 3 to 5 pathway, the exosome, a large multisubunit complex, plays a key role. The exosome exists in archaeal cells, too. In bacteria, endoribonuclease E, a key enzyme involved in RNA decay and processing, organizes a protein complex called degradosome. RNase E or R interacts with the phosphate-dependent exoribonuclease polynucleotide phosphorylase, DEAD-box helicases, and additional factors in the RNA-degrading complex.; KEGG PATHWAY: ko04940: Type I diabetes mellitus: Type I diabetes mellitus is a disease that results from. autoimmune destruction of the insulin- producing beta-cells. Certain beta-cell proteins act as autoantigens after being processed by antigen-presenting cell (APC), such as macrophages and dendritic cells, and presented in a complex with MHC-II molecules on the surface of the APC. Then immunogenic signals from APC activate CD4+ T cells, predominantly of the Th1 subset. Antigen-activated Th1 cells produce IL-2 and IFNgamma. They activate macrophages and cytotoxic CD8+ T cells, and these effector cells may kill islet beta-cells by one or both of two types of mechanisms: (1) direct interactions of antigen-specific cytotoxic T cells with a beta-cell autoantigen-MHC-I complex on the beta-cell, and (2) non-specific inflammatory mediators, such as free radicals/oxidants and cytokines (IL-1, TNFalpha, TNFbeta, IFNgamma).; KEGG PATHWAY: ko05134: Legionellosis: Legionellosis is a potentially fatal infectious disease caused by the bacterium Legionella pneumophila and other legionella species. Two distinct clinical and epidemiological syndromes are associated with Legionella species: Legionnaires' disease is the more severe form of the infection, which may involve pneumonia, and Pontiac fever is a milder respiratory illness.; KEGG PATHWAY: ko05152: Tuberculosis: Tuberculosis, or TB, is an infectious disease caused by Mycobacterium tuberculosis. One third of the world's population is thought to be infected with TB. About 90% of those infected result in latent infections, and about 10% of latent infections develop active diseases when their immune system is impaired due to the age, other diseases such as AIDS or exposure to immunosuppressive drugs. TB is transmitted thrciugh the air and primarily attacks the lungs, then it can spread by the circulatory system to other parts of body. Once TB bacilli have entered the host by the respiratory route and infected macrophages in the lungs, they interfere with phagosomal maturation, antigen presentation, apoptosis and host immune system to establish persistent or latent infection. 4762 5AYg2260.t1 0.135 GO: 0043190: ATP-binding KEGG Orthology: K12368: dppA: dipeptide cassette (ABC) transporter transport system substrate-binding protein; complex; GO: 0055085: KEGG PATHWAY: ko02010: ABC transporters: transmembrane transport The ATP-binding cassette (ABC) transporters form one of the largest known protein families, and are widespread in bacteria, archaea, and eukaryotes. They couple ATP hydrolysis to active transport of a wide variety of substrates such as ions, sugars, lipids, sterols, peptides, proteins, and drugs. The structure of a prokaryotic ABC transporter usually consists of three components; typically two integral membrane proteins each having six transmembrane segments, two peripheral proteins that bind and hydrolyze ATP, and a periplasmic (or lipoprotein) substrate-binding protein. Many of the genes for the three components form operons as in fact observed in many bacterial and archaeal genomes. On the other hand, in a typical eukaryotic ABC transporter, the membrane spanning protein and the ATP-binding protein are fused, forming a multi-domain protein with the membrane- spanning domain (MSD) and the nucleotide- binding domain (NBD).; KEGG PATHWAY: ko02030: Bacterial chemotaxis: Chemotaxis is the process by which cells sense chemical gradients in their environment and then move towards more favorable conditions. In chemotaxis, events at the receptors control autophosphorylation of the CheA histidine kinase, and the phosphohistidine is the substrate for the response regulator CheY, which catalyzes the transfer of the phosphoryl group to a conserved aspartate. The resulting CheY-P can interact with the switch mechanism in the motor. This interaction causes a change in behavior, such as in direction or speed of rotation of flagella. 4763 5AYg980.t1 0.133866 GO: 0016021: integral KEGG Orthology: K16079: omp31: outer component of membrane membrane immunogenic protein 4764 5AYg2744.t1 0.131774 GO: 0000413: protein KEGG Orthology: K03769: ppiC: peptidyl-prolyl peptidyl-prolyl cis-trans isomerase C [EC:5.2.1.8] isomerization; GO: 0003755: peptidyl-prolyl cis-trans isomerase activity 4765 5AYg2575.t1 0.130147 GO: 0003735: structural KEGG Orthology: K02899: RP-L27, MRPL27, constituent of ribosome; rpmA: large subunit ribosomal protein L27; GO: 0005840: ribosome; KEGG PATHWAY: ko03010: Ribosome: GO: 0006412: translation; GO: 0019843: rRNA binding 4766 5AYg676.t1 0.128736 GO: 0005524: ATP binding; KEGG Orthology: K04078: groES, HSPE1: GO: 0005737: cytoplasm; chaperonin GroES GO: 0006457: protein folding
(573) SYM01004 Versus SYM00091
(574) TABLE-US-00049 TABLE 705 Differential secreted protein abundance between SYM01004 and SYM00091. SEQ ID SEQ ID Fold- FDR Beneficial A.protein Neutral B.protein KEGG GO A.mean B.mean change q-value 4734 5AYg1329.t1 4671 5BYg3790.t1 ade, Purine adenine catabolic process, 0.057 0 5.9 3.90E02 metabolism adenine deaminase activity 4735 5AYg1185.t1 4672 5BYg649.t1 Biosynthesis of amino L-serine biosynthetic 0 0.009 3.3 4.90E02 acids, Carbon process, NAD binding, metabolism, Glycine, oxidation-reduction process, serine and threonine phosphoglycerate metabolism, Methane dehydrogenase activity metabolism, serA, PHGDH 4736 5AYg1107.t1 4673 5BYg1291.t1 ABC transporters, ATP binding, ATP-binding 0.008 0 3.2 4.40E02 ABC.MS.S, msmX, cassette (ABC) transporter msmK, malK, sugC, complex, ATPase activity, ggtA, msiK carbohydrate transport, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances, metabolic process, transmembrane transport, transporter activity 4737 5AYg12621.t1 4674 5BYg1034.t1 None integral component of 0 0.007 3.1 4.00E02 membrane, transport, transporter activity 4738 5AYg1075.t1 4675 5BYg577.t1 E2.4.1.1, glgP, PYG, carbohydrate metabolic 0 0.007 2.9 3.00E02 Insulin signaling process, glycogen pathway, Starch and phosphorylase activity, sucrose metabolism pyridoxal phosphate binding 4739 5AYg1184.t1 4676 5BYg648.t1 Biosynthesis of amino cytoplasm, L-serine 0.036 0.005 2.7 4.90E02 acids, Carbon biosynthetic process, O- metabolism, Glycine, phospho-L-serine:2- serine and threonine oxoglutarate metabolism, Methane aminotransferase activity metabolism, serC, PSAT1, Vitamin B6 metabolism 4740 5AYg126.t1 4677 5BYg3243.t1 Carbon metabolism, glycine decarboxylation via 0.032 0.006 2.2 3.90E02 GLDC, gcvP, Glycine, glycine cleavage system, serine and threonine glycine dehydrogenase metabolism (decarboxylating) activity, lyase activity, oxidation- reduction process 4741 5AYg124.t1 14678 5BYg3241.t1 K09796 None 0.019 0.004 2.1 3.90E02
This table describes the differential protein expression between pairs of orthologous proteins from a genus, where one member of the pair has a beneficial effect on plant growth and the other has a neutral effect. A.mean represents the average normalized spectral counts between biological replicates of the beneficial member of the pair. B.mean represents the average normalized spectral counts between biological replicates of the neutral member of the pair. Fold change represents the fold change difference between the two organisms. FDR q-value represents the false discovery rate corrected q-value.
(575) A total of 1390 proteins were detected across all Agrobacterium samples with two or more unique peptides at the false discovery rates indicated above.
(576) KEGG Pathway Enrichment of Beneficial Fungi Versus Neutral Fungi
(577) TABLE-US-00050 TABLE 706 KEGG Pathway enrichment of beneficial fungi versus neutral fungi FDR SEQ ID SEQ ID q- Category KEGG ID Name Description Beneficial A.Protein.ID Neutral B.Protein.ID value KEGG PATHWAY ko00500 Starch and none 643; 2293; 1AXg13171.t1, 4104; 1BXg10106.t1, 2.92E10 sucrose 2292; 874; 1AXg2246.t1, 4126; 1BXg10460.t1, metabolism 480; 2288; 1AXg2742.t1, 4125; 1BXg10656.t1, 487; 2285; 1AXg2815.t1, 2443; 1BXg1289.t1, 580; 2279; 1AXg3149.t1, 4097; 1BXg135.t1, 4543; 1AXg4053.t1, 4122; 1BXg1561.t1, 4515; 1AXg5358.t1, 2349; 1BXg2692.t1, 4669; 1AXg5538.t1, 4118; 1BXg3232.t1, 4668; 1AXg5751.t1, 2382; 1BXg3531.t1, 4666; 1AXg8814.t1, 2436; 1BXg4362.t1, 4615; 3AXg10791.t1, 2377; 1BXg4998.t1, 4573; 3AXg10862.t1, 2350; 1BXg5592.t1, 4661; 3AXg1436.t1, 2721; 1BXg9114.t1, 4659; 3AXg192.t1, 2470; 1BXg9824.t1, 4571 3AXg2790.t1, 4508; 3BXg11320.t1, 3AXg4536.t1, 4413; 3BXg14385.t1, 3AXg4810.t1, 4507; 3BXg1864.t1, 3AXg6314.t1, 4505; 3BXg2317.t1, 3AXg7872.t1, 4422; 3BXg3121.t1, 3AXg9121.t1 4500; 3BXg3387.t1, 4433; 3BXg6481.t1, 4410; 3BXg6843.t1, 4423; 3BXg6890.t1, 4491; 3BXg7356.t1, 4487; 3BXg928.t1, 4442; 3BXg9632.t1, 4346; 3BXg9786.t1, 4484 3BXg9960.t1 KEGG Orthology K08257 E3.2.1.101 mannan endo- 2277; 528; 1AXg10033.t1, 2457; 1BXg12075.t1, 2.62E05 1,6-alpha- 623; 2278; 1AXg4291.t1, 4121; 1BXg1595.t1, mannosidase 4663; 1AXg459.t1, 4112; 1BXg6031.t1, [EC: 3.2.1.101] 4585 1AXg9931.t1, 2422; 1BXg8019.t1, 3AXg512.t1, 4391; 3BXg10636.t1, 3AXg7050.t1 4499; 3BXg3817.t1, 4492 3BXg7176.t1 KEGG K18576 XEG xyloglucan- 2273; 1AXg6048.t1, 2390; 1BXg307.t1, 4.04E05 Orthology specific endo- 1249; 1AXg9842.t1, 4109; 1BXg8240.t1, beta-1,4- 4540 3AXg10237.t1 3093; 1BXg9770.t1, glucanase 4509; 3BXg10794.t1, [EC: 3.2.1.151] 4343 3BXg1101.t1 KEGG ko00040 Pentose and none 480; 4515; 1AXg3149.t1, 4099; 1BXg12260.t1, 0.000335 PATHWAY glucuronate 4666; 3AXg10862.t1, 2377; 1BXg4998.t1, interconversions 4571 3AXg2790.t1, 4106; 1BXg941.t1, 3AXg9121.t1 4442 3BXg9632.t1 KEGG Orthology K00505 TYR tyrosinase 2275; 1AXg11951.t1, 4096; 1BXg5424.t1, 0.002931 [EC: 1.14.18.1] 4609; 3AXg2591.t1, 4113; 1BXg5696.t1, 4528; 3AXg2961.t1, 4415; 3BXg1833.t1, 4660 3AXg6319.t1 4501; 3BXg3225.t1, 4369; 3BXg390.t1, 4498; 3BXg3977.t1, 4495; 3BXg6039.t1, 4394; 3BXg8171.t1, 4488 3BXg8955.t1 KEGG PATHWAY ko00052 Galactose none 874; 2291; 1AXg2815.t1, 4097; 1BXg135.t1, 0.003136 metabolism 4669; 1AXg325.t1, 2382; 1BXg3531.t1, 4615; 3AXg1436.t1, 2350; 1BXg5592.t1, 4661 3AXg4536.t1, 2721; 1BXg9114.t1, 3AXg6314.t1 4508; 3BXg11320.t1, 4422; 3BXg3121.t1, 4496; 3BXg5975.t1, 4494; 3BXg6701.t1, 4410; 3BXg6843.t1, 4491; 3BXg7356.t1, 4484 3BXg9960.t1 KEGG PATHWAY ko00965 Betalain Betalains are 2275; 1AXg11951.t1, 4096; 1BXg5424.t1, 0.003618 biosynthesis water-soluble 4609; 3AXg2591.t1, 4113; 1BXg5696.t1, nitrogen- 4528; 3AXg2961.t1, 4415; 3BXg1833.t1, containing 4660 3AXg6319.t1 4501; 3BXg3225.t1, pigments that are 4369; 3BXg390.t1, present in plants 4498; 3BXg3977.t1, belonging to the 4495; 3BXg6039.t1, order 4394; 3BXg8171.t1, Caryophyllales 4488 3BXg8955.t1 (such as cactus and amaranth families) and in higher fungi. They contain betalamic acid as the chromophore and are classified into two types: betacyanins and betaxanthins. Betacyanins contain a cyclo- DOPA residue and exhibit red/violet coloration, while betaxanthins contain different amino acids or amino side chains and exhibit a yellow/orange coloration. The condensation of betalamic acid with amino acids (including cyclo- DOPA or amines) in plants is a spontaneous reaction, not an enzyme-catalyzed reaction. KEGG PATHWAY ko04916 Melanogenesis Cutaneous 2275; 665; 1AXg11951.t1, 2320; 1BXg11664.t1, 0.005636 melanin pigment 4609; 1AXg4299.t1, 4096; 1BXg5424.t1, plays a critical 4528; 3AXg2591.t1, 4113; 1BXg5696.t1, role in 4660 3AXg2961.t1, 4415; 3BXg1833.t1, camouflage, 3AXg6319.t1 4501; 3BXg3225.t1, mimicry, social 4369; 3BXg390.t1, communication, 4498; 3BXg3977.t1, and protection 4495; 3BXg6039.t1, against harmful 4394; 3BXg8171.t1, effects of solar 4488 3BXg8955.t1 radiation. Melanogenesis is under complex regulatory control by multiple agents. The most important positive regulator of melanogenesis is the MC1 receptor with its ligands melanocortic peptides. MC1R activates the cyclic AMP (cAMP) response- element binding protein (CREB). Increased expression of MITF and its activation by phosphorylation (P) stimulate the transcription of tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and dopachrome tautomerase (DCT), which produce melanin. Melanin synthesis takes place within specialized intracellular organelles named melanosomes. Melanin- containing melanosomes then move from the perinuclear region to the dendrite tips and are transferred to keratinocytes by a still not well- characterized mechanism. KEGG PATHWAY ko04142 Lysosome Lysosomes are 521; 2295; 1AXg11059.t1, 4102; 1BXg10249.t1, 0.009426 membrane- 608; 2290; 1AXg12307.t1, 4124; 1BXg11338.t1, delimited 2289; 1AXg1785.t1, 2407; 1BXg1175.t1, organelles in 2286; 1AXg3652.t1, 4116; 1BXg4075.t1, animal cells 2282; 1AXg3653.t1, 4111; 1BXg7402.t1, serving as the 4559; 1AXg5534.t1, 4107; 1BXg9090.t1, cell's main 4670; 1AXg7972.t1, 4506; 3BXg2203.t1, digestive 4665; 3AXg10485.t1, 4353; 3BXg4014.t1, compartment to 4525; 3AXg10865.t1, 4497; 3BXg4508.t1, which all sorts of 4526; 3AXg3114.t1, 4432; 3BXg5175.t1, macromolecules 4624 3AXg5987.t1, 4386; 3BXg5319.t1, are delivered for 3AXg8810.t1, 4362; 3BXg821.t1, degradation. They 3AXg9670.t1 4485 3BXg9634.t1 contain more than 40 hydrolases in an acidic environment (pH of about 5). After synthesis in the ER, lysosomal enzymes are decorated with mannose-6- phosphate residues, which are recognized by mannose-6- phosphate receptors in the trans-Golgi network. They are packaged into clathrin-coated vesicles and are transported to late endosomes. Substances for digestion are acquired by the lysosomes via a series of processes including endocytosis, phagocytosis, and autophagy. KEGG PATHWAY ko00950 Isoquinoline Isoquinoline 2275; 1AXg11951.t1, 4098; 1BXg12278.t1, 0.011241 alkaloid alkaloids are 1342; 1AXg7766.t1, 4119; 1BXg2903.t1, biosynthesis tyrosine-derived 4609; 3AXg2591.t1, 4096; 1BXg5424.t1, plant alkaloids 4528; 3AXg2961.t1, 4113; 1BXg5696.t1, with an 4660 3AXg6319.t1 4108; 1BXg8510.t1, isoquinoline 3185; 1BXg886.t1, skeleton. Among 4415; 3BXg1833.t1, them 4501; 3BXg3225.t1, benzylisoquinoline 4369; 3BXg390.t1, alkaloids form 4498; 3BXg3977.t1, an important 4495; 3BXg6039.t1, group with potent 4493; 3BXg6827.t1, pharmacological 4394; 3BXg8171.t1, activity, including 4488 3BXg8955.t1 analgesic compounds of morphine and codeine, and anti- infective agents of berberine, palmatine, and magnoflorine. Biosynthesis of isoquinoline alkaloids proceeds via decarboxylation of tyrosine or DOPA to yield dopamine, which together with 4- hydroxyphenylacetaldehyde, an aldehyde derived from tyrosine, is converted to reticuline, an important precursor of various benzylisoquinoline alkaloids. KEGG ko00630 Glyoxylate none 2272; 1AXg6636.t1, 4103; 1BXg10186.t1, 0.011241 PATHWAY and 4638; 3AXg457.t1, 2315; 1BXg2840.t1, dicarboxylate 4658 3AXg9876.t1 4110; 1BXg7797.t1, metabolism 4490 3BXg7921.t1 KEGG PATHWAY ko00740 Riboflavin none 2275; 485; 1AXg11951.t1, 4100; 1BXg11698.t1, 0.011241 metabolism 496; 663; 1AXg1240.t1, 4123; 1BXg11921.t1, 2283; 1AXg13882.t1, 4117; 1BXg3956.t1, 2280; 1AXg4563.t1, 2464; 1BXg4094.t1, 4609; 1AXg5998.t1, 4096; 1BXg5424.t1, 4528; 1AXg8556.t1, 4114; 1BXg5433.t1, 4660 3AXg2591.t1, 2477; 1BXg5689.t1, 3AXg2961.t1, 4113; 1BXg5696.t1, 3AXg6319.t1 4415; 3BXg1833.t1, 4503; 3BXg246.t1, 4501; 3BXg3225.t1, 4369; 3BXg390.t1, 4498; 3BXg3977.t1, 4469; 3BXg443.t1, 4495; 3BXg6039.t1, 4489; 3BXg8118.t1, 4394; 3BXg8171.t1, 4488 3BXg8955.t1 KEGG PATHWAY ko00520 Amino sugar none 2276; 1AXg10429.t1, 4101; 1BXg11696.t1, 0.041684 and 2296; 608; 1AXg11997.t1, 2407; 1BXg1175.t1, nucleotide 2294; 1AXg1785.t1, 4122; 1BXg1561.t1, sugar 2287; 1AXg2013.t1, 2483; 1BXg2454.t1, metabolism 2284; 1AXg5017.t1, 4120; 1BXg2483.t1, 2281; 1AXg5996.t1, 2382; 1BXg3531.t1, 2279; 1AXg8113.t1, 2322; 1BXg3931.t1, 4559; 1AXg8814.t1, 4115; 1BXg4950.t1, 4667; 3AXg10485.t1, 2350; 1BXg5592.t1, 4664; 3AXg2394.t1, 4105; 1BXg9514.t1, 4662; 3AXg407.t1, 4408; 3BXg11985.t1, 4602 3AXg618.t1, 4505; 3BXg2317.t1, 3AXg9481.t1 4502; 3BXg251.t1, 4410; 3BXg6843.t1, 4362; 3BXg821.t1, 4486 3BXg9283.t1 KEGG PATHWAY ko00350 Tyrosine none 2275; 1AXg11951.t1, 4098; 1BXg12278.t1, 0.045141 metabolism 1342; 1AXg7766.t1, 4119; 1BXg2903.t1, 4609; 3AXg2591.t1, 4096; 1BXg5424.t1, 4528; 3AXg2961.t1, 4113; 1BXg5696.t1, 4660 3AXg6319.t1 4108; 1BXg8510.t1, 3185; 1BXg886.t1, 4415; 3BXg1833.t1, 4501; 3BXg3225.t1, 4369; 3BXg390.t1, 4498; 3BXg3977.t1, 4495; 3BXg6039.t1, 4493; 3BXg6827.t1, 4394; 3BXg8171.t1, 4488 3BXg8955.t1 KEGG ko00240 Pyrimidine none 2274; 1AXg2750.t1, 2968; 1BXg1133.t1, 0.064093 PATHWAY metabolism 1124; 662; 1AXg5630.t1, 2326; 1BXg4339.t1, 4648 1AXg7452.t1, 2352; 1BXg5639.t1, 3AXg4651.t1 2463; 1BXg6885.t1, 4504 3BXg2357.t1
(578) Gene Ontology Enrichment of Beneficial Fungi Versus Neutral Fungi
(579) TABLE-US-00051 TABLE 707 GO enrichment of beneficial fungi versus neutral fungi SEQ ID SEQ ID FDR q- GO Term Description Beneficial A.Protein.ID Neutral B.Protein.ID value GO: 0005576 extracellular 478; 4917; 1AXg10805.t1, 4926; 1BXg1054.t1, 1.82E14 region 4918; 874; 1AXg1317.t1, 2435; 1BXg11562.t1, 633; 2291; 1AXg21242.t1, 4101; 1BXg11696.t1, 2287; 2285; 1AXg2815.t1, 4099; 1BXg12260.t1, 2284; 4947; 1AXg3175.t1, 4859; 1BXg1692.t1, 2281; 667; 1AXg325.t1, 4927; 1BXg177.t1, 497; 4948; 1AXg5017.t1, 4858; 1BXg2047.t1, 4877; 4919; 1AXg5538.t1, 2345; 1BXg2053.t1, 4878; 4559; 1AXg5996.t1, 4928; 1BXg4311.t1, 4879; 4920; 1AXg8019.t1, 4929; 1BXg4617.t1, 4515; 4880; 1AXg8113.t1, 4115; 1BXg4950.t1, 4921; 4666; 1AXg9193.t1, 2377; 1BXg4998.t1, 4650; 4922; 1AXg9750.t1, 4895; 1BXg6497.t1, 4923; 4881; 1AXg9874.t1, 4930; 1BXg6576.t1, 4525; 4510; 3AXg10204.t1, 4896; 1BXg7924.t1, 4661; 4882; 3AXg10215.t1, 4109; 1BXg8240.t1, 4924; 4925; 3AXg10410.t1, 2468; 1BXg8760.t1, 4571; 4883; 3AXg10485.t1, 2721; 1BXg9114.t1, 4658; 4642 3AXg10796.t1, 4932; 3BXg10428.t1, 3AXg10814.t1, 4897; 3BXg10792.t1, 3AXg10862.t1, 4356; 3BXg11001.t1, 3AXg2666.t1, 4898; 3BXg11l47.t1, 3AXg2755.t1, 4933; 3BXg11837.t1, 3AXg2790.t1, 4468; 3BXg12052.t1, 3AXg2954.t1, 4934; 3BXg14356.t1, 3AXg5176.t1, 4351; 3BXg2216.t1, 3AXg5370.t1, 4935; 3BXg2769.t1, 3AXg5893.t1, 4899; 3BXg3018.t1, 3AXg5987.t1, 4900; 3BXg3920.t1, 3AXg6236.t1, 4386; 3BXg5319.t1, 3AXg6314.t1, 4936; 3BXg5448.t1, 3AXg7257.t1, 4901; 3BXg6241.t1, 3AXg7674.t1, 4428; 3BXg7066.t1, 3AXg8315.t1, 4902; 3BXg7579.t1, 3AXg9121.t1, 4490; 3BXg7921.t1, 3AXg9736.t1, 4362; 3BXg821.t1, 3AXg9876.t1, 4937; 3BXg9358.t1, 3AXg9889.t1 4442; 3BXg9632.t1, 4938 3BXg9781.t1 GO: 0008812 choline 4608; 4582 3AXg1008.t1, 4387; 3BXg1050.t1, 3.00E06 dehydrogenase 4555; 4594 3AXg10624.t1, 4365; 3BXg3212.t1, activity 4562; 4829 3AXg3404.t1, 4358; 3BXg4400.t1, 4560 3AXg3931.t1, 4811; 3BXg5049.t1, 3AXg6329.t1, 4363 3BXg7997.t1 3AXg8145.t1, 3AXg8514.t1 GO: 0005618 cell wall 4939; 614; 1AXg12959.t1, 2413; 1BXg2549.t1, 1.22E05 934; 4571; 1AXg2047.t1, 4475; 3BXg11145.t1, 4940 1AXg6047.t1, 4341 3BXg3303.t1 3AXg9121.t1, 3AXg9980.t1 GO: 0016614 oxidoreductase 4803; 4876; 1AXg11202.t1, 2433; 1BXg11481.t1, 2.62E05 activity, 4865; 4864; 1AXg1148.t1, 4857; 1BXg3389.t1, acting on 4863; 4840; 1AXg7074.t1, 4844; 1BXg8979.t1, CHOH 4527; 4518; 1AXg7314.t1, 4843; 1BXg9251.t1, group of 4570; 4884; 1AXg8008.t1, 4824; 3BXg10091.t1, donors 4885; 4886; 3AXg10359.t1, 4466; 3BXg1035.t1, 4572; 4887; 3AXg1658.t1, 4823; 3BXg10533.t1, 4888; 4538 3AXg2998.t1, 4479; 3BXg13120.t1, 3AXg3962.t1, 4906; 3BXg3860.t1, 3AXg5234.t1, 4907; 3BXg5594.t1, 3AXg5286.t1, 4908; 3BXg7349.t1, 3AXg6307.t1, 4909; 3BXg7537.t1, 3AXg6312.t1, 4910; 3BXg8146.t1, 3AXg7030.t1, 4417; 3BXg8641.t1, 3AXg7536.t1, 4399; 3BXg8643.t1, 3AXg8418.t1 4911 3BXg9353.t1 GO: 0000272 polysaccharide 2293; 2284; 1AXg2246.t1, 4125; 1BXg10656.t1, 3.30E05 catabolic 2273; 667; 1AXg5996.t1, 2435; 1BXg11562.t1, process 1249; 4540; 1AXg6048.t1, 4101; 1BXg11696.t1, 4668; 4941; 1AXg9193.t1, 2349; 1BXg2692.t1, 4923 1AXg9842.t1, 4928; 1BXg4311.t1, 3AXg10237.t1, 2468; 1BXg8760.t1, 3AXg192.t1, 3093; 1BXg9770.t1, 3AXg2760.t1, 4509; 3BXg10794.t1, 3AXg5370.t1 4356; 3BXg11001.t1, 4343; 3BXg1101.t1, 4500; 3BXg3387.t1, 4942; 3BXg6628.t1, 4423; 3BXg6890.t1, 4460 3BXg9765.t1 GO: 0045490 pectin 4948; 4666; 1AXg9874.t1, 4099; 1BXg12260.t1, 3.30E05 catabolic 4943; 4571 3AXg2790.t1, 4937; 3BXg9358.t1, process 3AXg5277.t1, 4449 3BXg9608.t1 3AXg9121.t1 GO: 0004252 serine-type 4804; 652; 1AXg11086.t1, 2467; 1BXg10439.t1, 3.92E05 endopeptidase 4947; 666; 1AXg7771.t1, 4850; 1BXg782.t1, activity 4670; 4921; 1AXg8019.t1, 2452; 1BXg7838.t1, 4577; 4834; 1AXg9261.t1, 4814; 3BXg1720.t1, 4922; 4525; 3AXg10865.t1, 4497; 3BXg4508.t1, 4526 3AXg2755.t1, 4386; 3BXg5319.t1, 3AXg2995.t1, 4936; 3BXg5448.t1, 3AXg3480.t1, 4355; 3BXg6263.t1, 3AXg5176.t1, 4944; 3BXg6633.t1, 3AXg5987.t1, 4381; 3BXg8638.t1, 3AXg8810.t1 4485; 3BXg9634.t1, 4945 3BXg9880.t1 GO: 0006979 response to 2272; 4626; 1AXg6636.t1, 4103; 1BXg10186.t1, 1.11E04 oxidative 4635 3AXg10815.t1, 4860; 1BXg11947.t1, stress 3AXg2285.t1 4946 3BXg8947.t1 GO: 0030248 cellulose 478; 4917; 1AXg10805.t1, 4926; 1BXg1054.t1, 1.51E04 binding 4918; 633; 1AXg1317.t1, 4927; 1BXg177.t1, 2291; 2287; 1AXg21242.t1, 2345; 1BXg2053.t1, 2285; 2281; 1AXg3175.t1, 4929; 1BXg4617.t1, 497; 4920; 1AXg325.t1, 4115; 1BXg4950.t1, 4924; 4925 1AXg5017.t1, 4930; 1BXg6576.t1, 1AXg5538.t1, 4933; 3BXg11837.t1, 1AXg8113.t1, 4934; 3BXg14356.t1, 1AXg9750.t1, 4935; 3BXg2769.t1, 3AXg10814.t1, 4428; 3BXg7066.t1, 3AXg7674.t1, 4938; 3BXg9781.t1 3AXg8315.t1 GO: 0016788 hydrolase 4805; 4873; 1AXg10964.t1, 2489; 1BXg11282.t1, 3.35E04 activity, 496; 645; 1AXg1296.t1, 4862; 1BXg11329.t1, acting on 4836; 4539; 1AXg13882.t1, 2445; 1BXg12241.t1, ester bonds 4569 1AXg13885.t1, 2477; 1BXg5689.t1, 3AXg1785.t1, 4852; 1BXg6844.t1, 3AXg6767.t1, 4847; 1BXg8700.t1, 3AXg8951.t1 4818; 3BXg12041.t1, 4467; 3BXg3959.t1, 4469; 3BXg443.t1, 4905 3BXg5704.t1 GO: 0004190 aspartic- 482; 494; 1AXg10578.t1, 2439; 1BXg12089.t1, 3.46E04 type 673; 2252; 1AXg6959.t1, 4853; 1BXg5763.t1, endopeptidase 4919; 4529; 1AXg6960.t1, 4076; 1BXg6565.t1, activity 4833; 4581; 1AXg9542.t1, 2323; 1BXg7026.t1, 4894 3AXg10215.t1, 2474; 1BXg9737.t1, 3AXg1976.t1, 4842; 1BXg9738.t1, 3AXg3738.t1, 4932; 3BXg10428.t1, 3AXg573.t1, 4347; 3BXg11695.t1, 3AXg9318.t1 4472; 3BXg4394.t1, 4385; 3BXg5286.t1, 4483; 3BXg8935.t1, 4904 3BXg9882.t1 GO: 0004650 polygalacturonase 4515; 4666; 3AXg10862.t1, 2377; 1BXg4998.t1, 3.46E04 activity 4943 3AXg2790.t1, 4937; 3BXg9358.t1, 3AXg5277.t1 4442 3BXg9632.t1 GO: 0004185 serine-type 587; 2282; 1AXg11050.t1, 4102; 1BXg10249.t1, 0.000484 carboxypeptidase 4838; 4837; 1AXg7972.t1, 2386; 1BXg2887.t1, activity 4827; 4826; 3AXg10866.t1, 4825; 3BXg10049.t1, 4624 3AXg1190.t1, 4812; 3BXg3887.t1, 3AXg891.t1, 4353; 3BXg4014.t1, 3AXg9023.t1, 4432; 3BXg5175.t1, 3AXg9670.t1 4810; 3BXg5715.t1, 4807 3BXg9635.t1 GO: 0016798 hydrolase 530; 2296; 1AXg10268.t1, 4800; 1BXg10455.t1, 0.000484 activity, 4875; 477; 1AXg11997.t1, 3811; 1BXg10918.t1, acting on 4872; 2292; 1AXg12212.t1, 2483; 1BXg2454.t1, glycosyl 480; 2290; 1AXg13463.t1, 4949; 1BXg4330.t1, bonds 2289; 487; 1AXg15301.t1, 2352; 1BXg5639.t1, 4891; 4667; 1AXg2742.t1, 4849; 1BXg817.t1, 4892; 4893 1AXg3149.t1, 2300; 1BXg8757.t1, 1AXg3652.t1, 4813; 3BXg2207.t1, 1AXg3653.t1, 4480 3BXg8858.t1 1AXg5358.t1, 1AXg7786.t1, 3AXg2394.t1, 3AXg7003.t1, 3AXg8007.t1 GO: 0005507 copper ion 4802; 1342; 1AXg12235.t1, 2539; 1BXg10115.t1, 0.000489 binding 4632; 4597; 1AXg7766.t1, 4098; 1BXg12278.t1, 4595; 4831 3AXg1263.t1, 4856; 1BXg3746.t1, 3AXg3686.t1, 3185; 1BXg886.t1, 3AXg3946.t1, 4427; 3BXg10410.t1, 3AXg5094.t1 4817; 3BXg12053.t1, 4403 3BXg689.t1 GO: 0008810 cellulase 4918; 1249; 1AXg21242.t1, 4927; 1BXg177.t1, 0.000644 activity 4540; 4839; 1AXg9842.t1, 4929; 1BXg4617.t1, 4941; 4532 3AXg10237.t1, 4930; 1BXg6576.t1, 3AXg10372.t1, 4109; 1BXg8240.t1, 3AXg2760.t1, 3093; 1BXg9770.t1, 3AXg6046.t1 4509; 3BXg10794.t1, 4343; 3BXg1101.t1, 4934; 3BXg14356.t1, 4942; 3BXg6628.t1, 4903 3BXg9093.t1 GO: 0071555 cell wall 4939; 614; 1AXg12959.t1, 4099; 1BXg12260.t1, 0.001751 organization 934; 4515; 1AXg2047.t1, 2413; 1BXg2549.t1, 4666; 4659; 1AXg6047.t1, 2482; 1BXg264.t1, 4940 3AXg10862.t1, 2377; 1BXg4998.t1, 3AXg2790.t1, 4475; 3BXg11145.t1, 3AXg7872.t1, 4487; 3BXg928.t1, 3AXg9980.t1 4937; 3BXg9358.t1, 4442 3BXg9632.t1 GO: 0008081 phosphoric 4520; 4950; 3AXg3348.t1, 2343; 1BXg6110.t1, 0.003097 diester 4951 3AXg429.t1, 4952; 3BXg10729.t1, hydrolase 3AXg8372.t1 4953; 3BXg10989.t1, activity 4954; 3BXg1818.t1, 4388 3BXg5195.t1 GO: 0004601 peroxidase 4626; 4635 3AXg10815.t1, 2539; 1BXg10115.t1, 0.003136 activity 3AXg2285.t1 4808; 3BXg8361.t1, 4946 3BXg8947.t1 GO: 0044238 primary 501; 4835; 1AXg11043.t1, 4798 3BXg2943.t1 0.008701 metabolic 4630; 4830; 3AXg3154.t1, process 4828 3AXg6318.t1, 3AXg8054.t1, 3AXg8258.t1 GO: 0006629 lipid 4520; 4950; 3AXg3348.t1, 2339; 1BXg11161.t1, 0.022235 metabolic 4832; 4951 3AXg429.t1, 2343; 1BXg6110.t1, process 3AXg4906.t1, 4822; 3BXg10687.t1, 3AXg8372.t1 4952; 3BXg10729.t1, 4953; 3BXg10989.t1, 4954; 3BXg1818.t1, 4388 3BXg5195.t1 GO: 0030246 carbohydrate 4801; 487; 1AXg4233.t1, 4097; 1BXg135.t1, 0.022419 binding 4615 1AXg5358.t1, 4949; 1BXg4330.t1, 3AXg4536.t1 4854; 1BXg5733.t1, 2332; 1BXg9970.t1, 4815; 3BXg144.t1, 4422; 3BXg3121.t1, 4489; 3BXg8118.t1, 4484 3BXg9960.t1 GO: 0008233 peptidase 567; 489; 1AXg1909.t1, 4124; 1BXg11338.t1, 0.026107 activity 1013; 2286 1AXg3273.t1, 4861; 1BXg11861.t1, 1AXg3484.t1, 2858; 1BXg2151.t1, 1AXg5534.t1 4846; 1BXg8705.t1, 4809 3BXg7109.t1 GO: 0016311 dephosphorylation 485; 602; 1AXg1240.t1, 2329; 1BXg1583.t1, 0.028109 4870; 4869; 1AXg12610.t1, 2401; 1BXg3489.t1, 4868; 4867; 1AXg2072.t1, 4855; 1BXg4136.t1, 4866; 4841; 1AXg2679.t1, 4114; 1BXg5433.t1, 4889; 4623; 1AXg3651.t1, 2478; 1BXg6623.t1, 4618; 4646; 1AXg5280.t1, 4821; 3BXg10709.t1, 4890 1AXg7026.t1, 4439; 3BXg11186.t1, 3AXg10295.t1, 4816; 3BXg12884.t1, 3AXg2325.t1, 4912; 3BXg23.t1, 3AXg2688.t1, 4503; 3BXg246.t1, 3AXg6634.t1, 4913; 3BXg383.t1, 3AXg8755.t1, 4914; 3BXg4227.t1, 3AXg9415.t1 4915; 3BXg5208.t1, 4425 3BXg5671.t1 GO: 0005886 plasma 484; 4874; 1AXg11973.t1, 2336; 1BXg1674.t1, 0.120452 membrane 4871; 649; 1AXg12543.t1, 2431; 1BXg3283.t1, 665; 658; 1AXg20005.t1, 2451; 1BXg7238.t1, 651; 4641; 1AXg2148.t1, 4851; 1BXg7733.t1, 4521; 4955; 1AXg4299.t1, 4848; 1BXg8189.t1, 4956; 4514; 1AXg4879.t1, 4845; 1BXg8837.t1, 4957 1AXg9624.t1, 4820; 3BXg11471.t1, 3AXg10151.t1, 4819; 3BXg11779.t1, 3AXg1507.t1, 4916; 3BXg11859.t1, 3AXg1833.t1, 4473 3BXg8700.t1 3AXg3620.t1, 3AXg7460.t1, 3AXg7667.t1 GO: 0008168 methyltransferase 4799; 4663; 3AXg3246.t1, 4797; 3BXg5144.t1, 0.14079 activity 4662 3AXg512.t1, 4492 3BXg7176.t1 3AXg618.t1
(580) These data suggest that numerous biological processes are different in beneficial endophytes, for example as compared to neutral endophytes. Some of these processes include cell wall degradation, starch and sucrose metabolism, and protection from oxidative stress.
(581) One mechanism of entry of endophytes into intact plant tissue is by enzymatic processes involving degradation of cell walls. Beneficial endophytes used in this example show increased levels of secreted proteins that may be involved in such degradation, for example those that fall within the following gene ontology annotations: GO:0005618 (cell wall), GO:0000272 (polysaccharide catabolic process), GO:0045490 (pectin catabolic process), GO:0030248 (cellulose binding), GO:0004650 (polygalacturonase activity), GO:0008810 (cellulase activity), GO:0071555 (cell wall organization), GO:0004185 (serine-type carboxypeptidase activity), GO:0016798 (hydrolase activity, acting on glycosyl bonds), and GO:0030246 (carbohydrate binding). Certain of the proteins that fall within these gene ontology annotations may also be involved in starch and sucrose metabolism.
(582) Beneficial endophytes of the invention secreted proteins that may provide a benefit to the plant, such as proteins involved in protection against oxidative stress (GO:0016614 (oxidoreductase activity, acting on CHOH group of donors); GO:0006979 (response to oxidative stress); GO:0005507 (copper ion binding), and GO:0004601 (peroxidase activity)).
Example 8: Greenhouse Characterization
(583) Setup and Watering Conditions
(584) A sandy loam growth substrate is mixed in the greenhouse and consisting of 60% loam and 40% mortar sand (Northeast Nursery, Peabody, Mass.). Prior to mixing, loam is sifted through a square steel mesh screen to remove larger particles and debris. Half of the appropriate fertilizers and soil treatments to be applied during the season is added to the soil mixture prior to sowing. The remaining components are provided dissolved in irrigation water at the onset of the reproductive stages of development. Substrate surface area per pot is calculated based on pot diameter in order to approximate the acreage of individual pots. An equivalent volume of fertilized soil is then gently added to each pot in order to minimize compaction of the soil. The substrate is saturated with water 3-4 hours before sowing.
(585) Commercially available seeds (e.g., seeds described herein) are coated with microbial treatments using the formulation used for field trials and described herein. Treatments included microbial coatings and two controls (non-treated and formulation). Three seeds are sown evenly spaced at the points of a triangle. Soil is then overlaid atop the seeds and an additional 200 mL water was added to moisten the overlaying substrate.
(586) Midseason Measurements and Harvest
(587) Emergence percentage is observed. Further, at various times through the growing season, plants are assessed for onset of and recovery from stress symptoms, for example but not limited to: leaf senescence, anthesis-silking interval, leaf chlorophyll content, grain weight, and total yield.
(588) To compare treated plants to controls, a fully Bayesian robust t-test is performed. Briefly, R (R Core Team, 2015) was used with the BEST package (Kruschke and Meredith, 2015) and JAGS (Plummer, 2003) to perform a Markov Chain Monte Carlo estimation of the posterior distribution the likely differences between the two experimental groups. A 95% highest density interval (HDI) is overlayed onto this distribution to aid in the interpretation of whether the two biological groups truly differ.
(589) Tissue Collection and Processing for Transcriptomics, Hormone, and Metabolomics Analysis
(590) In order to assess the effects of endophyte treatment on plant growth at the transcriptomic, phytohormone, and metabolomic levels, plants are harvested. Three pots from each treatment are selected. Once separated, the tissues (roots, stems, leaves, other plant elements as appropriate) from the three pots of each treatment are pooled. For collection, first all loosely attached substrate is removed from the roots by gently tapping and shaking the roots. Any adherent substrate is removed by submerging the roots in water and manually dislodging attached soil and debris. The roots are then blotted dry before being cut from the aerial tissue, followed by separating petioles and leaves from the stem. As tissues are removed from the plant they are immediately bagged and frozen in liquid nitrogen. All harvested tissues are kept in liquid nitrogen or stored at 80 C. until further processing.
(591) To prepare for analyses, the tissues are ground with liquid nitrogen using a pre-chilled mortar and pestle. Approximately 100-200 micrograms of each ground sample pool is transferred to a chilled 1.5 mL microtube for RNA extraction and subsequent transcriptome, phytohormone and metabolite analysis. For proteomic analysis, 3 g of each ground sample pool is used. The remaining ground tissue is then transferred to a chilled 50 mL conical tube and stored in liquid nitrogen or at 80 C. until shipment for further analyses.
Example 9: Assessment of Plant Colonization
(592) The protocols described in this section allow confirmation of successful colonization of plants by endophytes, for example by direct recovery of viable colonies from various tissues of the inoculated plant.
(593) Recovery of Viable Colonies from Seeds
(594) Seeds are surface-sterilized by exposing them to chlorine gas overnight, using the methods described elsewhere. Sterile seeds are then inoculated with submerged in 0.5 OD overnight cultures (Tryptic Soy Broth, TSB) of bacteria and allowed to briefly air dry. The seeds are then placed in tubes filled partially with a sterile sand-vermiculite mixture [(1:1 wt:wt)] and covered with 1 inch of the mixture, watered with sterile water, sealed and incubated in a greenhouse for 7 days. After incubation, various tissues of the plants are harvested and used as donors to isolate bacteria by placing tissue section in a homogenizer (TSB 20%) and mechanical mixing. The slurry is then serially diluted in 10-fold steps to 10-3 and dilutions 1 through 10-3 are plated on TSA 20% plates (1.3% agar). Plates are incubated overnight and pictures are taken of the resulting plates as well as colony counts for CFU. Bacteria are identified visually by colony morphotype and molecular methods described herein. Representative colony morphotypes are also used in colony PCR and sequencing for isolate identification via ribosomal gene sequence analysis as described herein. These trials are repeated twice per experiment, with 5 biological samples per treatment.
(595) Culture-Independent Methods to Confirm Colonization of the Plant or Seeds by Bacteria or Fungi.
(596) One way to detect the presence of endophytes on or within plants or seeds is to use quantitative PCR (qPCR). Internal colonization by the endophyte can be demonstrated by using surface-sterilized plant tissue (including seed) to extract total DNA, and isolate-specific fluorescent MGB probes and amplification primers are used in a qPCR reaction. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter. Fluorescence is measured by a quantitative PCR instrument and compared to a standard curve to estimate the number of fungal or bacterial cells within the plant.
Experimental Description
(597) The design of both species-specific amplification primers, and isolate-specific fluorescent probes are well known in the art. Plant tissues (seeds, stems, leaves, flowers, etc.) are pre-rinsed and surface sterilized using the methods described herein.
(598) Total DNA is extracted using methods known in the art, for example using commercially available Plant-DNA extraction kits, or the following method.
(599) 1. Tissue is placed in a cold-resistant container and 10-50 mL of liquid nitrogen is applied. Tissues are then macerated to a powder.
(600) 2. Genomic DNA is extracted from each tissue preparation, following a chloroform:isoamyl alcohol 24:1 protocol (Sambrook et al., 1989).
(601) Quantitative PCR is performed essentially as described by Gao et al. (2010) with primers and probe(s) specific to the desired isolate using a quantitative PCR instrument, and a standard curve is constructed by using serial dilutions of cloned PCR products corresponding to the specie-specific PCR amplicon produced by the amplification primers. Data are analyzed using instructions from the quantitative PCR instrument's manufacturer software.
(602) As an alternative to qPCR, Terminal Restriction Fragment Length Polymorphism, (TRFLP) can be performed, essentially as described in Johnston-Monje and Raizada (2011). Group specific, fluorescently labelled primers are used to amplify a subset of the microbial population, especially bacteria, especially fungi, especially archaea, especially viruses. This fluorescently labelled PCR product is cut by a restriction enzyme chosen for heterogeneous distribution in the PCR product population. The enzyme cut mixture of fluorescently labelled and unlabeled DNA fragments is then submitted for sequence analysis on a Sanger sequence platform such as the Applied Biosystems 3730 DNA Analyzer.
(603) Immunological Methods to Detect Microbes in Seeds and Vegetative Tissues
(604) A polyclonal antibody is raised against specific bacteria X or fungus Y strains via standard methods. A polyclonal antibody is also raised against specific GUS and GFP proteins via standard methods. Enzyme-linked immunosorbent assay (ELISA) and immunogold labeling is also conducted via standard methods, briefly outlined below.
(605) Immunofluorescence microscopy procedures involve the use of semi-thin sections of plant element or adult plant tissues transferred to glass objective slides and incubated with blocking buffer (20 mM Tris (hydroxymethyl)-aminomethane hydrochloride (TBS) plus 2% bovine serum albumin, pH 7.4) for 30 min at room temperature. Sections are first coated for 30 min with a solution of primary antibodies and then with a solution of secondary antibodies (goat anti-rabbit antibodies) coupled with fluorescein isothiocyanate (FITC) for 30 min at room temperature. Samples are then kept in the dark to eliminate breakdown of the light-sensitive FITC. After two 5-min washings with sterile potassium phosphate buffer (PB) (pH 7.0) and one with double-distilled water, sections are sealed with mounting buffer (100 mL 0.1 M sodium phosphate buffer (pH 7.6) plus 50 mL double-distilled glycerine) and observed under a light microscope equipped with ultraviolet light and a FITC Texas-red filter.
(606) Ultrathin (50- to 70-nm) sections for TEM microscopy are collected on pioloform-coated nickel grids and are labeled with 15-nm gold-labeled goat anti-rabbit antibody. After being washed, the slides are incubated for 1 h in a 1:50 dilution of 5-nm gold-labeled goat anti-rabbit antibody in IGL buffer. The gold labeling is then visualized for light microscopy using a BioCell silver enhancement kit. Toluidine blue (0.01%) is used to lightly counterstain the gold-labeled sections. In parallel with the sections used for immunogold silver enhancement, serial sections are collected on uncoated slides and stained with 1% toluidine blue. The sections for light microscopy are viewed under an optical microscope, and the ultrathin sections are viewed by TEM.
Example 10: Assessment of Improved Plant Characteristics: Differentially Regulated Hormones
(607) Methods
(608) For hormone analysis, 10010 mg tissue is measured into microtubes (chilled with liquid nitrogen), and sent on dry ice to a vendor. Plant hormone analysis is performed per Christiansen et al. (2014) with slight modification. Briefly, hormones are extracted from 10010 mg of frozen tissue and tissue weights are recorded for quantification. A mixture containing 10 microliters of 2.5 microMolar internal standards and 500 microliters of extraction buffer [1-propanol/H2O/concentrated HCl (2:1:0.002, vol/vol/vol) is added to each sample and vortexed until thawed. Samples are agitated for 30 min at 4 C., then 500 microliters of dichloromethane (CH2Cl2) is added. Samples are agitated again for 30 min at 4 C., and then centrifuged at 13,000g for 5 min. in darkness. The lower organic layer is removed into a glass vial and the solvent is evaporated by drying samples for 30-40 min under a N2 stream. Samples are re-solubilized in 150 microliters of MeOH, shaken for 1 min and centrifuged at 14,000g for 2 min. A supernatant of 90 microliters is transferred into the autosampler vial and hormones are analyzed by ultraperformance liquid chromatography, coupled to mass spectrometry (UPLC-MS/MS). Ascentis Express C-18 Column (3 cm2.1 mm, 2.7 cm) is connected to an API 3200 using electrospray ionization-tandem mass spectrometry (MS/MS) with scheduled multiple reaction monitoring (SMRM). The injection volume is 5 microliters and has a 300 microliters/min mobile phase consisting of Solution A (0.05% acetic acid in water) and Solution B (0.05% acetic acid in acetonitrile) with a gradient consisting of (time-% B): 0.3-1%, 2-45%, 5-100%, 8-100%, 9-1%, 11-stop. Quantitation is carried out with Analyst software (AB Sciex), using the internal standards as a reference for extraction recovery. Leaf, root, and/or other tissue is saved in 62 C. and saved for subsequent gene expression analysis.
(609) Mass spectra of plant hormones are obtained. Fold changes between control and treated samples are calculated by dividing the mass spectrum value from the treated sample by the value from the control sample.
(610) Modulation of hormones related to growth as well as related to resistance to abiotic and biotic stresses are found in plants treated with endophytes as compared to isoline plants lacking such treatment.
Example 11: Assessment of Improved Plant Characteristics and Differentially Regulated Metabolites
(611) Methods
(612) For metabolite analysis, 15010 mg of each sample is transferred into 1.5 mL microtubes (chilled in liquid nitrogen) and sent on dry ice to the Proteomics and Metabolomics Facility at Colorado State University. Metabolomics data acquisition is performed per the following methods provided by Dr. Corey Broeckling at CSU. To prepare the samples for analysis, phytohormones are extracted from ground plant material using a biphasic protocol. One mL of a methyl tert-butyl ether (MTBE): methanol:water mixture (6:3:1) is added to each sample then shaken for 1 hour. Next, 250 microliters cold water and a mix of internal standards are added to each sample to promote phase separation. Samples are shaken again for 5 minutes. Samples are then centrifuged at 2,095g at 4 C. for 15 minutes. The organic top phase is removed for hormone analysis, dried under an inert nitrogen environment, then re-suspended in 400 microliters of 50% acetonitrile. Extracts are then directly analyzed by LC-MS.
(613) For GC-MS, the polar (lower phase) extract is dried using a speedvac, resuspended in 50 microliters of pyridine containing 50 mg/mL of methoxyamine hydrochloride, incubated at 60 C. for 45 min, sonicated for 10 min, and incubated for an additional 45 min at 60 C. Next, 25 microliters of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (MSTFA+1% TMCS, Thermo Scientific) is added and samples re incubated at 60 C. for 30 min, centrifuged at 3000g for 5 min, cooled to room temperature, and 80 microliters of the supernatant is transferred to a 150 microliters glass insert in a GC-MS autosampler vial. Metabolites are detected using a Trace GC Ultra coupled to a Thermo ISQ mass spectrometer (Thermo Scientific). Samples are injected in a 1:10 split ratio twice in discrete randomized blocks. Separation occurs using a 30 m TG-5MS column (Thermo Scientific, 0.25 mm i.d., 0.25 micrometer film thickness) with a 1.2 mL/min helium gas flow rate, and the program consists of 80 C. for 30 sec, a ramp of 15 C. per min to 330 C., and an 8 min hold. Masses between 50-650 m/z re scanned at 5 scans/sec after electron impact ionization. The ionization source is cleaned and retuned and the injection liner replaced between injection replicates. Analysis for plant hormones is performed by UPLC-MS/MS as follows.
(614) Metabolites are detected and mass spectra annotated by comparing to libraries of known spectra including an in-house database at CSU (LC-MS only), the National Institute of Standards and Technology databases, Massbank MS database, and the Golm Metabolite Database. Initial annotation is automated, followed by manual validation of annotations. Following annotation, compounds are identified. After removal of technical artifacts (e.g. siloxane), and ambiguous or vague annotations (e.g. carbohydrate or saccharide), identified compounds remain for analysis. These compounds are assessed for fold change over control plants. Metabolites are grouped by pathways (e.g. carbohydrate metabolism or alkaloid biosynthesis) and the KEGG database and literature are manually referenced to identify pertinent shifts in metabolic patterns in plants treated with microbes. Any compound without an appreciable shift compared to that observed in control plants is removed from further analysis.
(615) Modulation of metabolites related to growth as well as related to resistance to abiotic and biotic stresses are found in plants treated with endophytes as compared to isoline plants lacking such treatment.
Example 12: Efficacy Testing of Endophytes in Crop Production
(616) Method
(617) Whole plants or plant elements, such as seeds, roots, or leaves, from any of the crops useful in the invention are treated with endophytes as described in Examples 3, 4, or 8. They are then sown in a variety in different growing regions for efficacy testing. Trials consist of ten replicate plots for each treatment and control respectively arranged in a spatially balanced randomized complete block design (Van Es et al. 2007). In addition to measuring total yield, metrics such as seedling emergence, normalized difference vegetation index (NDVI) and time to flowering are assessed. Endophytes are applied alone as a seed treatment, as well as in combination with other endophytes.
(618) Results
(619) Crop plants that have been treated with the endophyte(s) of the present invention demonstrate improvements in one or more agronomically-important characteristic, for example but not limited to: disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved nitrogen utilization, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, increased yield, increased yield under water-limited conditions, health enhancement, vigor improvement, growth improvement, photosynthetic capability improvement, nutrition enhancement, altered protein content, altered oil content, increased biomass, increased shoot length, increased root length, improved root architecture, improved plant standability, increased plant element weight, altered plant element carbohydrate composition, altered plant element oil composition, number of pods, delayed senescence, stay-green, and altered plant element protein composition.
Example 13: Generating/Isolating Endophytes Compatible with Agrochemicals
(620) The application of pesticides against fungal pathogens of agriculturally-relevant plants is a common practice in agriculture to ensure higher yields. One method of pesticide delivery is to cover the seeds with a coating with pesticides. Although pesticides are meant to deter the growth and propagation of pathogenic microorganisms, they may also affect endophyte populations residing inside of the seed. For this purpose, conferring compatibility mechanisms to endophytic fungi providing beneficial properties which are sensitive to these compounds is desirable for the maintenance of endophytes in the seeds.
(621) Compatibility with pesticides can be intrinsic (naturally pesticide compatible fungi, for example) or acquired (due to mutations in the genetic material of the microorganism, or to the introduction of exogenous DNA by natural DNA transfer).
(622) Fungicides used as protectants are effective only on the seed surface, providing protection against seed surface-borne pathogens and providing some level of control of soil-borne pathogens. These products generally have a relatively short residual. Protectant fungicides such as captan, maneb, thiram, or fludioxonil help control many types of soil-borne pathogens, except root rotting organisms. Systemic fungicides are absorbed into the emerging seedling and inhibit or kill susceptible fungi inside host plant tissues. Systemic fungicides used for seed treatment include the following: azoxystrobin, carboxin, mefenoxam, metalaxyl, thiabendazole, trifloxystrobin, and various triazole fungicides, including difenoconazole, ipconazole, tebuconazole, and triticonazole. Mefenoxam and metalaxyl are primarily used to target the oomycetes such as species of Pythium and Phytophthora.
(623) Strobilurin analogues, such as azoxystrobin, inhibit mitochondrial respiration by blocking electron transfer at the cytochrome bcl complex. Phenylamides, including metalaxyl, interfere with RNA synthesis in target fungi. Oxathiin systemic fungicides like carboxin inhibits the incorporation of phenylalanine into protein and of uracil into RNA. Azole fungicides BAS 480F, flusilazole, and tebuconazole are inhibitors of sterol 14-demethylase, and block sterol biosynthesis.
(624) I. Determination of Intrinsic Resilience Against Agrochemicals of Bacteria Cultured from Seeds
(625) To test the intrinsic resilience pesticides of bacteria isolated as described herein, minimum inhibitory concentration (MIC) assays are performed on all isolated bacteria of interest, as described in Wiegand, Irith, Kai Hilpert, and Robert E W Hancock. Nature protocols 3.2 (2008): 163-175, which is incorporated herein by reference in its entirety. Briefly, known concentrations of bacterial cells or spores are used to inoculate plates containing solid media with different concentrations of the pesticide, or to inoculate liquid media containing different concentrations of the pesticide (in a 96-well plate). The pesticides are used at the concentration recommended by the manufacturer for seed coating, and two-fold dilutions down to 0.000125 (12 two-fold dilutions). Growth is assessed after incubation for a defined period of time (16-20 h) and compared to cultures grown in the same manner without any pesticides as control. The MIC value is determined as described in Wiegand, Irith, Kai Hilpert, and Robert E W Hancock. Nature protocols 3.2 (2008): 163-175.
(626) II. Determination of Intrinsic Resilience Against Agrochemicals of Fungi Cultured from Seeds
(627) To test the intrinsic resilience against pesticides of the fungi isolated as described in this application, minimum inhibitory concentration (MIC) assays are performed on all isolated fungi of interest, as described in Mohiddin, F. A., and M. R. Khan. African Journal of Agricultural Research 8.43 (2013): 5331-5334 (incorporated herein by reference in its entirety), with the following changes: Briefly, double strength potato dextrose agar is prepared containing different concentrations of each pesticide. The pesticides are applied at the concentration recommended by the manufacturer, and also in two fold dilutions to 0.000125 (12 two-fold dilutions). Thereafter, the plates are seeded centrally with a 3 mm disc of 4 days old culture of each fungus that had been centrifuged and rinsed twice in sterile phosphate buffer. PDA plates without a fungicide but inoculated with the fungi serve as a control. The inoculated plates are incubated at 252 C. for 5 days. The radial growth of the colony in each treatment is measured and the percent inhibition of growth is calculated as described by Mohiddin, F. A., and M. R. Khan. African Journal of Agricultural Research 8.43 (2013): 5331-5334 (incorporated herein by reference in its entirety). Fungal isolates are classified as resilience against the particular pesticide if their maximum tolerance concentration (MTC) is 2 or above the concentration of pesticides recommended to be used in seed coatings.
(628) III. Generating Fungal Species with Compatibility with Commercial Pesticides Coated onto Seeds
(629) When a fungal strain of interest that provides a beneficial property to its plant host is found to be sensitive to a commercially-relevant pesticide, pesticide-compatible variants of the strains need to be generated for use in this application. Generation of compatibility to multiple pesticides or cocktails of pesticides is accomplished by sequentially selecting compatible variants to each individual pesticide and then confirming compatibility with a combination of the pesticides. After each round of selection, fungi are tested for their ability to form symbiotic relationships with the plants and to confirm that they provide a beneficial property on the plant as did the parental strain, with or without application of the pesticide product as described herein.
(630) Generation and isolation of pesticide-compatible strains derived from endophytic strains isolated from seeds and shown to provide beneficiary traits to plants is performed as described by Shapiro-Ilan, David I., et al. Journal of invertebrate pathology 81.2 (2002): 86-93 (incorporated herein by reference in its entirety), with some changes. Briefly, spores of the isolated fungi are collected and solutions containing between 110.sup.3 spores are used to inoculate potato dextrose agar (PDA) plates containing 2, 5, and 10 times the MTC of the particular strain. Plates are incubated for 1-5 days and a single colony from the highest concentration of pesticide which allows growth is inoculated onto a fresh plate with the same pesticide concentration 7 consecutive times. After compatibility has been established, the strain is inoculated onto PDA plates 3 consecutive times and then inoculated onto a PDA plate containing the pesticide to confirm that the compatibility trait is permanent.
(631) Alternatively, if this method fails to provide a compatible strain, a spore suspension is treated with ethyl methanesulfonate to generate random mutants, similarly as described by Leonard, Cory A., Stacy D. Brown, and J. Russell Hayman. International journal of microbiology 2013 (2013), Article ID 901697 (incorporated herein by reference in its entirety) and spores from this culture are used in the experiment detailed above.
(632) To develop fungal endophytes compatible with multiple pesticides or cocktails of pesticides, spores of a strain compatible with one or more pesticides are used to select for variants to a new pesticide as described above. Strains developed this way are tested for retention of the pesticide-compatibility traits by inoculating these strains onto PDA plates containing each single pesticide or combinations of pesticides.
(633) IV. Generating Bacterial Species with Compatibility to Commercial Pesticides Coated onto Seeds
(634) When a bacterial strain of interest is found to be sensitive to a commercially-relevant pesticide, generation of pesticide-compatible variants of the strains can be generated for use in this application. Generation of compatible with multiple pesticides or cocktails of pesticides is accomplished by first sequentially selecting variants compatible with incrementally higher concentrations of each individual pesticide (as described by Thomas, Louise, et al. Journal of Hospital Infection 46.4 (2000): 297-303, which is incorporated herein by reference in its entirety). To develop bacterial endophytes compatible with multiple pesticides or cocktails of pesticides, bacterial cells of a strain compatible with one or more pesticides is used to select for variants to a new pesticide as described above. Strains developed this way are tested for retention of the pesticide-compatible traits by inoculating these strains onto PDA plates containing each single pesticide or combinations of pesticides.
(635) After each round of selection, bacteria are tested for their ability to live within plants and for their ability to provide the same beneficial property to the plant as did the parental strain, with or without application of the pesticide product to the plants as described herein.
(636) V. Generation of Pesticide-Compatible Bacteria by Insertion of a Resistance Plasmid
(637) Many bacterial plasmids that confer compatible pesticides have been described in the literature (Don, R. H., and J. M. Pemberton. Journal of Bacteriology 145.2 (1981): 681-686; and Fisher, P. R., J. Appleton, and J. M. Pemberton. Journal of bacteriology 135.3 (1978): 798-804, each of which is incorporated herein by reference in its entirety)
(638) For cases in which obtaining naturally occurring compatible bacteria is not feasible, use of these plasmids is a possible way to develop endophytic strains compatible with multiple pesticides.
(639) For example, a Pseudomonas fluorescens strain that provides anti-nematode properties to plants but is sensitive to the pesticides 2,4-dichlorophenoxyacetic acid and 4-chloro-2-methylphenoxyacetic can be transformed with the plasmid pJP2 (isolated from Alcaligenes eutrophus) which provides transmissible compatible with these compounds, as described by Don and Pemberton, 1981. Briefly, plasmids are transferred by conjugation to Pseudomonas, using the method described in Haas, Dieter, and Bruce W. Holloway. Molecular and General Genetics 144.3 (1976): 243-251 (incorporated herein by reference in its entirety).
(640) After the generation of bacteria carrying pesticide-compatibility conferring plasmids, these endophytes are tested for their ability to live inside plant tissues and for their ability to provide the same beneficial property to the plant as it did for the parental strain, with or without application of the pesticide product to the plants as described herein.
(641) VI. Growth and Scale-Up of Bacteria for Inoculation on Solid Media
(642) The bacterial isolates are grown by loop-inoculation of a single colony into R2A broth (supplemented with appropriate antibiotics) in 100 mL flasks. The bacterial culture is incubated at 302 C. for 2 days at 180 rpm in a shaking incubator (or under varying temperatures and shaking speeds as appropriate). This liquid suspension is then used to inoculate heat sterilized vermiculite powder that is premixed with sterile R2A broth (without antibiotics), resulting in a soil like mixture of particles and liquid. This microbial powder is then incubated for an additional couple of days at 302 C. with daily handshaking to aerate the moist powder and allow bacterial growth. Microbially inoculated vermiculite powder is now ready for spreading on to soil or onto plant parts. Alternatively, the R2A broth is used to inoculate Petri dishes containing R2A or another appropriate nutrient agar where lawns of bacteria are grown under standard conditions and the solid colonies scraped off, resuspended in liquid and applied to plants as desired.
(643) VII. Growth & Scale-Up of Fungi for Inoculation on Solid Media
(644) Once a fungal isolate has been characterized, conditions are optimized for growth in the lab and scaled-up to provide sufficient material for assays. For example, the medium used to isolate the fungus is supplemented with nutrients, vitamins, co-factors, plant-extracts, and other supplements that can decrease the time required to grow the fungal isolate or increase the yield of mycelia and/or spores the fungal isolate produces. These supplements can be found in the literature or through screening of different known media additives that promote the growth of all fungi or of the particular fungal taxa.
(645) To scale up the growth of fungal isolates, isolates are grown from a frozen stock on several Petri dishes containing media that promotes the growth of the particular fungal isolate and the plates are incubated under optimal environmental conditions (temperature, atmosphere, light). After mycelia and spore development, the fungal culture is scraped and resuspended in 0.05M Phosphate buffer (pH 7.2, 10 mL/plate). Disposable polystyrene Bioassay dishes (500 cm.sup.2, Thermo Scientific Nunc UX-01929-00) are prepared with 225 mL of autoclaved media with any required supplements added to the media, and allowed to solidify. Plates are stored at room temperature for 2-5 days prior to inoculation to confirm sterility. 5 mL of the fungal suspension is spread over the surface of the agar in the Bioassay plate in a biosafety cabinet, plates are allowed to dry for 1 h, and they are then incubated for 2-5 days, or until mycelia and/or spores have developed.
(646) A liquid fungal suspension is then created via the following. Fungal growth on the surface of the agar in the Bioassay plates are then scraped and resuspended in 0.05M Phosphate buffer (pH 7.2). OD.sub.600 readings are taken using a spectrometer and correlated to previously established OD.sub.600/CFU counts to estimate fungal population densities, and the volume adjusted with additional sodium phosphate buffer to result in 100 mL aliquots of fungi at a density of approximately 10.sup.6-10.sup.11 spores/mL. This suspension may or may not be filtered to remove mycelia and can be used to create a liquid microbial formulation as described herein to apply the fungal isolate onto a plant, plant part, or seed.
(647) VIII. Growth & Scale-Up of Bacteria for Inoculation in Liquid Media
(648) Bacterial strains are grown by loop-inoculation of one single colony into R2A broth (amended with the appropriate antibiotics) in 100 mL flasks. The bacterial culture is incubated at 282 C. for 1 day at 180 rpm in a shaking incubator (or under varying temperatures and shaking speeds as appropriate). The bacteria are pelleted by centrifugation and resuspended in sterile 0.1 M sodium phosphate. OD.sub.600 readings are taken using a spectrometer and correlated to previously established OD.sub.600/CFU counts to estimate bacterial population densities, and the volume adjusted with additional sodium phosphate buffer to result in 100 mL aliquots of bacteria at a density of 110.sup.8 cells/mL. To help break surface tension, aid bacterial entry into plants and provide microbes for some energy for growth, 10 L of Silwet L-77 surfactant and 1 g of sucrose is added to each 100 mL aliquot (resulting in 0.01% v/v and 1% v/v concentrations, respectively) in a similar way as in the protocol for Agrobacterium-mediated genetic transformation of Arabidopsis thaliana seed [Clough, S., Bent, A. (1999) The Plant Journal 16(6): 735-743].
(649) IX. Growth & Scale-Up of Fungi for Inoculation in Liquid Media
(650) Once a fungal isolate has been characterized, conditions are optimized for growth in the lab and scaled-up to provide enough material for assays. For example, the medium used to isolate the fungi is supplemented with nutrients, vitamins, co-factors, plant-extracts, and/or other supplements that can decrease the time required to grow the fungal isolate and/or increase the yield of mycelia and/or spores the fungal isolate produces. These supplements can be found in the literature or through screening of different known media additives that promote the growth of all fungi or of the particular fungal taxa.
(651) To scale up the growth of fungal isolates, isolates are grown from a frozen stock on Petri dishes containing media that promotes the growth of the particular fungal isolate and the plates are incubated under optimal environmental conditions (temperature, atmosphere, light). After mycelia and spore development, the fungal culture is scraped and resuspended in 0.05M Phosphate buffer (pH 7.2, 10 mL/plate). 1 liter of liquid media selected to grow the fungal culture is prepared in 2 L glass flasks and autoclaved and any required supplements added to the media. These are stored at room temperature for 2-5 days prior to inoculation to confirm sterility. 1 mL of the fungal suspension is added aseptically to the media flask, which is then incubated for 2-5 days, or until growth in the liquid media has reached saturation. Spore counts are determined using hemacytometer and correlated to previously established OD.sub.600/CFU counts to estimate fungal population densities, and the volume adjusted with additional sodium phosphate buffer to result in 100 mL aliquots of fungi at a density of approximately 10.sup.6-10.sup.11 spores/mL. This suspension may or may not be filtered to remove mycelia and can be used to create a liquid microbial formulation as described herein to apply the fungal isolate onto a plant, plant part, or seed.
(652) X. Creation of Liquid Microbial Formulations or Preparations for the Application of Microbes to Plants
(653) Bacterial or fungal cells are cultured in liquid nutrient broth medium to between 10.sup.2-10.sup.12 CFU/mL. The cells are separated from the medium and suspended in another liquid medium if desired. The microbial formulation may contain one or more bacterial or fungal strains. The resulting formulation contains living cells, lyophilized cells, or spores of the bacterial or fungal strains. The formulation may also contain water, nutrients, polymers and binding agents, surfactants or polysaccharides such as gums, carboxymethylcellulose and polyalcohol derivatives. Suitable carriers and adjuvants can be solid or liquid and include natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, thickeners, binders or fertilizers. Compositions can take the form of aqueous solutions, oil-in-water emulsions, or water-in-oil emulsions. Small amounts of insoluble material can optionally be present, for example in suspension in the medium, but it is generally preferred to minimize the presence of such insoluble material.
(654) XI. Inoculation of Plants by Coating Microbes Directly onto Seed
(655) Seed is treated by coating it with a liquid microbial formulation (prepared as described herein) comprising microbial cells and other formulation components, directly onto the seed surface at the rate of 10.sup.2-10.sup.8 microbial CFU per seed. Seeds are soaked in liquid microbial formulation for 1, 2, 3, 5, 10, 12, 18 or 24 hours or 2, 3, or 5 days. After soaking in microbial formulation, seeds are planted in growing containers or in an outdoor field. Seeds may also be coated with liquid microbial formulation by using an auger or a commercial batch treater. One or more microbial formulations or other seed treatments are applied concurrently or in sequence. Treatment is applied to the seeds using a variety of conventional treatment techniques and machines, such as fluidized bed techniques, augers, the roller mill method, rotostatic seed treaters, and drum coaters. Other methods, such as spouted beds may also be useful. The seeds are pre-sized before coating. Optionally the microbial formulation is combined with an amount of insecticide, herbicide, fungicide, bactericide, or plant growth regulator, or plant micro- or macro-nutrient prior to or during the coating process. After coating, the seeds are typically dried and then transferred to a sizing machine for grading before planting. Following inoculation, colonization of the plants or seeds produced therefrom is confirmed via any of the various methods described herein. Growth promotion or stress resilience benefits to the plant are tested via any of the plant growth testing methods described herein.
(656) XII. Inoculation of Plants with a Combination of Two or More Microbes
(657) Seeds can be coated with bacterial or fungal endophytes. This method describes the coating of seeds with two or more bacterial or fungal strains. The concept presented here involves simultaneous seed coating of two microbes (e.g., both a gram negative endophytic bacterium Burkholderia phytofirmans and a gram positive endophytic bacterium Bacillus mojavensis). Optionally, both microbes are genetically transformed by stable chromosomal integration as follows. Bacillus mojavensis are transformed with a construct with a constitutive promoter driving expression of a synthetic operon of GFPuv and spectinomycin resistance genes, while Burkholderia phytofirmans are transformed with a construct with a constitutive promoter driving expression of the lac operon with an appended spectinomycin resistance gene. Seeds are coated with a prepared liquid formulation of the two microbes the various methods described herein. Various concentrations of each endophyte in the formulation is applied, from 10.sup.2 CFU/seed to about 10.sup.8 CFU/seed. Following inoculation, colonization of the plants or seeds produced therefrom may be confirmed via any of the various methods described herein. Growth promotion or stress resilience benefits to the plant are tested via any of the plant growth testing methods described herein.
(658) XIII. Culturing to Confirm Colonization of Plant by Bacteria
(659) The presence in the seeds or plants of GFPuv or gusA-labeled endophytes can be detected by colony counts from mashed seed material and germinated seedling tissue using R2A plates amended with 5-Bromo-4-chloro-3-indolyl -D-glucuronide (X-glcA, 50 g/mL), IPTG (50 g/mL) and the antibiotic spectinomycin (100 g/mL). Alternatively, bacterial or fungal endophytes not having received transgenes can also be detected by isolating microbes from plant, plant tissue or seed homogenates (optionally surface-sterilized) on antibiotic free media and identified visually by colony morphotype and molecular methods described herein. Representative colony morphotypes are also used in colony PCR and sequencing for isolate identification via ribosomal gene sequence analysis as described herein. These trials are repeated twice per experiment, with 5 biological samples per treatment.
(660) XIV. Culture-Independent Methods to Confirm Colonization of the Plant or Seeds by Bacteria or Fungi
(661) One way to detect the presence of endophytes on or within plants or seeds is to use quantitative PCR (qPCR). Internal colonization by the endophyte can be demonstrated by using surface-sterilized plant tissue (including seed) to extract total DNA, and isolate-specific fluorescent MGB probes and amplification primers are used in a qPCR reaction. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter. Fluorescence is measured by a quantitative PCR instrument and compared to a standard curve to estimate the number of fungal or bacterial cells within the plant.
(662) XV. Experimental Description
(663) The design of both species-specific amplification primers, and isolate-specific fluorescent probes are well known in the art. Plant tissues (seeds, stems, leaves, flowers, etc.) are pre-rinsed and surface sterilized using the methods described herein.
(664) Total DNA is extracted using methods known in the art, for example using commercially available Plant-DNA extraction kits, or the following method. 1. Tissue is placed in a cold-resistant container and 10-50 mL of liquid nitrogen is applied. Tissues are then macerated to a powder. 2. Genomic DNA is extracted from each tissue preparation, following a chloroform:isoamyl alcohol 24:1 protocol (Sambrook, Joseph, Edward F. Fritsch, and Thomas Maniatis. Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press, 1989.).
(665) Quantitative PCR is performed essentially as described by Gao, Zhan, et al. Journal of clinical microbiology 48.10 (2010): 3575-3581 with primers and probe(s) specific to the desired isolate using a quantitative PCR instrument, and a standard curve is constructed by using serial dilutions of cloned PCR products corresponding to the specie-specific PCR amplicon produced by the amplification primers. Data are analyzed using instructions from the quantitative PCR instrument's manufacturer software.
(666) As an alternative to qPCR, Terminal Restriction Fragment Length Polymorphism, (TRFLP) can be performed, essentially as described in Johnston-Monje D, Raizada M N (2011) PLoS ONE 6(6): e20396. Group specific, fluorescently labelled primers are used to amplify a subset of the microbial population, especially bacteria, especially fungi, especially archaea, especially viruses. This fluorescently labelled PCR product is cut by a restriction enzyme chosen for heterogeneous distribution in the PCR product population. The enzyme cut mixture of fluorescently labelled and unlabeled. DNA fragments is then submitted for sequence analysis on a Sanger sequence platform such as the Applied Biosystems 3730 DNA Analyzer.
(667) XVI. Immunological Methods to Detect Microbes in Seeds and Vegetative Tissues
(668) A polyclonal antibody is raised against specific bacteria X or fungus Y strains via standard methods. A polyclonal antibody is also raised against specific GUS and GFP proteins via standard methods. Enzyme-linked immunosorbent assay (ELISA) and immunogold labeling is also conducted via standard methods, briefly outlined below.
(669) Immunofluorescence microscopy procedures involve the use of semi-thin sections of seed or seedling or adult plant tissues transferred to glass objective slides and incubated with blocking buffer (20 mM Tris (hydroxymethyl)-aminomethane hydrochloride (TBS) plus 2% bovine serum albumin, pH 7.4) for 30 min at room temperature. Sections are first coated for 30 min with a solution of primary antibodies and then with a solution of secondary antibodies (goat anti-rabbit antibodies) coupled with fluorescein isothiocyanate (FITC) for 30 min at room temperature. Samples are then kept in the dark to eliminate breakdown of the light-sensitive FITC. After two 5-min washings with sterile potassium phosphate buffer (PB) (pH 7.0) and one with double-distilled water, sections are sealed with mounting buffer (100 mL 0.1 M sodium phosphate buffer (pH 7.6) plus 50 mL double-distilled glycerine) and observed under a light microscope equipped with ultraviolet light and a FITC Texas-red filter.
(670) Ultra-thin (50- to 70-nm) sections for TEM microscopy are collected on pioloform-coated nickel grids and are labeled with 15-nm gold-labeled goat anti-rabbit antibody. After being washed, the slides are incubated for 1 h in a 1:50 dilution of 5-nm gold-labeled goat anti-rabbit antibody in IGL buffer. The gold labeling is then visualized for light microscopy using a BioCell silver enhancement kit. Toluidine blue (0.01%) is used to lightly counterstain the gold-labeled sections. In parallel with the sections used for immunogold silver enhancement, serial sections are collected on uncoated slides and stained with 1% toluidine blue. The sections for light microscopy are viewed under an optical microscope, and the ultrathin sections are viewed by TEM.
(671) XVII. Characterization of Uniformity of Endophytes in a Population of Seeds
(672) To test for the homogeneity of endophytes either on the surface or colonizing the interior tissues in a population of seeds, seeds are tested for the presence of the microbes by culture-dependent and/or -independent methods. Seeds are obtained, surface sterilized and pulverized, and the seed homogenate is divided and used to inoculate culture media or to extract DNA and perform quantitative PCR. The homogeneity of colonization in a population of seeds is assessed through detection of specific microbial strains via these methods and comparison of the culture-dependent and culture-independent results across the population of seeds. Homogeneity of colonization for a strain of interest is rated based on the total number of seeds in a population that contain a detectable level of the strain, on the uniformity across the population of the number of cells or CFU of the strain present in the seed, or based on the absence or presence of other microbial strains in the seed.
(673) XVIII. Experimental Description
(674) Surface sterilized seeds are obtained as described herein. For culture-dependent methods of microbial-presence confirmation, bacterial and fungi are obtained from seeds essentially as described herein with the following modification. Seed homogenate is used to inoculate media containing selective and/or differential additives that will allow to identification of a particular microbe.
(675) For qPCR, total DNA of each seed is extracted using methods known in the art, as described herein.
(676) XIX. Characterization of Homogeneity of Colonization in Population of Plants
(677) To test for the homogeneity of microorganisms (including endophytes) colonizing the interior in a population of plants, tissues from each plant are tested for the presence of the microbes by culture-dependent and/or -independent methods. Tissues are obtained, surface sterilized and pulverized, and the tissue material is divided and used to inoculate culture media or to extract DNA and perform quantitative PCR. The homogeneity of colonization in a population of plants is assessed through detection of specific microbial strains via these methods and comparison of the culture-dependent and culture-independent results across the population of plants or their tissues. Homogeneity of colonization for a strain of interest is rated based on the total number of plants in a population that contain a detectable level of the strain, on the uniformity across the population of the number of cells or CFU of the strain present in the plant tissue, or based on the absence or presence of other microbial strains in the plant.
(678) XX. Experimental Description
(679) Surface sterilized plant tissues are obtained as described herein. For culture-dependent methods of microbial-presence confirmation, bacterial and fungi are obtained from plant tissues essentially as described herein with the following modification. Plant tissue homogenate is used to inoculate media containing selective and/or differential additives that will allow identification of a particular microbe.
(680) For qPCR, total DNA of each plant tissue is extracted using methods known in the art, as described herein.
(681) Other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the embodiments. Consider the specification and examples as exemplary only, with a true scope and spirit being indicated by the following claims.