PICHINDE VIRUS REVERSE GENETICS SYSTEMS AND METHODS OF USE
20200165578 ยท 2020-05-28
Inventors
Cpc classification
A61P43/00
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
A61P31/00
HUMAN NECESSITIES
C12N2760/16134
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/86
CHEMISTRY; METALLURGY
C12N2760/10043
CHEMISTRY; METALLURGY
International classification
Abstract
Provided herein are genetically engineered Pichinde viruses that include three ambisense genomic segments. The first genomic segment includes a coding region encoding a Z protein and a coding region encoding a L RdRp protein. The second genomic segment includes a coding region encoding a nucleoprotein (NP) and the third genomic segment includes a coding region encoding a glycoprotein. Each of the second and third genomic segments optionally include an additional coding region that may encode an antigen or a detectable marker. Also provided herein is a reverse genetics system for making a genetically engineered Pichinde virus, and a collection of vectors that can be used to produce a genetically engineered Pichinde virus. Further provided are methods for using a reverse genetics system, and methods for producing an immune response in a subject.
Claims
1-52. (canceled)
53. A genetically engineered Pichinde virus comprising: three separate ambisense genomic segments, wherein the first genomic segment comprises a coding region encoding a Z protein and a coding region encoding a L RNA-dependent RNA polymerase protein, wherein the second genomic segment comprises a coding region encoding a nucleoprotein (NP), wherein the third genomic segment comprises a coding region encoding a glycoprotein wherein the second genomic segment further comprises a coding region encoding a first protein, or the third genomic segment further comprises a coding region encoding a second protein.
54. The virus of claim 53 wherein the second genomic segment further comprises the coding region encoding the first protein, and the third genomic segment further comprises the coding region encoding the second protein.
55. The virus of claim 53 wherein the first protein and the second protein are selected from an antigen and a detectable marker.
56. The virus of claim 53 wherein the first protein and the second protein encode an antigen.
57. The virus of claim 55 wherein the antigen is a protein expressed by a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen.
58. The virus of claim 53 wherein the first protein and the second protein are different.
59. The virus of claim 53 wherein the first protein and the second protein are the same.
60. The virus of claim 53 wherein the nucleoprotein comprises at least one mutation that reduces exoribonuclease activity of the nucleoprotein, wherein the mutation is a mutation of at least one RNase catalytic residue.
61. The virus of claim 53 wherein the glycoprotein comprises at least one mutation that alters the activity of the glycoprotein, wherein when the glycoprotein comprises SEQ ID NO:4 the mutation is selected from an asparagine at amino acid 20 and an asparagine at amino acid 404, or a combination thereof, and wherein the asparagine is substituted with any other amino acid.
62. An infectious virus particle comprising the three genomic segments of claim 53.
63. A composition comprising the isolated infectious virus particle of claim 62, wherein the infectious virus particle is isolated.
64. A collection of vectors comprising: a first vector encoding a first genomic segment comprising a coding region encoding a Z protein and a coding region encoding a L RdRp protein, wherein the coding region encoding the Z protein is antigenomic, a second vector encoding a second genomic segment comprising a coding region encoding a nucleoprotein (NP), wherein the coding region encoding the NP is antigenomic, and a third vector encoding a third genomic segment comprises a coding region encoding a glycoprotein, wherein the coding region encoding the glycoprotein is antigenomic; and wherein the second genomic segment further comprises a coding region encoding a first protein, or the third genomic segment further comprises a coding region encoding a second protein.
65. The collection of claim 64 wherein the second genomic segment further comprises the coding region encoding the first protein, and the third genomic segment further comprises the coding region encoding the second protein.
66. The collection of claim 64 wherein the vectors are plasmids.
67. The collection of claim 64 wherein the plasmids further comprise a T7 promoter.
68. The collection of claim 64 wherein the first protein and the second protein are selected from an antigen and a detectable marker.
69. The collection of claim 68 wherein the first protein and the second protein encode an antigen.
70. The collection of claim 68 wherein the antigen is a protein expressed by a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen.
71. The collection of claim 64 wherein the first protein and the second protein are different.
72. The collection of claim 64 wherein the first protein and the second protein are the same.
73. A method for making a genetically engineered Pichinde virus comprising: introducing into a cell the collection of vectors of claim 64; and incubating the cells in a medium wherein the first, second, and third genomic segments are expressed and packaged.
74. The method of claim 73 further comprising isolating an infectious virus particle from the medium.
75. The method of claim 73 wherein the cells express a T7 polymerase.
76. The isolated infectious virus particle of claim 73.
77. A composition comprising the isolated infectious virus particle of claim 76.
78. A reverse genetics system for making a genetically engineered Pichinde virus comprising three vectors, wherein a first vector encodes a first genomic segment comprising a coding region encoding a Z protein and a coding region encoding a L RdRp protein, wherein the coding region encoding the Z protein is antigenomic, wherein the second vector encodes a second genomic segment comprising a coding region encoding a nucleoprotein (NP), wherein the coding region encoding the NP is antigenomic, wherein the third vector encodes a third genomic segment comprises a coding region encoding a glycoprotein, wherein the coding region encoding the glycoproteinis antigenomic wherein the second genomic segment further comprises a coding region encoding a first protein, or the third genomic segment further comprises a coding region encoding a second protein.
79. The reverse genetics system of claim 53 wherein the second genomic segment further comprises the coding region encoding the first protein, and the third genomic segment further comprises the coding region encoding the second protein.
80. The reverse genetics system of claim 78 wherein each plasmid comprises a T7 promoter.
81. A method for using a reverse genetics system, comprising: introducing into a cell the three vectors of genomic segments of claim 78; incubating the cell wherein the three genomic segments are transcribed and the coding regions of each genomic segment are expressed.
82. The method of claim 81 further comprising isolating infectious virus particles produced by the cell, wherein each infectious virus particle comprises the three genomic segments.
83. The method of claim 81 wherein the introducing comprises transfecting a cell with the three genomic segments.
84. The method of claim 81 wherein the introducing comprises contacting the cell with an infectious virus particle comprising the three genomic segments.
85. The method of claim 81 wherein the cell is ex vivo.
86. The method of claim 81 wherein the cell is a vertebrate cell.
87. The method of claim 86 wherein the vertebrate cell is a mammalian cell.
88. The method of claim 87 wherein the mammalian cell is a human cell.
89. The method of claim 86 wherein the vertebrate cell is an avian cell.
90. The method of claim 89 wherein the avian cell is a chicken embryonic fibroblast.
91. A method for producing an immune response in a subject, comprising administering to a subject the infectious virus particle of claim 62, wherein the second genomic segment further comprises a coding region encoding a first antigen, or the third genomic segment further comprises a coding region encoding a second antigen.
92. The method of claim 91 wherein the subject is a vertebrate.
93. The method of claim 92 wherein the vertebrate is a mammal.
94. The method of claim 93 wherein the mammalian is a human.
95. The method of claim 91 wherein the vertebrate is avian.
96. The method of claim 91 wherein the immune response comprises a humoral immune response.
97. The method of claim 91 wherein the immune response comprises a cell-mediated immune response.
98. The method of claim 91 wherein the first antigen or the second antigen is a protein expressed by a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen, and wherein the subject is at risk of exposure to the viral pathogen, the prokaryotic pathogen, or the eukaryotic pathogen.
99. The method of claim 91 wherein the administering comprises administering at least two populations of infectious virus particles, wherein each population of infectious virus particle encodes a different antigen.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0046] Provided herein is a reverse genetics system for producing genetically modified Pichinde virus. The genetically modified Pichinde virus-based reverse genetics system described herein has multiple advantages over other arenavirus systems. Pichinde virus is not known to cause disease in humans, and there is evidence that Pichinde virus can cause asymptomatic human infections in a laboratory setting. For instance, 46% of laboratory personnel working with the virus are serum positive but do not show a distinct illness (Buchmeier et al., 2007, Arenaviridae: the viruses and their replication. In: Knipe and Howley (eds), Fields Virology. 5th ed. Philadelphia, Pa.: Lippincott Williams & Wilkins. pp. 1791-1827). The modified Pichinde virus described herein is further attenuated, compared to the parental virus used in the human-infection study reported by Buchmeier et al. The modified Pichinde virus is genetically stable through serial passages in cell cultures. General human populations are not known to have prior exposure to Pichinde virus, which makes it an ideal vector for vaccine development due to the lack of pre-existing immunity against this Pichinde virus vector. As used herein, genetically modified and genetically engineered refers to a Pichinde virus which has been modified and is not found in any natural setting. For example, a genetically modified Pichinde virus is one into which has been introduced an exogenous polynucleotide, such as a restriction endonuclease site. Another example of a genetically modified Pichinde virus is one which has been modified to include three genomic segments.
[0047] The reverse genetics system for this modified Pichinde virus includes two to three genomic segments. The first genomic segment includes two coding regions, one that encodes a Z protein and a second that encodes a RNA-dependent RNA polymerase (L RdRp). The second genomic segment includes a coding region that encodes a nucleoprotein (NP), and may include at least one restriction enzyme site, such as a multiple cloning site. The third genomic segment includes a coding region that encodes a glycoprotein, and may include at least one restriction enzyme site, such as a multiple cloning site. A coding region is a nucleotide sequence that encodes a protein and, when placed under the control of appropriate regulatory sequences expresses the encoded protein. As used herein, the term protein refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term protein also includes molecules which contain more than one protein joined by disulfide bonds, ionic bonds, or hydrophobic interactions, or complexes of proteins that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, and polypeptide are all included within the definition of protein and these terms are used interchangeably. It should be understood that these terms do not connote a specific length of a polymer of amino acids, nor are they intended to imply or distinguish whether the protein is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring.
[0048] The Z protein, L RdRp, NP protein, and glycoprotein are those encoded by a Pichinde virus. The Z protein is a small RING-domain containing matrix protein that mediates virus budding and also regulates viral RNA synthesis. One example of a Z protein from a Pichinde virus is the sequence available at Genbank accession number ABU39910.1 (SEQ ID NO:1). The L RdRp protein is a RNA-dependent RNA polymerase that is required for viral DNA synthesis. One example of a L RdRp protein from a Pichinde virus is the sequence available at Genbank accession number ABU39911.1 (SEQ ID NO:2). The NP protein encapsidates viral genomic RNAs, is required for viral RNA synthesis, and also suppresses host innate immune responses. One example of a NP protein from a Pichinde virus is the sequence available at Genbank accession number ABU39909.1 (SEQ ID NO:3). The glycoprotein is post-translationally processed into a stable signal peptide (SSP), the receptor-binding G1 protein, and the transmembrane G2 protein. One example of a glycoprotein from a Pichinde virus is the sequence available at Genbank accession number ABU39908.1 (SEQ ID NO:4).
[0049] Other examples of Z proteins, L RdRp proteins, NP proteins, and glycoprotein include proteins having structural similarity with a protein that is encoded by a Pichinde virus, for instance, SEQ ID NO:1, 2, 3, and/or 4. Structural similarity of two polypeptides can be determined by aligning the residues of the two polypeptides (for example, a candidate polypeptide and a reference polypeptide described herein) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical amino acids, although the amino acids in each sequence must nonetheless remain in their proper order. A reference polypeptide may be a polypeptide described herein, such as SEQ ID NO:1, 2, 3, or 4. A candidate polypeptide is the polypeptide being compared to the reference polypeptide. A candidate polypeptide may be isolated, for example, from a cell of an animal, such as a mouse, or can be produced using recombinant techniques, or chemically or enzymatically synthesized. A candidate polypeptide may be inferred from a nucleotide sequence present in the genome of a Pichinde virus.
[0050] Unless modified as otherwise described herein, a pair-wise comparison analysis of amino acid sequences can be carried out using the Blastp program of the blastp suite-2sequences search algorithm, as described by Tatiana et al., (FEMS Microbiol Lett, 174, 247-250 (1999)), and available on the National Center for Biotechnology Information (NCBI) website. The default values for all blastp suite-2sequences search parameters may be used, including general parameters: expect threshold=10, word size=3, short queries=on; scoring parameters: matrix=BLOSUM62, gap costs=existence:11 extension:1, compositional adjustments=conditional compositional score matrix adjustment. Alternatively, polypeptides may be compared using the BESTFIT algorithm in the GCG package (version 10.2, Madison Wis.).
[0051] In the comparison of two amino acid sequences, structural similarity may be referred to by percent identity or may be referred to by percent similarity. Identity refers to the presence of identical amino acids. Similarity refers to the presence of not only identical amino acids but also the presence of conservative substitutions. A conservative substitution for an amino acid in a polypeptide described herein may be selected from other members of the class to which the amino acid belongs. For example, it is known in the art of protein biochemistry that an amino acid belonging to a grouping of amino acids having a particular size or characteristic (such as charge, hydrophobicity and hydrophilicity) can be substituted for another amino acid without altering the activity of a protein, particularly in regions of the protein that are not directly associated with biological activity. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Conservative substitutions include, for example, Lys for Arg and vice versa to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free OH is maintained; and Gln for Asn to maintain a free NH2.
[0052] The skilled person will recognize that the Z protein depicted at SEQ ID NO:1 can be compared to Z proteins from other arenaviruses, including Lassa virus (O73557.4), LCMV Armstrong (AAX49343.1), and Junin virus (NP_899216.1) using readily available algorithms such as ClustalW to identify conserved regions of Z proteins. ClustalW is a multiple sequence alignment program for nucleic acids or proteins that produces biologically meaningful multiple sequence alignments of different sequences (Larkin et al., 2007, ClustalW and ClustalX version 2, Bioinformatics, 23(21):2947-2948). Using this information the skilled person will be able to readily predict with a reasonable expectation that certain conservative substitutions to an Z protein such as SEQ ID NO:1 will not decrease activity of the polypeptide.
[0053] The skilled person will recognize that the L RdRp protein depicted at SEQ ID NO:2 can be compared to L RdRp proteins from other arenaviruses, including Lassa virus (AAT49002.1), LCMV Armstrong (AAX49344.1), and Junin virus (NP 899217.1) using readily available algorithms such as ClustalW to identify conserved regions of L RdRp proteins. Using this information the skilled person will be able to readily predict with a reasonable expectation that certain conservative substitutions to an L RdRp protein such as SEQ ID NO:2 will not decrease activity of the polypeptide.
[0054] The skilled person will recognize that the NP protein depicted at SEQ ID NO:3 can be compared to NP proteins from other arenaviruses, including Lassa virus (P13699.1), LCMV Armstrong (AAX49342.1), and Junin virus (NP 899219.1) using readily available algorithms such as ClustalW to identify conserved regions of NP proteins. Using this information the skilled person will be able to readily predict with a reasonable expectation that certain conservative substitutions to a NP protein such as SEQ ID NO:3 will not decrease activity of the polypeptide.
[0055] The skilled person will recognize that the glycoprotein depicted at SEQ ID NO:4 can be compared to glycoproteins from other arenaviruses, including Lassa virus (P08669), LCMV Armstrong (AAX49341.1), and Junin virus (NP_899218.1) using readily available algorithms such as ClustalW to identify conserved regions of glycoproteins. Using this information the skilled person will be able to readily predict with a reasonable expectation that certain conservative substitutions to a glycoprotein such as SEQ ID NO:4 will not decrease activity of the polypeptide.
[0056] Thus, as used herein, a Pichinde virus Z protein, L RdRp protein, an NP protein, or a glycoprotein includes those with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence similarity to a reference amino acid sequence. Alternatively, as used herein, a Pichinde virus Z protein, L RdRp protein, an NP protein, or a glycoprotein includes those with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity to a reference amino acid sequence. Unless noted otherwise, Pichinde virus Z protein, Pichinde virus L RdRp protein, Pichinde virus NP protein, and Pichinde virus glycoprotein refer to a protein having at least 80% amino acid identity to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively.
[0057] A Pichinde virus Z protein, L RdRp protein, an NP protein, or a glycoprotein having structural similarity the amino acid sequence of SEQ ID NO:1, 2, 3, or 4, respectively, has biological activity. As used herein, biological activity refers to the activity of Z protein, L RdRp protein, an NP protein, or a glycoprotein in producing an infectious virus particle. The biological role each of these proteins play in the biogenesis of an infectious virus particle is knows, as are assays for measuring biological activity of each protein.
[0058] In one embodiment, the NP protein may include one or more mutations. A mutation in the NP protein may result in a NP protein that continues to function in the production of infectious viral particles, but has a decreased ability to suppress the production of certain cytokines by a cell infected with a Pichinde virus. A Pichinde virus that has decreased ability to suppress cytokine production is expected to be useful in enhancing an immunological response to an antigen encoded by the virus. Examples of mutations include the aspartic acid at residue 380, the glutamic acid at residue 382, the aspartic acid at residue 457, the aspartic acid at residue 525, and the histidine at residue 520. A person of ordinary skill in the art recognizes that the precise location of these mutations can vary between different NP proteins depending upon the presence of small insertions or deletions in the NP protein, thus the precise location of a mutation is approximate, and can vary by 1, 2, 3, 4, or 5 amino acids.
[0059] In one embodiment, the mutation in the NP protein may be the replacement of the aspartic acid, glutamic acid, or histidine at residues 380, 382, 457, 525, and/or 520 with any other amino acid. In one embodiment, the mutation may be the conservative substitution of the aspartic acid, glutamic acid, or histidine at residues 380, 382, 457, 525, and/or 520. In one embodiment, the mutation may be the replacement of the aspartic acid, glutamic acid, or histidine at residues 380, 382, 457, 525, and/or 520 with a glycine or an alanine. In one embodiment, the NP protein may include a mutation at one, two, three, or four of the residues 380, 382, 457, 525, or 520, and in one embodiment the NP protein may include a mutation at all five residues.
[0060] In one embodiment, the glycoprotein may include one or more mutations. A mutation in the glycoprotein may result in a glycoprotein that impairs virus spreading in vivo. Examples of mutations include the asparagine at residue 20, and/or the asparagine at residue 404. A person of ordinary skill in the art recognizes that the precise location of these mutations can vary between different glycoproteins depending upon the presence of small insertions or deletions in the glycoprotein, thus the precise location of a mutation is approximate, and can vary by 1, 2, 3, 4, or 5 amino acids.
[0061] In one embodiment, the mutation in the glycoprotein may be the replacement of the asparagine residue 20 and/or 404 with any other amino acid. In one embodiment, the mutation may be the conservative substitution of the asparagine residue 20 and/or 404. In one embodiment, the mutation may be the replacement of the asparagine residue 20 and/or 404 with a glycine or an alanine.
[0062] Proteins as described herein also may be identified in terms the polynucleotide that encodes the protein. Thus, this disclosure provides polynucleotides that encode a protein as described herein or hybridize, under standard hybridization conditions, to a polynucleotide that encodes a protein as described herein, and the complements of such polynucleotide sequences. As used herein, the term polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides, and includes both double- and single-stranded DNA and RNA. A polynucleotide may include nucleotide sequences having different functions, including for instance coding sequences, and non-coding sequences such as regulatory sequences. A polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques. A polynucleotide can be linear or circular in topology. A polynucleotide can be, for example, a portion of a vector, such as an expression or cloning vector, or a fragment. An example of a polynucleotide is a genomic segment.
[0063] An example of a polynucleotide encoding a Z protein is the nucleotides 85-372 of the sequence available at Genbank accession number EF529747.1 (SEQ ID NO:5), an example of a polynucleotide encoding an L RdRp protein is the complement of nucleotides 443-7027 of the sequence available at Genbank accession number EF529747.1 (SEQ ID NO:5), an example of a polynucleotide encoding an NP protein is the complement of nucleotides 1653..3338 of the sequence available at Genbank accession number EF529746.1 (SEQ ID NO:6), and an example of a polynucleotide encoding a glycoprotein protein is the nucleotides 52-1578 of the sequence available at Genbank accession number EF529746.1 (SEQ ID NO:6). It should be understood that a polynucleotide encoding a Z protein, an L RdRp protein, an NP protein, or a glycoprotein represented by SEQ ID NO:1, 2, 3, or 4, respectively, is not limited to the nucleotide sequence disclosed at SEQ ID NO:5 or 6, but also includes the class of polynucleotides encoding such proteins as a result of the degeneracy of the genetic code. For example, the naturally occurring nucleotide sequence SEQ ID NO:5 is but one member of the class of nucleotide sequences encoding a protein having the amino acid sequence SEQ ID NO:1 and a protein having the amino acid sequence SEQ ID NO:2. The class of nucleotide sequences encoding a selected protein sequence is large but finite, and the nucleotide sequence of each member of the class can be readily determined by one skilled in the art by reference to the standard genetic code, wherein different nucleotide triplets (codons) are known to encode the same amino acid.
[0064] As used herein, reference to a polynucleotide as described herein and/or reference to the nucleic acid sequence of one or more SEQ ID NOs can include polynucleotides having a sequence identity of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an identified reference polynucleotide sequence.
[0065] In this context, sequence identity refers to the identity between two polynucleotide sequences. Sequence identity is generally determined by aligning the bases of the two polynucleotides (for example, aligning the nucleotide sequence of the candidate sequence and a nucleotide sequence that includes, for example, a nucleotide sequence that encodes a protein of SEQ ID NO:1, 2, 3, or 4) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order. A candidate sequence is the sequence being compared to a known sequencee.g., a nucleotide sequence that includes the appropriate nucleotide sequence selected from, for example, SEQ ID NO:5 or 6. For example, two polynucleotide sequences can be compared using the Blastn program of the BLAST 2 search algorithm, as described by Tatiana et al., FEMS Microbiol Lett., 1999;174: 247-250, and available on the world wide web at ncbi.nlm.nih.gov/BLAST/. The default values for all BLAST 2 search parameters may be used, including reward for match=1, penalty for mismatch=2, open gap penalty=5, extension gap penalty=2, gap x_dropoff=50, expect=10, wordsize=11, and filter on.
[0066] In one embodiment, the second and/or third genomic segments may each independently include a multiple cloning site with one restriction site or more than one restriction site.
[0067] In one embodiment, the second and/or third genomic segments may each independently include an additional coding region that encodes a protein, such as an antigen. Thus, the second genomic segment includes the coding region encoding the nucleoprotein and may include a second coding region that encodes an antigen. Likewise, the third genomic segment includes the coding region encoding the glycoprotein and may include a second coding region that encodes an antigen. The second and third genomic segments may encode the same antigen or different antigens. In both the second genomic segment and the third genomic segment this second coding region may be inserted into a restriction site present, such as a restriction site present in a multiple cloning site. The second coding region that may be present on the second genomic segment and/or the third genomic segment is not intended to be limiting.
[0068] In one embodiment, the second coding region may encode a protein that is useful as an antigen that can elicit an immune response in a subject. Examples 1, 2, and 3 show the use of influenza nucleoproteins and influenza hemagglutinins as model antigens to demonstrate the effectiveness of the reverse genetics systems and viruses disclosed herein, and accordingly the identity of the antigen is not intended to be limiting. An example of an antigen is a full length protein encoded by a prokaryotic cell, a eukaryotic cell (including, for instance a fungus, yeast, or protozoan) or a virus, or a fragment thereof. In one embodiment, the protein may be one that is naturally expressed by a pathogen, such as a viral pathogen, a prokaryotic pathogen, or a eukaryotic pathogen. Antigenic proteins encoded by a prokaryotic cell, a eukaryotic cell, or a virus are known to the skilled person in the art. Another example of an antigen is a protein engineered to include one or more epitopes. In one embodiment, the protein may be one that is expressed by a tumor cell or is present in a tumor environment.
[0069] Examples of prokaryotic pathogens from which an antigen may be obtained include gram negative pathogens and gram positive pathogens. Examples of gram negative pathogens include enteropathogens, such as members of the family Enterobacteriaceae, including members of the family Enterobacteriaceae that are members of the tribe Escherichieae or Salmonelleae. Examples of enteropathogens include members of the family Enterobacteriaceae, members of the family Vibrionaceae (including, for instance, Vibrio cholerae), and Campylobacter spp. (including, for instance, C. jejuni). Examples of preferred members of the family Enterobacteriaceae include, for instance, E. coli, Shigella spp., Salmonella spp., Proteus spp., Klebsiella spp. (for instance, K. pneumoniae), Serratia spp., and Yersinia spp. Examples of strains of E. coli include, for example, E. coli scrotypes O1a, O2a, O78, and O157, different O:H serotypes including 0104, 0111, 026, 0113, 091, hemolytic strains of enterotoxigenic E. coli such as K88+, F4+, F18ab+, and F18ac+, and non-hemolytic strains such as 987P, F41, and K99. As used herein, the term strain refers to members of a species of microbe where the members have different genotypes and/or phenotypes. Other examples of E. coli include five categories of diarrheagenic Escherichia coli that cause foodborne and waterborne diseases in humans: the enteropathogenic (EPEC), enterohemorrhagic (EHEC), enterotoxigenic (ETEC), enteroinvasive (EIEC) and enteroaggregative (EAEC) strains. Other gram negative microbes include members of the family Pasteurellaceae, preferably Pasturella spp., such as P. multocida, and Mannheimia haemolytica, and members of the family Pseudomonadaceae, such as Pseudomonas spp., including P. aeruginosa. Yet other gram negative microbes include Bordetella spp., Burkholderia spp., Chlamydia spp., Enterobacter spp., Helobacter spp., Histophilus spp., Moraxella spp., Legionella spp., Leptospiria spp., Rickettsia spp., Treponnema spp., Neisseria spp., Actinobacillus spp., Haemophilus spp., Myxcobacteria spp., Sporocytophaga spp., Chondrococcus spp., Cytophaga spp., Flexibacter spp., Flavobacterium spp., Aeromonas spp. Examples of Yersinia spp. include Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica. Examples of Fusobacterium spp. belonging to the family Fusobacteriaceae include F. necrophorum (including subspecies F. necrophorum subsp. necrophorum and F. necrophorum subsp. funduliforme), F. nucleatum, F. canifelinum, F. gonidiaformans, F. mortiferum, F. naviforme, F. necrogenes, F. russii, F. ulcerans, and F. variu.
[0070] Examples of gram-positive pathogens include members of the family Micrococcaceae, including Staphylococcus spp., such as S. aureus. Other gram positive pathogens include members of the family Deinococcaceae, such as Streptococcus agalactiae, Streptococcus uberis, Streptococcus bovis, Streptococcus equi, Streptococcus zooepidemicus, and Streptococcus dysgalatiae. Other gram positive microbes from which an antigen may be obtained include Bacillus spp., Clostridium spp., Corynebacterium spp., Erysipelothrix spp., Listeria spp., Mycobacterium spp., Other gram positive pathogens include members of the Corynebacteriaceae, Enterococcacae, Micrococcaceae, Mycobacteriaceae, Nocardiaceae, and Peptococcaceae, which include such bacterial species as Actinomyces spp., Bifidobacterium spp., Enterococcus spp., Eubacterium spp., Kytococcus spp., Lactobacillus spp., Micrococcus spp., Mobiluncus spp., Mycobacteria spp., Peptostreptococcus spp., and Propionibacterium spp., Gardnerella spp., Mycoplasma, Norcardia spp., Streptomyces spp., Borrelia spp., and Bacillus spp.
[0071] Examples of pathogenic protozoa include intestinal protozoa, urogenital protozoa, Systemic protozoa, and extraintestinal protozoa. Specific examples include, but are not limited to, e.g. Entamoeba histolytica, Giardia lamblia, Cryptosporidium parvum, Cystoisospora belli, Cyclospora cayetanensis, members of the phylum Microsporidia, Trichomonas vaginalis, Plamodium falciparum, Toxoplasma gondii, members of the subclass Coccidiosis such as members of the genus Eimeria, including E. acervulina., E. necatrix and E. tenella, Nematodes, Trematodes, and Cestodes.
[0072] Examples of viral pathogens include, but are not limited to members of the family Rhabdoviridae (including Vesicular stomatitis virus VSV), members of the genus Aphthovirus (including Foot-and-mouth disease virus FMDV), members of the genus Pestivirus (including Bovine viral diarrhea virus), members of the family Arterivirus (including porcine reproductive and respiratory syndrome virus PRRSV), Coronaviruses (including Porcine Epidemic Diarrhea virus EPDV, SARS-CoV, MERS-CoV), members of the genus Torovirus (including Equine torovirus), members of the family Orthomyxoviridae (including influenza virus), members of the family Reoviridae (including rotavirus, Bluetongue disease virus, avian reoviruses), members of the family Circovirus, members of the family Herpesviridae, members of the family Retroviridae (including HIV, FIV, SIV, ALV, BLV, RSV), members of the Asfariridae family (including African swine fever virus), members of the genus Flavivirus (including Dengue virus, Yellow fever virus), members of the family Paramyxoviridae (including Newcastle disease virus and Respiratory syncytial virus RSV), as well as members of the genus arenavirus (including members of the LCMV-Lassa virus (Old World) complex and the Tacaribe virus (New World) complex). Specific non-limiting examples of members of the genus arenavirus include Lymphocytic choriomeningitis virus, Pichinde virus, Lassa virus, Mopeia virus, Junin virus, Guanarito virus, Lujo virus , Machupo virus, Sabia virus, and Whitewater Arroyo virus.
[0073] In one embodiment, the protein encoded by the second coding region may be from an influenza virus, such as a nucleoprotein, a hemagglutinin, or a portion thereof. The nucleoprotein may be of any subtype, including but not limited to, A/PR8 NP (e.g., Genbank accession number NP_040982.1). The hemagglutinin may be of any subtype, including but not limited to, H1 and H3.
[0074] The protein encoded by the second coding region may be one that results in a humoral immune response, a cell-mediated immune response, or a combination thereof. In one embodiment, the protein encoded by the second coding region of the second and third genomic segments is at least 6 amino acids in length. The antigen may be heterologous to the cell in which the coding region is expressed. The nucleotide sequence of a second coding region present on a second and third genomic segment and encoding the antigen can be readily determined by one skilled in the art by reference to the standard genetic code. The nucleotide sequence of a second coding region present on a second and third genomic segment and encoding the antigen may be modified to reflect the codon usage bias of a cell in which the antigen will be expressed. The usage bias of nearly all cells in which a Pichinde virus would be expressed is known to the skilled person.
[0075] In one embodiment, the second coding region may encode a protein that is useful as a detectable marker, e.g., a molecule that is easily detected by various methods. Examples include fluorescent polypeptides (e.g., green, yellow, blue, or red fluorescent proteins), luciferase, chloramphenicol acetyl transferase, and other molecules (such as c-myc, flag, 6his, HisGln (HQ) metal-binding peptide, and V5 epitope) detectable by their fluorescence, enzymatic activity or immunological properties.
[0076] When the second and/or third genomic segments include a coding region that encodes an antigen, the maximum size in nucleotides of the coding region(s) is determined by considering the total size of the second genomic segment and the third genomic segment. The total size of the two genomic segments may be no greater than 3.4 kilobases (kb), no greater than 3.5 kb, no greater than 3.6 kb, no greater than 3.7 kb, no greater than 3.8 kb, no greater than 3.9 kb, no greater than 4.0 kb, no greater than 4.1 kb, no greater than 4.2 kb, no greater than 4.3 kb, no greater than 4.4 kb, or no greater than 4.5 kb.
[0077] Pichinde virus is an arenavirus, and one characteristic of an arenavirus is an ambisense genome. As used herein, ambisense refers to a genomic segment having both positive sense and negative sense portions. For example, the first genomic segment of a Pichinde virus described herein is ambisense, encoding a Z protein in the positive sense and encoding a L RdRp protein in the negative sense. Thus, one of the two coding regions of the first genomic segment is in a positive-sense orientation and the other is in a negative-sense orientation. When the second and/or the third genomic segment includes a second coding region encoding an antigen, the coding region encoding the antigen is in a negative-sense orientation compared to the NP protein of the second genomic segment and to the glycoprotein of the third genomic segment.
[0078] Each genomic segment also includes nucleotides encoding a 5 untranslated region (UTR) and a 3 UTR. These UTRs are located at the ends of each genomic segment. Nucleotides useful as 5 UTRs and 3 UTRs are those present in Pichinde virus and are readily available to the skilled person (see, for instance, Buchmeier et al., 2007, Arenaviridae: the viruses and their replication. In: Knipe and Howley (eds), Fields Virology. 5th ed. Philadelphia, Pa.: Lippincott Williams & Wilkins. pp. 1791-1827). In one embodiment, a genomic segment that encodes a Z protein and an L RdRp protein includes a 5 UTR sequence that is 5 CGCACCGGGGAUCCUAGGCAUCUUUGGGUCACGCUUCAAAUUUGUCCAAUUUGAA CCCAGCUCAAGUCCUGGUCAAAACUUGGG (SEQ ID NO:8) and a 3 UTR sequence that is CGCACCGAGGAUCCUAGGCAUUUCUUGAUC (SEQ ID NO:9). In one embodiment, a genomic segment that encodes a NP protein or a glycoprotein includes a 5 UTR sequence that is 5 CGCACCGGGGAUCCUAGGCAUACCUUGGACGCGCAUAUUACUUGAUCAAAG (SEQ ID NO:10) and a 3 UTR sequence that is 5 CGCACAGUGGAUCCUAGGCGAUUCUAGAUCACGCUGUACGUUCACUUCUUCACUG ACUCGGAGGAAGUGCAAACAACCCCAAA (SEQ ID NO:11). Alterations in these sequences are permitted, and the terminal 27-30 nucleotides are highly conserved between the genomic segments.
[0079] Each genomic segment also includes an intergenic region located between the coding region encoding a Z protein and the coding region encoding a L RdRp protein, between the coding region encoding a nucleoprotein and the at least one first restriction enzyme site, and between the coding region encoding a glycoprotein and at least one second restriction enzyme site. Nucleotides useful as an intergenic region are those present in Pichinde virus and are readily available to the skilled person. In one embodiment, an IGR sequence of a genomic segment that encodes a Z protein and an L RdRp protein includes 5 ACCAGGGCCCCUGGGCGCACCCCCCUCCGGGGGUGCGCCCGGGGGCCCCCGGCCCC AUGGGGCCGGUUGUU (SEQ ID NO:12). In one embodiment, an IGR sequence of a genomic segment that encodes a NP protein or a glycoprotein includes 5 GCCCUAGCCUCGACAUGGGCCUCGACGUCACUCCCCAAUAGGGGAGUGACGUCGA GGCCUCUGAGGACUUGAGCU (SEQ ID NO:13).
[0080] In one embodiment, each genomic segment is present in a vector. In one embodiment, the sequence of a genomic segment in the vector is antigenomic, and in one embodiment the sequence of a genomic segment in the vector is genomic. As used herein, anti-genomic refers to a genomic segment that encodes a protein in the orientation opposite to the viral genome. For example, Pichinde virus is a negative-sense RNA virus. However, each genomic segment is ambisense, encoding proteins in both the positive-sense and negative-sense orientations. Anti-genomic refers to the positive-sense orientation, while genomic refers to the negative-sense orientation.
[0081] A vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a genomic segment, and construction of genomic segments including insertion of a polynucleotide encoding an antigen, employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989) or Ausubel, R. M., ed. Current Protocols in Molecular Biology (1994). A vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of an RNA encoded by the genomic segment, i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors. Typically, a vector is capable of replication in a prokaryotic cell and/or a eukaryotic cell. In one embodiment, the vector replicates in prokaryotic cells, and not in eukaryotic cells. In one embodiment, the vector is a plasmid.
[0082] Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like. Suitable host cells for cloning or expressing the vectors herein are prokaryote or eukaryotic cells.
[0083] An expression vector optionally includes regulatory sequences operably linked to the genomic segment. The term operably linked refers to a juxtaposition of components such that they are in a relationship permitting them to function in their intended manner. A regulatory sequence is operably linked to a genomic segment when it is joined in such a way that expression of the genomic segment is achieved under conditions compatible with the regulatory sequence. One regulatory sequence is a promoter, which acts as a regulatory signal that bind RNA polymerase to initiate transcription of the downstream (3 direction) genomic segment. The promoter used can be a constitutive or an inducible promoter. The invention is not limited by the use of any particular promoter, and a wide variety of promoters are known. In one embodiment, a T7 promoter is used. Another regulatory sequence is a transcription terminator located downstream of the genomic segment. Any transcription terminator that acts to stop transcription of the RNA polymerase that initiates transcription at the promoter may be used. In one embodiment, when the promoter is a T7 promoter, a T7 transcription terminator is also used. In one embodiment, a ribozyme is present to aid in processing an RNA molecule. A ribozyme may be present after the sequences encoding the genomic segment and before a transcription terminator. An example of a ribozyme is a hepatitis delta virus ribozyme. One example of a hepatitis delta virus ribozyme is 5 AGCTCTCCCTTAGCCATCCGAGTGGACGACGTCCTCCTTCGGATGCCCAGGTCGGAC CGCGAGGAGGTGGAGATGCCATGCCGACCC (SEQ ID NO:14).
[0084] Transcription of a genomic segment present in a vector results in an RNA molecule. When each of the three genomic segments is present in a cell the coding regions of the genomic segments are expressed and viral particles that contain one copy of each of the genomic segments are produced. The three genomic segments of the reverse genetics system described herein are based on Pichinde virus, an arenavirus with a segmented genome of two single-stranded ambisense RNAs. While the ability of the reverse genetics system to replicate and produce infectious virus typically requires the presence of the ambisense RNAs in a cell, the genomic segments described herein also include the complement thereof (i.e., complementary RNA), and the corresponding DNA sequences of the two RNA sequences.
[0085] The polynucleotide used to transform a host cell optionally includes one or more marker sequences, which typically encode a molecule that inactivates or otherwise detects or is detected by a compound in the growth medium. For example, the inclusion of a marker sequence can render the transformed cell resistant to an antibiotic, or it can confer compound-specific metabolism on the transformed cell. Examples of a marker sequence are sequences that confer resistance to kanamycin, ampicillin, chloramphenicol, tetracycline, and neomycin.
[0086] Also provided herein are compositions including a viral particle described herein, or the three genomic segments described herein. Such compositions typically include a pharmaceutically acceptable carrier. As used herein pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Additional active compounds can also be incorporated into the compositions.
[0087] A composition described herein may be referred to as a vaccine. The term vaccine as used herein refers to a composition that, upon administration to an animal, will increase the likelihood the recipient mounts an immune response to an antigen encoded by one of the genomic segments described herein.
[0088] A composition may be prepared by methods well known in the art of pharmaceutics. In general, a composition can be formulated to be compatible with its intended route of administration. Administration may be systemic or local. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, subcutaneous, intraperitoneal, intramuscular), enteral (e.g., oral), and topical (e.g., epicutaneous, inhalational, transmucosal) administration. Appropriate dosage forms for enteral administration of the compound of the present invention may include tablets, capsules or liquids. Appropriate dosage forms for parenteral administration may include intravenous administration. Appropriate dosage forms for topical administration may include nasal sprays, metered dose inhalers, dry-powder inhalers or by nebulization.
[0089] Solutions or suspensions can include the following components: a sterile diluent such as water for administration, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfate; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates; electrolytes, such as sodium ion, chloride ion, potassium ion, calcium ion, and magnesium ion, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A composition can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0090] Compositions can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, phosphate buffered saline (PBS), and the like. A composition is typically sterile and, when suitable for injectable use, should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0091] Sterile solutions can be prepared by incorporating the active compound (e.g., a viral particle described herein) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and any other appropriate ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterilized solution thereof.
[0092] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0093] For administration by inhalation, the active compounds are delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
[0094] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0095] The active compounds may be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.
[0096] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in an animal. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED.sub.50 (the dose therapeutically effective in 50% of the population) with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
[0097] The compositions can be administered once to result in an immune response, or one or more additional times as a booster to potentiate the immune response and increase the likelihood immunity to the antigen is long-lasting. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
[0098] Also provided herein are methods for using the genomic segments. In one embodiment, a method includes making an infectious viral particle. Such a method includes, but is not limited to, providing a cell that includes each of the three genomic segments described herein (a first genomic segment, a second genomic segment, and a third genomic segment) and incubating the cell under conditions suitable for generating full-length genomic RNA molecules of each genomic segment. The full-length genomic RNA of each genomic segment is antigenomic. Production of full-length genomic RNA molecules of each genomic segment results in transcription and translation of each viral gene product and amplification of the viral genome to generate infectious progeny virus particles. As used herein, an infectious virus particle refers to a virus particle that can interact with a suitable eukaryotic cell, such as a mammalian cell (e.g., a murine cell or a human cell) or an avian cell, to result in the introduction of the three genomic segments into the cell, and the transcription of the three genomic segments in the cell. The method may also include introducing into the cell vectors that encode the three genomic segments. Infectious virus particles are released into supernatants and may be isolated and amplified further by culturing on cells. The method may include isolating a viral particle from a cell or a mixture of cells and cellular debris. The method may include inactivating virus particles using standard methods, such a hydrogen peroxide treatment. Also provided is a viral particle, infectious or inactivated, that contains three genomic segments described herein.
[0099] In one embodiment, a method includes expression of an antigen in a cell. Such a method includes, but is not limited to, introducing into a cell the three genomic segments described herein. In one embodiment, the introducing is by introduction of a virus particle that is infectious or inactivated. The second and/or the third genomic segment may include a second coding region that encodes an antigen. The second and third genomic segments may encode the same antigen or they may encode different antigens. More than one type of virus particle may be administered. For instance, two populations of virus particles may be administered where each population encodes different antigens. In this embodiment, a single administration can result in expressing multiple antigens in a cell. The cell is a suitable eukaryotic cell, such as a mammalian cell (e.g., a murine cell or a human cell) or an avian cell. In one embodiment, the avian cell is a chicken embryonic fibroblast. The cell may be ex vivo or in vivo. The three genomic segments may be introduced by contacting a cell with an infectious virus particle that contains the three genomic segments, or by introducing into the cell vectors that include the genomic segments. The method further includes incubating the cell under conditions suitable for expression of the coding regions present on the three genomic segments, including the one or two second coding regions present on the second and/or third genomic segments. As used herein, ex vivo refers to a cell that has been removed from the body of an animal. Ex vivo cells include, for instance, primary cells (e.g., cells that have recently been removed from a subject and are capable of limited growth in tissue culture medium), and cultured cells (e.g., cells that are capable of long term culture in tissue culture medium). In vivo refers to cells that are within the body of a subject.
[0100] In one embodiment, a method includes immunizing an animal. Such a method includes, but is not limited to, administering to an animal a viral particle that is infectious or inactivated, that contains the three genomic segments described herein. The second and/or the third genomic segment may include a second coding region that encodes an antigen. The second and third genomic segments may encode the same antigen or they may encode different antigens. More than one type of virus particle may be administered. For instance, two populations of virus particles may be administered where each population encodes different antigens. In this embodiment, a single administration can result in vaccinating an animal against multiple pathogens. The animal may be any animal in need of immunization, including a vertebrate, such as a mammal or an avian. The animal can be, for instance, avian (including, for instance, chicken or turkey), bovine (including, for instance, a member of the species Bos taurus), caprine (including, for instance, goat), ovine (including, for instance, sheep), porcine (including, for instance, swine), bison (including, for instance, buffalo), a companion animal (including, for instance, cat, dog, and horse), members of the family Muridae (including, for instance, rat or mouse), Guinea pig, or human. In one embodiment, the animal may be an animal at risk of exposure to an infectious disease, such as a disease caused by or associated with a viral, prokaryotic, or eukaryotic pathogen. In one embodiment, the animal may be an animal in need of immunization against an antigen that is associated with non-infectious disease, such as cancer. For instance, the antigen may be one that helps an animal mount an immune response that targets and eliminates cancer cells. The immune response may be a humoral response (e.g., the immune response includes production of antibody in response to an antigen), a cellular response (e.g. the activation of phagocytes, antigen-specific cytotoxic T-lymphocytes, and the release of cytokines in response to an antigen), or a combination thereof.
[0101] In another embodiment, a method includes treating one or more symptoms of certain conditions in an animal. In one embodiment, a condition is caused by infection by a virus or a microbe. As used herein, the term infection refers to the presence of and multiplication of a virus or microbe in the body of a subject. The infection can be clinically inapparent, or result in symptoms associated with disease caused by the virus or microbe. The infection can be at an early stage, or at a late stage. In another embodiment, a condition is caused by a disease, such as cancer. As used herein, the term disease refers to any deviation from or interruption of the normal structure or function of a part, organ, or system, or combination thereof, of a subject that is manifested by a characteristic symptom or set of symptoms. The method includes administering an effective amount of a composition described herein to an animal having or at risk of having a condition, or symptoms of a condition, and determining whether at least one symptom of the condition is changed, preferably, reduced.
[0102] Treatment of symptoms associated with a condition can be prophylactic or, alternatively, can be initiated after the development of a condition. As used herein, the term symptom refers to objective evidence in a subject of a condition caused by infection by disease. Symptoms associated with conditions referred to herein and the evaluations of such symptoms are routine and known in the art. Treatment that is prophylactic, for instance, initiated before a subject manifests symptoms of a condition, is referred to herein as treatment of a subject that is at risk of developing the condition. Accordingly, administration of a composition can be performed before, during, or after the occurrence of the conditions described herein. Treatment initiated after the development of a condition may result in decreasing the severity of the symptoms of one of the conditions, or completely removing the symptoms. In this aspect of the invention, an effective amount is an amount effective to prevent the manifestation of symptoms of a condition, decrease the severity of the symptoms of a condition, and/or completely remove the symptoms.
[0103] Also provided herein is a kit for immunizing an animal. The kit includes viral particles as described herein, where the second and/or third genomic segments each independently include a coding region that encodes an antigen, in a suitable packaging material in an amount sufficient for at least one immunization. In one embodiment, the kit may include more than one type of viral particle, e.g., the kit may include one viral particle that encodes one or two antigens and a second viral particle that encodes one or two other antigens. Optionally, other reagents such as buffers and solutions needed to practice the invention are also included. Instructions for use of the packaged viral particles are also typically included.
[0104] As used herein, the phrase packaging material refers to one or more physical structures used to house the contents of the kit. The packaging material is constructed by known methods, preferably to provide a sterile, contaminant-free environment. The packaging material has a label which indicates that the viral particles can be used for immunizing an animal. In addition, the packaging material contains instructions indicating how the materials within the kit are employed to immunize an animal. As used herein, the term package refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits viral particles. Thus, for example, a package can be a glass vial used to contain an appropriate amount of viral particles. Instructions for use typically include a tangible expression describing the amount of viral particles, route of administration, and the like.
[0105] The term and/or means one or all of the listed elements or a combination of any two or more of the listed elements.
[0106] The words preferred and preferably refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.
[0107] The terms comprises and variations thereof do not have a limiting meaning where these terms appear in the description and claims.
[0108] Unless otherwise specified, a, an, the, and at least one are used interchangeably and mean one or more than one.
[0109] Also herein, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
[0110] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
[0111] The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.
[0112] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
EXAMPLE 1
[0113] An Arenavirus-Based Vaccine Vector Carrying Influenza Virus Antigens Confers Long-Term Protection of Mice Against Lethal Influenza Virus Challenge
[0114] Pichinde virus (PICV) is a non-pathogenic arenavirus that has been used as a model virus to study viral hemorrhagic fever infection. A reverse genetics system was previously developed to generate infectious PICV viruses from two plasmids that encode the viral large (L) and small (S) RNA segments (Lan et al., 2009, J Virol 83:6357-6362). In the current study, a second-generation reverse genetics system was created to produce recombinant infectious PICV viruses from 3 separate plasmids that are referred to as the tri-segmented PICV system. These recombinant viruses carry 3 viral genomic RNA segments that encode for all of the viral gene products as well as two foreign genes. This tri-segmented PICV system can be used as a novel vaccine vector to deliver the hemagglutination (HA) and the nucleoprotein (NP) of the influenza virus A/PR8 strain. Mice immunized with these recombinant viruses are protected against lethal influenza virus challenge as evidenced by the survival of the animals afforded by the high levels of HA neutralizing antibodies and NP-specific cytotoxic T lymphocyte (CTL) responses to viral infection. These tri-segmented recombinant PICV viruses do not induce strong anti-PICV vector immunity, thus making them ideal candidates in a prime-boost vaccination strategy in order to induce cross-reactive immunity. In summary, a novel live vaccine vector has been developed that can express multiple foreign antigens to induce strong humoral and cell-mediated immunity and little anti-vector immunity in vivo.
Introduction
[0115] We have developed the only available reverse-genetics system to generate infectious PICV viruses from plasmid transfection into appropriate mammalian cells (Lan et al., 2009, J Virol 83:6357-6362). This system consists of 2 plasmids to generate full-length genomic L and S RNAs from an engineered bacteriophage T7 regulatory (promoter/terminator) signals and the hepatitis delta ribozyme sequence located upstream and downstream of the PICV genomic sequences, respectively. When transfected into baby hamster's kidney epithelial cells that constitutively express the bacteriophage T7 RNA polymerase (BSRT7-5, a.k.a. BHK-T7), the L and S RNA segments of PICV are generated, from which all PICV viral gene products, including the L polymerase and NP nucleoprotein are transcribed and translated in order to amplify the viral genome and generate infectious progeny virus particles. Infectious PICV viruses are released into supernatants and are isolated and amplified further by culturing on African green-monkey epithelial (Vero) cells.
[0116] As described herein a second-generation reverse genetics system has been developed to produce recombinant infectious PICV viruses from 3 separate plasmids that are referred to as the tri-segmented PICV system. These recombinant viruses carry 3 viral genomic RNA segments that encode for all of the viral gene products as well as two foreign genes. This tri-segmented PICV system can be used as a novel vaccine vector to deliver other viral antigens, such as those of the influenza virus. Briefly summarized, tri-segmented PICV viruses expressing the hemagglutination (HA) or the nucleoprotein (NP) of the influenza virus A/PR8 strain have been produced, and these tri-segmented PICV vaccine vectors can induce strong humoral and cell-mediated immunity, such as a robust production of influenza-specific neutralizing antibodies and a strong influenza-specific cytotoxic T lymphocyte (CTL) response in vaccinated mice with little anti-PICV vector immunity, which makes them ideal candidates for the prime-boost vaccination strategy in order to induce long-lasting and cross-reactive immunity. Therefore, this novel PICV-based vaccine vector system described herein we have developed satisfies all required criteria of an ideal viral vector, such as safety, induction of strong and durable cellular and humoral immune responses, no pre-existing immunity and lack of anti-vector immunity.
Materials and Methods
[0117] Construction of Plasmids Encoding the Engineered Pichinde Virus P18 S RNA Segments with Multiple-Cloning-Sites (MCS) Replacing Either GPC or NP Gene.
[0118] A reverse genetics system for PICV was previously developed by transfection of 2 plasmids, encoding the L and S RNA segments in anti-genomic (ag) sense, into BHK-T7 cells (
Recovery of Recombinant Tri-Segmented Pichinde Viruses Expressing GFP, Influenza HA or NP.
[0120] Recombinant viruses were recovered from plasmids by transfecting BSRT7-5 (a.k.a. BHK-T7) cells with 3 plasmids expressing the full-length P18 L agRNA segment, a P18S segment with MCS in place of GPC (P18S-MCS/NP), and a P18S segment with GFP, HA, or NP gene in place of NP (P18S-GPC/GFP, P18S-GPC/N1, or P18S-GPC/NP) (
Detection of Influenza Antigen Expression in Cells Infected with Recombinant Tri-Segmented PICV Vectors.
[0121] BHK-21 cells grown on coverslips were infected with wild type Pichinde virus (PICV) or recombinant PICV viruses expressing either the influenza HA (rPICV-HA) or NP gene (rPICV-NP). After 24 hours of virus infection, cells were fixed with 4% paraformaldehyde for 15 mins at room temperature followed by 3 washes with phosphate buffer saline (PBS). Cells were then incubated in 0.1% Triton X-100 for 12 minutes followed by 1 hour incubation with primary antibody (mouse anti-NP influenza A). Cells were then washed and incubated with secondary antibody (anti mouse alexa flour-647) for 1 hour at room temperature.
Mouse Immunization and Challenge.
[0122] Six- to eight-week old female C57BL/6 mice were obtained from Charles River Laboratories and housed for at least 1 week for acclimatization. Mice were housed in microisolator cages in BSL-2 equipped animal facility. Mice were injected with 100,000 pfu of rPICV virus in 100 ul of total volume through intra-peritoneal route. After 14 days of last booster, mice were challenged intra-nasally with 10 LD.sub.50 (10,000 pfu) of the mouse-adapted influenza A/PR8 strain.
Analysis of Virus Specific CTL by Tetramer Staining.
[0123] Single-cell splenocytes were obtained and red blood cells (RBCs) were lysed using ACK lysis buffer. The splenocytes were then washed with FACS buffer (PBS+2% FBS) twice. Cells (110.sup.5) were stained with CD8-PerCP-Cy5.5, CD3-APC and H-2Db-PE tetramer with the NP.sub.366-374 epitope ASNENME (SEQ ID NO:7) for 1 hr at room temperature. After incubation, cells were washed with FACS buffer three times and the labeled cells were analyzed by flow cytometry. The FACS data was analyzed using FloJo software.
Hemagglutination Inhibition Assay.
[0124] Blood was collected after 14 days of each immunization and serum was harvested. Non-specific inhibitors were removed from the serum by an overnight treatment with 5 volumes of receptor destroying enzyme (Sigma), followed by 45 min incubation at 56 C. to inactivate the enzyme and serum. Each serum sample was then serially diluted in 25 ul of PBS and then mixed with an equal volume of PBS containing 4 HA units of A/PR8. After 15 min incubation at room temperature, 50 ul of 0.5% turkey RBC was added and the mixture was incubated for 1 hour at 4 C before evaluation of agglutination. The titre was recorded as the inverse of the last dilution that inhibited agglutination.
Determination of Virus Titers in the Lungs.
[0125] To evaluate the replication of influenza A/PR8 in mice, lungs were collected on day 6 of post challenge, weighed and homogenized in L15 media. Tissue homogenate was centrifuged at 10,000 rpm for 10 mins and virus was titrated in 12-well plate on monolayers of Madin-Darby canine kidney (MDCK) cells.
Results
1. Generation of Recombinant Tri-Segmented Pichinde Virus Expressing the GFP Reporter Gene.
[0126] A tri-segmented arenavirus system was first reported for LCMV by de la Torre group (Emonet et al., 2009,Proc Natl Acad Sci USA 106:3473-3478), which has generated infectious recombinant LCMV that packages 3 RNA segments, one full-length L segment, and two S segments with deletion in either GPC or NP. We have previously developed a reverse genetics system for the Pichinde virus (PICV) (Lan et al., 2009, J Virol 83:6357-6362), which is a prototypic arenavirus that is non-pathogenic in humans. This system consists of 2 plasmids expressing the L and S segments of PICV when they are transfected into the BSRT7-5 (a.k.a. BHKT7) cells (
[0127] In the current study, a second-generation of the PICV reverse genetic system has been generated that consists of 3 plasmids that produce two distinct S RNA segments, one carrying a deletion in GPC and the other S segment contains a deletion of the NP gene (
[0128] Virus growths of the bi- and tri-segmented PICVs was compared by performing the growth curve analysis of the rP2, rP18, and rP18tri-GFP on BHK-21 cells at the multiplicity of infection (moi) of 0.01. As expected, the known virulent rP18 virus grew slightly faster and better than rP2 by 0.5 log in virus titer. The tri-segmented rP18tri-GFP virus grew at a similar kinetic as the rP2 and rP18 viruses albeit at 1 to 1.5 log lowered virus titers (
[0129] In order to determine the stability of the rP18tri-GFP virus, that is to test whether in vitro culturing of the rP18tri-GFP virus will select for a bi-segmented wild-type virus revertant that have lost GFP gene due to genome recombination, the rP18tri-GFP was passaged in the BHK-21 cell cultures continuously, and conducted plaque assay at various passages to examine GFP expression in each of the plaques. At any tested passages (up to 23 passages), all plaques still expressed strong GFP reporter gene levels, suggesting that the GFP reporter gene could be stably maintained in the infectious viral particles even after extensive passages in cell culture.
2. Generation of Recombinant Tri-Segmented Pichinde Virus Expressing Influenza Virus Antigens.
[0130] HA and NP genes of the influenza virus A/PR8/H1N1 strain were molecularly cloned into the MSC of the P18 S2 plasmid, respectively (
[0131] All infected cells (i.e., plaques) were green under fluorescence microscopy as the recombinant viruses carried the GFP reporter gene on the P18S2-GFP segment (
3. The rP18Tri-Based Influenza Vaccines Induce Protective Immunity in Mice.
[0132] Previous work from our laboratory demonstrated that infection of mice with PICV even at high doses via different routes does not cause diseases as PICV is cleared by 4 days post infection (dpi) (data not shown). Here, we have examined whether rP18tri-based vaccine vectors can induce protective immunity in mice. C57BL6 mice were mock infected or infected intra-nasally (i.n.) with a low dose (50 pfu) of A/PR8 or via i.p. route with 110.sup.5 pfu of rP18tri-GFP, rP18tri-GFP/HA, and rP18tri-GFP/NP viruses, respectively. Mice were boosted twice with the same virus at the same dosage at day 14 and 28. Blood samples were collected at different time points post priming and post boosting for neutralizing antibody titer determination. Mice were challenged at 14 d after the 2.sup.nd boost with a known lethal dose of A/PR8 (10MLD50) and monitored for body weight and disease symptoms for up to 21 days. All challenged animals that have previously received PBS or rP18tri-GFP vaccination reached terminal points by 7 dpi, whereas all mice vaccinated with rP18tri-GFP/HA were completely protected from lethal influenza virus infection. Two out of three mice vaccinated with rP18tri-GFP/NP survived (
[0133] Taken together, these results suggest that the rP18tri-based vaccine vector can induce protective immunity from lethal influenza virus infection in mice. Consistent with previous influenza vaccine studies, HA vaccination can induce a complete protection from influenza virus-induced disease while NP vaccination normally leads to partial protection by reducing disease severity and controlling virus replication in vivo.
4. The rP18Tri-GFP/HA Vaccine Induces High Neutralizing Antibody Titers in Mice.
[0134] The hemagglutination inhibition (HAI) titers was measured in peripheral blood collected from vaccinated mice at different time points: 14 d post-prime, 7 d and 14 d post-1.sup.st boost, and 14 d post-2.sup.nd-boost (
[0135] HAI titers generated by different vaccination routes were compared (
5. The rP18Tri-GFP/NP Vaccine Induces Strong CTL Responses in Mice.
[0136] NP is an intracellular viral protein and is known to induce CD8+ T cell response against it. Whether the rP18tri-GFP/NP vaccine can induce CTL responses was examined by conducting NP-specific tetramer analysis of splenic cells and PBMCs at different time points after prime and boost with rP18tri-GFP/NP intraperitoneally. As shown in
6. Can rP18Tri-Based Vaccine Trigger Long-Lasting Immunity?
[0137] The potential of the rP18tri-GFP/HA vaccine vector to induce long lasting immunity was evaluated. C57BL6 mice were immunized twice at an interval of 4 wks and were challenged either 4 or 8 wks after second immunization with a lethal dose of the A/PR/8 (H1N1) virus. Serum samples analysed for HAI titres at days 14 and 30 post prime and days 30 and 60 post boost demonstrated a strong neutralizing antibody titer (
Single Immunization with rP18tri-GFP/HA Induced Protection Against Lethal H1N1 Challenge
[0138] C57BL6 mice were immunized with rP18triGFP-HA through intramuscular route. Remarkably, a single dose of rP18tri-GFP/HA induced complete protection against lethal infection with the mouse-adapted A/PR/8 (H1N1) virus. As shown in
Generation and Characterization of rP18Tri-Based Virus Expressing Dual Influenza Viral Protein Antigens
[0139] To obtain the rP18tri-based vector expressing influenza HA and NP or HA1 and HA3, DNA encoding the respective influenza virus genes was inserted into plasmid vectors P18S-GPC/MCS and P18S-MCS/NP accordingly. The RT-PCR amplified HAL NP and HA3 were cloned and each clone was sequence verified. The resulting plasmids were designated as P18S-GPC/HA1, P18S-NP1/NP and P18S-HA3/NP. The recombinant virus expressing dual antigens (influenza HA1 and NP1) was then rescued by co-transfecting 3 plasmids expressing the full-length P18 L agRNA segment, P18S-GPC/HA1 and P18S-NP1/NP. Simultaneously, a similar 3-segmented recombinant virus with swapped influenza genes was also generated by co-transfecting the full-length P18 L agRNA segment, P18S-GPC/NP1 and P18S-HAl/NP. Similarly, recombinant virus expressing dual antigens (influenza HA1 and HA3) was rescued by co-transfecting 3 plasmids expressing the full-length P18 L agRNA segment, P18S-GPC/HAland P18S-HA3/NP.
[0140] Interestingly, rP18tri-HANP had lower titres than rP18tri-NP/HA and formed smaller plaques in Vero cells (
rP18Tri-Based Vector Encoding Multiple Influenza Viral Protein Antigens (HA and NP) Induced Both Humoral and T Cell Responses in Immunized Mice.
[0141] rP18tri-based vector encoding both influenza viral HA and NP successfully induced potent humoral and T cell responses in mice that were immunized with 10.sup.4 pfu/ml of either the rP18tri-HA/NP or rP18tri-NP/HA vector. Peripheral blood and spleen of mice were used to monitor the levels of T cell responses to immunodominant NP336 epitope using an MEW class I tetramer. Anti-NP-specific CD8+ T cells were detected in peripheral blood and splenocytes of immunized mice. On day 7 post-immunization, mice had a significantly greater percentage of NP-specific T cells (
[0142] Taken altogether, the rtriP18-HA/NP vaccine elicited a stronger immune response in comparison to the rP18tri-NP/HA vaccine. The better levels of immune response of the rP18tri-HA/NP could be attributed to a higher expression level of the influenza viral antigens (
rP18Tri-Based Vector Encoding Multiple Influenza Antigens (HA1 and HA3) Induced Protection Against Dual Challenges
[0143] Different groups of C57BL6 female mice were immunized with two dosages of either the rtriP18-based vector vaccine encoding only HA of the H1-subtyped virus (rP18tri-HA1) or HA of the H3-subtyped (rP18tri-HA3) or both HA of the H1 subtype and the H3 subtype (rP18tri-HA1/HA3). The results indicated that the first dose of the rtriP18-based vector encoding HA1 and HA3 induced antibody responses to both the encoded influenza viral antigens as revealed by robust HI titres for PR8 and X31. The second dose of the vaccine further boosted the antibody response. Interestingly, the HI titres induced for PR8 (H1) and X31 (H3) by rP18tri encoding both HA1 and HA3 were comparable to that induced by the rtriP18-based vector encoding only HA1 or HA3 (
rP18Tri-Based Flu Vaccines do not Induce Anti-Vector Immunity.
[0144] A perceived weakness of live viral vector is the anti-vector immunity, which impairs the immune responses induced by the same vector and excludes its usage in a prime-boost vaccination strategy. PICV has little to no pre-existing immunity in general population (Trapido et al., 1971, Am J Trop Med Hyg 20:631-641). We determined the effect of anti-vector immunity against PICV vector by measuring the levels of antibody and CTL responses by prime-boost with the same vector. Surprisingly, we found no evidence for anti-vector immunity against rPICVtri vector. Shown in
Summary
[0145] A novel PICV reverse genetic system has been developed to generate tri-segmented recombinant PICV viruses that can encode up to two foreign genes of interest. These rP18tri-based recombinant viruses can express the influenza HA and/or NP genes along with the GFP reporter gene in target cells. When tested in mice, the rP18tri-GFP/HA virus can induce high levels of HA-specific neutralizing antibodies, while the rP18tri-GFP/NP virus can induce strong NP-specific CTL responses. In addition, the rP18tri-based vector expressing dual influenza viral antigens HA and NP successfully induced both humoral and T cell responses that conferred complete protection in immunized mice against a lethal challenge with the A/PR8. More importantly, the triP18- based vector expressing HA of two different influenza virus subtypes i.e PR8 (H1N1) and X31 (H3N2) conferred protection against both of the viral challenges, demonstrating the prowess and versatility of these novel vaccine vectors against pathogenic influenza viruses. It is also important to note that there is no pre-existing immunity against PICV vector and that animals immunized with the tri-segmented PICV viruses generate little anti-PICV vector immunity, making this an ideal vector vaccine platform for inducing potent, long-lasting and cross-reactive immunity upon repeated vaccination in the event that a prime-boost vaccination strategy is needed.
EXAMPLE 2
[0146] The Viological Role of NP Exoribonuclease in Arenavirus Infection In Vitro and In Vivo
[0147] Arenavirus NP RNase activity is important for type I interferon (IFN) suppression but its biological role(s) have not been well characterized. Recombinant Pichinde viruses with RNase catalytic mutations induced high levels of IFNs and grew poorly in IFN-competent cells, and, when infecting guinea pigs, stimulated strong IFN responses, failed to replicate productively, and generated wild-type revertants. Thus, the NP RNase activity is essential for the IFN suppression and establishing productive replication early in arenavirus infection.
[0148] Arenaviruses include several hemorrhagic fever (HF)-causing agents (e.g., Lassa virus-LASV), with limited preventative or therapeutic measures (McLay et al., 2013, Antiviral Res 97:81-92, McLay et al., 2014, J Gen Virol 95:1-15). Arenavirus pathogenesis is associated with high viremia and generalized immune suppression, the mechanism of which is poorly understood. It has been shown that viral NP can effectively mediate Type-I IFN suppression via its exoribonuclease (RNase) function (Jiang et al., 2013, J Biol Chem 288:16949-16959, Martinez-Sobrido et al., 2007, J Virol 81:12696-12703, Martinez-Sobrido et al., 2006, J Virol 80:9192-9199, Qi et al., 2010, Nature 468:779-783, Hastie et al., 2011, Proc Natl Acad Sci USA 108:2396-2401, Hastie et al., 2012, PLoS ONE 7:e44211). However, the role of the NP RNase activity in mediating host immune suppression in vivo has not been well characterized. In this study, Pichinde virus (PICV) infection of guinea pigs was used as a surrogate model of arenavirus hemorrhagic fevers (HFs) (Aronson et al., 1994, Am J Pathol 145:228-235, Lan et al., 2009, J Virol 83:6357-6362) to characterize the role of the NP RNase in viral infection and host IFN responses. Single alanine substitution at each of the RNase catalytic residues (D380A, E382A, D525A, H520A, and D457A) could abolish the NP ability to suppress Sendai virus-induced IFN activation by a luciferase (LUC) reporter assay (
[0149] Viral growth kinetics was determined in the IFN-deficient Vero cells and IFN-competent A549 cells at moi=0.01. All 5 mutants replicated well in Vero cells, reaching 10.sup.6 pfu/ml at 48 hpi, albeit at 0.5-1 log lower than the WT rP18 (
[0150] To compare viral virulence in vivo, we infected 6 Hartley outbred guinea pigs intraperitoneally with 110.sup.4 pfu of each virus as previously described (Lan et al., 2009, J Virol 83:6357-6362, Kumar et al., 2012, Virology 433:97-103, McLay et al., 2013, J Virol 87:6635-6643). All procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at University of Minnesota. Animals were monitored daily for body weight and disease signs for up to 18 days, and were euthanized when they reached the predetermined terminal points (moribund), such as more than 30% weight loss compared to a nomogram or rectal temperature below 38 C. in combination with continuing weight loss. As expected, all rP2-infected animals survived and cleared the virus, while rP18-infected animals developed early onset of fever, showed significantly decreased body weight starting at 7 dpi, and reached terminal points by 13 dpi (
TABLE-US-00001 TABLE 1 Guinea pigs infected with the respective recombinant PICVs. Recombinant Viremia.sup.1 PICV strains Disease (PFU/ml) Viral sequences.sup.2 rP2.sup.3 survived ND.sup.4 rP18 moribund 2.00E+06 moribund 5.80E+05 moribund 2.80E+05 moribund 1.80E+06 moribund 2.30E+05 moribund 8.00E+05 D380A moribund 5.00E+04 WT reversion moribund 3.10E+05 WT reversion moribund 3.30E+06 WT reversion moribund 1.60E+04 WT reversion moribund 5.00E+04 WT reversion survived ND E382A survived ND survived 2.13E+03 WT reversion survived ND survived 9.00E+02 WT reversion survived ND survived ND D525A moribund 7.50E+04 WT reversion moribund 6.25E+04 WT reversion moribund 1.75E+05 WT reversion moribund 1.40E+04 WT reversion moribund 2.40E+04 WT reversion moribund 2.10E+05 WT reversion H520A moribund 5.75E+05 WT reversion survived ND moribund 7.50E+05 WT reversion moribund ND moribund ND moribund ND D457A survived ND survived ND survived ND survived 6.20E+02 WT reversion moribund 5.50E+04 WT reversion moribund 1.10E+05 WT reversion .sup.1Virus titers in the blood collected at the time of euthanization when animals reached terminal points or at day 18 post infection. .sup.2Sequences of viruses isolated from animals at the time of euthanization when animals reached terminal points or at day 18 post infection. .sup.3All 6 animals in the rP2-infected group survived with no detectable viremia at day 18 post infection. .sup.4ND, not detectable by plaque assay
[0151] To examine the role(s) of RNase in early viral infection and host innate immune responses in infected animals, we monitored viral spread and quantified innate antiviral genes at 1 dpi and 3 dpi. At day 1, viruses were detected at low levels in the livers and spleens of rP18-infected animals and in the livers of some animals infected with rP2 and the RNase mutant viruses (
[0152] In summary, our study with recombinant PICV RNase mutants has not only confirmed the important role of NP RNase in type I IFNs suppression and viral replication in vitro, but also provided unequivocal evidence for its essential role in early innate immune suppression to allow establishment of a productive infection in vivo. Given that the NP RNase-dependent IFN suppression mechanism is conserved among arenaviruses (Jiang et al., 2013, J Biol Chem 288:16949-16959), our results can be extrapolated to other arenaviral pathogens and implicate NP RNase as an ideal target for antivirals development.
EXAMPLE 3
The Arenavirus-Based Vaccine Vector Delivers Two Antigens and Confers Immunity to each of the Antigens
[0153] 1. Generation of rP18tri Live Vaccine Vectors Expressing Dual Influenza Antigens HA and NP
[0154] Example 1 discloses a replication-competent tri-segmented rPICV system (rP18tri) and using this rP18tri vector to express either the influenza HA (abbreviated as H) or NP antigen (P), it was demonstrated that the vector can induce strong antibody and CTL responses in mice. To determine whether a single rP18tri virion particle can be used to deliver both HA and NP genes, S1 and S2 viral genomic RNA segments were generated to encode the influenza HA and NP genes, respectively. By using different combinations of plasmids in the transfection reactions, we have successfully generated live vaccine vectors, rP18tri-P/H and rP18tri-H/P, which encode HA and NP genes on different S segments as illustrated in
2. The HA/NP Dual Antigen Vaccine Vectors can Induce Protective Immunity in Mice.
[0155] To test the protective immunity of rP18tri-P/H and rP18tri-H/P live vectors in vivo, we immunized a group of mice (n>=3) with the rP18tri-G/G control vector, rP18tri-P/H, or rP18tri-H/P at 110.sup.4 pfu through the IM route, boosted with the same vectors 14 days later, and challenged with a lethal dose of the mouse-adapted A/PR8 influenza virus (10MLD.sub.50) 14 days after vaccination. All the control vector-immunized mice succumbed to the infection by day 6, while all mice receiving rP18tri-P/H or rP18tri-H/P survived the challenge without any disease signs or body weight loss (
3. The H1/H3 Dual Antigen Vector Induces Balanced HA Neutralizing Antibodies.
[0156] Whether two different HA subtypes can be used to induce neutralizing antibodies at equal efficiency was determined. Toward this end, we have cloned the H3 HA gene of the A/x31 (H3N2 subtype of the influenza virus) to the S2 segment and when transfected with the full-length L segment, and the S1 segment encoding the H1 HA of A/PR8, live rP18tri-H3/H1 vector can be generated (
4. Induction of Heterosubtypic Neutralizing Antibodies by a Prime-and-Boost Strategy with Different HA Subtypes
[0157] Recent studies have suggested that broadly neutralizing antibodies can be generated by prime-and-boost vaccinations or sequential infections (Wei et al., 2010, Science 329:1060-1064, Wei et al., 2012, Sci Transl Med 4:147ra114, Miller et al., 2013, Sci Transl Med 5:198ra107, Wrammert et al., 2011, J Exp Med 208:181-193, Krammer et al., 2012, J Virol 86:10302-10307, Miller et al., 2013, J Infect Dis 207:98-105, Margine et al., 2013, J Virol 87:4728-4737). As the rP18tri vector enhances immune responses upon a booster dose, whether it can induce cross-reactive immunity using a prime and boost strategy with different HA subtypes was tested. Toward this end, live rP18tri-P/H1 and rP18tri-P/H3 vectors were generated, each encoding A/PR8 NP, a conserved viral protein (see GenBank Accession number NP_040982.1) that is known to elicit T cell responses, together with either H1 (A/PR8) or H3 (31) HA (
5. The rP18Tri Vector can Induce Both Humoral and T Cell Responses Through Oral Route.
[0158] To determine whether the rP18tri vector can be conveniently given through oral route, C57BL6 mice were immunized with 110.sup.4 pfu of the rP18tri-G vector (n=3) or rP18tri-P/H (n=4) through oral gavage and boosted with the same vector 42 days later. The NP tetramer-positive effector T cells (CD8.sup.+CD44.sup.high) at 7 days post prime and post boost were measured by the established NP tetramer analysis. At 7 days post prime, two out of three tested mice from the rP18tri-P/H-immunized mice had NP.sup.+CD8.sup.+CD44.sup.high cells (1.24% and 0.55%) that were clearly higher than the background level seen in the vector-immunized mice (0.13% and 0.09%). The NP-specific effector cells increased significantly at 7 days post boost, ranging from 5.7 to 7.1% in all 4 immunized mice (
6. Inactivated rP18Tri Vector can Induce both Humoral and T Cell Responses.
[0159] Whether inactivated rP18tri vector can induce vaccine immunity was determined. Live or hydrogen peroxide-treated rP18tri-P/H vaccine vector (i.e., inactivated vaccine vector) was used to immunize mice in 2 doses at a 34-day interval. Neither neutralizing antibodies nor NP-specific T cells were detected immediately after prime (7 days post-prime, 7 dpp). However, high levels of NP-specific effector T cells were detected after a booster dose (7 days post-boost, 7 dpb) with the inactivated vaccine vector (
7. The rP18Tri Vector Induces Protective Immunity Against Virulent P18 Virus in a Guinea Pig Model.
[0160] WT P18 virus was obtained after serial passages of the Pichinde virus (PICV) in guinea pigs and causes a hemorrhagic fever-like disease in the animals, which has been used as a safe surrogate model for studying pathogenesis of Lassa fever virus infection in humans (Jahrling et al., 1981, Infect Immun 32:872-880, Aronson et al., 1994, Am J Pathol 145:228-235, Liang et al., 2009, Ann NY Acad Sci 1171 Suppl 1:E65-74). Compared to WT P18 virus, the tri-segmented rP18tri vectors grow at least 1 log lower in vitro. We also determined the virulence potential of the rP18tri-G vector in guinea pigs. Guinea pigs infected with 110.sup.4 pfu of rP18 virus developed early onset fever, rapidly lost weight after 7 days post-infection, and reached terminal points by day 14 (
[0161] Whether this non-pathogenic rP18tri vectors could induce protective immunity against a lethal rP18 challenge in guinea pigs was determined. Guinea pigs were injected with either phosphor buffer saline (PBS) to represent mock infection or with 110.sup.4 pfu of rP18tri-G through IP route and, 14 days later, challenged with a lethal dose of rP18 virus. PBS-immunized guinea pigs (n=3) soon developed fevers and lost body weight significantly and all animals reached predetermined terminal points by day 11 (
[0162] In summary, a novel Pichinde virus (PICV)-based live viral vector rP18tri was developed that packages 3 RNA segments and encodes 2 foreign protein antigens. The viral vector was attenuated in vitro and in vivo. Using influenza HA as a model antigen, rP18tri-G/H can induce long-lasting protective immunity in mice. The rP18tri vector can induce strong humoral responses in mice and in guinea pigs and high levels of virus-specific effector T cells. The rP18tri-vector-induced antibody and T cell responses were significantly increased by a booster vaccination and were at high levels even after four applications, a unique feature of this live viral vector that is ideal for a prime-and-boost vaccination strategy. The vector can be given via various routes including intramuscular (IM), intraperitoneal (IP), intranasal (IN), and oral. Priming and boosting with different HA proteins from different influenza virus strains induced heterosubtypic immunity, thus there is potential to develop universal flu vaccines. Chemically inactivated rP18tri-P/H induced both humoral and CTL responses after a boost dose. The rP18tri vector induced protective immunity against virulent rP18 virus, thus there is the potential for developing cross-reactive vaccines against other pathogenic arenaviruses such as Lassa fever virus, and dual (triple) vaccines against combinations of other pathogens.
[0163] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and/or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
[0164] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term about. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0165] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
[0166] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.