TISSUE SCAFFOLD

Abstract

There is provided a tissue scaffold and a method for making a tissue scaffold. The tissue scaffold comprises elastin and optionally fibrin and/or collagen. The elastin in the scaffold may be cross-linked. The elastin that is cross-linked preferably comprises solubilised elastin and is unfractionated.

Claims

1. A method for forming a tissue scaffold, comprising cross-linking a composition, the composition comprising elastin, wherein the elastin is unfractionated and comprises solubilised elastin.

2. A method according to claim 1, comprising a step of solubilising elastin.

3. A method for forming a tissue scaffold, comprising cross-linking a composition comprising unfractionated solubilised elastin.

4. A method according to claim 3, comprising a step of solubilising elastin to form the composition comprising unfractionated solubilised elastin.

5. A method according to any preceding claim, wherein the elastin is, or has been, solubilised by contacting with oxalic acid.

6. A method according to any preceding claim, wherein the elastin is, or has been, solubilised at a temperature less than 100 C.

7. A method according to claim 6, wherein the step of solubilising the elastin is, or has been, carried out at a temperature less than or equal to 50 C.

8. A method according to claim 7, wherein the step of solubilising the elastin is, or has been, carried out at a temperature of 15 to 30 C.

9. A method according to any preceding claim, wherein the composition that is cross-linked comprises insoluble elastin.

10. A method for forming a tissue scaffold, comprising cross-linking a composition, the composition comprising soluble elastin and insoluble elastin.

11. A method according to any preceding claim, wherein the composition that is cross-linked comprises collagen and/or fibrin.

12. A method according to claim 3 or claim 4, or any claim dependent on claim 3 or claim 4, comprising cross-linking a composition comprising unfractionated solubilised elastin and a) collagen and/or b) fibrin.

13. A method according to any of claims 11 to 12, wherein the collagen is in the form of a collagen hydrogel.

14. A method according to any of claims 11 to 13, wherein the fibrin is in the form of a fibrin gel.

15. A method according to any preceding claim, wherein the cross-linking comprises chemical cross-linking.

16. A method according to claim 15, wherein the cross-linking comprises contacting the composition with an aldehyde cross-linking agent.

17. A method according to claim 16, wherein the aldehyde cross-linking agent is glutaraldehyde.

18. A method according to any preceding claim, wherein the cross-linking is carried out at a temperature of 25 C. to 50 C.

19. A method according to any preceding claim, wherein the cross-linking takes place in the presence of CO.sub.2.

20. A method according to claim 19, wherein the cross-linking takes place in the presence of 2 to 10% CO.sub.2.

21. A method according to any preceding claim, wherein the cross-linking takes place from 1 to 24 hours.

22. A method according to claim 3 or claim 4, or any claim dependent on claim 3 or claim 4, comprising lyophilising the composition comprising cross-linked unfractionated solubilised elastin.

23. A method according to any preceding claim, wherein lyophilisation takes place following solubilisation and cross-linking.

24. A method of forming a tissue scaffold comprising lyophilising a composition comprising cross-linked elastin, optionally wherein the composition comprising cross-liked elastin has been formed by cross-linking a formulation comprising elastin that is unfractionated and comprises solubilised elastin.

25. A method according to claim 24, comprising lyophilising a composition comprising cross-linked, unfractionated, solubilised elastin.

26. A method according to any preceding claim, comprising washing to remove agents involved in solubilising and/or cross-linking.

27. A method according to claim 26 comprising lyophilisation and washing, wherein the washing takes place following lyophilisation.

28. A method according to claim 26 or claim 27, wherein the step of washing to remove agents involved in solubilising and/or cross-linking comprises washing with a reducing agent.

29. A method according to claim 28, wherein the reducing agent comprises sodium borohydride or agents with similar carbonyl group reactivity.

30. A method according to any of claims 26 to 29, wherein the step of washing to remove agents involved in solubilising and/or cross-linking is carried out for at least 5 hours, preferably at least 8 hours.

31. A method according to any preceding claim comprising sterilising the scaffold.

32. A method according to claim 31, comprising contacting the scaffold with ethanol.

33. A composition comprising a) elastin, a solubilising agent that is able to solubilise the elastin and a cross-linking agent, or b) elastin, and a cross-linking agent, wherein the elastin in the composition is unfractionated and comprises solubilised elastin.

34. A composition comprising unfractionated, solubilised elastin and a cross linking agent.

35. A composition according to claim 33 or claim 34 comprising collagen and/or fibrin.

36. A tissue scaffold obtained or obtainable by a method as disclosed in any of claims 1 to 32.

37. A tissue scaffold comprising cross-linked elastin, wherein the cross-linked elastin has been formed by cross-linking a composition comprising elastin that is unfractionated and comprises solubilised elastin.

38. A tissue scaffold comprising cross-linked unfractionated solubilised elastin.

39. A tissue scaffold comprising cross-linked elastin, wherein the cross-linked elastin has been formed by cross-linking a composition comprising soluble elastin and insoluble elastin

40. A tissue scaffold according to claim 37 wherein the cross-linked elastin has been formed by cross-linking a composition comprising insoluble elastin, or according to claim 38, wherein the tissue scaffold comprises insoluble elastin.

41. A tissue scaffold according to any of claims 37 to 40, comprising collagen and/or fibrin.

42. A tissue scaffold according to any of claims 37 to 41, which is lyophilised.

43. A tissue scaffold according to any of claims 37 to 44 which is sterile.

44. A method for promoting tissue regeneration, tissue healing or tissue repair comprising applying a tissue scaffold according to any of claims 36 to 43, to a patient in need thereof.

45. A method according to claim 44, wherein the method is for promoting soft tissue regeneration or repair.

46. A tissue scaffold according to any of claims 36 to 43, for use in promoting tissue regeneration, tissue healing or tissue repair.

47. The tissue scaffold for use according to claim 46, for promoting soft tissue repair.

48. A method for solubilising elastin, comprising contacting elastin with oxalic acid at a temperature less than 100 C.

49. A method according to claim 48, comprising contacting elastin with oxalic acid at a temperature less than 50 C., preferably at a temperature of 15 to 30 C.

50. A method according to claim 48 or claim 49, wherein the elastin is contacted with the acid for 5 minutes or less, preferably from 1 to 3 minutes.

51. A method for solubilising elastin comprising contacting elastin with oxalic acid for 5 minutes or less.

52. A method according to claim 51, wherein the elastin is contacted with oxalic acid at a temperature less than 100 C.

53. A method according to claim 52, comprising contacting elastin with oxalic acid at a temperature less than 50 C., preferably at a temperature of 15 to 30 C.

54. A method according to any of claims 48 to 53, wherein the oxalic acid is 0.2M to 1M.

55. A composition obtained or obtainable from a method according to any of claims 48 to 54.

56. A method comprising cross-linking a composition as defined in claim 55.

57. A tissue scaffold comprising i) elastin; and ii) collagen and/or fibrin, wherein the elastin is cross-linked.

58. A tissue scaffold according to claim 56, wherein the collagen and/or fibrin is cross-linked.

59. A tissue scaffold according to claim 57 or claim 58, wherein the elastin comprises solubilised elastin.

60. A tissue scaffold according to any of claims 57 to 59, wherein the elastin comprises insoluble elastin.

61. A tissue scaffold according to any of claims 57 to 60, wherein the elastin is unfractionated.

62. A composition comprising i) elastin, ii) a cross-linking agent; and iii) fibrin and/or collagen.

63. A composition according to claim 61, wherein the elastin comprises solubilised elastin.

64. A composition according to any of claims 62 to 63, wherein the elastin is unfractionated elastin.

65. A composition according to any of claims 62 to 64, comprising a solubilising agent for solubilising elastin.

66. A method comprising cross-linking a composition comprising i) elastin, and ii) collagen and/or fibrin.

67. A method according to claim 66, wherein the elastin is unfractionated.

68. A method according to claim 66 or claim 67, wherein the elastin comprises solubilised elastin.

69. A method according to any of claims 66 to 68, wherein the elastin comprises insoluble elastin.

70. A tissue scaffold according to any of claims 57 to 60 for use in promoting tissue healing, regeneration or repair.

71. A method for promoting tissue regeneration, tissue healing or tissue repair comprising applying a tissue scaffold according to any of claims 57 to 61, to a patient in need thereof.

72. A tissue scaffold according to any of claims 36 to 43 or 57 to 61, seeded with cells.

73. A method comprising seeding a scaffold with cells, wherein the scaffold is as defined in any of claims 36 to 43 or 57 to 61.

74. A cell or tissue culture comprising a scaffold, wherein the scaffold is as defined in any of claims 36 to 43 or 57 to 61

Description

[0120] Examples of the invention are now described by way of example only, with reference to the accompanying drawings, in which:

[0121] FIG. 1 shows elastin scaffold fabrication process from insoluble elastin (A), mixed with 0.5M oxalic acid (B), crosslinked with 1% GTA and incubated at 37 C. for 1 hour (C), frozen at 80 C. overnight (D), and lyophilised for 48 hours (E);

[0122] FIG. 1 shows scaffolds fabricated without crosslinking agent (A), or with cross-linking agent (B);

[0123] FIG. 2 shows a scaffold stabilisation study without crosslinking agent (A), and with crosslinking agent (B) after 28 days in PBS;

[0124] FIG. 3 shows a live/dead assay at 1(A), 3 (B) and 7 (C) days for adipose derived stem cells (ADSC) growing on the scaffolds, with green points indicating alive cells;

[0125] FIG. 4 shows a cell proliferation assay using alamar blue at 1, 3 and 7 days;

[0126] FIG. 6 shows scanning electron microscopy (SEM) images of elastin scaffolds;

[0127] FIG. 7 shows live/dead assay on days 1, 3 and 7 for different combination scaffolds (3A=Collagen/Elastin/Fibrin 2:1:1; 3B=Elastin/Collagen/Fibrin 2:1:1; 3C=Fibrin! Collagen/Elastin 2:1:1; 3D=Fibrin! Collagen/Elastin 1:1:1);

[0128] FIG. 8 shows a cell proliferation assay (alamar blue activity) for combination scaffolds (3A=Collagen/Elastin/Fibrin 2:1:1; 3B=Elastin! Collagen/Fibrin 2:1:1; 3C=Fibrin/Collagen/Elastin 2:1:1; 3D=Fibrin! Collagen/Elastin; 1:1:1);

[0129] FIG. 9 shows SEM Images illustrating differences in fibril network and pore structure of each individual combination, A) 3A=Collagen! Elastin/Fibrin 2:1:1, B) 3B=Elastin! Collagen/Fibrin 2:1:1, C) 3C=Fibrin/Collagen/Elastin 2:1:1, D) 3D=Fibrin/Collagen/Elastin 1:1:1;

[0130] FIG. 10 shows wettability of elastin scaffolds at 0 seconds (A), 4 seconds (B), 9 seconds (C) and water contact angle measurement per second (D);

[0131] FIG. 11 shows water contact angle measurements per second for elastin-based scaffolds;

[0132] FIG. 12 shows an accelerated degradation profile of an elastin scaffold over a period of time;

[0133] FIG. 13 shows accelerated degradation profiles of elastin-based composite scaffolds;

[0134] FIG. 14 shows SEM images of elastin scaffolds (50 and 1000) and pore % from 0-120+m;

[0135] FIG. 15 shows pore size pattern for elastin-based composite scaffolds;

[0136] FIG. 16 shows mechanical testing of anelastin scaffold: pre-test scaffold (A), post-test scaffold (B), stress distribution on the scaffold (C) and break strength of the elastin scaffold (D) (*** denotes the statistical significance of p<0.0001);

[0137] FIG. 17 shows mechanical properties for elastin-based composite scaffolds;

[0138] FIG. 18 shows developing chorio-allantoic membrane (CAM) on an elastin scaffold on embryonic day (ED) 12 (A), total vascular area (B), the processed image for CAM analysis (C) and a number of bifurcation points (D);

[0139] FIG. 19 shows Vascular area (%) for elastin-based composite scaffolds;

[0140] FIG. 20 shows a gene expression profile of an elastin scaffold;

[0141] FIG. 21 shows gene expression profiles for elastin-based composite scaffolds;

[0142] FIG. 22 shows the difference in swelling ratio between Elastin/Collagen and Elastin/Fibrin scaffolds;

[0143] FIG. 23 shows the difference in degradation profiles between Elastin/Collagen and Elastin/Fibrin scaffolds;

[0144] FIG. 24 shows the microstructure of Elastin/Collagen and Elastin/Fibrin scaffolds using SEM;

[0145] FIG. 25 shows the pore size of distribution of Elastin/Collagen and Elastin/Fibrin scaffolds;

[0146] FIG. 26 shows the results of a live/dead assay for Elastin/Collagen and Elastin/Fibrin scaffolds; and

[0147] FIG. 27 shows the vascular area for Elastin/Collagen and Elastin/Fibrin scaffolds at day 12.

EXAMPLE 1ELASTIN SCAFFOLDS

Fabrication Method and Materials

[0148] Insoluble elastin powder was obtained from Sigma (the source of elastin was derived from bovine neck ligament) (FIG. 1A). 100 mg of insoluble elastin powder was mixed with 1 ml of 0.5M oxalic acid (C.sub.2H.sub.2O.sub.4) (freshly prepared) at room temperature (FIG. 1B).

[0149] To cross-link the protein, a homobifunctional cross-linking agent, 1% glutaraldehyde (GTA) (v/v), was added to the solution (FIG. 1C). The solution was cast in a well of a 24 well plate and incubated at 37 C. with 5% CO.sub.2 for one hour (FIG. 1C).

[0150] The mixture was frozen at 80 C. overnight (FIG. 1D) and lyophilised for 48 hours to form a scaffold (FIG. 1E).

[0151] The fabricated scaffold was brought to room temperature and washed with 0.1M Glycine buffer at pH=10.4 with 2 washes of 15 minutes each and washed with tris-glycine buffer for 15 minutes. To remove excess of oxalic acid and unbound glutaraldehyde, scaffolds were washed with 0.1% w/v sodium boro-hydride (NaBH.sub.4) a reducing agent for approximately 8 hours on a shaker.

[0152] Subsequently, scaffolds were washed with distilled warm water (60 C.) for 15 minutes and two washes of distilled water for 30 minutes each to remove remaining unbound glutaraldehyde from the scaffold.

[0153] For sterilisation, scaffolds were washed with 70% ethanol for 15 minutes and then with PBS.

Structural Integrity and Stability

[0154] The fabricated crosslinked elastin scaffold was intact (FIG. 2B). However, the non-crosslinked scaffold was dismantled/disintegrated (FIG. 2A).

[0155] An in vitro scaffold stabilisation study was carried out by comparing scaffolds with and without cross-linking for 28 days in PBS at 37 C. and 5% CO.sub.2. It was found that non-crosslinked scaffolds (FIG. 3A) were dismantled/disintegrated after 28 days in PBS and in contrast crosslinked scaffolds were intact (FIG. 3B). This indicates that this method of fabrication effectively produced an integral scaffold,

Biological Activity

[0156] To evaluate the efficacy and biological activity of the scaffolds, adipose-derived stem cells (ADSCs) were cultured under standard culture conditions i.e. incubation at 37 C. with 5% CO.sub.2 in MesenPRO RS basal cell culture medium (ThermoFisher, UK) supplemented with 2% MesenPRO RS growth supplement (ThermoFisher, UK) and 1% penicillin/streptomycin (Sigma-Aldrich, UK). 50000 cells were seeded on 6 mm diameter scaffolds and cultured for 1, 3 and 7 days. Cell survival and proliferation were studied using live/dead and alamar blue assays respectively. ADSCs were alive and adhered to the scaffold by day 1 and exhibited non-aggregated morphology on days 3 and 7 (FIG. 4). Additionally, cells maintained their non-aggregated behavior and demonstrated spindle morphological structure (FIG. 4) suggesting they retain their stem characteristics during the culture period.

[0157] Cell proliferation was quantitatively measured by alamar blue activity, a cell metabolic assay, and the absorbance at 570 nm was measured using a spectrophotometer at days 1, 3, and 7 (n=3 per time point) (FIG. 5).

Scanning Electron Microscopy

[0158] Elastin scaffolds were washed with distilled water in an ultra-sonic cleaner for 3 minutes to remove salts and dried for 24 hours in a lyophiliser. Scaffolds were mounted on stubs and sputter-coated with carbon under vacuum. All images were obtained using a secondary electron detector in a Philips XL 30 Field Emission SEM, operated at 5 kV and average working distance was 10 mm.

[0159] The SEM images in FIGS. 6A and 6B show that elastin scaffolds have an homogeneous structure and are porous in nature. FIG. 6A is at 50 magnification and FIG. 2 is at 250 magnification.

Discussion

[0160] This is a very cost-effective and time-efficient way to fabricate elastin scaffolds because, as of the priority date of this application, 5 mg of insoluble elastin from bovine neck ligament cost 69.70 GBP (E1625) whereas 1 mg of soluble -elastin costs 272.50 GBP (E6527) from Sigma as the commercial supplier.

[0161] The live/dead assay results showed that cells maintained their spindle morphological structure which is one of the characteristics of ADSCs. Since ADSC have contact inhibition behavior (Majd et al., 2011) by using an elastin scaffold within the scope of the invention, the inventors were able to maintain contact inhibition behavior up to day 7 (FIG. 4). This cell morphology can maintain ADSCs phenotype and multipotent characteristics without undergoing any differentiation (Zhang and Kilian, 2013). An increase in the alamar blue absorbance is an indication of constant cell proliferation. These results also show that the fabricated scaffold was non-toxic to the cells.

EXAMPLE 2ELASTIN/COLLAGEN/FIBRIN SCAFFOLDS

Fabrication Method and Materials

[0162] Tube 1: Elastin powder (9.7% w/v)+0.5M oxalic acid+3% glutaraldehyde (w/v).

[0163] Tube 2: Collagen hydrogelprepared using 80% rat tail collagen type I (v/v) (First Link, Birmingham, UK) and 10% of 10 Minimal Essential Medium (Invitrogen, Paisley, UK), neutralised using 5M and 1M sodium hydroxide (Sigma-Aldrich, Dorset, UK) and added 10 DMEM.

[0164] Tube 3: Fibrin gelprepared with 2% fibrinogen (w/v) dissolved in 1 ml of PBS and for fibrillogenesis, 1% thrombin (w/v) was added along with 0.1M CaCl.sub.2

[0165] Tubes 1 to 3 were mixed in varying ratios, cast and then incubated at 37 C. with 5% CO.sub.2 for 1 hour. The final volume after mixing the 3 tubes was always 1 ml, which was then cast. [0166] For scaffolds that were 21:1 (collagen/elastin/fibrin), 500 l of Tube 2 were mixed with 250 l of Tube 1 and 250 l of Tube 3 (Also referred to herein as scaffold 3A). [0167] For scaffolds that were 2:1:1 (elastin/collagen/fibrin), 500 l of Tube 1 was mixed with 250 l of Tube 2 and 250 l of Tube 3 (Also referred to herein as scaffold 3B). [0168] For scaffolds that were 2:1:1 (fibrin/elastin/collagen), 500 l of Tube 3 were mixed with 250 l of Tube 1 and 250 l of Tube 2 (Also referred to herein as scaffold 3C). For scaffolds that were 1:1:1, 333.3 l of each tube were mixed and cast (Also referred to herein as scaffold 3D).

[0169] The mixture was freeze-dried for 48 hours.

[0170] Washing: First, a wash for 15 minutes with tris-glycine buffer. Second, to remove excess and unbound glutaraldehyde, scaffolds were washed with 0.1% sodium boro-hydride (NaBH.sub.4) a reducing agent for approximately 8 hours on a shaker.

Biocompatibility

[0171] To evaluate biocompatibility of each combination scaffold, 50000 adipose derived stem cells (ADSC) were seeded per scaffold and cultured up to 7 days. Cell survival and proliferation at 1, 3 and 7 days after seeding were studied using live/dead and alamar blue assays respectively.

[0172] As an example, results for the three-component scaffolds show that ADSC were alive and adhered to the scaffold (FIG. 7) and were proliferating until day 7 (FIG. 8). The same results were observed in two-component scaffolds (i.e. scaffolds comprising elastin and collagen, or elastin and fibrin).

Microstructure

[0173] Microstructure of each scaffold was studied using SEM. Results for three-component scaffolds (FIG. 9) showed that each scaffold combination has a unique ultrastructural fibril network and pore size. Similar observations were made for two-component scaffolds. This variation in the structure could alter ADSC behaviour and differentiation as well as biomechanical properties of the scaffolds (See Ghasemi-Mobarakeh et al (2015)).

EXAMPLE 3WATER CONTACT ANGLE (WCA)

[0174] The wettability of the elastin scaffold was investigated by developing an experimental setup and a 30 L distilled water droplet was dispensed onto each scaffold and several images were taken over the time interval between 0 to 5 seconds. The time at 0 seconds was considered the initial time of contact with a liquid medium (water). The WCA was calculated using Young's equation and the angle was measured from the water-scaffold interface to the line tangent and perimeter of the water droplet (Fu et al (2014)). The calculated WCA is a demonstration of water-material interaction.

[0175] The calculated WCA for elastin at 0 seconds was 1027.75 and it was reduced to 73.885.90 at 4 seconds. Over the time WCA continued to decrease over time and at reached 0 at 9 seconds which indicated complete wettability of the elastin scaffold (FIG. 10).

[0176] However, by combining elastin with other natural polymers such as fibrin and collagen at different ratios the WCA for 3A (68.183.38 at 0 seconds to 0 at 3 seconds), 3C (67.464.51 at 0 seconds to 0 at 4 seconds) was altered and showed complete wettability by 4 seconds. Interestingly WCA for 3B (112.345.37 at 0 seconds to 99.3214.55 at 10 seconds) and 3D (120.185.36 at 0 seconds to 113.238.93 at 10 seconds) (FIG. 11) did not show complete wettability even at 10 seconds making them hydrophobic as for any material >90 is considered to be hydrophobic therefore elastin, 3A and 3C scaffolds demonstrated hydrophilic nature and showed high cohesion towards water and gained complete wettability by 9 seconds. but scaffolds 3B and 3D showed to hydrophilic nature with low cohesion towards the water.

EXAMPLE 4ACCELERATED TRYPSIN DEGRADATION

[0177] To measure the stability of scaffolds, an accelerated degradation profile was carried out by using 1 trypsin. An initial weight of scaffolds was measured using XS205 Mettler Toledo digital scale. The scaffolds were placed in 24 well-plate with 1 trypsin and incubated at 37 C. and with 5% CO.sub.2. At each time point, scaffolds were washed with distilled water and lyophilised and weight was measured.

[0178] A net change in the weight was measured as a parameter of the degradation. In vitro accelerated degradation results indicated that elastin scaffold degraded from day 1 (136.0611.90 mg). By the day 5, there was 25% decrease in the weight and this trend continued and by day 42 there was 70% degradation of the scaffold (FIG. 12).

[0179] The degradation profile for the elastin-based co-polymers was identical for 3A, 3C and 3D. By day 7 almost 40% scaffolds were degraded this pattern was continued until day 42 where almost 70% of scaffolds were degraded. However, 3B, which has 50% of elastin, was the most stable scaffold with 55% degradation until day 42 (FIG. 13). This shows that different degradation pattern of elastin-based scaffolds can be used for various tissue engineering application depending upon regenerative properties of each tissue type.

EXAMPLE 5STRUCTURAL PROPERTIES

[0180] To measure pore size range and porosity, all SEM images were quantitively analysed using ImageJ bundled with 64-bit Java 1.6.0 (NIH, USA). A threshold function was used to visualise all pores in the scaffold. Additionally, friction area, particle analysis function was used.

[0181] Calculated pore size percentages for the scaffolds were in the range of 0-120+m and 28% pores were in the range of 0-19 m, 48% pores in the range of 20-79 m and remaining 24% in the range of 80-120+m (FIG. 14) and total porosity of scaffold was 48%.

[0182] When elastin was combined with other polymers, 70% pores were present in the 0-59 and remaining 50% in the range of 60-120+m in 3A. In 3B, the majority of pores (65%) were in the range of 20-59 m but in 3C pore pattern was uniform and 55% pores were in the range of 20-59 m. However, in 3D 75% pores were in the 0-59 m range (FIG. 15).

[0183] Pore and porosity play a vital role in the angiogenesis and diffusion of nutrients. The results suggest that elastin-based scaffolds could be used for various tissue engineering applications.

EXAMPLE 6MECHANICAL PROPERTIES

[0184] The elastin scaffold was tested to failure using bi-axial BioTester (CellScale Biomaterials Testing, Canada). The system includes 2 high-performance actuators with temperature-controlled media bath to avoid scaffold drying while testing cell-seeded scaffolds. To analyse real-time stress distribution, a time synchronised high-resolution CCD camera for the acquisition and processing of the test results was used.

[0185] The wet mechanical properties of elastin scaffold at day 0 was 1541 mN and after seeding hADSC cells for 28 days the strength of the scaffold significantly (p<0.0001) increased to 185.51.5 mN (FIG. 16). This demonstrates that cells seeded in the scaffolds add to the mechanical integrity of scaffold by tissue remodelling mechanism,

[0186] The calculated break strength for the 3A 74.333.78 mN, 119.3333.12 nN for 3B, 103.3420.23 mN for 3C and 71.684.72 mN for 3D. This demonstrates that after adding another co-polymer the mechanical properties of elastin decrease. It is believed that this is due to the non-fibril arrangement of the polymers (Lake et al. (2012)).

EXAMPLE 7ANGIOGENESIS

[0187] Pathogen-free fertilised eggs were obtained from a commercial supplier and incubated for 3 days at 38 C. with 40-45% humidity. On an, embryonic day (ED), 3 (ED 3) ex ovo glass bowl set-up was constructed to grow the embryonic culture and maintained at 37.5 C. with 3% CO.sub.2 and an average humidity in the range of 80-85% (3). At ED 9 elastin scaffold were placed on the developing chorio-allantoic membrane (CAM) to allow infiltration of blood vessels and at ED 12 embryos were euthanised as per home office guideline, and scaffolds were excised and fixed in 4% glutaraldehyde and analysed.

[0188] A total calculated vascular area for ED 10 was 4.782.12% and this vascular area increased to 6.013.34% at ED 11 although this increment was not statistically significant but developed two large vessels with a number of capillary plexus. This trend continues to follow on ED 12 with the calculated vascular area was 8.342.67% (FIG. 18).

[0189] When elastin was combined with fibrin and collagen, in different ratios, then there was an increase in the total vascular area % by day 12. The calculated % vascular area was 12.970.61% for 3A, 11.331.52% for 3B, 14.410.67% for 3C and 16.520.57 for 3D (FIG. 19). Therefore, it appears beneficial to use a combination of polymers to enhance angiogenetic properties of elastin. A CAM assay acted as ex vivo bioreactor to understand vascular invasion into the elastin-based scaffolds. In view that scaffolds have pore distribution in the range of 0 m-120+m which act as a pro-angiogenetic material for blood vessels infiltration.

EXAMPLE 8CELLULAR DIFFERENTIATION

[0190] To understand human adipose-derived cells (hADSCs) differentiation pathway on the elastin scaffold, a total 510.sup.5/mm.sup.3 hADSC of passage 4 seeded on scaffolds. RNA was isolated by using TRIzol (Invitrogen, Paisley, UK) method on day 1, 7 14 and total RNA yield was quantified by using spectrophotometer (Spectronic Camspec Ltd, Garforth, UK). cDNA synthesis was carried out using Precision nanoscript 2 reverse transcription kit (Primer Design, Southampton, UK) and quantitative PCR was performed with custom designed and synthesised primers (Table 1) (Primer Design, Southampton, UK).

TABLE-US-00002 TABLE1 Forwardandreverseprimers Name of gene Forwardprimer Reverseprimer MYOD1 CGCCTGAGCAAAGTAAATGAG GCCCTCGATATAGCGGATG (SEQID:1) (SEQID:2) PPARG GAATAAAGATGGGGTTCTCAT AACTTCAGCAAACTCAAACTT ATCC(SEQID:3) (SEQID:4) CEBPA CGGCAACTCTAGTATTTAGGA CAAATAAAATGACAAGGCAC TAAC(SEQID:5) GATT(SEQID:6) RUNX2 TTCTCCCCTTTTCCCACTGA CAAACGCAATCACTATCTAT (SEQID:7) ACCAT(SEQID:8) SOX9 GGACCAGTACCCGCACTTG AATCCGGGTGGTCCTTCTTG (SEQID:9) (SEQID:10) OCT4 CACTAAGGAAGGAATTGGGA GGGATTAAAATCAAGAGCAT ACA(SEQID:11) CATTG(SEQID:12) REX1 CGTTTCGTGTCCCTTTCA CCTCTTGTTCATTCTTGTTCGT (SEQID:13) ATT(SEQID:14)

[0191] Gene expression of and mesenchymal lineage-specific differentiation markers Adipogenic (CEBPA and PPARG), Osteogenic (RUNX2), Myogenic (MYOD1), Chondrogenic (SOX9) and MSC markers (OCT4 and REX1) were studied in hADSCs.

[0192] Differentiation profile of hADSC on the elastin scaffold. OCT4, CEBPA, PPARG and MYOD1 showed an identical trend of significant upregulation by 0.03-0.04 units on day 7 and 14 in comparison to day 1 (p<0.0001). However, there was no significant upregulation on day 14 in comparison to day 7. RUNX2 did not show any trend. SOX9 exhibited negligible expression (<0.027) at all three-time points identical to all the other scaffolds reported above, although it showed a significant upregulation on day 14 (0.025, p<0.05) in comparison to day 1 (0.027). REX1 exhibited an initial downregulation on day 7 (0.036 to 0.028, p<0.0001), followed by a significant upregulation trend on day 14 (0.031, p<0.0001) (FIG. 20).

[0193] In 3A, Oct-4 shows significant downregulation on day 7 and 14 (0.028, p<0.0001) from day 1 (0.031). Rex-1 downregulated significantly on day 7 (0.026, p<0.0001) and 14 (0.029, p<0.0001) in comparison to day 1 (0.031). However, expression on day 14 was significantly higher than day 7 (p<0.0001), whereas MyoD-1 was constant at 0.032. CEBP showed a marginal upregulation on day 7 (p<0.05) and significantly downregulated to 0.025 on day 14 (p<0.0001). In 3B, Oct-4, RUX-2 and CEBP showed significant downregulation on day 7 and 14 (p<0.0001) in comparison and there was no significant difference between expression on day 7 and 14. In 3C, Oct-4 showed a steady and significant downregulation from 0.030 on day to 0.029 on day 14 (p<0.001). Rex-1 and RUNX-2 downregulated significantly (p<0.0001) from 0.032 on day 1 to 0.030 and 0.029 respectively on day 7. In 3D, Oct-4, CEBP, PPAR-gamma and MyoD-1 showed identical trend of significant downregulation by 0.04-0.06 units on day 7 and 14 in comparison to day 1 (p<0.0001)

EXAMPLE 9BINARY ELASTIN-BASED SCAFFOLDS

[0194] Elastin/Collagen1:1 ratio [0195] Elastin/Fibrin1:1 ratio

[0196] The elastin, collagen and fibrin were prepared as shown in Example 2. [0197] Swelling ratio

[0198] FIG. 22 shows the difference in swelling ratio between Elastin/Collagen and Elastin/Fibrin scaffolds. Swelling ratio is an indication of the interaction between a solvent and a polymer. It shows exchange of the affinity and enthalpy between two phases. The higher the crosslinking density inside a polymer then the lower the swelling property, and vice-versa. The swelling ratio (SR) of the elastin and its composites was measured from dry mass and wet mass with the following equation

[00001]$\begin{array}{cc}\mathrm{SR}=\frac{M_w-M_d}{M_w}& \left(1\right)\end{array}$

where M.sub.d is the dry weight of the scaffold and M.sub.w is the wet weight of the scaffold. A wet mass of the scaffold was measured by immersing into 2 ml of distilled water. Dry and wet mass measured with the digital scale (XS205 Mettler Toledo) and the SR was calculated using equation (1) [0199] Degradation

[0200] FIG. 23 shows the difference in degradation profiles between Elastin/Collagen and Elastin/Fibrin scaffolds. The experimental protocol was the same as described in Example 4. [0201] Microstructure

[0202] FIG. 24 shows the microstructure of Elastin/Collagen (A) and Elastin/Fibrin (B) scaffolds using SEM. [0203] Pore size distribution

[0204] FIG. 25 shows the pore size of distribution of Elastin/Collagen and Elastin/Fibrin scaffolds. [0205] Biological activity

[0206] FIG. 26 shows the results of a live/dead assay for Elastin/Collagen and Elastin/Fibrin scaffolds. The experimental protocol was the same as described in Example 1. [0207] Angiogenesis

[0208] FIG. 27 shows the vascular area for Elastin/Collagen and Elastin/Fibrin scaffolds at day 12. The experimental protocol was the same as described in Example 7.

REFERENCES

[0209] ADAIR, G. S., DAVIS, H. F. & PARTRIDGE, S. M. 1951. A Soluble Protein derived from Elastin. Nature, 167, 605-605. [0210] ANNABI, N., MITHIEUX, S. M., BOUGHTON, E. A., RUYS, A. J., WEISS, A. S. & DEHGHANI, F. 2009. Synthesis of highly porous crosslinked elastin hydrogels and their interaction with fibroblasts in vitro. Biomaterials, 30, 4550-4557. [0211] BANGA, I. 1966. Structure and function of elastin and collagen. [0212] BUTTAFOCO, L., KOLKMAN, N., ENGBERS-BUIJTENHUIJS, P., POOT, A., DIJKSTRA, P., VERMES, I. & FEIJEN, J. 2006. Electrospinning of collagen and elastin for tissue engineering applications. Biomaterials, 27, 724-734. [0213] DAAMEN, W. F., VEERKAMP, J. H., VAN HEST, J. C. M. & VAN KUPPEVELT, T. H. 2007. Elastin as a biomaterial for tissue engineering. Biomaterials, 28, 4378-4398. [0214] GRAY, W. R. 1973. Molecular model for elastin structure and function. Nature, 246, 461-466. [0215] HUANG, W., ROLLETT, A. & KAPLAN, D. L. 2015. Silk-elastin-like protein biomaterials for the controlled delivery of therapeutics. Expert Opin Drug Deliv, 12, 779-91. [0216] LEACH, J. B., WOLINSKY, J. B., STONE, P. J. & WONG, J. Y. 2005. Crosslinked alpha-elastin biomaterials: towards a processable elastin mimetic scaffold. Acta Biomater, 1, 155-64. [0217] NIVISON-SMITH & WEISS 2011 Regenerative Medicine and Tissue EngineeringCells and Biomaterials Chapter 15Elastin Based Constructs ISBN978-953-307-663-8 DOI:10.5772/837 [0218] MAJD, H., QUINN, T. M., WIPFF, P. J. & HINZ, B. 2011. Dynamic expansion culture for mesenchymal stem cells. Methods Mol Biol, 698, 175-88. [0219] RYAN, A. J. & O'BRIEN, F. J. 2015. Insoluble elastin reduces collagen scaffold stiffness, improves viscoelastic properties, and induces a contractile phenotype in smooth muscle cells. Biomaterials, 73, 296-307. [0220] SKOPINSKA-WISNIEWSKA, J., KUDERKO, J., BAJEK, A., MAJ, M., SIONKOWSKA, A. & ZIEGLER-BOROWSKA, M. 2016. Collagen/elastin hydrogels cross-linked by squaric acid. Mater Sci Eng C Mater Biol Appl, 60, 100-8. [0221] STOKLASOVA, A., RANDOVA, Z., ROCKOVA, V. & LEDVINA, M. 1992. Soluble elastins, their preparation and characterization. Sb Ved Pr Lek Fak Karlovy Univerzity Hradci Kralove, 35, 217-23. [0222] ZHANG, D. & KILIAN, K. A. 2013. The effect of mesenchymal stem cell shape on the maintenance of multipotency. Biomaterials, 34, 3962-9.

[0223] GHASEMI-MOBARAKEH, LALEH ET AL. 2015 Structural Properties of Scaffolds: Crucial Parameters towards Stem Cells Differentiation. World Journal of Stem Cells 7.4 (2015): 728-744. PMC. Web. [0224] FU W, LIU Z, FENG B, HU R, HE X, WANG H 2014 Electrospun gelatin/PCL and collagen/PLCL scaffolds for vascular tissue engineering. Int J Nanomedicine.; 9:2335-44. [0225] LAKE S P, HADI M F, LAI V K, BAROCAS V H. 2012. Mechanics of a fiber network within a non-fibrillar matrix: model and comparison with collagen agarose co-gels. Annals of biomedical engineering. 40(10):2111-21. [0226] AUERBACH R, KUBAI L, KNIGHTON D, FOLKMAN J. 1974. A simple procedure for the long-term cultivation of chicken embryos. Dev Biol.; 41(2):391-4.