INHIBITION OF VASCULAR ENDOTHELIAL CELL-MEDIATED PHAGOCYTIC PROCESSES FOR TREATMENT OF DEMYELINATING CONDITIONS
20200165608 ยท 2020-05-28
Inventors
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
C12N2310/20
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K38/47
HUMAN NECESSITIES
C12Y302/01096
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present invention concerns a method for treating a demyelinating condition in a subject, by administering an agent to the subject that inhibits vascular endothelial cell phagocytosis. The method of the invention is useful in treating, for example, a demyelinating condition associated with an injury, such as a spinal cord injury or traumatic brain injury, as well as other demyelinating conditions, such as multiple sclerosis.
Claims
1. A method for treating a demyelinating condition in a human or animal subject, comprising administering an agent to the subject that inhibits vascular endothelial cell phagocytosis.
2. The method of claim 1, wherein the demyelinating condition is associated with a neural injury.
3. The method of claim 2, wherein the neural injury is an injury of the peripheral nervous system (PNS), central nervous system (CNS), or both.
4. The method of claim 3, wherein neural injury is a spinal cord injury (SCI).
5. The method of claim 1, wherein the subject has the demyelinating condition at the time of administering the agent to the subject, and the agent is administered as therapy.
6. The method of claim 1, wherein the subject does not have the demyelinating condition at the time of administering the agent to the subject, and the agent is administered as prophylaxis to prevent, delay onset or recurrence, or to reduce the severity of a potential demyelinating condition.
7. The method of claim 1, wherein the demyelinating condition is selected from among spinal cord injury, traumatic brain injury, multiple sclerosis (MS), Alzheimer's disease, autoimmune encephalomyelitis, acute disseminated encephalomyelitis (ADEM), Balo's disease (concentric sclerosis), Charcot-Marie-Tooth disease (CMT), Guillaian Barre Syndrome (GB S), HTLV-1-associated myelopathy (HAM), neuromyelitis optica (Devic's disease), Schilder's disease, transverse myelitis, congenital metabolic disorder with demyelination, neuropathy with abnormal myelination, drug-induced demyelination, radiation-induced demyelination, hereditary demyelination condition, prion-induced demyelination, encephalitis-induced demyelination, and chronic inflammatory demyelinating neuropathy.
8. The method of claim 7, wherein the chronic inflammatory demyelinating neuropathy is selected from among chronic Immune Demyelinating Polyneuropathy (CIDP); multifocal CIDP; multifocal motor neuropathy (MMN); anti-MAG Syndrome (Neuropathy with IgM binding to Myelin-Associated Glycoprotein); GALOP Syndrome (Gait disorder Autoantibody Late-age Onset Polyneuropathy); anti-sulfatide antibody syndrome; anti-GM2 gangliosides antibody syndrome; POEMS syndrome (Polyneuropathy Organomegaly Endocrinopathy or Edema M-protein Skin changes); perineuritis; and IgM anti-GD1b ganglioside antibody syndrome.
9. The method of claim 1, wherein the agent is a MAP kinase inhibitor, PI3K inhibitor, protein biosynthesis inhibitor, Vacuolar-type H (+)-ATPase (V-ATPase) inhibitor, lysosomal lumen alkalyzer, acid protease inhibitor, or endosome inhibitor.
10. The method of claim 1, wherein the agent inhibits the autophagy-lysosome pathway in vascular endothelial cells and is selected from among: 3-methyladenine (3-MA), CPD18 (also known as 3-methyl-6-(3-methylpiperidin-1-yl)-3H-purine), bafilomycin A1, chloroquine, hydroxychloroquine, LY294002 (also known as 2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one), SB202190, SB203580, SC79, Wortmannin (also known as SL-2052), SP600125 (also known as 1,9-Pyrazoloanthrone), U0126 (also known as (2Z,3Z)-2,3-bis[amino-(2-aminophenyl)sulfanylmethylidene]butanedinitrile), MHY1485 (also known as 4,6-dimorpholino-N-(4-nitrophenyl)-1,3,5-triazin-2-amine), autophinib, azithromycin, ()-Bay K 8644, concanamycin A (also known as folimycin), DBeQ (also known as N2,N4-Bis(phenylmethyl)-2,4-quinazolinediamine), E 64d (also known as (2S,3S)-3-[[[(1S)-3-Methyl-1-[[(3-methylbutyl)amino]carbonyl]butyl]amino]carbonyl]-2-oxiranecarboxylic acid ethyl ester), edaravone (also known as MCI 186), GW 4064 (also known as 3-[2-[2-Chloro-4-[[3-(2,6-dichlorophenyl)-5-(1-methylethyl)-4-isoxazolyl]methoxy]phenyl]ethenyl]benzoic acid), Mdivi 1 (also known as 3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(1H)-quinazolinone), ML 240 (2-(2-Amino-1H-benzimidazole-1-yl)-8-methoxy-N-(phenylmethyl)-4-quinazolinamine), MRT 67307 (also known as N-[3-[[5-Cyclopropyl-2-[[3-(4-morpholinylmethyl)phenyl]amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), MRT 68601 (N-[3-[[5-Cyclopropyl-2-[[4-(4-morpholinyl)phenyl]amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), MRT 68921 (also known as N-[3-[[5-Cyclopropyl-2-[(1,2,3,4-tetrahydro-2-methyl-6-isoquinolinyl)amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), NMS 873 (3-[3-(Cyclopentylthio)-5-[[[2-methyl-4-(methylsulfonyl)[1,1-biphenyl]-4-yl]oxy]methyl]-4H-1,2,4-triazol-4-yl]pyridine), nocodazole (also known as [5-(2-Thienylcarbonyl)-1H-benzimidazol-2-yl]carbonic acid, methyl ester), pepstatin A, apautin 1 (also known as 6-Fluoro-N-[(4-Fluorophenyl)methyl]-4-quinazolinamine), taxol (also known as paclitaxel), vinblastine (also known as vincaleukoblastine), xanthohumol (also known as (2E)-1-[2,4-Dihydroxy-6-methoxy-3-(3-methyl-2-buten-1-yl)phenyl]-3-(4-hydroxyphenyl)-2-propen-1-one), Tetrahydroacridine 33 (also known as 6-Chloro-N-(1-ethylpiperidin-4-yl)-1,2,3,4-tetrahydroacridin-9-amine), Thapsigargin (also known as 3S,3aR,4S,6S,6aR,7S,8S,9b S)-6-(Acetyloxy)-4-(butyryloxy)-3,3a-dihydroxy-3,6,9-trimethyl-8-{[(2Z)-2-methylbut-2-enoyl]oxy}-2-oxo-2,3,3a,4,5,6,6a,7,8,9b-decahydroazuleno[4,5-b]furan-7-yl octanoate), ARN5187 (also known as 4-(((1-(2-Fluorophenyl)cyclopentyl)-amino)methyl)-2-((4-methylpiperazin-1-yl)methyl)phenol), Spautin-1 (6-fluoro-N-[4-fluorobenzyl]quinazolin-4-amine), N-acetyl cysteine (also known as NAC), L-asparagine (also known as (S)-2-Aminosuccinic acid 4-amide), Catalase from human erythrocytes (also known as H.sub.2O.sub.2:H.sub.2O.sub.2 oxidoreductase), E-64d (also known as (2S,3S)-trans-Epoxysuccinyl-L-leucylamido-3-methylbutane ethyl ester, GMX1778 (also known as N-[6-(4-Chlorophenoxy)hexyl]-N-cyano-N-4-pyridinyl-guanidine), Leupeptin (also known as Acetyl-Leu-Leu-Arg-al), and SBI-0206965 (also known as 2-((5-Bromo-2-((3,4,5-trimethoxyphenyl)amino)pyrimidin-4-yl)oxy)-N-methylbenzamide).
11. The method of claim 1, wherein the agent inhibits the autophagy-lysosome pathway in vascular endothelial cells and is selected from among an antisense, RNA-interference molecule, and microRNA that targets a component of the autophagy-lysosome pathway in vascular endothelial cells by blocking or reducing the component's expression, as a genetic intervention.
12. The method of claim 1, wherein the agent inhibits the autophagy-lysosome pathway in vascular endothelial cells and inhibits ATG5 in vascular endothelial cells.
13. The method of claim 1, wherein the agent depletes immunoglobulin G (IgG) or inactivates IgG in the subject.
14. The method of claim 13, wherein the agent that inactivates IgG is an enzyme that hydrolyzes IgG, such as EndoS or IdeS.
15. The method of claim 1, wherein the agent inhibits immunoglobulin G (IgG) opsonization of myelin debris.
16. The method of claim 15, wherein the agent blocks the Fc receptor on vascular endothelial cells in the subject.
17. The method of claim 13, wherein the agent depletes IgG and is a B-cell-attenuating agent.
18. The method of claim 1, wherein the agent is administered locally at a anatomical site, or where demyelination exists or is at risk of occurring, or is administered directly into the cerebrospinal fluid (CSF) of the subject.
19. A packaged dosage formulation for treating a demyelinating condition, comprising an agent that inhibits vascular endothelial cell phagocytosis in a pharmaceutically acceptable dosage.
20. A kit for treating a demyelinating condition, comprising, in one or more containers, at least one agent that inhibits vascular endothelial cell phagocytosis.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
[0015]
[0016]
[0017]
[0018]
[0019] Engulfed myelin debris is delivered through autophagosomes to lysosomes for myelin degradation to lipids in BMECs. (
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
BRIEF DESCRIPTION OF THE SEQUENCES
[0037] SEQ ID NOs: 1-22 are forward and reverse primers used for quantitative real-time polymerase chain reaction (RT-PCR).
[0038] SEQ ID NO:23 is the sequence of the Atg5 gene locus (
[0039] SEQ ID NO:24 is a single guide RNA targeting sequence.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The inventor hypothesized that in spinal cord injury (SCI) microvessels and the lining microvascular ECs serve as amateur phagocytic sources for myelin debris uptake, which would be consistent with the early presence and great number of newly formed microvessels in the injury core.
[0041] In the study described herein, the inventor established a previously unidentified role for microvessels and lining microvascular ECs in engulfing and clearing myelin debris after SCI and experimental autoimmune encephalomyelitis (EAE), a commonly used animal model of multiple sclerosis (MS). The inventor also discovered a novel pathway for myelin debris degradation through the autophagy-lysosome system. Importantly, the inventor demonstrated for the first time that microvascular EC uptake exerts critical functions beyond myelin debris clearance. Engulfment and autophagic processing of myelin debris by microvascular ECs have sequential consequences in promoting chronic inflammation and pathological healing (angiogenesis and fibrotic scar formation) during the progression of demyelinating disorders. Therefore, this study reveals how myelin debris engulfment and processing by microvascular ECs contribute to pathological progression in demyelinating disorders.
[0042] The inventor determined that microvessels and lining ECs act as amateur phagocytes to engulf myelin debris generated by disorders associated with demyelination. The inventor determined that IgG opsonization of myelin debris is required for efficient uptake by microvascular ECs. The engulfed myelin debris is then delivered through the autophagy-lysosome pathway for intracellular degradation. Functionally, engulfment and autophagy-dependent processing of myelin debris by microvascular ECs contribute to three critical processes that are closely associated with demyelinating disorders: robust angiogenesis that results in excessive and abnormal microvessels, chronic inflammation, and endothelial-mediated fibrosis that most likely takes place through endoMT. Therefore, the inventor proposes that a benefit to patients can be obtained by intervening and interfering with the effects of myelin-ECs by targeting these particular processes (e.g., myelin debris uptake, autophagy and endoMT).
[0043] In the context of spinal cord injury, it was observed that vascular endothelial cells (VECs), through non-canonical phagocytic mechanisms, are capable of endocytosing myelin debris produced by damaged nerve tissue. In doing so, these VECs appear to promote fibrosis by becoming fibroblast-like cells. Fibrosis resulting from nervous tissue is generally viewed as deleterious. The non-professional phagocytic activity of VECs appears to be conducted through autophagy-linked molecular pathways, including the protein, ATG5. ATG5 is a well-characterized, critical molecular component in normal cell autophagy.
[0044] The data described herein support the use of directed interference of autophagy pathways, e.g., by ATG5 inhibition, to treat, prevent, or delay onset of a demyelinating condition, and to reduce VEC-induced fibrosis, such as fibrotic scarring that occurs following neural injury such as spinal cord injury. The data further suggest that fibrotic VEC phagocytosis is also dependent on immunoglubulin G (IgG); therefore, immunodepletion of IgG can be used to reduce VEC-induced fibrosis in a manner similar to targeted ATG5 inhibition. The invention concerns methods for using one or both approaches to reduce fibrosis, or to treat a fibrotic condition in a subject.
[0045] The invention concerns a method for treating a demyelinating condition in a human or animal subject, wherein the method comprises administering an agent to the subject that inhibits vascular endothelial cell phagocytosis. In some embodiments, the demyelinating condition is associated with a wound or injury, such as a neural injury (an injury to nervous tissue). For example, the neural injury may be a neuropraxia, axonotmesis, or neurotmesis. The neural injury may be an injury nervous tissue of the peripheral nervous system (PNS), central nervous system (CNS), or both. For example, the injury may be a spinal cord injury (SCI).
[0046] The invention also concerns agents that inhibit vascular endothelial cell phagocytosis for use in treatment of demyelination and demyelinating conditions, and use of an agent that inhibits vascular endothelial cell phagocytosis in the manufacture of a medicament for the treatment of demyelination or a demyelinating condition.
[0047] The demyelinating condition may associated with a wound, i.e., a disruption of normal continuity of physiological structures. The wound may be any type, acute or chronic, of any cause, such as physical, chemical, or radiation. For example, the wound may be caused by trauma or surgery, or a burn. Common types of wounds include acute wounds, skin tears, shear damage, and pressure damage.
[0048] In some embodiments, the wound is a wound or other injury of the nervous tissue of the peripheral nervous system (PNS), central nervous system (CNS), or both. For example, the wound may be a spinal cord injury (SCI) or traumatic brain injury (TBI). The SCI may be in any location of the spinal cord (cervical, thoracic, lumbar, sacral), and may be any type severity of SCI (complete or incomplete), such as anterior cord syndrome, central cord syndrome, or Brown-Sequard syndrome. In some embodiments, the wound is a CNS wound caused by one or more of the following: trauma, surgery, ischemia-reperfusion injury, chemotherapy-induced injury, radiotherapy-induced injury, infection, and the body's immune system.
[0049] Among other physiological effects, the method of the invention may be used to reduce or inhibit one or more of: formation or deposition of tissue fibrosis; reducing the size, cellularity (e.g., fibroblast or immune cell numbers), composition; or cellular content, of a fibrotic lesion; or reducing fibrosis associated with an inflammatory response.
[0050] Thus, by extension, the method for treating a demyelinating condition may reduce fibrosis, or treatment of a fibrotic condition in a human or animal subject. The fibrosis or fibrotic condition may be one that is vascular endothelial cell-induced, i.e., mediated by vascular cell phagocytosis (endocytosis of myelin debris by vascular endothelial cells through non-canonical phagocytic mechanisms).
[0051] The fibrotic condition may be a primary fibrosis. The fibrotic condition may be idiopathic. In some embodiments, the fibrotic condition is associated with (e.g., is secondary to) a disease (e.g., an infectious disease, an inflammatory disease, an autoimmune disease, a malignant or cancerous disease, and/or a connective disease); a toxin; an insult (e.g., an environmental hazard (e.g., asbestos, coal dust, polycyclic aromatic hydrocarbons), cigarette smoking, a wound); a medical treatment (e.g., surgical incision, chemotherapy or radiation), or a combination of any of the foregoing. In some embodiments, the fibrotic condition is associated with an autoimmune disease selected from scleroderma or lupus, e.g., systemic lupus erythematosus.
[0052] It may be desirable to use the method of the invention in a surgical setting, such as peritoneal, pericardial, obstetric, gynecological, neurosurgical, arthroscopic, orthopedic, plastic, reconstructive, muscle, or tendon surgery. Specific examples of surgery where it would be advantageous to administer the agent that inhibits vascular endothelial cell phagocytosis before, during, and/or after surgery include abdominal surgery, joint surgery, tendon surgery, surgery to remove pelvic sidewall adhesions, peritoneal surgery, thoracic surgery, vascular surgery, cardiac surgery, heart bypass surgery, heart valve replacement surgery, or open heart surgery, laminectomy, fallopian tube surgery, plastic surgery, arthritis & osteoarthritis, and surgery to treat temporo-mandibular joint dysfunction. The agent may be administered before, during, or after any procedure in which there is a risk of inducing a demyelinating condition, such as a surgery in which neural injury may occur.
[0053] In some embodiments, the subject has a demyelinating condition, e.g., a condition that results in damage to the myelin sheath surrounding the spinal cord, brain, optic nerve, or any combination thereof, interfering with the normal conduction of signals in the affected nerves.
[0054] As used herein, a demyelinating condition is a condition that destroys, or disrupts the integrity of, or damages, a myelin sheath. As used herein, the term myelin sheath refers to an insulating layer surrounding vertebrate peripheral neurons increases the speed of conduction and is formed by Schwann cells in the peripheral nervous system or by oligodendrocytes in the central nervous system. In some embodiments, the demyelinating condition is caused by an injury to neural tissue. In some embodiments, the demyelinating condition is hereditary. Some examples of demyelinating conditions are described in Love S, Demyelinating diseases, J Clin Pathol, 2006, 59:1151-1159).
[0055] Examples of demyelinating conditions include, but are not limited to, spinal cord injury, traumatic brain injury, multiple sclerosis (MS), Alzheimer's disease, autoimmune encephalomyelitis, acute disseminated encephalomyelitis (ADEM), Balo's disease (concentric sclerosis), Charcot-Marie-Tooth disease (CMT), Guillaian Barre Syndrome (GBS), HTLV-1-associated myelopathy (HAM), neuromyelitis optica (Devic's disease), Schilder's disease, transverse myelitis, congenital metabolic disorder with demyelination, neuropathy with abnormal myelination, drug-induced demyelination, radiation-induced demyelination, hereditary demyelination condition, prion-induced demyelination, encephalitis-induced demyelination, and chronic inflammatory demyelinating neuropathy.
[0056] Examples of chronic inflammatory demyelinating neuropathies include, but are not limited to, chronic Immune Demyelinating Polyneuropathy (CIDP); multifocal CIDP; multifocal motor neuropathy (MMN); anti-MAG Syndrome (Neuropathy with IgM binding to Myelin-Associated Glycoprotein); GALOP Syndrome (Gait disorder Autoantibody Late-age Onset Polyneuropathy); anti-sulfatide antibody syndrome; anti-GM2 gangliosides antibody syndrome; POEMS syndrome (Polyneuropathy Organomegaly Endocrinopathy or Edema M-protein Skin changes); perineuritis; and IgM anti-GD1b ganglioside antibody syndrome.
[0057] The demyelinating condition may be any form or severity. For example, in the case of MS, the condition may be clinically isolated syndrome (CIS), relapsing-remitting multiple sclerosis (RRMS), secondary progressive multiple sclerosis (SPMS), or primary progressive multiple sclerosis (PPMS).
[0058] The method of the invention involves administering an agent or treatment to the subject that inhibits vascular endothelial cell phagocytosis in the subject. In some embodiments, the agent or treatment inhibits the autophagy-lysosome pathway in vascular endothelial cells of the subject. In some embodiments, the agent that inhibits the autophagy-lysosome pathway is an agent that inhibits ATG5 in vascular endothelial cells.
[0059] Examples of agents that inhibit the autophagy-lysosome pathway include, but are not limited to, a MAP kinase inhibitor (e.g., SP600125, U0126, SB202190, and SB203580), PI3K inhibitor (e.g., 3-methyladenine, LY294002, and Wortmannin), protein biosynthesis inhibitor (e.g., cycloheximide), Vacuolar-type H (+)-ATPase (V-ATPase) inhibitor (e.g., bafilomycin), lysosomal lumen alkalyzer (e.g., chloroquine, hydroxychloroquine, NH4Cl, neutral red, Lys01,and Lys05), acid protease inhibitor (e.g., leupeptin, E64d, and pepstatin A), and endosome inhibitor (e.g., Bafilomycin A1, and chloroquine).
[0060] Additional agents that inhibit the autophagy-lysosome pathway include, but are not limited to, 3-methyladenine (3-MA), CPD18 (a.k.a. 3-methyl-6-(3-methylpiperidin-1-yl)-3H-purine), bafilomycin A1, chloroquine, hydroxychloroquine, LY294002 (a.k.a. 2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one), SB202190, SB203580, SC79, Wortmannin (a.k.a. SL-2052), SP600125 (a.k.a. 1,9-Pyrazoloanthrone), U0126 (a.k.a. (2Z,3Z)-2,3-bis[amino-(2-aminophenyl)sulfanylmethylidene]butanedinitrile), MHY1485 (a.k.a. 4,6-dimorpholino-N-(4-nitrophenyl)-1,3,5-triazin-2-amine), autophinib, azithromycin, ()-Bay K 8644, concanamycin A (a.k.a. folimycin), DBeQ (a.k.a. N2,N4-Bis(phenylmethyl)-2,4-quinazolinediamine), E 64d (a.k. a. (2 S,3 S)-3-[ [[(1 S)-3-Methyl-1-[[(3-methylbutyl)amino]carbonyl]butyl]amino]carbonyl]-2-oxiranecarboxylic acid ethyl ester), edaravone (a.k.a. MCI 186), GW 4064 (a.k.a. 3-[2-[2-Chloro-4-[[3-(2,6-dichlorophenyl)-5-(1-methylethyl)-4-isoxazolyl]methoxy]phenyl]ethenyl]benzoic acid), Mdivi 1 (a.k.a. 3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(1H)-quinazolinone), ML 240 (2-(2-Amino-1H-benzimidazole-1-yl)-8-methoxy-N-(phenylmethyl)-4-quinazolinamine), MRT 67307 (a.k.a. N-[3-[ [5-Cyclopropyl-2-[[3-(4-morpholinylmethyl)phenyl]amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), MRT 68601 (N-[3-[[5-Cyclopropyl-2-[[4-(4-morpholinyl)phenyl]amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), MRT 68921 (a.k.a. N-[3-[[5-Cyclopropyl-2-[(1,2,3,4-tetrahydro-2-methyl-6-isoquinolinyl)amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), NMS 873 (3-[3-(Cyclopentylthio)-5-[[[2-methyl-4-(methylsulfonyl)[1,1-biphenyl]-4-yl]oxy]methyl]-4H-1,2,4-triazol-4-yl]pyridine), nocodazole (a.k.a. [5-(2-Thienylcarbonyl)-1H-benzimidazol-2-yl]carbonic acid, methyl ester), pepstatin A, apautin 1 (a.k.a. 6-Fluoro-N-[(4-Fluorophenyl)methyl]-4-quinazolinamine), taxol (a.k.a. paclitaxel), vinblastine (a.k.a. vincaleukoblastine), xanthohumol (a.k.a. (2E)-1-[2,4-Dihydroxy-6-methoxy-3-(3-methyl-2-buten-1-yl)phenyl]-3-(4-hydroxyphenyl)-2-propen-1-one), Tetrahydroacridine 33 (a.k.a. 6-Chloro-N-(1-ethylpiperidin-4-yl)-1,2,3,4-tetrahydroacridin-9-amine), Thapsigargin (a.k.a. 3 S,3aR,4S,6S,6aR,7S,8S,9b S)-6-(Acetyloxy)-4-(butyryloxy)-3,3a-dihydroxy-3,6,9-trimethyl-8-{[(2Z)-2-methylbut-2-enoyl]oxy}-2-oxo-2,3,3a,4,5,6,6a,7,8,9b-decahydroazuleno[4,5-b]furan-7-yl octanoate), ARN5187 (a.k.a. 4(((1-(2-Fluorophenyl)cyclopentyl)-amino)methyl)-2-((4-methylpiperazin-1-yl)methyl)phenol), Spautin-1 (6-fluoro-N-[4-fluorobenzyl]quinazolin-4-amine), N-acetyl cysteine (a.k.a. NAC), L-asparagine (a.k.a. (S)-2-Aminosuccinic acid 4-amide), Catalase from human erythrocytes (a.k.a. H.sub.2O.sub.2:H.sub.2O.sub.2 oxidoreductase), E-64d (a.k.a. (2S,3S)-trans-Epoxysuccinyl-L-leucylamido-3-methylbutane ethyl ester, GMX1778 (a.k.a. N-[6-(4-Chlorophenoxy)hexyl]-N-cyano-N-4-pyridinyl-guanidine), Leupeptin (a.k.a. Acetyl-Leu-Leu-Arg-al), and SBI-0206965 (a.k.a. 2-((5-Bromo-2-((3,4,5-trimethoxyphenyl)amino)pyrimidin-4-yl)oxy)-N-methylbenzamide).
[0061] In other embodiments, the agent that inhibits the autophagy-lysosome pathway is selected from among an antisense, RNA-interference molecule (e.g., shRNA), and microRNA that targets a component of the autophagy-lysosome pathway (e.g., ATG5) in vascular endothelial cells by blocking or reducing the component's expression, as a genetic intervention.
[0062] In some embodiments, the agent that inhibits vascular endothelial cell phagocytosis in the subject is an agent that depletes or inactivates immunoglobulin G (IgG) locally at a desired anatomical site or systemically. For example, an immunomodulating enzyme that hydrolyzes IgG in the subject, such as the endoglycosidase EndoS or the protease IdeS, may be administered to the subject. IdeS cleaves IgG in the lower hinge region, while EndoS hydrolyzes the conserved N-linked glycan in the Fc region (Collin M and Bjrck L, Toward Clinical use of the IgG Specific Enzymes IdeS and EndoS against Antibody-Mediated Diseases, Methods Mol. Biol., 2017, 1535:339-351; Jarnum S et al., Enzymatic Inactivation of Endogenous IgG by IdeS Enhances Therapeutic Antibody Efficacy, Mol. Cancer. Therap., 2017 Sep. 16(9):1887-1897; and Winstedt L et al., Complete Removal of Extracellular IgG Antibodies in a Randomized Dose-Escalation Phase I Study with the Bacterial Enzyme IdeSA Novel Therapeutic Opportunity, PLoS One. 2015; 10(7):e0132011, published online Jul. 15, 2015, which are each incorporated herein by reference in their entireties). The agent may a B-cell-attenuating agent that destroys B-cells or otherwise reduces B-cells' production of IgG, such as bortezomib or rituximab.
[0063] The agent may be an agent that inhibits IgG opsonization of myelin debris, thereby inhibiting myelin uptake by vascular endothelial cells. For example, the agent may bind to the Fc receptor (FcRn receptor) on vascular endothelial cells in the subject, or interfere with interactions between the IgG and the Fc receptor, to inhibit myelin uptake by ECs. Fc receptors have been described in the literature (see, for example, Kuijpers T, Fc-dependent mechanisms of action: roles of FcR and FcRn receptors, Clinical and Experimental Immunology, 178:89-91; and Pzik M et al., FcRn: The architect behind the immune and non-immune functions of IgG and albumin, J Immunol, 2015, May 15, 194(10):4595-4603, which are incorporated herein by reference in their entireties).
[0064] In some embodiments, the agent is monoclonal or polyclonal antibody, or antigen-binding fragment thereof, that binds to the Fc receptor (e.g., FcRn receptor) on vascular endothelial cells.
[0065] Agents that block FcRn have been reported in the literature and may be used in the invention: [0066] 1. ABDEGs (antibodies that enhance IgG degradation) are IgG molecules, where the Fc-part has been engineered to bind with high affinity to FcRn at both physiological and endosomal pH. These molecules can decrease the overall serum level of IgG in mice and have also been shown to ameliorate disease in an antibody dependent murine model of multiple sclerosis (Challa, D. K. et al. Autoantibody depletion ameliorates disease in murine experimental autoimmune encephalomyelitis. MAbs 5, 655-659, 2013.) [0067] 2. FcRn mAb, 1G3. Treatment with 1G3 significantly reduced the severity of the disease symptoms as well as the levels of total IgG and anti-AChR IgG relative to untreated animals. These data suggest that FcRn blockade may be an effective way to treat Ab-mediated autoimmune diseases. (Liu, L. et al. Amelioration of experimental autoimmune myasthenia gravis in rats by neonatal FcR blockade. J. Immunol. 178, 5390-5398, 2007. [0068] 3. A 26-amino acid peptide (SYN1436) binding to FcRn was developed, and was shown to decrease the overall serum-level of IgG upon injection into non-human primates. (Mezo, A. R. et al. Reduction of IgG in nonhuman primates by a peptide antagonist of the neonatal Fc receptor FcRn. Proc. Natl. Acad. Sci. USA 105, 2337-42, 2008. [0069] 4. An FcRn-binding affibody molecule (ZFcRn, affinity protein domains, 58 amino acids long) (Seijsing, J. et al. An engineered affibody molecule with pH-dependent binding to FcRn mediates extended circulatory half-life of a fusion protein. Proc. Natl. Acad. Sci. USA 111, 17110-5, 2014; Seij sing at al. In vivo depletion of serum IgG by an affibody molecule binding the neonatal Fc receptor. Scientific Reports. volume 8, 5141, 2018 [0070] 5. M281: A Therapeutic Anti-FcRn Blocking Antibody for Rapid Clearance of IgG and IgG Autoantibodies in Immune Cytopenias and Other Auto/Allo-Immune Disease. Leona E Ling et al. Blood 2015 126:3472; [0071] 6. Rozanolixizumab (UCB7665; CA170_01519.g57 IgG4P) is an anti-human FcRn monoclonal antibody.
[0072] Other agents that act on Fc receptors are described in U.S. Patent Application Publication Nos. 2018/0305454 (Sexton Daniel J et al.), 2018/0291101 (Blumberg L J et al.), 2018/0127498 (Bhatta Petal.), 2018/0179258 (Ulrichts Petal.), 2018/0016334 (Kehry M et al.), 2017/0210801 (Kim S W et al.), and 2017/0209529 (Blumberg R S et al.), which are each incorporated by reference herein in their entireties.
[0073] One or a combination of two or more agents that inhibit vascular endothelial phagocytosis may be utilized. The agents in a combination may be the same class of agent (e.g., small molecule, nucleic acid, protein, antibody or antibody fragment) or different classes of agent, and may operate by the same mechanism of action in inhibiting vascular endothelial cell phagocytosis or by different mechanisms of action.
[0074] The clearance of damaged myelin sheaths is important to ensure functional recovery from central nervous system disorders associated with demyelination, such as spinal cord injury (SCI) and multiple sclerosis (MS). However, the cellular and molecular mechanisms for myelin clearance remain unclear and how myelin debris contributes to progression of demyelination disorders is poorly understood. The inventor shows herein that a previously unidentified role for microvessels and their lining endothelial cells (ECs) in engulfing myelin debris in two animal models of demyelination diseases: SCI and experimental autoimmune encephalomyelitis (EAE), a pre-clinical animal model of MS neural injury. The inventor demonstrates that IgG opsonization of myelin debris is required for its effective engulfment by ECs and that the autophagy-lysosome pathway is crucial for the degradation of engulfed myelin debris. The inventor further shows that following myelin uptake and autophagy-dependent processing, ECs exert critical functions beyond myelin clearance to promote progression of demyelination disorders by regulating inflammation, angiogenesis, and fibrosis. Specifically, ECs acquire the ability to facilitate the recruitment of bone marrow-derived macrophages to promote chronic inflammation and stimulate excessive proliferation for pathologic angiogenesis in both SCI and EAE models. Unexpectedly, myelin debris engulfment induces the endothelial-to-mesenchymal transition, a process that confers upon EC the ability to stimulate the endothelial-derived production of fibrotic components including collagen and fibronectin, suggesting a previously unknown function of ECs in fibrotic scar formation. Taken together, this demonstrates that microvascular ECs provide a novel route for the engulfment and processing of myelin debris through the autophagy-lysosome pathway, which in turn induces chronic pathology by promoting inflammation, angiogenesis, and fibrotic scar formation.
[0075] The efficient removal of degenerating myelin is important for functional recovery and inflammation resolution in the injured spinal cord. Therefore, understanding the cellular and molecular mechanisms for the clearance of myelin debris is an important therapeutic target. While professional phagocytes such as BMDM are the major players in the clearance of myelin debris generated after SCI, the in vitro and in vivo experiments described herein demonstrated that microvascular ECs are the additional source for the clearance of myelin debris through the autophagy pathway. Importantly, the inventor revealed the biological significance of myelin debris uptake by microvascular ECs during SCI progression through a sequential regulation of inflammation, angiogenesis, and fibrotic scar formation.
[0076] Most of the knowledge of myelin debris phagocytosis comes from studies on macrophages and microglia. Receptors such as CR3, Mac-2 and LRP-1 are involved in myelin debris phagocytosis by macrophages/microglia [21]. It has been shown that ECs do not employ these receptors for myelin debris uptake. The naked myelin debris is not recognized by ECs and only IgG-opsonized myelin debris can be engulfed effectively, suggesting IgG receptors (FcRs) may be involved in myelin debris engulfment by ECs. The family of FcRs is highly expressed in macrophages to regulate a multitude of immune responses by interaction with IgG, immune complexes and opsonized particles or cells [34]. It is likely that ECs only express a small amount of FcRs that engage in the engulfment of IgG-opsonized myelin debris, and this may thus account for the limited phagocytic capacity of ECs compared to strong phagocytosis of myelin debris by BMDM. Compromised BBB leads to leakage of IgG in the injured area [35], which may be the source of IgG for oposinization.
[0077] Given the fact that brain ECs and other antigen presenting cells are able to engulf myelin debris and present myelin antigens to lymphocytes [36], it is possible that the specific antibodies may further opsonize myelin debris and facilitate its engulfment. Endogenous antibodies have been shown to promote the rapid clearance of myelin debris in mouse [37], but it is unknown which cell type(s) benefit from the opsonization by antibody for myelin debris clearance. Because IgG opsonization is required for myelin debris uptake by ECs, but not BMDM (
[0078] Autophagy is a fundamental degradative pathway for degradation of intracellular proteins and organelles. One feature of autophagy is the formation of autophagosomes, which engulf cargoes and upon fusion with lysosomes form autolysosomes leading to the degradation of the enclosed materials [28]. Autophagy has recently emerged as an alternative mechanism for myelin debris clearance in Schwann cells [38,39]. The inventor shows that autolysosomes are involved in myelin debris degradation in microvascular ECs. It is to be determined whether autophagic processing of myelin debris is required for ECs' activities including ECs proliferation, inflammation and transition to fibroblast-like cells, which could be determined using an autophagy-deficient mouse model, for example, endothelium-specific atg5 or atg7 knockout mouse model [40].
[0079] The major form of vascular change in the injury area is angiogenesis during chronic stages of SCI. Surprisingly, it was found that the newly formed microvessels are structurally abnormal. They are dilated and appear more disorganized and tortuous. The mechanisms and biological outcomes for these vascular abnormalities are poorly understood after SCI. The inventor demonstrated that myelin debris could be one of the lesion-related factors that causes excessive EC proliferation, which may contribute to microvessel dilation at injury sites. Interestingly, the dilated microvessels in the injured spinal cords recapitulated the microvessels in mice lacking pericytes in an early stage of SCI [41], a cellular constituent in the neurovascular unit that has been recently reported to constrict microvessels [42]. Therefore, an alternative explanation for the microvessels' dilation could be that these newly formed microvessels have defects in pericytes maturation or/and coverage, which thus fail to constrict microvessels and lead to microvessels dilation. One of the most important features of neuroinflammation is the leukocyte recruitment from the blood circulation into the CNS, which requires the activation of ECs through an increased expression of adhesion molecules and secretion of cytokines/chemokines in ECs [43].
[0080] The study herein demonstrates that myelin debris engulfment activates microvascular ECs by increasing expression of adhesion molecules such as VCAM-1 and a variety of cytokines/chemokines, which could facilitate BMDM recruitment to injury site. The RNA sequencing data suggests myelin debris might also promote BMDM influx to injury site by increasing microvascular permeability to leukocytes, as indicated by the downregulation of genes related to cell junctions in myelin-ECs.
[0081] The fibrotic scars in the central region of injury sites, characterized by the excessive accumulation of pro-fibrotic proteins such as collagen and fibronectin, have been known to inhibit axon regeneration [44]. Fibroblasts, which are prominent in the injured epicenter, are thought of as the major contributor of the fibrotic scar formation by stimulating the production of collagen [30] and fibronectin [31]. However, little is known about the cellular origin of fibroblasts in the contusive injured spinal cords, whose dura is generally left intact and do not permit the invasion of meningeal fibroblasts into lesions [30,31,45]. Soderblom et al reported a resident source of perivascular fibroblasts from large blood vessels that migrate to the injury site to promote the fibrotic scar formation in mice after contusive SCI [46]. Besides resident fibroblasts, the activated fibroblasts or myofibroblasts may arise from different sources including resident fibroblasts, perivascular pericytes, bone marrow-derived precursors and others [47]. It has been recently reported that ECs have greater plasticity than previously appreciated, and could acquire fibroblast-like properties by undergoing EndoMT [33].
[0082] The study herein demonstrated that myelin debris induces EndoMT and confers microvascular ECs with fibroblasts-like properties including the production of endothelial-derived fibrotic proteins, suggesting microvascular ECs are additional source of fibroblasts or fibroblasts-like cells at the SCI lesion core. It takes a few days for myelin debris to significantly increase expression of fibronectin, collagen and a-SMA in microvascular ECs (
[0083] The inventor has determined that microvessels and the lining microvascular ECs are a novel source for the clearance of myelin debris generated following SCI. Mechanistically, the inventor determined the requirement of IgG opsonization of myelin debris for efficient clearance by microvascular ECs. The engulfed myelin debris is then delivered through autophagy-lysosome pathway for intracellular degradation. Functionally, myelin debris engulfment by microvascular ECs contributes to three critical processes that are closely associated with the SCI progression, including robust angiogenesis that results in excessive and abnormal microvessels in SCI lesions, chronic inflammation, and endothelial-mediated fibrosis probably through EndoMT (
[0084] The autophagy-lysosome pathway (ALP) is described in Martini-Stoica H. et al., The Autophagy-Lysosomal Pathway in Neurodegeneration: A TFEB Perspective, Cell Death Dis., 2018 September; 9(9):858; Epub Aug. 28, 2018, which is incorporated herein by reference. Autophagy can potentially be suppressed at any stage of autophagic flux. Although autophagy and autophagy-related processes are dynamic, they can be broken down into several steps: (1) induction, (2) autophagosome formation, (3) autophagolysosome formation, and (4) delivery and degradation of the autophagic body. The primary step in inducing autophagy involves membrane nucleation, controlled by ULK complex and Beclin1. Inhibitors of positive regulators of of the ULK complex and Beclin1 have been demonstrated to block autophagy.
[0085] These include inhibitors to the MAP kinases, JNK1, ERK and p38. The induction of Atg protein and LC3 proteins is required for vesicle expansion and formation. Inhibitors of the class III PI3 kinases can block autophagy. In a later step of the autophagic process, inhibitors that inhibit lysosome acidification essentially block the formation of autophagosome and autophagic degradation. Further examples of various types of ALP inhibitors are described in Pasquier B et al., Autophagy Inhibitors, Cell Mol Life Sci., 2016 March, Epub Dec. 11, 2015, 73(5):985-1001; and Ha J et al., Novel pharmacological modulators of autophagy: an updated patent review (2012-2015, Expert Opin Ther Pat., 2016 November, Epub Aug. 8, 2016, 26(11):1273-1289, which are incorporated herein by reference in their entireties.
[0086] The methods of the invention may be used to reduce demyelination or an existing demyelinating condition, or treatment of an existing demyelination or a demyelinating condition, or may be used prophylactically to prevent demyelination or a demyelinating condition, or a recurrence thereof, in a subject. As used herein, in this context, the term prevent or prevention is inclusive of delaying the onset of demyelination or a demyelination condition and/or one or more symptoms of a demyelinating condition, and precluding the occurrence or reoccurrence of a demyelinating condition and/or one or more symptoms of a demyelinating condition. Thus, in some embodiments, the subject has demyelination or a demyelinating condition at the time the agent is administered, and the treatment or agent is administered as therapy.
[0087] The methods of the invention may also be used to reduce existing fibrosis, or treatment of an existing fibrotic condition, or may be used prophylactically to prevent a fibrosis or to prevent a fibrotic condition, or a recurrence thereof, in a subject. As used herein, in this context, the term prevent or prevention is inclusive of delaying the onset of fibrosis and/or one or more symptoms of a fibrotic condition, and precluding the occurrence or reoccurrence of fibrosis and/or one or more symptoms of a fibrotic condition. Thus, in some embodiments, the subject has the fibrosis or fibrotic condition at the time the treatment or agent is administered, and the treatment or agent is administered as therapy. Preferably, the agent is administered prior to fibrosis or the existence of a fibrotic condition.
[0088] Optionally, the methods of the invention further comprise, prior to administering the agent that inhibits vascular endothelial cell phagocytosis to the subject, identifying the subject as having the demyelinating condition, or testing for the presence of a demyelinating condition. Demyelination and a demyelinating condition in a subject can be identified using diagnostic methods known in the art, such as imaging (e.g., magnetic resonance imaging), changes in cerebral spinal fluid, and biopsies (see, for example, Kuhlmann T et al., Diagnosis of inflammatory demyelination in biopsy specimens: a practical approach, Acta Neuropathol, 2008 March, 115(3):275-287, which is incorporated herein by reference in its entirety).
[0089] Agents that inhibit vascular endothelial cell phagocytosis (also referred to herein as the active ingredients and compounds of the invention) are administered by any route appropriate to the location of the demyelination or potential demyelination to be addressed. Suitable routes of administration are described, for example in Remington: The Science and Practice of Pharmacy, University of the Sciences in Philadelphia (2005). For example, the agents may be administered intravascularly (e.g., intravenously), topically, orally, intramuscularly, intradermally, by inhalation or subcutaneously.
[0090] Suitable routes include oral, rectal, nasal, topical (including buccal and sublingual), vaginal and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intrathecal and epidural), inhalation, and the like. It will be appreciated that the preferred route may vary with for example the condition of the subject. In some embodiments, the agent is administered orally, nasally, rectally, parenterally, subcutaneously, intramuscularly, intravascularly (e.g., intravenously), intrathecally, intracerebroventricularly, or locally at a desired anatomical site, such as a site of existing demyelination or potential site of potential demyelination.
[0091] In some embodiments, the agent is administered directly into the subject's cerebrospinal fluid (CSF), e.g., by infusion, pump, or direct injection. For example, the agent may be administered intrathecally, by introduction into the spinal canal or into the subarachnoid space so that it reaches the CSF.
[0092] The fibrotic condition may be systemic. In some embodiments, the fibrotic condition is systemic sclerosis (e.g., limited systemic sclerosis, diffuse systemic sclerosis, or systemic sclerosis sine scleroderma), nephrogenic systemic fibrosis, cystic fibrosis, chronic graft vs. host.
[0093] In some embodiments, the fibrotic condition is scleroderma. In some embodiments, the scleroderma is localized, e.g., morphea or linear scleroderma. In some embodiments, the condition is a systemic sclerosis, e.g., limited systemic sclerosis, diffuse systemic sclerosis, or systemic sclerosis sine scleroderma.
[0094] In some embodiments, the fibrotic condition is a fibrotic condition of the lung, a fibrotic condition of the liver, a fibrotic condition of the heart or vasculature, a fibrotic condition of the kidney, a fibrotic condition of the skin, a fibrotic condition of the gastrointestinal tract, a fibrotic condition of the bone marrow or a hematopoietic tissue, a fibrotic condition of the nervous system, a fibrotic condition of the eye, or a combination of two or more of the foregoing.
[0095] The fibrotic condition may involve one or more of: the deposition of excess collagen, fibronectin and or other extracellular matrix components. In some embodiments, the fibrotic condition is lung fibrosis, glaucoma, scleroderma, liver fibrosis, cardiac fibrosis, renal fibrosis or renal failure.
[0096] The method of the invention may be carried out before, during, and/or after a surgical procedure. In some embodiments, the surgical procedure involves eye surgery, is performed on internal organs and tissues, is performed on the epidermal layer or is a procedure is to repair tendon injury. In some embodiments, the surgical procedure is performed on the epidermal layer and may lead to keloid formation or is associated with cosmetic or plastic surgery.
[0097] In some embodiments, the treatment or agent is administered to prevent or delay onset of post-operative surgical adhesions between abutting surfaces. In such cases, the method may comprise the steps of providing a sterile biomaterial and positioning the biomaterial between the abutting surfaces in the course of surgery. In some embodiments, the biomaterial is selected from the group consisting of serous and fibro-serous membranes, such as pericardium (e.g., bovine pericardium), peritoneum, fascia lata, dura mater, dermis, and small intestinal submucosa.
[0098] In some embodiments, the biomaterial is provided in the form of flat or textured sheets or strips.
In some embodiments, the surgery is selected from consisting of peritoneal, pericardial, obstetric, gynecological, neurosurgical, arthroscopic, orthopedic, plastic, reconstructive, muscle, or tendon surgery.
[0099] Optionally, the method further includes the step of suturing or stapling the biomaterial into place between the surfaces, or otherwise allowing the biomaterial to adhere into place between the surfaces.
[0100] The abutting surfaces may be two surface portions of the same tissue, surfaces from each of two or more discrete tissues, or the surfaces of a tissue and implanted material, for example.
[0101] The method of the invention can improve the healing of wounds or alleviation of demyelinating conditions and fibrotic disorders, resulting in reduced or improved scarring, comprising the use of agents that inhibit vascular endothelial cell phagocytosis. By wounds or fibrotic disorder is meant any condition which may result in the formation of scar or fibrotic tissue.
[0102] Treatment is effected by administering an effective amount of an agent to an subject in need of treatment, using a suitable route of administration, such as, but not limited to intravenous administration, oral administration, local administration, and inhalation. The agents, prodrugs or salts to be administered will typically be in the form of a pharmaceutical composition, optionally including pharmaceutically acceptable excipients and/or carriers.
[0103] The method of the invention may be used either immediately before or immediately after a surgical procedure to promote reduced or improved scarring.
[0104] For a lung fibrosis condition, potential routes of administration include orally and locally by inhalation. Inhaled agents can be formulated for use with dry powdered inhalers, metered dose inhalers or as a solution for nebulization. Oral agents can be formulated as a capsule, tablet or solution.
[0105] To treat subjects suffering from cardiac scarring, potential routes of administration include oral, intravenous, subcutaneous and as a coated stent to be implanted by a surgeon.
[0106] For subject undergoing eye surgery, or who have suffered wounds to the eye, or who have glaucoma, potential routes of administration include oral, intravenous, by injection directly into the affected region of the eye, as eye drops, by soaking into a sponge and being applied to the wound at the time of surgery, and contained within in an implant which may be surgically introduced.
[0107] For subjects undergoing spinal and back surgery, potential routes of administrations include oral, intravenous, and direct application to the wound during surgery, e.g., as a powder, solution or soaked into a sponge.
[0108] For subjects suffering from scleroderma and kidney fibrosis, some potential routes of administration include oral, intravenous, and coated implants.
[0109] For subjects undergoing plastic surgery, or who are prone to keloid formation, or who have skin burns, potential routes of administration include local application in the form of an ointment or a cream, or injected directly to the site of the wound, or orally or intravenously.
[0110] For subjects suffering from injury to tendons, including tendons in the hands, shoulders, elbows, hips, knees and feet, Dupuytren's disease, frozen shoulder (adhesive capsulitis), some potential routes of administration include local injection, as an ointment or cream, or administered directly to the site of the wound, oral or intravenous.
[0111] In some embodiments, the administration of the agent for any demyelinating condition is by injection into or adjacent a site of injury, by infusion, for example via an epidural intrathecal catheter, or by direct application to a site of injury or adjacent thereto.
[0112] In some embodiments, the method of the invention is used to control adhesions following a following a surgical procedure, comprising the steps of: providing an agent that inhibits vascular endothelial cell phagocytosis; and administration involves introducing the agent onto or into an area of the body following the procedure to inhibit adhesions, or scar formation. In some embodiments, the agent is used to prevent the formation of scar tissue following spinal surgery. In some embodiments, the agent is placed over the dura lining the spinal nerves and spinal cord. In some embodiments, the agent is placed around the great vessels after an anterior approach to the spine.
[0113] In some embodiments, the agent is used before, during, and/or after abdominal surgery to inhibit adhesions following abdominal surgery.
[0114] In some embodiments, the method is used in conjunction with spinal fusion and bone ingrowth for artificial disc replacement.
[0115] In some embodiments, the agent is incorporated into a hydrogel to effectuate slow release in the subject.
[0116] In some embodiments, the agent is released from a cardiac stent or other implant.
[0117] In some embodiments, one or more additional substances are administered such as agents that inactivate IgG in the subject (e.g., immunomodulating enzyme that hydrolyzes IgG in the subject, such as EndoS or IdeS).
[0118] An effective amount of an agent can be administered by one or multiple doses at one day or several days.
[0119] Agents that inhibit vascular endothelial cell phagocytosis can be administered to the body via a device such as a graft or other implant. In some embodiments, an agent that inhibits vascular endothelial cell phagocytosis is admixed with a matrix. Such a matrix can be a polymeric matrix, and can serve to bond the agent to a device. Polymeric matrices suitable for such use, include, for example, lactone-based polyesters or copolyesters such as polylactide, polycaprolactonglycolide, polyorthoesters, polyanhydrides, polyaminoacids, polysaccharides, polyphosphazenes, poly(ether-ester) copolymers (e.g. PEO-PLLA); polydimethylsiloxane, poly(ethylene-vinylacetate), acrylate-based polymers or copolymers (e.g. polyhydroxyethyl methylmethacrylate, polyvinyl pyrrolidinone), fluorinated polymers such as polytetrafluoroethylene and cellulose esters. Suitable matrices can be non-degrading or can degrade with time, releasing the agent(s), and optionally other compounds. An agent can be applied to the surface of a device by various methods such as dip/spin coating, spray coating, dip-coating, and/or brush-coating. An agent can be applied in a solvent and the solvent can be allowed to evaporate, thus forming a layer of agent onto the device. Alternatively, an agent can be located in the body of the device, for example in microchannels or micropores.
[0120] The method of the invention may be used in conjunction with other methods known in the art for treating demyelinating conditions, promoting the healing of wounds, and reducing scarring or treating fibrotic disorders. Numerous compounds have shown activity in the bleomycin animal model of pulmonary fibrosis, for example, and many of these can work additively or synergistically with agents and treatments used in the present invention to lead to a better therapeutic outcome; these are described in Moeller A., et al. The International Journal of Biochemistry and Cell Biology, 2008, 40:362-382. Specific examples are: N-acetyl cysteine, aminoguanidine, anti-VEGF antibody, Batimastat, Bosentan, dexamethasone, difluoromethylornithine, Etanercept, Gefitinib, Imatinib, methylprednisolone, Pentoxifylline, Pirfenidone, prednisolone, Rosiglitazone, TGF-beta antibody, TNF-alpha antibody, and Vinblastine.
[0121] Another aspect of the invention concerns a packaged dosage formulation for treating a demyelinating condition, comprising an agent that inhibits vascular endothelial cell phagocytosis in a pharmaceutically acceptable dosage in one or more packages, packets, or containers.
[0122] Another aspect of the invention concerns a kit for treating a demyelinating condition, comprising, in one or more containers, at least one agent that inhibits vascular endothelial cell phagocytosis. In some embodiments, the kit comprises a combination of two or more agents that inhibit vascular endothelial cell phagocytosis. In some embodiments, the kit further comprises an additional agent effective for inhibiting vascular endothelial cell phagocytosis. In some embodiments, the kit further comprises an additional agent effective for the treatment of one or more symptoms of a demyelinating condition.
[0123] Chemical reactions, reactants, and reagents that may be utilized to enhance solubility and make prodrugs of compounds are described in March's Advanced Organic Chemistry, 7.sup.th edition, 2013, Michael B. Smith, which is incorporated herein by reference in its entirety.
[0124] Agents that inhibit vascular endothelial cell phagocytosis, and compositions comprising them, useful in the methods of the subject invention can be formulated according to known methods for preparing pharmaceutically useful compositions. Formulations are described in detail in a number of sources which are well known and readily available to those skilled in the art. For example, Remington's Pharmaceutical Science by E. W. Martin describes formulations which can be used in connection with the subject invention. In general, the compositions of the subject invention will be formulated such that an effective amount of at least agent that inhibits vascular endothelial cell phagocytosis is combined with a suitable carrier or diluent in order to facilitate effective administration of the composition.
[0125] The compositions used in the present methods can also be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as tablets, pills, powders, liquid solutions or suspension, suppositories, injectable and infusible solutions, and sprays. The preferred form depends on the intended mode of administration and application. The compositions also preferably include conventional pharmaceutically acceptable carriers and diluents which are known to those skilled in the art. Examples of carriers or diluents for use with the active ingredients include, but are not limited to, water, saline, oils including mineral oil, ethanol, dimethyl sulfoxide, gelatin, cyclodextrans, magnesium stearate, dextrose, cellulose, sugars, calcium carbonate, glycerol, alumina, starch, and equivalent carriers and diluents, or mixtures of any of these. Formulations of the agents of the invention can also comprise suspension agents, protectants, lubricants, buffers, preservatives, and stabilizers. To provide for the administration of such dosages for the desired therapeutic treatment, pharmaceutical compositions of the invention will advantageously comprise between about 0.1% and 45%, and especially, 1 and 15% by weight of the total of one or more of the agents based on the weight of the total composition including carrier or diluent.
[0126] The agents that inhibit vascular endothelial cell phagocytosis can also be administered utilizing liposome technology, controlled release matrices, implantable pumps, and biodegradable containers. These delivery methods can, advantageously, provide a uniform dosage over an extended period of time.
[0127] The invention further provides kits, including at least one agent that inhibits vascular endothelial cell phagocytosis and pharmaceutical formulations, packaged into suitable packaging material, optionally in combination with instructions for using the kit components, e.g., instructions for performing a method of the invention. In one embodiment, a kit includes an amount of an agent that inhibits vascular endothelial cell phagocytosis, and instructions for administering an agent that inhibits vascular endothelial cell phagocytosis to a subject in need of treatment on a label or packaging insert. In further embodiments, a kit includes an article of manufacture, for delivering such an agent into a subject locally, regionally or systemically, for example.
[0128] As used herein, the term packaging material refers to a physical structure housing the components of the kit. The packaging material can maintain the components in a sterile state, and can be made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc.). The label or packaging insert can include appropriate printed and/or digital instructions, for example, for practicing a method of the invention, e.g., reducing demyelination or treating a demyelinating condition, an assay for identifying a subject having a demyelinating condition, etc. Thus, in additional embodiments, a kit includes a label or packaging insert including instructions for practicing a method of the invention in solution, in vitro, in vivo, or ex vivo.
[0129] Instructions can therefore include instructions for practicing any of the methods of the invention described herein. For example, pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration to a subject to reduce demyelination or to treat a demyelinating condition. Instructions may additionally include indications of a satisfactory clinical endpoint or any adverse symptoms that may occur, storage information, expiration date, or any information required by regulatory agencies such as the Food and Drug Administration or European Medicines Agency for use in a human subject.
[0130] The instructions may be digital or on printed matter, e.g., on paper or cardboard within the kit, on a label affixed to the kit or packaging material, or attached to a vial or tube containing a component of the kit. Instructions may comprise voice or video tape and additionally be included on a computer readable medium, such as a disk (diskette or hard disk), optical CD such as CD- or DVD-ROM/RAM, magnetic tape, electrical storage media such as RAM and ROM and hybrids of these such as magnetic/optical storage media.
[0131] Kits can additionally include a buffering agent, a preservative, or an agent for stabilizing at least one compound of the invention. The kit can also include components for assaying for the presence of demyelination or a demyelinating condition, a control sample or a standard. Each component of the kit can be enclosed within an individual container or in a mixture and all of the various containers can be within single or multiple packages.
[0132] Kits can include packaging material that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) including one of the separate elements to be used in a method described herein. Packaging materials for use in packaging pharmaceutical products include, by way of example only U.S. Pat. Nos. 5,323,907, 5,052,558 and 5,033,252. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, pumps, bags, vials, light-tight sealed containers, syringes, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
[0133] A kit may include one or more additional containers, each with one or more of various materials desirable from a commercial and user standpoint for use of the agents for reducing demyelination or for treating or preventing a demyelinating condition. Non-limiting examples of such materials include, but not limited to, buffers, diluents, carrier, package, container, vial and/or tube labels listing contents and/or instructions for use, and package inserts with instructions for use.
[0134] A label can be on or associated with a container containing an agent to be used in the method of the invention. A label can be on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. A label can be used to indicate that the contents are to be used for a specific therapeutic application. The label can also indicate directions for use of the contents, such as in the methods described herein.
[0135] In some embodiments of the kit, the agent(s) can be presented in a pack or dispenser device which can contain one or more unit dosage forms containing an agent disclosed herein. The pack can for example contain metal or plastic foil, such as a blister pack. The pack or dispenser device can be accompanied by instructions for administration. The pack or dispenser can also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the agent for human or veterinary administration. Such notice, for example, can be the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert. Compositions containing an agent provided herein formulated in a compatible pharmaceutical carrier can also be prepared, placed in an appropriate container, and labeled for treatment of an indicated demyelination or demyelinating condition.
Definitions
[0136] The terms compounds of the invention or compounds of the present invention (unless specifically identified otherwise), and grammatical variations thereof, refer to the compounds and classes of compounds disclosed herein, such as agents that inhibit vascular endothelial cell phagocytosis, including those specifically identified as well as a prodrug, metabolite, or derivative thereof, or a pharmaceutically acceptable salt of any of the disclosed agents, as well as all stereoisomers (including diastereoisomers and enantiomers), rotamers, tautomers and isotopically labeled compounds (including deuterium substitutions), as well as inherently formed moieties (e.g., polymorphs, solvates and/or hydrates). For purposes of this invention, solvates and hydrates are generally considered compositions.
[0137] The term a, an, the and similar terms used in the context of the present invention (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. Thus, for example, reference a cell or an agent should be construed to cover both a singular cell or singular agent and a plurality of cells and a plurality of agents unless indicated otherwise or clearly contradicted by the context.
[0138] The term agent refers to all materials that may be used as or in a pharmaceutical composition, or that may be a compound such as small synthetic or naturally derived organic compounds, nucleic acids, polypeptides, antibodies, fragments, isoforms, variants, or other materials that may be used independently for such purposes.
[0139] The term small molecule refers to a composition that has a molecular weight of less than about 3 kilodaltons (kDa), less than about 1 kDa, or less than about 1 kDa. Small molecules may be nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids, or other organic (carbon-containing) or inorganic molecules. A small organic molecule is an organic compound (or organic compound complexed with an inorganic compound (e.g., metal), that has a molecular weight of less than about 3 kDa, less than about 1.5 kDa, or less than about 1 kDa.
[0140] The term isolated, when used as a modifier of a composition of matter, such as a compound, means that the compositions are made by the hand of man or are separated from their naturally occurring in vivo environment. Generally, compositions so separated are substantially free of one or more materials with which they normally associate with in nature, for example, one or more protein, nucleic acid, lipid, carbohydrate, cell membrane. A substantially pure molecule can be combined with one or more other molecules. Thus, the term substantially pure does not exclude combinations of compositions. Substantial purity can be at least about 60% or more of the molecule by mass. Purity can also be about 70% or 80% or more, and can be greater, for example, 90% or more. Purity can be determined by any appropriate method, including, for example, UV spectroscopy, chromatography (e.g., HPLC, gas phase), gel electrophoresis (e.g., silver or coomassie staining) and sequence analysis (for nucleic acid and peptide). The compounds of the invention may be in isolated or substantially pure form.
[0141] The present invention includes derivatives of identified compounds, also referred to herein as pharmaceutically active derivatives. Pharmaceutically active derivative refers to any compound that upon administration to the subject or cell, is capable of providing directly or indirectly, the activity disclosed herein. The term indirectly also encompasses prodrugs which may be converted to the active form of the drug via endogenous enzymes or metabolism. The prodrug is a derivative of the agents according to the invention and presenting vascular endothelial cell phagocytosis inhibitory activity. The prodrug is converted into an agent according to the present invention by a reaction with an enzyme, gastric acid or the like under a physiological condition in the living body, e.g., by oxidation, reduction, hydrolysis or the like, each of which is carried out enzymatically. These compounds can be produced from compounds of the invention according to well-known methods. The term indirectly also encompasses metabolites of compounds according to the invention. Chemical reactions, reactants, and reagents useful for making derivatives can be found, for example, in March's Advanced Organic Chemistry, 7.sup.th edition, 2013, Michael B. Smith, which is incorporated herein by reference in its entirety.
[0142] The term metabolite refers to all molecules derived from any of the compounds according to the invention in a cell or organism, preferably mammal. Pharmaceutically active metabolites of the compounds of the invention may be administered to a subject or contacted with a cell in vitro or in vivo.
[0143] The term prodrug refers to a chemical compound that can be converted by the body (i.e., biotransformed) to another chemical compound that has pharmacological activity. The prodrug may itself have pharmacological activity before conversion, or be inactive before conversion and activated upon conversion. Active prodrugs or inactive prodrugs of compounds of the invention may be administered to a subject or contacted with a cell in vitro or in vivo. Instead of administering a drug directly, a prodrug may be used instead to improve how a drug is absorbed, distributed, metabolized, and excreted (ADME). For example, a prodrug may be used to improve bioavailability when a drug itself is poorly absorbed from the gastrointestinal tract, or to improve how selectively the drug interacts with cells or processes that are not its intended target, which can reduce adverse or unintended effects of a drug.
[0144] Pharmaceutical formulations include pharmaceutically acceptable and physiologically acceptable carriers, diluents or excipients. As used herein the terms pharmaceutically acceptable and physiologically acceptable carriers, dilutents, or excipients include solvents (aqueous or non-aqueous), solutions, emulsions, dispersion media, coatings, isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration. Such formulations can be contained in a liquid; emulsion, suspension, syrup or elixir, or solid form; tablet (coated or uncoated), capsule (hard or soft), powder, granule, crystal, or microbead. Supplementary compounds (e.g., preservatives, antibacterial, antiviral and antifungal agents) can also be incorporated into the compositions. The phrase pharmaceutically acceptable indicates that the substance or composition must be compatible chemically and/or toxicologically, with the other ingredients comprising a formulation, and/or the mammal and/or cells being treated therewith. Examples of pharmaceutically acceptable carriers include but are not limited to saline, buffered saline, isotonic salinle, Ringer's solultion, dextrose, sterile water, deionized water, glycerol, ethanol, 5% dextrose in water, propylene glycol, and combinations of two or more of the foregoing.
[0145] The phrase effective amount, in the context of a subject, means an amount of at least one agent of the invention that (i) treats or prevents the particular disease, condition, or disorder (e.g., demyelinating condition or fibrotic condition) in a subject, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder (e.g., demyelinating condition or fibrotic condition) in a subject, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein (e.g., demyelinating condition or fibrotic condition) in a subject. It is not necessary that the symptoms be completely alleviated, prevented, or delayed, though they may be.
[0146] The phrase effective amount, in the context of a cell in vitro or in vivo, means an amount of at least one agent that (i) treats or prevents the particular disease, condition, or disorder (e.g., demyelinating condition or fibrotic condition) in a cell, (ii) attenuates, ameliorates, or eliminates one or more effects of the particular disease, condition, or disorder (e.g., demyelinating condition or fibrotic condition) in a cell, or (iii) prevents or delays the onset of one or more effects of the particular disease, condition, or disorder described herein (e.g., demyelinating condition or fibrotic condition) in a subject.
[0147] As used herein, a subject is in need of a treatment if such human or non-human animal subject would benefit biologically, medically or in quality of life from such treatment (preferably, a human). In some embodiments, the subject has a demyelinating condition and is in need of therapy. In other embodiments, the subject does not have a demyelinating condition and is in need of prophylaxis. In some embodiments, the subject in need of prophylaxis is at risk of developing demyelination or a demyelinating condition. In some embodiments, the subject is at increased risk of developing demyelination or a demyelinating condition relative to others in the population. In some embodiments, the subject is suspected to have demyelination or a demyelinating condition.
[0148] As used herein, the term inhibit, inhibition or inhibiting refers to the reduction or suppression of a given condition, symptom, or disorder, or disease (e.g., demyelination or demyelinating condition, or a fibrotic condition), or a significant decrease in the baseline activity of a biological activity or process (inhibits or suppresses vascular endothelial cell phagocytosis).
[0149] As used herein, the terms subject, patient, and individual refer to a human or non-human animal. Typically, the animal is a mammal. A subject also refers to for example, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds and the like. The animal may be an animal model of a disease, such as experimental autoimmune encephalomyelitis (EAE). In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human. The subject may be any age or gender.
[0150] As used herein, the term treat, treating or treatment of any disease or disorder refers in one embodiment, to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another embodiment treat, treating or treatment refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the subject. In yet another embodiment, treat, treating or treatment refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. In yet another embodiment, treat, treating or treatment refers to prophylaxis (preventing or delaying the onset or development or progression of the disease or disorder).
[0151] As used herein, the term administration is intended to include, but is not limited to, the following delivery methods: topical, oral, parenteral, subcutaneous, transdermal, transbuccal, intravascular (e.g., intravenous or intra-arterial), intramuscular, subcutaneous, intranasal, and intra-ocular administration. Administration can be local at a particular anatomical site, such as a site of demyelination, suspected demyelination, or anticipated demyelination, or systemic. In some embodiments, the agent is administered directly into the subject's cerebrospinal fluid (CSF), e.g., by infusion, pump, or direct injection. For example, the agent may be administered intrathecally, by introduction into the spinal canal or into the subarachnoid space so that it reaches the CSF. In some embodiments, the agent is administered locally to tissue at a site of demyelination, suspected demyelination, or anticipated demyelination by injection or topical application.
[0152] The agents to be used in the present invention can be formulated into pharmaceutically-acceptable salt forms. Pharmaceutically-acceptable salts of the compounds of the invention can be prepared using conventional techniques. Pharmaceutically acceptable salt includes both acid and base addition salts. A pharmaceutically acceptable salt of any one of the compounds described herein is intended to encompass any and all pharmaceutically suitable salt forms. Preferred pharmaceutically acceptable salts described herein are pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.
[0153] Pharmaceutically acceptable acid addition salt refers to those salts which retain the biological effectiveness and properties of the free bases, which are not biologically or otherwise undesirable, and which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, hydroiodic acid, hydrofluoric acid, phosphorous acid, and the like. Also included are salts that are formed with organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, alkanedioic acids, aromatic acids, aliphatic and. aromatic sulfonic acids, etc. and include, for example, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. Exemplary salts thus include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, trifluoroacetates, propionates, caprylates, isobutyrates, oxalates, malonates, succinate suberates, sebacates, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, malates, tartrates, methanesulfonates, and the like. Also contemplated are salts of amino acids, such as arginates, gluconates, and galacturonates (see, for example, Berge S. M. et al., Pharmaceutical Salts, Journal of Pharmaceutical Science, 66:1-19 (1997), which is hereby incorporated by reference in its entirety). Acid addition salts of basic compounds may be prepared by contacting the free base forms with a sufficient amount of the desired acid to produce the salt according to methods and techniques with which a skilled person is familiar.
[0154] Pharmaceutically acceptable base addition salt refers to those salts that retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared from addition of an inorganic base or an organic base to the free acid. Pharmaceutically acceptable base addition salts may be formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, for example, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, N,N-dibenzylethylenediamine, chloroprocaine, hydrabamine, choline, betaine, ethylenediamine, ethylenedianiline, N-methylglucamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. See Berge et al., supra.
Materials and Methods
[0155] Reagents. Chemical reagents were purchased from Sigma-Aldrich (St. Louis, Mo.) and cell culture media was purchased from Invitrogen (Carlsbad, Calif.), unless otherwise indicated. Carboxyfluorescein succinimidyl ester (CFSE; # C1157) was from Life Technologies (Carlsbad, Calif.). 3-Methuladenine (3-MA; BML-AP502) was from Enzo Life Sciences (Farmingdale, N.Y.). Rapamycin (#553210) was purchased from EMD Millipore (Burlington, Mass.). Recombinant mouse TGF-1 (#5231) was from Cell Signaling Technology (Danvers, Mass.). Mouse MCP-1 ELISA kit (#432701) was from Bio Legend (San Diego, Calif.). Matrigel matrix growth factor reduced (#354230) was from BD Biosciences (San Jose, Calif.). Lysotracker red DND-99 (L7528; 1:5,000 for staining) was purchased from Invitrogen.
[0156] Antibodies. Anti-CD31 (#550274; 1:100 for IF) was from BD Biosciences (Franklin Lakes, N.J.). Anti-MBP (ab40390; 1:200 for IF; 1:1,000 for ELISA), anti-Ki-67 (ab15580; 1:200 for IF), anti-CD11b (ab133357; 1:100 for IF), anti-Von Willebrand Factor (vWF; ab11713; 1:100 for IF), anti-a-SMA (ab124964; 1:400 for IF), anti-fibronectin (ab23750; 1:200 for IF; 1:1,000 for WB), anti-collagen I (ab34710; 1:200 for IF), anti-GFAP (# ab53554, 1:400 and GAPDH (ab181602; 1:3,000 for WB) were purchased from Abcam (Cambridge, Mass.). The antibodies against LC3 (#4108; 1:100 for IF; WB 1:1,000), Atg5 (D5F5U, #12994, 1:1000 for WB), Rab5 (#3547; 1:50 for IF), Rab7 (#9367; 1:100 for IF) and GABARAP (#13733; 1:200 for IF) were purchased from Cell Signaling Technology (Danvers, Mass.). Another anti-MBP (MAB386; 1:1,000 for ELISA) was purchased from Millipore (Billerica, Mass.), anti-VCAM-1 (sc-8304; 1:250 for WB) was purchased from Santa Cruz Biotechnology (Dallas, Tex.) and anti-Lamp1 (1D4B; 1:25 for IF) was from Developmental Studies Hybridoma Bank. Anti-tubulin (DM1A; 1:5,000 for WB) was from Sigma-Aldrich (St. Louis, Mo.). Anti-p62 (PM045; 1:1,000 for WB) was from MBL (Woburn, Mass.). Anti-ubiquitin (FK2, # BML-PW8810-0500; 1:200 for IF) was from ENZO Life Sciences. Anti-Iba-1 (#019-19741, 1:200 for IF) was from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). F4/80 and Mac-2 antibodies were produced by hybridoma cell lines (HB-198 for F4/80; TIB-166 for Mac-2) from American Tissue Culture Collection (ATCC, Manassas, Va.). VEGF neutralizing antibody (# AF-493-NA, 20 g/ml for neutralization) and pan-TGF- neutralizing antibody (# MAB1835R-100, 20 g/ml for neutralization) were from R&D Systems (Minneapolis, Minn.). Alexa Fluor 488, 555, 647-conjuated secondary antibodies (1:600 for IF) and HRP-conjugated secondary antibody (1:3,000 for ELISA) were purchased from Invitrogen. IRDye-800CW or IRDye-680LT-conjugated secondary antibodies (1:20,000 for WB) were from LI-COR Bioscience.
[0157] Mice strains. C57BL/6J, C57BL/6-Tg (ACTB-EGFP)10sba and C3Fe.SWV-MBPshia mice were purchased from Jackson Laboratory (Bar Harbor, Me.) and maintained in pathogen-free animal facility in xxx. All animal protocols were approved by the Animal Care and Facilities Committee of xxx.
[0158] Spinal cord injury in mice. Thoracic spinal cord contusion injuries were performed on 8-10 week old C57BL/6J female mice. To expose the spinal cord, a laminectomy was performed on the T10 vertebrae. The contusion injury was induced using the NYU impactor with a 5 gram rod dropped 6.25 mm from the cord surface 1. Mice in the sham group were subjected to only a laminectomy without a contusion.
[0159] Active EAE induction in mice. EAE induction was performed as described previously with minor modifications 2, 3. All the animal experiments were approved by the Committee on the Use of Live Animals in Teaching and Research at xxx. 7-8 week old female C57BL/6J mice were used for EAE induction. The animals were housed in the Laboratory Animal Unit on a 12 hr day/night cycle, with food and water ad libitum, and were allowed to acclimatize for 1 week before disease induction.
[0160] Female mice were subcutaneously immunized with 200 g MOG35-55 peptide (Genscript, Piscataway, N.J.) in complete Freund's adjuvant (3 mg/ml). Freshly prepared pertussis toxin (PHZ1174,ThermoFisher250 ng) in sterile PBS was injected intraperitoneally on day 0 and 48 h later.
[0161] EAE symptoms were scored daily as follows: 0, no clinical signs; 0.5, partially limp tail; 1, paralyzed tail; 1.5, hindlimb paresis or loss in coordinated movement; 2, loss in coordinated movement and hindlimb paresis; 3, one hindlimb paralyzed; 4, both hindlimbs paralyzed; 5, hindlimbs paralyzed, weakness in forelimbs; 6, moribund.
[0162] Generation of GFP+ bone marrow chimeras. GFP+ bone marrow chimeric mice were generated according to previous publication 4. Briefly, female C57BL/6 mice of 8-10 weeks of age were exposed to irradiation with 10 Gy X-ray and then intravenously injected with 5106 bone marrow cells freshly collected from transgenic mice (C57BL/6-Tg(ACTB-EGFP)1Osb/J) constitutively expressing GFP. Efficient reconstitution was confirmed by postmortem examination of circulating blood for GFP+ cells. On average, 80% the transplant engraftment efficiency was achieved.
[0163] Cell cultures. Primary mouse brain microvascular endothelial cells (BMECs, # C57-6023; Cell Biologics, Chicago, Ill.) were cultured in complete mouse endothelial cell medium (Cell Biologics, Chicago, Ill.). The primary BMECs were confirmed by staining two endothelial-specific markers, CD31 and vWF. Primary BMECs cultures were used from passage 3 to 5 and they are all positive for both CD31 and vWF (data not shown). Mouse brain microvascular endothelial cell line (bEnd.3, CRL-2299) and a mouse neuroblastoma cell line, Neuro-2a (N2A, CCL-131) were purchased from ATCC. Endothelial cell line bEnd.3 and Neuro-2a cell line were cultured in DMEM containing 5% or 10% FBS and 1% penicillin/streptomycin.
[0164] Bone marrow-derived macrophages (BMDM) from female C57BL/6J mice were prepared as previously described 4. Briefly, bone marrow cells from mice 6-8 weeks of age were collected from femoral shafts by flushing the marrow cavity of femurs of with DMEM supplemented with 5% NCS. Cells were cultured for 7 days in DMEM supplemented with 15% conditioned medium from L929 cells (a source of M-CSF) and 5% NCS. All of the cell types were cultured in an incubator at 37 C., with 5% CO.sub.2.
[0165] Generation of Atg5 knockout EC cell line by CRISPR/Cas9 technique. Single guide RNA targeting sequence, atgaaggcacacccctgaaa (SEQ ID NO:24), was selected to target the third exon of mouse Atg5 gene. The expression of guide RNA & scaffold RNA is driven under U6 promoter. The U6 promotor and guide & scaffold cassette was incorporated into a Cas9 expressing backbone vector tagged with EGFP. The sequence of the U6 promotor, guide RNA & scaffold RNA was confirmed by the sequencing, then transfected into mouse endothelial cells line bEnd.3 using FuGENE 6 (# E2693, Promega) followed by the FACS sorting process. The method for CRISPR-Cas9 has not been published and a full characterization of this method will be published elsewhere. Forty eight hours later, cells were trypsinized into single cells, and sorted according to the GFP+ signal into 96-well plate. After colony expansion, the protein expression of Atg5 was analyzed by western blotting. The genomic DNA was extracted from those clones which completely lost the Atg5 protein expression, then the targeted region was PCR amplified with the primer set flanked the targeted region. PCR amplicons was purified with the PCR purification kit (#28104, QIAGEN), T7E1 (# E3321, NEB) assay was carried out to confirm the mismatch occurred at very specific site.
[0166] Preparation and fluorescent labeling of myelin debris. Myelin debris was isolated as described previously 5. The endotoxin concentration of myelin debris was below the detection limit by Pierce LAL Chromogenic Endotoxin Quantitation Kit (Thermo Fisher). The concentration of myelin debris was 1 mg/ml for cell culture throughout this study.
[0167] Fluorescent labeling of myelin debris was performed using a non-cytotoxic dye, CFSE. The dye enters the myelin debris by passive diffusion, where it covalently couples to free amine groups. Myelin debris (1 mg/ml) was labeled with 50 M CFSE and incubated protected from light at 37 C. for 15 min. The labeled myelin debris was washed with PBS containing 100 mM glycine at 14,000 rpm for 15 min, then washed with PBS twice at 14,000 rpm for 15 min each. The myelin debris pellets were collected and refilled to 100 l with PBS. CFSE-labeled myelin debris co-localizes with anti-MBP signals (
[0168] Myelin debris uptake assay. 2104 BMECs were seeded on coverslips in 24-well plates with medium containing 1% FBS. CFSE-labeled myelin debris was added to the BMECs cultures for indicated time periods at a final concentration of 1 mg/ml. Non-ingested myelin debris was washed away from cell surface with EDTA for 30 seconds, citric acid for 1 min. Myelin debris uptake was analyzed by standard assays including confocal fluorescent imaging, flow cytometry and ELISA detection of intracellular MBP as described below.
[0169] To study the roles of CR3 or Mac-2 in EC uptake of myelin debris, BMECs were pre-incubated with anti-CR3 or Mac-2 mAb (hybridoma supernatant) or control IgG for 3 hr. A combinated incubation of anti-CR3 and Mac-2 mAb was included to cover any compensatory effect. 1 mg/ml CFSE-labeled myelin debris was added and cultured for 72 hr. After removal of non-ingested myelin debris, BMECs on coverslips were analyzed for myelin uptake by fluorescent imaging. Meanwhile, BMDM were included as positive control cells to test the utility of the used neutralizing antibodies.
[0170] Serum-dependent uptake of myelin debris was performed as described above, except the use of FBS concentrations, where 0%, 1% or 5% FBS-containing medium were used to culture BMECs for 48 hr. We determined that cell viability was indistinguishable among the different serum concentrations during the 48 hr culture period (data not shown).
[0171] To test the requirement of IgG or complement opsonization for myelin debris uptake by BMECs, FBS was heated for 20 min at 56 C. to inactivate complement, and at 70 C. to inactivate IgG. The complement-inactivated or IgG-inactivated FBS was then used in BMECs cultures for the analysis of myelin debris uptake as described above.
[0172] Media containing no serum or IgG-inactivated serum were supplemented with 100 g/ml purified IgG to test whether IgG supplementation could rescue myelin debris uptake. CFSE-labeled myelin debris was then added in BMECs cultures for 72 hr, followed by MBP ELISA assay to detect engulfed myelin debris. To determine whether myelin debris pre-coated with IgG could bypass the requirement of IgG in medium for myelin debris uptake, IgG-opsonized myelin debris was added to BMECs culture medium with no serum or IgG-inactivated serum. IgG-opsonized myelin debris was first prepared by incubating myelin debris with 100 g/ml purified IgG at room temperature for 30 min and then overnight at 4 C. Afterwards, it was washed 3 times of PBS to remove uncoated IgG.
[0173] EC uptake of necrotic neuronal cell bodies and zymosan. Neuronal cells were differentiated from Neuro-2a (N2A) cells, a mouse neuroblastoma cell line as previously described 6. Briefly, N2A cells were normally cultured in DMEM medium with 10% FBS. To induce differentiation of N2A cells into neuronal cells, N2A cells were cultured in DMEM with 2% FBS and 20 M retinoic acid for 3 days, and medium was changed every 24 hr. Cells having one or more neurites of a length more than twice the diameter of the cell body were considered as differentiated neuronal cells. The N2A-differentiated neuronal cell bodies were generated by heating at 60 C. for 1 hr. The necrotic neuronal cell bodies were fluorescently labelled with CFSE and incubated with BMECs at 8:1 ratio for 72 hr, followed by immunostaining and confocal imaging. BMDM uptake of necrotic cell bodies was performed as positive control at the same ratio for 6 hr. For zymosan uptake, commercially available zymosan was labeled with CFSE and incubated with BMECs or BMDM for 72 hr and 3 hr, respectively.
[0174] Flow cytometry analysis of myelin debris uptake. BMECs were treated with or without CFSE-labeled myelin debris for 72 hr, and washed to remove non-ingested myelin debris. BMECs were collected and resuspended in PBS, followed by immediate detection with a BD FACS Canto flow cytometer (Becton Dickinson).
[0175] Enzyme-linked immunosorbent assay (ELISA) detection of engulfed myelin debris. To detect the engulfed myelin debris in ECs, we performed MBP-specific sandwich ELISA as previously described 7, 8, with rabbit MBP antibody being the capturing antibody and rat MBP antibody being the detecting antibody. Myelin-laden ECs were lysed in RIPA buffer with 1% protease inhibitor cocktail (ThermoFisher). Protein concentration was measured using BCA kit and 10 g of total protein was loaded for ELISA detection of MBP. Rabbit MBP antibody in coating buffer (0.5 M sodium carbonate buffer, pH 9.6) was bound to NUNC MaxiSorp ELISA plates (ThermoFisher) overnight at 4 C., followed by blocking with 2% BSA for 2 hr at 37 C. and washed five times with PBS containing 0.05% Tween-20. Lysates were added to react with MBP detecting antibody overnight at 4 C. Rat MBP antibody was used to detect immobilized MBP, followed by incubation with HRP-conjugated antibody and detection at 450 nm after reaction with TMB colorimetric substrates (#421101; BioLegend). ELISA detection of cytokines in cell culture supernatant was performed following the instructions of manufacturer.
[0176] Myelin debris engulfment by microvessels-like structures. Primary BMECs were seeded on the polymerized Matrigel and cultured at 37 C. for 24 hr to form the tubular structures and then incubated with CFSE-myelin debris. After removal of non-ingested myelin debris, cells on Matrigel-coated coverslips were fixed with 2% paraformaldehyde (PFA), followed by regular immunostaining.
[0177] Images were acquired with Nikon A1 laser scanning confocal microscope (Nikon, Japan) and the slice view of the tubular structures from both x-y axis and x-z axis was collected from the Nikon Elements analysis software.
[0178] Histology and immunofluorescent staining. To collect the spinal cords from SCI mice, EAE mice, or normal mice with spinal cord injections, mice were anaesthetized and then rapidly perfused transcardially with 0.9% saline, followed by 4% PFA. Spinal cords were rapidly collected and fixed in 4% PFA overnight, and then cryoprotected in 30% sucrose overnight at 4 C. before being sectioned for immunohistochemistry. For immunofluorescent staining, the sectioned slices were blocked with PBS containing 0.3% Triton X-100 and 1% BSA for 1 hr at room temperature. After incubation with primary antibodies overnight at 4 C., the samples were washed, followed by incubation with secondary antibodies for 1.5 hr at room temperature. Cell samples were fixed with 4% PFA in PBS for 20 min, permeabilized with 0.2% Triton X-100 for 8 min and blocked with 5% BSA for 30 min, then incubated with primary antibodies overnight at 4 C. followed by secondary antibodies at room temperature for 1.5 hr.
[0179] Histology quantification. Quantifications of microvessel size were performed by unbiased researchers. To quantify the size of microvessels in three consecutive regions (injured, marginal and uninjured) of SCI, we first classified the three regions with GFAP staining as a major reference according to a previous publication with modification 9. Using Nikon NIS-Elements software, the total area of the spinal cord and the area of the GFAP+ regions were outlined and measured at 200 m intervals over a 2 mm distance, centered on the lesion core. The injured regions were defined as the regions spanning with a radius of around 300 which were negative for GFAP but densely positive for nucleus staining (Hoechst staining). The marginal regions, within the GFAP glia scar, were considered as 300-600 m away from the epicenter, and the uninjured regions were considered as regions>600 m away from the epicenter. We usually analyzed the normal regions that were more than 1000 m away from epicenter. For microvessel size quantification in mouse EAE spinal cord samples, we measured microvessel diameter in both non-demyelinated and demyelinated regions in T10 segment, where mild demyelination occurred. At least 20 microvessels with clear CD31 signals on each region were included for diameter analysis using image J Pro Plus 6.0 (Media Cybernetics, Rockville, Md.).
[0180] To quantify the microvessel uptake of MBP+ myelin debris in mouse SCI samples, we focused on uninjured and injured regions as classified above. The uninjured region represents the region without myelin debris and the injured region represents the region that accumulates myelin debris. X-Y, X-Z and Y-Z views were included to carefully assess the presence of myelin puncta within microvessels. Microvessels containing at least one fluorescently clear MBP+ puncta were considered as myelin-containing microvessels.
[0181] To quantify the microvessel uptake of MBP+ myelin debris in mouse EAE samples, we focused on T10 regions at early time points (pre-onset stage) when mild demyelination, but not severe demyelination, occurred. This choice allowed us to observe the microvessel uptake of myelin debris before myelin removal by other professional phagocytes such as microglial cells. Similar quantification of myelin-containing microvessels were performed as above.
[0182] To quantify the Ki67 positive microvessels in SCI samples, the microvessels positive for both Ki67 and CD31 staining were counted in the injured regions of 1-weeks post SCI or normal spinal cords.
[0183] For quantification of GFP+ BMDC infiltration across microvessels at different time points of SCI, we stained spinal cord tissues with CD31 in GFP+ bone marrow chimeric mice after SCI and counted the number of GFP+ BMDCs that are closely associated with microvessels in one whole field with an area of 0.044 mm2.
[0184] For quantification of Iba-1+ cells in EAE microvessels, we stained Iba-1 and CD31 in T10 segment of 7 days post EAE spinal cords and counted the number of Iba-1+ cells showing close association with per normal-sized or enlarged microvessels. 15-days post EAE samples had similar results with 7 days post EAE samples in Iba-1+ cells association with enlarged microvessels.
[0185] Oil Red O (ORO) staining. ORO staining was performed to detect intracellular neutral lipid accumulation in injured spinal cords and cultured BMECs. Spinal frozen sections or fixed cells were dehydrated in 100% propylene glycol for 5 min, then stained with 0.5% ORO solution at 60 C. for 8 min. The samples were then processed with 85% propylene glycol for 5 min followed by distilled water rinsing for 3 times. Stained samples were imaged with a confocal laser scanning microscope.
[0186] Lysotracker red staining and analysis. BMECs were treated with or without CF SE-myelin debris for 72 hr. After washing away the non-ingested myelin debris, cells were stained by Lysotracker red (1:5,000) and Hoechst (1:1,000) for 15 min at 37 C. After three rapid washes in PBS, cells were imaged immediately with a Nikon A1 laser scanning confocal microscope using a 60/1.49NA oil immersion objective. The number and size of Lysotracker red positive puncta were analyzed using Image J Pro Plus 6.0. The size of Lysotracker red positive puncta was measured as the diameter of the puncta. More than 200 puncta in at least 20 cells from 3 independent experiments were measured.
[0187] Starvation and drug treatments for autophagy assays. BMECs cultured with 5% FBS containing medium were used as negative control for autophagy. The positive control for autophagy induction, BMECs, were starved with Hanks Balanced Salt Solution for 6 hr to induce autophagy. 10 M chloroquine, an inhibitor of lysosomes, or 1 M of rapamycin, an inducer of autophagy, was added to BMECs cultures for 24 hr after myelin debris treatment. 2 mM of 3-MA, a PI3K inhibitor of autophagy was cultured with ECs for 48 hr, starting from the last 24 hr treatment of myelin debris to the subsequent 24 hr of medium wash. Cells grown on coverslips were fixed and stained with Oil Red 0 for detection of myelin-derived lipids as above described.
[0188] Autophagy measurements and co-localization analysis. BMECs were immunostained with antibodies against endogenous LC3 or GABARAP. The number of LC3+ or GABARAP+ puncta per image was counted automatically with Image J after intensity thresholding of images.
[0189] The number of LC3+ puncta was counted from 3 independent experiments that include at least 50 cells every triplicate.
[0190] Co-localization between two channels of confocal images with maximum intensity projection was performed with Image Pro Plus. Pearson's correlation coefficient (R) was analyzed. Co-localization of Lysotracker red puncta and engulfed CFSE-myelin debris was analyzed on at least 10 cells from 3 independent experiments. The co-localization between myelin debris and autophagosomes or endosomes was performed in the same way. At least 10 cells from 3 independent experiments were included for the co-localization between myelin debris and autophagosomes by LC3 or GABARAP antibody staining, or co-localization between myelin and endosomes by Rab5 or Rab7 staining.
[0191] Propidium iodide (PI) staining assay for cell death analysis. Wild-type BMECs or Atg5 knockout BMECs were cultured with DMEM medium containing 5% FBS in 24-well plate. To test the toxicity of different autophagy-related drugs, BMECs were treated with or without myelin debris and were treated with or without 1 mM 3-MA (48 hr), 10 M chloroquine (24 hr), or 1 M rapamycin (24 hr). After reaching 70% confluence, cells were washed with 1PBS and fixed with 4% PFA. The fixed cells were stained with propidium iodide and Hoechst, followed by imaging and quantification of PI positive nucleus using Nikon Element software.
[0192] Image acquisition. Samples from spinal cords and cell culture were imaged with a Nikon Ti-E microscope (Nikon Instruments, Melville, N.Y.) using 10objective for large images acquisition with 25% overlapping. Regions of interest were imaged with Nikon A1 laser scanning confocal microscope using a 20objective or a 60/1.49NA oil immersion objective. All confocal images were acquired with a spacing of 0.25 m or 0.5 m between z-sections in Nikon NIS-Elements software and are maximum intensity projections of z stacks. In some images, volume view of xyz axis with or without 3D rendering, and slice view of x-y, x-z or y-z axis were applied. Gamma correction was applied in some images.
[0193] Quantitative RT-PCR. Total RNA from cells was extracted using TRIzol. cDNA was reverse transcribed from 1 g of RNA using qScript Flex cDNA Synthesis Kit (#95047; Quanta Biosciences, Beverly, Mass.) according to the manufacturer's instructions. A total of 20 L reaction system was prepared for quantitative RT-PCR using perfecta SYBR Green supermix (#95054; Quanta Biosciences). All reactions were run in triplicates using a real-time PCR system (CFX96; BioRad), and the specificity of every reaction was determined by a melting curve analysis. The expression level of target genes was normalized to GAPDH and calculated using the .sup.Ct method. Primers used for the reactions are as follows:
TABLE-US-00001 GAPDH-forward: (SEQIDNO:1) 5'-ATCAACGACCCCTTCATTGACC-3' reverse: (SEQIDNO:2) 5'-CCAGTAGACTCCACGACATACTCAGC-3' Il-4-forward: (SEQIDNO:3) 5'-TCAACCCCCAGCTAGTTGTC-3' reverse: (SEQIDNO:4) 5'-TGTTCTTCGTTGCTGTGAGG-3' Il-6-forward: (SEQIDNO:5) 5'-TGGGAAATCGTGGAAATGAG-3' reverse: (SEQIDNO:6) 5'-CTCTGAAGGACTCTGGCTTTG-3' Mcpl-forward: (SEQIDNO:7) 5'-ATGCAGGTCCCTGTCATGCTT-3' reverse: (SEQIDNO:8) 5'-CATTGGGATCATCTTGCTGGT-3' vegf-forward: (SEQIDNO:9) 5'-CAGGCTGCTGTAACGATGAA-3' reverse: (SEQIDNO:10) 5'-GCATTCACATCTGCTGTGCT-3' iNOS-forward: (SEQIDNO:11) 5'-TTGGAGCGAGTTGTGGATTGT-3' reverse: (SEQIDNO:12) 5'-GTAGGTGAGGGCTTGGCTGA-3' Collagen11-forward: (SEQIDNO:13) 5'-TGACTGGAAGAGCGGAGAGT-3' reverse: (SEQIDNO:14) 5'-AGACGGCTGAGTAGGGAACA-3' Collagen12-forward: (SEQIDNO:15) 5'-CACCCCAGCGAAGAACTCATA-3' reverse: (SEQIDNO:16) 5'-GCCACCATTGATAGTCTCTCC-3' Collagen52-forward: (SEQIDNO:17) 5'-TTGGAAACCTTCTCCATGTCAGA-3' reverse: (SEQIDNO:18) 5'-TCCCCAGTGGGTGTTATAGGA-3' -SMA-forward: (SEQIDNO:19) 5'-GTCCCAGACATCAGGGAGTAA-3' reverse: (SEQIDNO:20) 5'-TCGGATACTTCAGCGTCAGGA-3' Tgf-1-forward: (SEQIDNO:21) 5'-GGATACCAACTATTGCTTCAGCTCC-3' reverse: (SEQIDNO:22) 5'-AGGCTCCAAATATAGGGGCAGGGTC-3'
[0194] RNA-sequencing and data analysis. Mouse brain microvascular endothelial cells (bEnd.3) were plated at equal density in cell culture dishes and allowed to rest overnight prior to the addition of 1 mg/mL myelin debris prepared as previously described. Total RNA was isolated from each of 2 biological replicates for control and myelin debris treated cells for 72 hours using the TRIzol Plus RNA Purification Kit (Thermo Fisher). Selection of mRNA from total RNA was accomplished using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB # E7490). From the total mRNA obtained, cDNA was generated using the high fidelity ProtoScript II Reverse Transcriptase (NEB) with a random primer mix to generate fragments. The double-stranded cDNA was purified using 1.8 Agencourt AMPure XP Beads prior to end preparation for adaptor ligation. The ligation reaction was performed using AMPure XP Beads and enriched via PCR and followed by a final purification using the Agencourt AMPure XP Beads. Quality of the resulting library was examined using Agilent High Sensitivity DNA Bioanalyzer Chips (Agilent Technologies 5067-4626) and quantified by KAPA Library Quantification Kits for Illumina sequencing platforms (KAPA Biosystems KK4824). Single-end sequencing was performed on the Illumina HiSeq 2000 DNA Sequencer.
[0195] For mRNA-seq data analysis, the resulting sequences were trimmed of their Illumina indexing adaptors using Trimmomatic.sup.10. All reads between 50 and 100 bases were included in further analyses. Any reads with greater than 2 Ns were considered to be low quality, and thus discarded. Unique reads were aligned to the Mus musculus genome using TopHat2. A total of 4 mismatches between the reference genome and sample were allowed during alignment to account for strain differences between the endothelial cell line and the C57BL/6 reference genome. The TopHat2 mapped reads were further processed (filtered, sorted and indexed) with Samtools such that reads mapped to a single gene were used for further analysis.sup.11, 12. The uniquely mapped reads were then used to generate counts for each annotated gene using HTSeq (from Bioconductor version 3.0.2).sup.13. Finally, differential expression analysis of count tables for control versus myelin debris treated comparisons at each time point was performed in DESeq2 (1.8.1, Benjamini-Hochberg FDR correction).sup.14-16.
[0196] Western blot. BMECs were lysed in RIPA lysis and extraction buffer (G-Biosciences, MO) containing 1% protease inhibitor cocktail. Protein concentration of the lysates was measured using BCA kit. 50 g of total protein was resolved by either 4%-20% gradient SDS-PAGE gel or 7.5%-15% gel. SDS-PAGE gels were then transferred to PVDF membrane (Bio-rad) at 350 mA for 2 hr using a wet transfer system (Bio-rad). After blocking with 5% non-fat milk in TBST for 1 hr, the membrane was probed with primary antibodies diluted in TBST overnight at 4 C. After washing in TBST three times for 5 min each, the washed membrane was incubated with secondary antibodies conjugated with IRDye-800CW or IRDye-680LT for 1 hr at room temperature. The fluorescent signals of the probed bands were imaged with an Odyssey Infrared Imaging system (LI-COR Bioscience, Lincoln, Nebr.), followed by image processing in Adobe Photoshop CS4. Densitometric quantification of the bands was analyzed with Image J. All values were normalized to tubulin or GAPDH as indicated in figure legends.
[0197] Cells proliferation assay. Ki-67 labeling assay and cell number counting assay were used to assess the proliferation capacity of BMECs following myelin debris engulfment. Either 510.sup.3 cells or 210.sup.4 cells were seeded and cultured for 24 hr in 24-well plates for Ki-67 labeling or cell number counting, respectively, followed by treatment with or without 1 mg/ml myelin debris for 24-120 hr. For Ki-67 labeling, the fixed cells on coverslips were stained with anti-Ki-67 and Hoechst as marker of proliferation and nucleus. The Ki-67 and Hoechst signals were imaged using fluorescent microscope and counted with Nikon Elements software. The percentage of Ki-67.sup.+ and the total number of cells with Hoechst were calculated to show the proliferation capacity of endothelial cells. For cell counting assay, after the same treatment with Ki-67 assay, the cells in 24-well plates were trypsinized and counted using a hemocytometer.
[0198] To examine the role of autophagy in myelin-induced EC proliferation, myelin debris was added to wild-type or Atg5 knockout BMECs for 72 hr, followed by cell number counting.
[0199] To examine VEGF function in myelin-induced EC proliferation, VEGF neutralizing antibody (20 g/ml) or control IgG was added to BMECs 3 hr prior to myelin debris upload for 72 hr. Cell number was counted.
[0200] To examine ECs proliferation after engulfment of necrotic neuronal cell bodies, BMECs were seeded in 24-well plate and necrotic cell bodies were added to BMECs at 8:1 ratio. After co-culture for 72 hr, BMECs were stained with Hoechst to label nucleus. Necrotic cell bodies were negative for Hoechst staining. The number ECs was quantified by counting the nucleus number and calculated per mm.sup.2.
[0201] In vivo Matrigel plug angiogenesis assay. Matrigel plug angiogenesis assay was performed with a method modified from our previous publication.sup.17. Briefly, 810.sup.5 primary myelin-BMECs or nave BMECs were mixed with 100 l of pre-cooled Matrigel solution. The mixtures were subcutaneously injected in mice. Myelin-ECs, nave-ECs and PBS (as blank control) were injected in the same mouse at different sites. After implantation for 7 days, the Matrigel plugs were excised, immediately photographed with a MVX10 Macro Zoom microscope (Olympus), subsequently followed by regular tissue histology and immunofluorescent staining for CD31 to label microvessels, whose density was analyzed and calculated as the percentage of CD31 positive area to the whole field.
[0202] BMDM adhesion on endothelial cells. BDECs were seeded in 24-well plates and treated with or without 1 mg/ml CFSE-labeled myelin debris for 72 hr to induce myelin-ECs. After removal of the myelin debris remnant in the culture, 310.sup.5 BMDM were added to nave-ECs and myelin-ECs monolayer. After 1 hr adhesion, non-adhered BMDM were gently washed away with PBS for 5 times. The adhered BMDM on EC monolayer were stained with Mac-2 antibody and imaged by a combination of phase contrast and fluorescent microscopy for visualization of endothelial monolayer and Mac-2.sup.+ BMDM, respectively. The number of Mac-2.sup.+ BMDM that adhered on endothelial monolayer was counted and normalized to the number of ECs as the percentage of BMDM adhesion onto endothelial monolayer.
[0203] To investigate whether any remaining myelin debris in BMECs could affect BMDM adhesion, we treated BMECs with myelin debris in the presence of 70 C. heated serum (IgG-inactivated) for 72 hr. These BMECs, which were exposed to myelin debris but unable to engulf myelin debris, were used for the above macrophages adhesion assay.
[0204] To examine whether Atg5 knockout BMECs have any effects on macrophage adhesion, we performed the same assay using Atg5 knockout BMECs as above described.
[0205] BMDM chemotaxis towards endothelial cells supernatant. A modified transwell assay was used to examine BMDM chemotaxis towards EC's supernatant. After BMECs engulf myelin debris for three days, they were quickly washed with PBS three times. This step gets rid of most remaining non-engulfed myelin debris in ECs. After the washes, myelin-laden BMECs were cultured for 24 hr in fresh culture media, followed by collection of cell culture supernatant from the myelin-laden ECs. The cell culture supernatant was clarified by centrifugation to remove any remaining myelin debris. Then, the BMEC supernatant was placed in the bottom chamber of the transwell, and BMDM were seeded on the upper chamber. After chemotaxis for 6 hr, migrated BMDM on the lower side of the membrane were stained with crystal violet (Alfa Aesar).
[0206] Astrocytes-endothelial cells co-culture assay. Primary astrocytes were isolated from C57BL/6 mice between 2 and 3 days old.sup.18. The cerebral cortices were dissected and dissociated prior to plating in tissue culture flasks. The mixed glial cultures were grown in DMEM/F12 supplemented with 10% FBS, and 1% penicillin/streptomycin until reaching confluence. The flasks were then shaken at 200 rpm for 5 hours at 37 C. to get rid of microglia. After 4 rounds of shaking, the cells remaining in the flask were cultured as an enriched astrocyte primary culture which was confirmed by GFAP staining. For astrocytes-ECs co-culture, we used a transwell system where astrocytes were seeded in the lower chamber and BMECs were seeded in the upper chamber. 210.sup.4 non-reactive astrocytes or LPS-induced reactive astrocytes (LPS, 1,000 ng/ml for 18 hr.sup.19 were cultured in the transwell lower chamber with astrocytes medium (50% DMEM, 50% Ham's F-12 and 10% FBS) when they reached 90% confluency. Meanwhile, 210.sup.3 BMECs were cultured in an insert with 5% FBS in DMEM medium for 24 hr. Then, the inserts with the BMEC growths were placed into the lower chambers containing the astrocytes. These two cell types were co-cultured with astrocytes medium (50% DMEM, 50% Ham's F-12 and 1% FBS) for 72 hr and the BMECs in the insert were stained with Hoechst to label nuclei. The number of BMEC nuclei was then quantified using Nikon Element software. Negative control was included in this assay where only medium, no astrocytes were cultured with BMECs. Myelin-treated BMECs in the upper chamber were used as positive control.
[0207] In vitro endothelial-to-mesenchymal transition (endoMT) assays. 510.sup.3 BMECs were seeded in 24-well plate for endoMT induction. As positive control, recombinant TGF-1 protein (long/ml) was added to BMECs for 72 hr to induce in vitro endoMT. Cells were considered spindle-shaped when the diameter at their longest axis to be 1.5-fold greater than the average diameter of untreated cobblestone BMECs. Myelin debris (1 mg/ml) was added to BMECs for 1, 3, 5, 7, and 10 days and culture medium was changed every 3 days, followed by morphological observation of spindle-shape cells. -SMA staining was used to confirm the mesenchymal transition. Percentage of spindle-shaped cells and percentage of a-SMA.sup.+/CD31.sup.+ were quantified. To examine the role of TGF- in myelin-induced endoMT, pan TGF- neutralizing antibody (20 g/ml) was added to BMECs together with myelin debris for 10 days and re-supplemented every 3 days.
[0208] Spinal cord BMEC injection. BMECs were treated with myelin debris for 72 hr, followed by wash to remove non-ingested myelin debris. Myelin-laden BMECs were fluorescently labeled after incubation for 1 hr with 50 M CFSE in DMEM without serum. The CFSE-labeled BMECs were washed once for 5 min with 1PBS containing 100 mM glycine and twice with 1PBS. The CF SE-labeled BMECs were trypinsized and resuspended in cold 1PBS. The CFSE signals in nave-ECs and myelin-ECs were confirmed after labeling. The fluorescent intensity of CFSE in myelin-ECs were much more rapidly diluted than nave-ECs after subculture (data not shown), probably due to robust proliferation of myelin-ECs, as shown in
[0209] Statistical analysis. The statistical significance of the difference between control and experimental groups was determined by unpaired Student's t-test, unless otherwise indicated using Prism 7 (Graphpad, San Diego, Calif.). Differences were considered statistically significant when p<0.05. * denotes p<0.05, ** for p<0.01 and *** for p<0.001 as shown in figures. Data were shown as means.e.m.
References For Materials and Methods (Only)
[0210] 1. Young, W. Spinal cord contusion models. Prog Brain Res 137, 231-255 (2002). [0211] 2. Wu, H. et al. Caveolin-1 Is Critical for Lymphocyte Trafficking into Central Nervous System during Experimental Autoimmune Encephalomyelitis. The Journal of neuroscience: the official journal of the Society for Neuroscience 36, 5193-5199 (2016). [0212] 3. Mi, S. et al. LINGO-1 antagonist promotes spinal cord remyelination and axonal integrity in MOG-induced experimental autoimmune encephalomyelitis. Nature medicine 13, 1228-1233 (2007). [0213] 4. Wang, X. et al. Macrophages in spinal cord injury: phenotypic and functional change from exposure to myelin debris. Glia 63, 635-651 (2015). [0214] 5. Sun, X. et al. Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system. PLoS One 5, e9380 (2010). [0215] 6. Zeng, M. & Zhou, J. N. Roles of autophagy and mTOR signaling in neuronal differentiation of mouse neuroblastoma cells. Cellular signalling 20, 659-665 (2008). [0216] 7. Gitik, M., Liraz-Zaltsman, S., Oldenborg, P. A., Reichert, F. & Rotshenker, S. Myelin down-regulates myelin phagocytosis by microglia and macrophages through interactions between CD47 on myelin and SIRPalpha (signal regulatory protein-alpha) on phagocytes. J Neuroinflammation 8, 24 (2011). [0217] 8. Guo, L. et al. Rescuing macrophage normal function in spinal cord injury with embryonic stem cell conditioned media. Mol Brain 9, 48 (2016). [0218] 9. Hackett, A. R. et al. STAT3 and SOCS3 regulate NG2 cell proliferation and differentiation after contusive spinal cord injury. Neurobiology of disease 89, 10-22 (2016). [0219] 10. Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120 (2014). [0220] 11. Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome biology 14, R36 (2013). [0221] 12. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079 (2009). [0222] 13. Anders, S., Pyl, P. T. & Huber, W. HTSeqa Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166-169 (2015). [0223] 14. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 550 (2014). [0224] 15. Wu, H., Wang, C. & Wu, Z. A new shrinkage estimator for dispersion improves differential expression detection in RNA-seq data. Biostatistics 14 (2013). [0225] 16. Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B Methodol 57 (1995). [0226] 17. Wang, X. et al. MIF produced by bone marrow-derived macrophages contributes to teratoma progression after embryonic stem cell transplantation. Cancer Res 72, 2867-2878 (2012). [0227] 18. Wu, J., Wrathall, J. R. & Schachner, M. Phosphatidylinositol 3-kinase/protein kinase Cdelta activation induces close homolog of adhesion molecule L1 (CHL1) expression in cultured astrocytes. Glia 58, 315-328 (2010). [0228] 19. Chung, I. Y. & Benveniste, E. N. Tumor necrosis factor-alpha production by astrocytes. Induction by lipopolysaccharide, IFN-gamma, and IL-1 beta. Journal of immunology 144, 2999-3007 (1990).
[0229] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
[0230] Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Example 1Microvessels in the Demyelinating Spinal Cords Contain Myelin Debris
[0231] Microvessels in the lesion epicenter are lost during the first two days after SCI, whereas ECs proliferate and give rise to newly formed microvessels from 3 days after injury, restoring microvessel density to a normal level by 1 week after SCI.sup.15,16. We first examined whether these newly formed microvessels could engulf myelin debris. Myelin is intact in normal spinal cords and the uninjured spinal microvessels contain very little detectable myelin basic protein (MBP) (
[0232] To investigate whether our observation extends to other demyelinating disorders, we established myelin oligodendrocyte glycoprotein (MOG)-induced EAE model in mice (
Example 2In Vitro BMECs-Induced Microvessel-Like Structures Engulf Myelin Debris
[0233] Primary mouse brain microvascular endothelial cells (BMECs) grown on Matrigel as their substrate could form microvessel-like structures that mimics diverse aspects of microvessels.sup.20. After 72 hr incubation with microvessel-like tubules, CFSE (Carboxyfluorescein succinimidyl ester)-labeled myelin debris was seen as scattered puncta around or within the tubules (
Example 3In Vitro Engulfment of Myelin Debris by BMECs
[0234] We next investigated the kinetics and mechanisms of microvascular engulfment of myelin debris by using primary BMECs and a BMEC cell line bEnd.3. Both primary BMECs and bEnd.3 cells engulfed myelin debris in a time-dependent manner with predominant perinuclear distribution (
Example 4IgG Opsonization is Required for Effective Myelin Debris Engulfment by BMECs
[0235] Complement-3 receptor (CR3) and Mac-2 (Glactin-3) have been proposed as receptors for myelin debris phagocytosis by macrophages.sup.21 (
[0236] Macrophage phagocytic capacity can be mediated by serum-derived opsonins including antibodies and complement proteins.sup.23. To evaluate the role of opsonins on myelin debris engulfment, we cultured BMECs with myelin debris in different concentrations of serum. BMEC engulfment of myelin debris was stronger in the presence of 5% serum than that in 1% serum (
Example 5Transcriptional Profiles of ECs after Engulfing Myelin Debris
[0237] To understand the cellular and molecular alterations in ECs after myelin debris uptake, we performed RNA sequencing of ECs with (myelin-ECs) or without myelin debris engulfment (nave-ECs). Over 2,500 genes were significantly upregulated and over 4,000 genes were downregulated in myelin-ECs compared to nave-ECs (
[0238] Noteworthy, among the top 50 upregulated genes in myelin-ECs, collagen genes including Col12, Col5 2, Col161, Col62, all of which were remarkably upregulated (
TABLE-US-00002 TABLE 1 Top 25 KEGG pathways that were up-regulated and down-regulated in myelin-ECs. up-regulated down-regulated Pathway Name Adj P Pathway Name AdjP Metabolic pathways 4.69e08 Pathways in cancer 9.51e23 Protein digestion and 9.22e06 Focal adhesion 1.97e21 absorption Focal adhesion 1.96e05 Regutation of actin 2.08e19 cytoskeleton ECM-receptor 0.0001 Endocytosis 2.12e17 interaction Cytokine-cytokine 0.0014 MAPK signaling 3.84e13 receptor interaction pathway Arachidonic acid 0.0014 Axon guidance 1.66e12 metabolism Propanoate metabolism 0.0014 ECM-receptor interaction 2.38e12 p53 signaling pathway 0.0024 Adherens junction 2.38e12 Phagosome 0.0054 Notch signaling pathway 1.72e09 TGF-beta signaling 0.0058 GnRH signaling pathway 2.58e09 pathway Allograft rejection 0.0062 ErbB signaling pathway 2.77e09 Tight junction 0.0062 Tight junction 8.26e09 Hedgehog signaling 0.0062 Arrhythmogenic right 1.98e08 pathway ventricular cardiomyopathy (ARVC) Glutathione 0.0062 Calcium signaling 1.98e08 metabolism pathway MAPK signaling 0.0084 Phophatidylinositol 3.81e08 pathway signaling system Regulation of actin 0.0103 Wnt signaling pathway 4.56e08 cytoskeleton Autoimmune thyroid 0.0108 Bacterial invasion of 9.35e08 disease epithelial cells Ribosome 0.0128 Small cell lung cancer 1.31e07 Melanoma 0.0128 Amoebiasis 1.31e07 Complement and 0.0146 Dilated cardiomyopathy 1.62e07 coagulation cascades Salivary secretion 0.0148 Protein processing in 1.62e07 endoplasmic reticulum Axon guidance 0.0160 Fe gamma R-mediated 1.77e07 phagocytosis Alzheimer's disease 0.0160 Insulin signaling pathway 1.85e07 Pathways in cancer 0.0174 Hypertrophic 4.61e07 cardiomyopathy (HCM) Pyruvate metabolism 0.0178 ABC transporters 4.61e07
Example 6Engulfed Myelin Debris is Delivered to Lysosomal Degradation System Through Autophagy Pathway
[0239] The perinuclear localization of engulfed myelin debris within BMECs (
[0240] Myelin debris uptake increased the size of the lysosomes, especially those containing myelin debris (
[0241] We then asked through which route(s) myelin debris is delivered to lysosomes. Cargo can be delivered through endocytosis or autophagy pathway to lysosomes for degradation.sup.26. We first examined whether myelin debris colocalizes with endosomes in BMECs. There was almost no or little co-localization between myelin debris and the early (Rab5)/late (Rab7) endosomes (
[0242] RNA sequencing data revealed upregulation of autophagy genes including Gabarapl2, Gabarap, Atg12, LC3b, Atg5 and Atg3 in myelin-ECs (
[0243] We next examined whether genetically or pharmacologically inhibiting autophagy-lysosome pathway could block myelin degradation into neutral lipids. We generated EC cell lines deficient for autophagy by knocking out the Atg5 gene, a core autophagy gene, using CRISPR-Cas9 technique (
Example 7Microvessels are Enlarged in SCI and EAE Model
[0244] Although it is known that microvessel density is remarkably increased during the subacute phase of SCI.sup.15,16, little attention has been paid to the change in the morphology and structure of the newly formed microvessels. Compared to the microvessels with a mean diameter of 8.170.41 m in normal spinal cords, the microvessels in the injured core increased the mean diameter to 16.660.51 m after 1 week post SCI (
Example 8Engulfment and Autophagic Processing of Myelin Debris by ECs Promotes ECs Proliferation and Angiogenesis
[0245] The spatial difference in the microvascular size suggests the presence of lesion-related factors that could stimulate microvascular growth. We showed that myelin debris uptake significantly increased the Ki-67.sup.+ proliferative cells in both primary BMECs and the bEnd.3 cell line (
Example 9ECs Engulfment of Necrotic Neuronal Cell Bodies Inhibits Cell Proliferation
[0246] In addition to the myelin debris present in lesion core, dead cells, like necrotic neuronal cell corpses are also present following acute SCI. We wondered whether the dead cells could be another lesion-localized factor in microvascular EC proliferation and angiogenesis. We firstly found that BMECs could not only engulf small particles like myelin debris, but also take up the large necrotic neuronal cell bodies, which were generated by 60 C. heating of neuro-2a (N2A) cells-differentiated neuronal cells (
Example 10Myelin Debris Uptake by Microvascular ECs Stimulates Inflammatory Responses
[0247] Since neovascularization and inflammation occur simultaneously and persist in the injury site, we sought to examine whether myelin debris-primed ECs promote leukocyte infiltration. Using mice reconstituted with GFP.sup.+ bone marrow cells, we can track the distribution of the GFP.sup.+ bone marrow-derived cells (BMDCs), which have been previously identified as BMDM mainly in the injured spinal cords.sup.10. Consistent with previous findings, normal spinal cords had little or no GFP.sup.+ BMDM infiltration. However, BMDM infiltrated in the injured core and closely associated with newly formed microvessels following 3 days post SCI (
[0248] We next determined whether myelin debris uptake activates ECs, which is a critical step for the adhesion and trans-endothelial migration of leukocytes into tissues. There were a greater number of BMDM adhering to the myelin-ECs monolayer than that to the nave-ECs monolayer (
Example 11Enlarged Microvessels and ECs Contribute to Fibrotic Components Production
[0249] After SCI, a fibrotic scar forms and occupies the injury core, which is typically characterized by extensive deposition of collagen.sup.30 and fibronectin.sup.31. However, little is known about the cellular origin of such fibrotic scar in the injury core. Given the highly upregulated collagen genes in myelin-ECs (
[0250] We next investigated the mechanisms by which microvascular ECs in the injured core become pro-fibrotic. RNA sequencing identified the top upregulated genes implicated in fibrosis, including collagen genes Col12, Col5 2, Col161, and Col62 in myelin-ECs (
Example 12Engulfment and Autophagic Processing of Myelin Debris by ECs Induces Endothelial-to-Mesenchymal Transition (endoMT)
[0251] Interestingly, treatment with myelin debris for 10 days reduced CD31 expression in some BMECs (
[0252] While professional phagocytes such as BMDM and microglia are the major players in the clearance of myelin debris generated after demyelination, our in vitro and in vivo data demonstrated that microvascular ECs can act as amateur phagocytes to engulf myelin debris. We revealed that myelin debris uptake and autophagic processing by microvascular ECs have more important functions. EC uptake and processing of myelin debris cause a series of sequential events associated with disease progression, including inflammation, angiogenesis, and fibrotic scar formation.
[0253] Most of our knowledge of myelin debris phagocytosis comes from studies on macrophages and microglia. Receptors such as CR3, Mac-2, and LRP-1 are involved in myelin debris phagocytosis by macrophages/microglia.sup.21. Our study showed that ECs do not employ these receptors for myelin debris uptake. The naked myelin debris is not recognized by ECs and only IgG-opsonized myelin debris can be engulfed effectively, suggesting IgG receptors (FcRs) are involved in myelin debris engulfment by ECs. The family of FcRs is highly expressed in macrophages to regulate a multitude of immune responses by interaction with IgG, immune complexes, and opsonized particles or cells.sup.34. It is likely that ECs only express a small amount of FcRs that engage in the engulfment of IgG-opsonized myelin debris, and this may account for the limited phagocytic capacity of ECs compared to strong phagocytosis of myelin debris by BMDM. Compromised BBB leads to leakage of IgG in the injured area.sup.35, which may be the source of IgG for oposinization. Given the fact that brain ECs and other antigen presenting cells are able to engulf myelin debris and present myelin antigens to lymphocytes.sup.36, it is speculated that the specific antibodies may further opsonize myelin debris and facilitate its engulfment. Endogenous antibodies have been shown to promote the rapid clearance of myelin debris in mouse.sup.37, but it is unknown which cell type(s) benefit from the opsonization by antibody for myelin debris uptake. Because IgG opsonization is required for myelin debris uptake by ECs, but not BMDM (data not shown), we propose that ECs, rather than BMDM, are the major cell type that relies on antibody opsonization of myelin debris for in vivo myelin debris clearance.
[0254] Autophagy is a fundamental degradative pathway for degradation of intracellular proteins and organelles. One feature of autophagy is the formation of autophagosomes, which engulf cargoes and upon fusion with lysosomes form autolysosomes leading to the degradation of the enclosed materials.sup.28. Autophagy has recently emerged as an alternative mechanism for myelin debris clearance in Schwann cells.sup.38,39. Using autophagy-deficient ECs, we show that autophagy is required for myelin debris degradation in ECs. Furthermore, autophagic processing of myelin debris is crucial for proangiogenic, pro-inflammatory, and pro-fibrotic responses. However, if either ECs contact myelin debris but do not internalize it, or internalize myelin debris without autophagic processing, it does not elicit those responses, indicating that myelin debris causes consequences only after being engulfed and intracellularly processed. It would be valuable to investigate the in vivo role of EC autophagy in demyelinating disorders using endothelium-specific atg5 or atg7 knockout mouse model.sup.40.
[0255] The major form of vascular change in the injury area is angiogenesis during chronic stages of SCI. The newly formed microvessels are structurally abnormal, appearing dilated and more disorganized (
[0256] One of the most important features of neuroinflammation is the leukocyte recruitment from the blood circulation into the CNS, which requires the activation of ECs through an increased expression of adhesion molecules and secretion of cytokines/chemokines in ECs.sup.43. Our study demonstrates that myelin debris engulfment activates microvascular ECs by increasing expression of adhesion molecules such as VCAM-1 and a variety of cytokines/chemokines that could facilitate BMDM recruitment to injury site. Our RNA sequencing data suggests myelin debris might also promote BMDM influx to injury site by increasing microvascular permeability to leukocytes, as indicated by the downregulation of genes related to cell junctions in myelin-ECs.
[0257] The fibrotic scars in the central region of injury sites, characterized by the excessive accumulation of pro-fibrotic proteins such as collagen and fibronectin, have been known to inhibit axon regeneration.sup.44. Fibroblasts, which are prominent in the injured epicenter, contribute to fibrotic scar formation by stimulating the production of collagen.sup.30 and fibronectin.sup.31. However, little is known about the cellular origin of fibroblasts in contusive injured spinal cords, whose dura is generally left intact and do not permit the invasion of meningeal fibroblasts into lesions.sup.30,31,45. Our study demonstrated that enlarged microvessels contribute to the significant deposition of fibrotic components in SCI and EAE models. Soderblom et al reported contribution of perivascular fibroblasts from larger-diameter microvessels (in our study, we referred to them as enlarged or dilated microvessels) to Col11 production and fibrotic scar formation using Col11-GFP transgene, which is consistent with our results.sup.30. The exact cellular identity of perivascular fibroblasts is not very clear, given that different cell types can share the same cell maker and some cell types can have further sub-types. The activated fibroblasts, or myofibroblasts, may arise from other sources including resident fibroblasts, perivascular pericytes, bone marrow-derived precursors and others.sup.46.
[0258] It has been recently reported that ECs have greater plasticity than was previously acknowledged, and can acquire fibroblast-like properties by undergoing endoMT.sup.33. Our study demonstrated that microvascular ECs could become fibroblasts-like cells after myelin uptake via endoMT. This suggests microvascular ECs are an additional source of fibroblasts or fibroblasts-like cells for fibrotic scar formation at the SCI lesion core. It is likely that the Col11-GFP transgene labels only a subset of collagen-producing cells, which may account for the 27% of CD13.sup.+ Col11-GFP cells.sup.30. CD13 is a marker that labels ECs and other cell types like pericytes. Interestingly, it takes a few days for myelin debris to significantly increase expression of fibronectin, collagen, and -SMA in microvascular ECs, coinciding with the delayed accumulation of perivascular fibroblasts at the injury core.sup.47. EndoMT occurs during SCI and EAE, as indicated by the expression of mesenchymal marker -SMA in microvessels. Endothelial lineage-tracking system could be applied in the future to confirm the endothelial origin of these fibroblasts-like cells in microvessels. We further determined that myelin debris induces endoMT via TGF-1-dependent mechanism. We showed myelin debris upregulates TGF-1 expression and TGF- signaling is required for myelin debris-induced endoMT. TGF signaling has been known as a master regulator of endoMT.sup.33 and participates in the formation of fibrotic scars in the injury site.sup.48,49. The TGF- signaling is activated in several cell types within SCI lesion, including macrophages, astrocytes as well as ECs in blood vessels.sup.44,50. Thus, we propose that TGF signaling-mediated endoMT in ECs may underlie the effects of TGF signaling on fibrotic scar formation in SCI lesions.
[0259] We have shown that microvessels and lining microvascular ECs act as amateur phagocytes to engulf myelin debris generated by CNS disorders associated with prominent demyelination. Mechanistically, we determined that IgG opsonization of myelin debris is required for efficient uptake by microvascular ECs. The engulfed myelin debris is then delivered through autophagy-lysosome pathway for intracellular degradation. Functionally, engulfment and autophagy-dependent processing of myelin debris by microvascular ECs contribute to three critical processes that are closely associated with CNS demyelinating disorders: robust angiogenesis that results in excessive and abnormal microvessels, chronic inflammation, and endothelial-mediated fibrosis that most likely takes place through endoMT (
Exemplified Embodiments
[0260] Exemplified embodiments of the invention include, but are not limited to:
Embodiment 1
[0261] A method for treating a demyelinating condition in a human or animal subject, comprising administering an agent to the subject that inhibits vascular endothelial cell phagocytosis.
Embodiment 2
[0262] The method of embodiment 1, wherein the demyelinating condition is associated with a neural injury.
Embodiment 3
[0263] The method of embodiment 2, wherein the neural injury is an injury of the peripheral nervous system (PNS), central nervous system (CNS), or both.
Embodiment 4
[0264] The method of embodiment 3, wherein the neural injury is an injury of the CNS.
Embodiment 5
[0265] The method of embodiment 4, wherein neural injury is a spinal cord injury (SCI).
Embodiment 6
[0266] The method of embodiment 1, wherein the subject has the demyelinating condition at the time of administering the agent to the subject, and the agent is administered as therapy.
Embodiment 7
[0267] The method of embodiment 1, wherein the subject does not have the demyelinating condition at the time of administering the agent to the subject, and the agent is administered as prophylaxis to prevent, delay onset or recurrence, or to reduce the severity of a potential demyelinating condition.
Embodiment 8
[0268] The method of any preceding embodiment, wherein the demyelinating condition is selected from among spinal cord injury, traumatic brain injury, multiple sclerosis (MS), Alzheimer's disease, autoimmune encephalomyelitis, acute disseminated encephalomyelitis (ADEM), Balo's disease (concentric sclerosis), Charcot-Marie-Tooth disease (CMT), Guillaian Barre Syndrome (GBS), HTLV-1-associated myelopathy (HAM), neuromyelitis optica (Devic's disease), Schilder's disease, transverse myelitis, congenital metabolic disorder with demyelination, neuropathy with abnormal myelination, drug-induced demyelination, radiation-induced demyelination, hereditary demyelination condition, prion-induced demyelination, encephalitis-induced demyelination, and chronic inflammatory demyelinating neuropathy.
Embodiment 9
[0269] The method of embodiment 8, wherein the chronic inflammatory demyelinating neuropathy is selected from among chronic Immune Demyelinating Polyneuropathy (CIDP); multifocal CIDP; multifocal motor neuropathy (MMN); anti-MAG Syndrome (Neuropathy with IgM binding to Myelin-Associated Glycoprotein); GALOP Syndrome (Gait disorder Autoantibody Late-age Onset Polyneuropathy); anti-sulfatide antibody syndrome; anti-GM2 gangliosides antibody syndrome; POEMS syndrome (Polyneuropathy Organomegaly Endocrinopathy or Edema M-protein Skin changes); perineuritis; and IgM anti-GD1b ganglioside antibody syndrome.
Embodiment 10
[0270] The method of any preceding embodiment, wherein the agent inhibits the autophagy-lysosome pathway in vascular endothelial cells.
Embodiment 11
[0271] The method of any preceding embodiment, wherein the agent is a MAP kinase inhibitor (e.g., SP600125, U0126, SB202190, and SB203580), PI3K inhibitor (e.g., 3-methyladenine, LY294002, and Wortmannin), protein biosynthesis inhibitor (e.g., cycloheximide), Vacuolar-type H (+)-ATPase (V-ATPase) inhibitor (e.g., bafilomycin), lysosomal lumen alkalyzer (e.g., chloroquine, hydroxychloroquine, NH4C1, neutral red, Lys01,and Lys05), acid protease inhibitor (e.g., leupeptin, E64d, and pepstatin A), or endosome inhibitor (e.g., Bafilomycin A1, and chloroquine).
Embodiment 12
[0272] The method of embodiment 10, wherein the agent that inhibits the autophagy-lysosome pathway is selected from among: 3-methyladenine (3-MA), CPD18 (a.k.a. 3-methyl-6-(3-methylpiperidin-1-yl)-3H-purine), bafilomycin A1, chloroquine, hydroxychloroquine, LY294002 (a.k.a. 2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one), SB202190, SB203580, SC79, Wortmannin (a.k.a. SL-2052), SP600125 (a.k.a. 1,9-Pyrazoloanthrone), U0126 (a.k.a. (2Z,3Z)-2,3-bis[amino-(2-aminophenyl)sulfanylmethylidene]butanedinitrile), MHY1485 (a.k.a. 4,6-dimorpholino-N-(4-nitrophenyl)-1,3,5-triazin-2-amine), autophinib, azithromycin, ()-Bay K 8644, concanamycin A (a.k.a. folimycin), DBeQ (a.k.a. N2,N4-Bis(phenylmethyl)-2,4-quinazolinediamine), E 64d (a.k.a. (2 S,3 S)-3-[[[(1 S)-3-Methyl-1-[[(3-methylbutyl)amino]carbonyl]butyl]amino]carbonyl]-2-oxiranecarboxylic acid ethyl ester), edaravone (a.k.a. MCI 186), GW 4064 (a.k.a. 3-[2-[2-Chloro-4-[[3-(2,6-dichlorophenyl)-5-(1-methylethyl)-4-isoxazolyl]methoxy]phenyl]ethenyl]benzoic acid), Mdivi 1 (a.k.a. 3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(1H)-quinazolinone), ML 240 (2-(2-Amino-1H-benzimidazole-1-yl)-8-methoxy-N-(phenylmethyl)-4-quinazolinamine), MRT 67307 (a.k.a. N-[3-[[5-Cyclopropyl-2-[[3-(4-morpholinylmethyl)phenyl]amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), MRT 68601 (N-[3-[[5-Cyclopropyl-2-[[4-(4-morpholinyl)phenyl]amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), MRT 68921 (a.k.a. N-[3-[[5-Cyclopropyl-2-[(1,2,3,4-tetrahydro-2-methyl-6-isoquinolinyl)amino]-4-pyrimidinyl]amino]propyl]cyclobutanecarboxamide), NMS 873 (3-[3-(Cyclopentylthio)-5-[[[2-methyl-4-(methylsulfonyl)[1,1-biphenyl]-4-yl]oxy]methyl]-4H-1,2,4-triazol-4-yl]pyridine), nocodazole (a.k.a. [5-(2-Thienylcarbonyl)-1H-benzimidazol-2-yl]carbonic acid, methyl ester), pepstatin A, apautin 1 (a.k.a. 6-Fluoro-N-[(4-Fluorophenyl)methyl]-4-quinazolinamine), taxol (a.k.a. paclitaxel), vinblastine (a.k.a. vincaleukoblastine), xanthohumol (a.k.a. (2E)-1-[2,4-Dihydroxy-6-methoxy-3-(3-methyl-2-buten-1-yl)phenyl]-3-(4-hydroxyphenyl)-2-propen-1-one), Tetrahydroacridine 33 (a.k.a. 6-Chloro-N-(1-ethylpiperidin-4-yl)-1,2,3,4-tetrahydroacridin-9-amine), Thapsigargin (a.k.a. 3 S,3aR,4S,6S,6aR,7S,8S,9b S)-6-(Acetyloxy)-4-(butyryloxy)-3,3a-dihydroxy-3,6,9-trimethyl-8-{[(2Z)-2-methylbut-2-enoyl]oxy}-2-oxo-2,3,3a,4,5,6,6a,7,8,9b-decahydroazuleno[4,5-b]furan-7-yl octanoate), ARN5187 (a.k.a. 4-(((1-(2-Fluorophenyl)cyclopentyl)-amino)methyl)-2-((4-methylpiperazin-1-yl)methyl)phenol), Spautin-1 (6-fluoro-N-[4-fluorobenzyl]quinazolin-4-amine), N-acetyl cysteine (a.k.a. NAC), L-asparagine (a.k.a. (S)-2-Aminosuccinic acid 4-amide), Catalase from human erythrocytes (a.k.a. H.sub.2O.sub.2:H.sub.2O.sub.2 oxidoreductase), E-64d (a.k.a. (2S,3S)-trans-Epoxysuccinyl-L-leucylamido-3-methylbutane ethyl ester, GMX1778 (a.k.a. N-[6-(4-Chlorophenoxy)hexyl]-N-cyano-N-4-pyridinyl-guanidine), Leupeptin (a.k.a. Acetyl-Leu-Leu-Arg-al), and SBI-0206965 (a.k.a. 2-((5-Bromo-2-((3,4,5-trimethoxyphenyl)amino)pyrimidin-4-yl)oxy)-N-methylbenzamide).
Embodiment 13
[0273] The method of embodiment 10, wherein the agent that inhibits the autophagy-lysosome pathway is selected from among an antisense, RNA-interference molecule (e.g., shRNA), and microRNA(e.g., MiR-101 and MiR-30a) that targets a component of the autophagy-lysosome pathway (e.g., ATG5) in vascular endothelial cells by blocking or reducing the component's expression, as a genetic intervention.
Embodiment 14
[0274] The method of embodiment 10, wherein the agent that inhibits the autophagy-lysosome pathway is an agent that inhibits ATG5 in vascular endothelial cells.
Embodiment 15
[0275] The method of any preceding embodiment, wherein the agent depletes immunoglobulin G (IgG) or inactivates IgG in the subject.
Embodiment 16
[0276] The method of embodiment 15, wherein the agent that inactivates IgG is an enzyme that hydrolyzes IgG, such as EndoS or IdeS.
Embodiment 17
[0277] The method of any one of embodiments 1 to 9, wherein the agent inhibits immunoglobulin G (IgG) opsonization of myelin debris.
Embodiment 18
[0278] The method of embodiment 17, wherein the agent blocks the Fc receptor on vascular endothelial cells in the subject.
Embodiment 19
[0279] The method of embodiment 18, wherein the Fc-gamma receptor is the FcRn receptor.
Embodiment 20
[0280] The method of embodiment 18 or 19, wherein the agent is a monoclonal or polyclonal antibody, antigen-binding fragment thereof, peptide, or small molecule that binds to the Fc-gamma receptor.
Embodiment 21
[0281] The method of embodiment 15, wherein the agent that depletes IgG is a B-cell-attenuating agent, such as bortezomib or rituximab.
Embodiment 22
[0282] The method of any preceding embodiment, wherein the agent is administered locally at a anatomical site.
Embodiment 23
[0283] The method of embodiment 22, wherein the desired anatomical site is a site where demyelination exists or is at risk of occurring.
Embodiment 24
[0284] The method of any preceding embodiment, wherein the agent is administered directly into the cerebrospinal fluid (CSF) of the subject.
Embodiment 25
[0285] A packaged dosage formulation for treating a demyelinating condition, comprising an agent that inhibits vascular endothelial cell phagocytosis in a pharmaceutically acceptable dosage.
Embodiment 26
[0286] A kit for treating a demyelinating condition, comprising, in one or more containers, at least one agent that inhibits vascular endothelial cell phagocytosis.
[0287] It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.
REFERENCES (OTHER THAN MATERIALS & METHODS SECTIONS)
[0288] 1. Ahuja, C. S., et al. Traumatic spinal cord injury. Nature reviews. Disease primers 3, 17018 (2017). [0289] 2. Schwab, M. E. & Bartholdi, D. Degeneration and regeneration of axons in the lesioned spinal cord. Physiological reviews 76, 319-370 (1996). [0290] 3. Franklin, R. J. & Ffrench-Constant, C. Remyelination in the CNS: from biology to therapy. Nature reviews. Neuroscience 9, 839-855 (2008). [0291] 4. Chen, M. S., et al. Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1. Nature 403, 434-439 (2000). [0292] 5. Filbin, M. T. Myelin-associated inhibitors of axonal regeneration in the adult mammalian CNS. Nature reviews. Neuroscience 4, 703-713 (2003). [0293] 6. Kotter, M. R., Li, W. W., Zhao, C. & Franklin, R. J. Myelin impairs CNS remyelination by inhibiting oligodendrocyte precursor cell differentiation. The Journal of neuroscience: the official journal of the Society for Neuroscience 26, 328-332 (2006). [0294] 7. Syed, Y. A., et al. Antibody-mediated neutralization of myelin-associated EphrinB3 accelerates CNS remyelination. Acta Neuropathol 131, 281-298 (2016). [0295] 8. Jeon, S. B., Yoon, H. J., Park, S. H., Kim, I. H. & Park, E. J. Sulfatide, a major lipid component of myelin sheath, activates inflammatory responses as an endogenous stimulator in brain-resident immune cells. Journal of immunology 181, 8077-8087 (2008). [0296] 9. Sun, X., et al. Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system. PLoS One 5, e9380 (2010). [0297] 10. Wang, X., et al. Macrophages in spinal cord injury: phenotypic and functional change from exposure to myelin debris. Glia 63, 635-651 (2015). [0298] 11. Napoli, I. & Neumann, H. Protective effects of microglia in multiple sclerosis. Experimental neurology 225, 24-28 (2010). [0299] 12. Neumann, H., Kotter, M. R. & Franklin, R. J. Debris clearance by microglia: an essential link between degeneration and regeneration. Brain: a journal of neurology 132, 288-295 (2009). [0300] 13. Guo, L., et al. Rescuing macrophage normal function in spinal cord injury with embryonic stem cell conditioned media. Mol Brain 9, 48 (2016). [0301] 14. Ponath, G., et al. Myelin phagocytosis by astrocytes after myelin damage promotes lesion pathology. Brain: a journal of neurology 140, 399-413 (2017). [0302] 15. Ng, M. T., Stammers, A. T. & Kwon, B. K. Vascular disruption and the role of angiogenic proteins after spinal cord injury. Transl Stroke Res 2, 474-491 (2011). [0303] 16. Whetstone, W. D., Hsu, J. Y., Eisenberg, M., Werb, Z. & Noble-Haeusslein, L. J. Blood-spinal cord barrier after spinal cord injury: relation to revascularization and wound healing. Journal of neuroscience research 74, 227-239 (2003). [0304] 17. Rengarajan, M., Hayer, A. & Theriot, J. A. Endothelial Cells Use a Formin-Dependent Phagocytosis-Like Process to Internalize the Bacterium Listeria monocytogenes. PLoS pathogens 12, e1005603 (2016). [0305] 18. Dini, L., et al. Phagocytosis of apoptotic bodies by liver endothelial cells. J Cell Sci 108 (Pt 3), 967-973 (1995). [0306] 19. Steffan, A. M., Gendrault, J. L., McCuskey, R. S., McCuskey, P. A. & Kim, A. Phagocytosis, an unrecognized property of murine endothelial liver cells. Hepatology 6, 830-836 (1986). [0307] 20. Arnaoutova, I. & Kleinman, H. K. In vitro angiogenesis: endothelial cell tube formation on gelled basement membrane extract. Nat Protoc 5, 628-635 (2010). [0308] 21. Smith, M. E. Phagocytic properties of microglia in vitro: implications for a role in multiple sclerosis and EAE. Microscopy research and technique 54, 81-94 (2001). [0309] 22. Gaultier, A., et al. Low-density lipoprotein receptor-related protein 1 is an essential receptor for myelin phagocytosis. J Cell Sci 122, 1155-1162 (2009). [0310] 23. Hart, S. P., Smith, J. R. & Dransfield, I. Phagocytosis of opsonized apoptotic cells: roles for old-fashioned receptors for antibody and complement. Clinical and experimental immunology 135, 181-185 (2004). [0311] 24. Jones, F. S. The Effect of Heat on Antibodies. The Journal of experimental medicine 46, 291-301 (1927). [0312] 25. Vermeer, A. W. & Norde, W. The thermal stability of immunoglobulin: unfolding and aggregation of a multi-domain protein. Biophysical journal 78, 394-404 (2000). [0313] 26. Tooze, S. A., Abada, A. & Elazar, Z. Endocytosis and autophagy: exploitation or cooperation? Cold Spring Harb Perspect Biol 6, a018358 (2014). [0314] 27. Shpilka, T., Weidberg, H., Pietrokovski, S. & Elazar, Z. Atg8: an autophagy-related ubiquitin-like protein family. Genome Biol 12, 226 (2011). [0315] 28. Mizushima, N., Yoshimori, T. & Levine, B. Methods in mammalian autophagy research. Cell 140, 313-326 (2010). [0316] 29. Deshmane, S. L., Kremlev, S., Amini, S. & Sawaya, B. E. Monocyte chemoattractant protein-1 (MCP-1): an overview. Journal of interferon & cytokine research: the official journal of the International Society for Interferon and Cytokine Research 29, 313-326 (2009). [0317] 30. Soderblom, C., et al. Perivascular fibroblasts form the fibrotic scar after contusive spinal cord injury. The Journal of neuroscience: the official journal of the Society for Neuroscience 33, 13882-13887 (2013). [0318] 31. Zhu, Y., Soderblom, C., Trojanowsky, M., Lee, D. H. & Lee, J. K. Fibronectin Matrix Assembly after Spinal Cord Injury. J Neurotrauma 32, 1158-1167 (2015). [0319] 32. Ignotz, R. A. & Massague, J. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. The Journal of biological chemistry 261, 4337-4345 (1986). [0320] 33. Piera-Velazquez, S., Mendoza, F. A. & Jimenez, S. A. Endothelial to Mesenchymal Transition (EndoMT) in the Pathogenesis of Human Fibrotic Diseases. Journal of clinical medicine 5 (2016). [0321] 34. Guilliams, M., Bruhns, P., Saeys, Y., Hammad, H. & Lambrecht, B. N. The function of Fcgamma receptors in dendritic cells and macrophages. Nat Rev Immunol 14, 94-108 (2014). [0322] 35. Winkler, E. A., Bell, R. D. & Zlokovic, B. V. Central nervous system pericytes in health and disease. Nature neuroscience 14, 1398-1405 (2011). [0323] 36. Lopes Pinheiro, M. A., et al. Internalization and presentation of myelin antigens by the brain endothelium guides antigen-specific T cell migration. eLife 5 (2016). [0324] 37. Vargas, M. E., Watanabe, J., Singh, S. J., Robinson, W. H. & Barres, B. A. [0325] Endogenous antibodies promote rapid myelin clearance and effective axon regeneration after nerve injury. Proceedings of the National Academy of Sciences of the United States of America 107, 11993-11998 (2010). [0326] 38. Brosius Lutz, A., et al. Schwann cells use TAM receptor-mediated phagocytosis in addition to autophagy to clear myelin in a mouse model of nerve injury. Proceedings of the National Academy of Sciences of the United States of America 114, E8072-E8080 (2017). [0327] 39. Gomez-Sanchez, J. A., et al. Schwann cell autophagy, myelinophagy, initiates myelin clearance from injured nerves. The Journal of cell biology 210, 153-168 (2015). [0328] 40. Torisu, T., et al. Autophagy regulates endothelial cell processing, maturation and secretion of von Willebrand factor. Nature medicine 19, 1281-1287 (2013). [0329] 41. Hellstrom, M., et al. Lack of pericytes leads to endothelial hyperplasia and abnormal vascular morphogenesis. The Journal of cell biology 153, 543-553 (2001). [0330] 42. Li, Y., et al. Pericytes impair capillary blood flow and motor function after chronic spinal cord injury. Nature medicine 23, 733-741 (2017). [0331] 43. Wu, F., Liu, L. & Zhou, H. Endothelial cell activation in central nervous system inflammation. Journal of leukocyte biology 101, 1119-1132 (2017). [0332] 44. Kawano, H., et al. Role of the lesion scar in the response to damage and repair of the central nervous system. Cell and tissue research 349, 169-180 (2012). [0333] 45. Fernandez, E. & Pallini, R. Connective tissue scarring in experimental spinal cord lesions: significance of dural continuity and role of epidural tissues. Acta neurochirurgica 76, 145-148 (1985). [0334] 46. Hinz, B., et al. The myofibroblast: one function, multiple origins. The American journal of pathology 170, 1807-1816 (2007). [0335] 47. Zhu, Y., et al. Hematogenous macrophage depletion reduces the fibrotic scar and increases axonal growth after spinal cord injury. Neurobiology of disease 74, 114-125 (2015). [0336] 48. Logan, A., et al. Effects of transforming growth factor beta 1 on scar production in the injured central nervous system of the rat. The European journal of neuroscience 6, 355-363 (1994). [0337] 49. Yoshioka, N., et al. Small molecule inhibitor of type I transforming growth factor-beta receptor kinase ameliorates the inhibitory milieu in injured brain and promotes regeneration of nigrostriatal dopaminergic axons. Journal of neuroscience research 89, 381-393 (2011). [0338] 50. Fee, D. B., et al. Traumatic brain injury increases TGF beta RII expression on endothelial cells. Brain research 1012, 52-59 (2004).