Cell-permeable (ICP) parkin recombinant protein and use thereof
10662419 ยท 2020-05-26
Assignee
Inventors
Cpc classification
C07K2319/10
CHEMISTRY; METALLURGY
C12Y603/02019
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed are improved cell-permeable Parkin recombinant proteins (iCP-Parkin) which have been developed as a protein-based anti-neurodegenerative agent for efficient BBB-penetration to effectively deliver the recombinant protein into the brain. A Parkin protein, a dopaminergic neuronal cell death inhibitor, has been fused with a newly developed advanced macromolecule transduction domain (aMTD) and preferably with a solubilization domain (SD) to increase the solubility/yield and cell-/tissue-permeability of the recombinant protein. In addition, the aMTD/SD-fused recombinant iCP-Parkin protein has shown BBB-permeability. Both in vitro and in vivo, the iCP-Parkin recombinant protein improved motor skills, a typical phenotype of Parkinson's disease, by increasing dopamine level in the brain by suppressing apoptosis of dopaminergic neuron cells. It also can be applicable as a protein-based anti-neurodegenerative agent to treat Parkinson's disease by protecting dopaminergic neuron cells and regulating the secretion of dopamine.
Claims
1. A recombinant protein, which comprises a Parkin protein and an advanced macromolecule transduction domain (aMTD), wherein the aMTD is fused to one end or both ends of the Parkin protein and the aMTD consists of the amino acid sequence of SEQ ID NO: 122.
2. The recombinant protein according to claim 1, wherein one or more solubilization domain (SD)(s) are further fused to the end(s) of one or more of the Parkin protein and the aMTD.
3. The recombinant protein according to claim 2, wherein the recombinant protein is represented by any one of the following structural formulae:
A-B-C; and
A-C-B-C wherein A is the aMTD, B is the Parkin protein, and C is the SD(s).
4. The recombinant protein according to claim 2, wherein the SD(s) have an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 799 and 804.
5. The recombinant protein of claim 4, wherein the SD(s) are encoded by a polynucleotide sequence independently selected from the group consisting of SEQ ID NOs: 806 and 811.
6. The recombinant protein according to claim 1, wherein the Parkin protein has the amino acid sequence of SEQ ID NO: 814.
7. The recombinant protein according to claim 6, wherein the Parkin protein is encoded by the polynucleotide sequence of SEQ ID NO: 815.
8. The recombinant protein according to claim 1, wherein the aMTD is encoded by the polynucleotide sequence of SEQ ID NO: 362.
9. The recombinant protein according to claim 1, wherein the fusion is formed via a peptide bond or a chemical bond.
10. A pharmaceutical composition comprising the recombinant protein of claim 1 as an active ingredient; and a pharmaceutically acceptable carrier.
11. A method of treating Parkinson's related diseases in a subject comprising: administering to the subject a therapeutically effective amount of the recombinant protein of claim 1.
12. A polynucleotide encoding a recombinant protein which comprises a Parkin protein and an advanced macromolecule transduction domain (aMTD), wherein the aMTD is fused to one end or both ends of the Parkin protein and the aMTD consists of the amino acid sequence of SEQ ID NO: 122.
13. The polynucleotide according to claim 12, wherein the sequence of the polynucleotide is represented by SEQ ID NO: 822.
14. The polynucleotide of claim 12, wherein one or more solubilization domain (SD)(s) are further fused to the end(s) of one or more of the Parkin protein and the aMTD, and wherein the recombinant protein is represented by any one of the following structural formulae:
A-B-C; and
A-C-B-C wherein A is the aMTD, B is the Parkin protein, and C is the SD(s).
15. The polynucleotide according to claim 14, wherein the sequence of the polynucleotide is selected from the group consisting of SEQ ID NOs: 824, 828, and 832.
16. A recombinant expression vector comprising the polynucleotide of claim 12.
17. A transformant transformed with the recombinant expression vector of claim 16.
18. A preparing method of a recombinant protein comprising: culturing the transformant of claim 17 in a culture medium to produce the recombinant protein; and recovering the recombinant protein expressed by the culturing, wherein the recombinant protein comprises a Parkin protein and an advanced macromolecule transduction domain (aMTD), and wherein the aMTD is fused to one end or both ends of the Parkin protein and the aMTD consists of the amino acid sequence of SEQ ID NO: 122.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
MODE FOR INVENTION
(40) 1. Analysis of Reference Hydrophobic CPPs to Identify Critical Factors for Development of Advanced MTDs
(41) Previously reported MTDs were selected from a screen of more than 1,500 signal peptide sequences. Although the MTDs that have been developed did not have a common sequence or sequence motif, they were all derived from the hydrophobic (H) regions of signal sequences (HRSSs) that also lack common sequences or motifs except their hydrophobicity and the tendency to adopt alpha-helical conformations. The wide variation in H-region sequences may reflect prior evolution for proteins with membrane translocating activity and subsequent adaptation to the SRP/Sec61 machinery, which utilizes a methionine-rich signal peptide binding pocket in SRP to accommodate a wide-variety of signal peptide sequences.
(42) Previously described hydrophobic CPPs (e.g. MTS/MTM and MTD) were derived from the hydrophobic regions present in the signal peptides of secreted and cell surface proteins. The prior art consists first, of ad hoc use of H-region sequences (MTS/MTM), and second, of H-region sequences (with and without modification) with highest CPP activity selected from a screen of 1,500 signal sequences (MTM). Second prior art, the modified H-region derived hydrophobic CPP sequences had advanced in diversity with multiple number of available sequences apart from MTS/MTM derived from fibroblast growth factor (FGF) 4. However, the number of MTDs that could be modified from naturally occurring secreted proteins are somewhat limited. Because there is no set of rules in determining their cell-permeability, no prediction for the cell-permeability of modified MTD sequences can be made before testing them.
(43) The hydrophobic CPPs, like the signal peptides from which they originated, did not conform to a consensus sequence, and they had adverse effects on protein solubility when incorporated into protein cargo. We therefore set out to identify optimal sequence and structural determinants, namely critical factors (CFs), to design new hydrophobic CPPs with enhanced ability to deliver macromolecule cargoes including proteins into the cells and tissues while maintaining protein solubility. These newly developed CPPs, advanced macromolecule transduction domains (aMTDs) allowed almost infinite number of possible designs that could be designed and developed based on the critical factors. Also, their cell-permeability could be predicted by their character analysis before conducting any in vitro and/or in vivo experiments. These critical factors below have been developed by analyzing all published reference hydrophobic CPPs.
(44) 1-1. Analysis of Hydrophobic CPPs
(45) Seventeen different hydrophobic CPPs (Table 1) published from 1995 to 2014 (Table 2) were selected. After physiological and chemical properties of selected hydrophobic CPPs were analyzed, 11 different characteristics that may be associated with cell-permeability have been chosen for further analysis. These 11 characteristics are as follows: sequence, amino acid length, molecular weight, pl value, bending potential, rigidity/flexibility, structural feature, hydropathy, residue structure, amino acid composition and secondary structure of the sequences (Table 3).
(46) Table 1 Shows the Summary of Published Hydrophobic Cell-Penetrating Peptides which were Chosen.
(47) TABLE-US-00001 TABLE 1 # Pepides Origin Protein Ref. 1 MTM Homo sapiens NP_001998 Kaposi fibroblast growth factor (K-FGF) 1 2 MTS Homo sapiens NP_001998 Kaposi fibroblast growth factor (K-FGF) 2 3 MTD10 Streptomyces coelicolor NP_625021 Glycosyl hydrolase 8 4 MTD13 Streptomyces coelicolor NP_639877 Putative secreted protein 3 5 MTD47 Streptomyces coelicolor NP_627512 Secreted protein 4 6 MTD56 Homo sapiens P23274 Peptidyl-prolyl cis-trans isomerase B precursor 5 7 MTD73 Drosophila melanogaster AAA17887 Spatzle (spz) protein 5 8 MTD77 Homo sapiens NP_003231 Kaposi fibroblast growth factor (K-FGF) 6 9 MTD84 Phytophthora cactorum AAK63068 Phytotoxic protein PcF precusor 4 10 MTD85 Streptomyces coelicolor NP_629842 Peptide transport system peptide binding 7 protein 11 MTD86 Streptomyces coelicolor NP_629842 Peptide transport system secreted peptide 7 binding protein 12 MTD103 Homo sapiens TMBV19 domain Family member B 8 13 MTD132 Streptomyces coelicolor NP_628377 P60-family secreted protein 4 14 MTD151 Streptomyces coelicolor NP_630126 Secreted chitinase 8 15 MTD173 Streptomyces coelicolor NP_624384 Secreted protein 4 16 MTD174 Streptomyces coelicolor NP_733505 Large, multifunctional secreted protein 8 17 MTD181 Neisseria meningitidis Z2491 CAB84257.1 Putative secreted protein 4
(48) Table 2 Summarizes Reference Information
(49) TABLE-US-00002 TABLE 2 References # Title Journal Year Vol Issue Page 1 Inhibition of Nuclear Translocation of Transcription Factor JOURNAL OF 1995 270 24 14255 NF-kB by a Synthetic peptide Containing a Cell Membrane- BIOLOGICAL permeable Motif and Nuclear Localization Sequence CHEMISTRY 2 Epigenetic Regulation of Gene Structure and Function with NATURE 2001 19 10 929 a Cell-Permeable Cre Recombinase BIOTECHNOLOGY 3 Cell-Permeable NM23 Blocks the Maintenance and CANCER 2011 71 23 7216 Progression of Established Pulmonary Metastasis RESEARCH 4 Antitumor Activity of Cell-Permeable p18INK4c With MOLECULAR 2012 20 8 1540 Enhanced Membrane and Tissue Penetration THERAPY 5 Antitumor Activity of Cell-Permeable RUNX3 Protein in CLINICAL 2012 19 3 680 Gastric Cancer Cells CANCER RESEARCH 6 The Effect of Intracellular Protein Delivery on the Anti- BIOMATERIALS 2013 34 26 6261 Tumor Activity of Recombinant Human Endostatin 7 Partial Somatic to Stem Cell Transformations Induced By SCIENTIFIC 2014 4 10 4361 Cell-Permeable Reprogramming Factors REPORTS 8 Cell-Permeable Parkin Proteins Suppress Parkinson PLOS ONE 2014 9 7 17 Disease-Associated Phenotypes in Cultured Cells and Animals
(50) Table 3 Shows Characteristics of Published Hydrophobic Cell-Penetrating Peptides (A) which were Analyzed.
(51) TABLE-US-00003 TABLE3 Rigidity/ Structural SEQ Flexibility Feature ID Molecular Bending (Instability (Aliphatic NOS Peptide Sequence Length Weight pI Potential Index:II) Index:AI) 850 MTM AAVALLPAVLLALLAP 16 1,515.9 5.6 Bending 45.5 220.0 851 MTS AAVLLPVLLAAP 12 1,147.4 5.6 Bending 57.3 211.7 852 MTD10 LGGAVVAAPVAAAVAP 16 1,333.5 5.5 Bending 47.9 140.6 853 MTD13 LAAAALAVLPL 11 1,022.3 5.5 Bending 26.6 213.6 854 MTD47 AAAVPVLVAA 10 881.0 5.6 Bending 47.5 176.0 855 MTD56 VLLAAALIA 9 854.1 5.5 No- 8.9 250.0 Bending 856 MTD73 PVLLLLA 7 737.9 6.0 No- 36.1 278.6 Bending 857 MTD77 AVALLILAV 9 882.1 5.6 No- 30.3 271.1 Bending 858 MTD84 AVALVAVVAVA 11 982.2 5.6 No- 9.1 212.7 Bending 859 MTD85 LLAAAAALLLA 11 1,010.2 5.5 No- 9.1 231.8 Bending 860 MTD86 LLAAAAALLLA 11 1,010.2 5.5 No- 9.1 231.8 Bending 861 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 862 MTD132 AVVVPAIVLAAP 12 1,119.4 5.6 Bending 50.3 195.0 863 MTD151 AAAPVAAVP 9 1,031.4 5.5 Bending 73.1 120.0 864 MTD173 AVIPILAVP 9 892.1 5.6 Bending 48.5 216.7 865 MTD174 LILLLPAVALP 12 1,011.8 5.5 Bending 79.1 257.3 866 MTD181 AVLLLPAAA 9 838.0 5.6 Bending 51.7 206.7 AVE 10.82.4 1,011189.6 5.60.1 Proline 40.121.9 217.943.6 Presence SEQ A/a ID Hydropathy Residue Composition Secondary NOS Peptide Sequence (GRAVY) Structure A V L I P G Structure Cargo Ref. 850 MTM AAVALLPAVLLALLAP 2.4 Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 851 MTS AAVLLPVLLAAP 2.3 Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 852 MTD10 LGGAVVAAPVAAAVAP 1.8 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 853 MTD13 LAAAALAVLPL 2.4 Aliphatic 5 1 4 0 1 0 No-Helix RUNX3 3 Ring 854 MTD47 AAAVPVLVAA 2.4 Aliphatic 5 3 1 0 1 0 No-Helix CMYC 4 Ring 855 MTD56 VLLAAALIA 3.0 Aliphatic 4 1 3 1 0 0 Helix ES 5 Ring 856 MTD73 PVLLLLA 2.8 Aliphatic 1 1 4 0 1 0 Helix ES 5 Ring 857 MTD77 AVALLILAV 3.3 Aliphatic 3 2 3 1 0 0 Helix NM23 6 Ring 858 MTD84 AVALVAVVAVA 3.1 Aliphatic 5 5 1 0 0 0 Helix OCT4 4 Ring 859 MTD85 LLAAAAALLLA 2.7 Aliphatic 6 0 5 0 0 0 No-Helix RUNX3 7 Ring 860 MTD86 LLAAAAALLLA 2.7 Aliphatic 6 0 5 0 0 0 No-Helix SOX2 7 Ring 861 MTD103 LALPVLLLA 2.8 Aliphatic 2 1 5 0 1 0 Helix p18 8 Ring 862 MTD132 AVVVPAIVLAAP 2.4 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 4 Ring 863 MTD151 AAAPVAAVP 1.6 Aliphatic No-Helix Parkin 8 Ring 864 MTD173 AVIPILAVP 2.4 Aliphatic 2 2 1 2 2 0 Helix KLF4 4 Ring 865 MTD174 LILLLPAVALP 2.6 Aliphatic Helix Parkin 8 Ring 866 MTD181 AVLLLPAAA 2.4 Aliphatic 4 1 3 0 1 0 No-Helix SOX2 4 Ring AVE 2.50.4
(52) Two peptide/protein analysis programs were used (ExPasy: SoSui: harrier.nagahama-i-bio.ac.jp) to determine various indexes and structural features of the peptide sequences and to design new sequence. Followings are important factors analyzed.
(53) 1-2. Characteristics of Analyzed Peptides: Length, Molecular Weight and pl Value
(54) Average length, molecular weight and pl value of the peptides analyzed were 10.82.4, 1,011189.6 and 5.60.1, respectively (Table 4)
(55) Table 4 summarizes Critical Factors (CFs) of Published Hydrophobic Cell-Penetrating Peptides (A) which were Analyzed.
(56) TABLE-US-00004 TABLE 4 Length: 10.8 2.4 Molecular Weight: 1,011 189.6 pI: 5.6 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides, or No Proline. Instability Index (II): 40.1 21.9 Residue Structure & Aliphatic Index (AI): 217.9 43.6 Hydropathy (GRAVY): 2.5 0.4 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: -Helix is favored but not required.
(57) 1-3. Characteristics of Analyzed Peptides: Bending PotentialProline Position (PP)
(58) Bending potential (bending or no-bending) was determined based on the fact whether proline (P) exists and/or where the amino acid(s) providing bending potential to the peptide in recombinant protein is/are located. Proline differs from the other common amino acids in that its side chain is bonded to the backbone nitrogen atom as well as the alpha-carbon atom. The resulting cyclic structure markedly influences protein architecture which is often found in the bends of folded peptide/protein chain.
(59) Eleven out of 17 were determined as Bending peptide which means that proline is present in the middle of sequence for peptide bending and/or located at the end of the peptide for protein bending. As indicated above, peptide sequences could penetrate the plasma membrane in a bent configuration. Therefore, bending or no-bending potential is considered as one of the critical factors for the improvement of current hydrophobic CPPs.
(60) 1-4. Characteristics of Analyzed Peptides: Rigidity/FlexibilityInstability Index (II)
(61) Since one of the crucial structural features of any peptide is based on the fact whether the motif is rigid or flexible, which is an intact physicochemical characteristic of the peptide sequence, instability index (II) of the sequence was determined. The index value representing rigidity/flexibility of the peptide was extremely varied (8.9-79.1), but average value was 40.121.9 which suggested that the peptide should be somehow flexible, but not too much rigid or flexible (Table 3).
(62) 1-5. Characteristics of Analyzed Peptides: Structural FeaturesStructural Feature (Aliphatic Index: AI) and Hydropathy (Grand Average of Hydropathy: GRAVY)
(63) Alanine (V), valine (V), leucine (L) and isoleucine (I) contain aliphatic side chain and are hydrophobicthat is, they have an aversion to water and like to cluster. These amino acids having hydrophobicity and aliphatic residue enable them to pack together to form compact structure with few holes. Analyzed peptide sequence showed that all composing amino acids were hydrophobic (A, V, L and I) except glycine (G) in only one out of 17 (MTD10Table 3) and aliphatic (A, V, L, I, and P). Their hydropathic index (Grand Average of Hydropathy: GRAVY) and aliphatic index (AI) were 2.50.4 and 217.943.6, respectively. Their amino acid composition is also indicated in the Table 3.
(64) 1-6. Characteristics of Analyzed Peptides: Secondary Structure (Helicity)
(65) As explained above, the CPP sequences may be supposed to penetrate the plasma membrane directly after inserting into the membranes in a bent configuration with hydrophobic sequences having -helical conformation. In addition, our analysis strongly indicated that bending potential was crucial for membrane penetration. Therefore, structural analysis of the peptides was conducted to determine whether the sequences were to form helix or not. Nine peptides were helix and eight were not (Table 3). It seems to suggest that helix structure may not be required.
(66) 1-7. Determination of Critical Factors (CFs)
(67) In the 11 characteristics analyzed, the following 6 are selected namely Critical Factors for the development of new hydrophobic CPPsadvanced MTDs: amino acid length, bending potential (proline presence and location), rigidity/flexibility (instability index: II), structural feature (aliphatic index: AI), hydropathy (GRAVY) and amino acid composition/residue structure (hydrophobic and aliphatic A/a) (Table 3 and Table 4).
(68) 2. Analysis of Selected Hydrophobic CPPs to Optimize Critical Factors
(69) Since the analyzed data of the 17 different hydrophobic CPPs (analysis A, Table 3 and 4) previously developed during the past 2 decades showed high variation and were hard to make common- or consensus-features, analysis B (Table 5 and 6) and C (Table 7 and 8) were also conducted to optimize the critical factors for better design of improved CPPsaMTDs. Therefore, 17 hydrophobic CPPs have been grouped into two groups and analyzed the groups for their characteristics in relation to the cell permeable property. The critical factors have been optimized by comparing and contrasting the analytical data of the groups and determining the common homologous features that may be critical for the cell permeable property.
(70) 2-1. Selective Analysis (B) of Peptides Used to Biologically Active Cargo Protein for In Vivo
(71) In analysis B, eight CPPs were used with each biologically active cargo in vivo. Length was 113.2, but 3 out of 8 CPPs possessed little bending potential. Rigidity/Flexibility (instability index: II) was 4115, but removing one [MTD85: rigid, with minimal II (9.1)] of the peptides increased the overall instability index to 45.69.3. This suggested that higher flexibility (40 or higher II) is potentially be better. All other characteristics of the 8 CPPs were similar to the analysis A, including structural feature and hydropathy (Table 5 and 6).
(72) Table 5 Shows Characteristics of Published Hydrophobic Cell-Penetrating Peptides (B): Selected CPPs That were Used to Each Cargo In Vivo.
(73) TABLE-US-00005 TABLE5 Rigidity/ Structural SEQ Flexibility Feature ID Molecular Bending (Instability (Aliphatic NOS Peptide Sequence Length Weight pI Potential Index:II) Index:AI) 850 MTM AAVALLPAVLLALLAP 16 1,515.9 5.6 Bending 45.5 220.0 851 MTS AAVLLPVLLAAP 12 1,147.4 5.6 Bending 57.3 211.7 852 MTD10 LGGAVVAAPVAAAVAP 16 1,333.5 5.5 Bending 47.9 140.6 856 MTD73 PVLLLLA 7 737.9 6.0 No- 36.1 278.6 Bending 857 MTD77 AVALLILAV 9 882.1 5.6 No- 30.3 271.1 Bending 859 MTD85 LLAAAAALLLA 11 1,010.2 5.5 No- 9.1* 231.8 Bending 861 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 862 MTD132 AVVVPAIVLAAP 12 1,119.4 5.6 Bending 50.3 195.0 AVE 113.2 1,083252 5.60.1 Proline 4115 22747 Presence SEQ A/a ID Hydropathy Residue Composition Secondary NOS Peptide Sequence (GRAVY) Structure A V L I P G Structure Cargo Ref. 850 MTM AAVALLPAVLLALLAP 2.4 Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 851 MTS AAVLLPVLLAAP 2.3 Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 852 MTD10 LGGAVVAAPVAAAVAP 1.8 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 856 MTD73 PVLLLLA 2.8 Aliphatic 1 1 4 0 1 0 Helix ES 6 Ring 857 MTD77 AVALLILAV 3.3 Aliphatic 3 2 3 1 0 0 Helix NM23 3 Ring 858 MTD85 LLAAAAALLLA 2.7 Aliphatic 6 0 5 0 0 0 No-Helix RUNX3 5 Ring 861 MTD103 LALPVLLLA 2.8 Aliphatic 2 1 5 0 1 0 Helix p18 4 Ring 862 MTD132 AVVVPAIVLAAP 2.4 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 7 Ring AVE 2.50.4 *Removing the MTD85 increases II to 45.6 9.3.
(74) Table 6 Shows Summarized Critical Factors of Published Hydrophobic Cell-Penetrating Peptides (B).
(75) TABLE-US-00006 TABLE 6 Length: 11 3.2 Molecular Weight: 1,083 252 pI: 5.6 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides, or No Proline. Instability Index (II): 41.0 15 (.sup..square-solid. Removing the MTD85 increases II to 45.6 9.3) Residue Structure & Aliphatic Index (AI): 227 47 Hydropathy (GRAVY): 2.5 0.4 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I). Secondary Structure: -Helix is favored but not required.
(76) 2-2. Selective Analysis (C) of Peptides that Provided Bending Potential and Higher Flexibility
(77) To optimize the Common Range and/or Consensus Feature of Critical Factor for the practical design of aMTDs and the random peptides (rPs or rPeptides), which were to prove that the Critical Factors determined in the analysis A, B and C were correct to improve the current problems of hydrophobic CPPsprotein aggregation, low solubility/yield, and poor cell-/tissue-permeability of the recombinant proteins fused to the MTS/MTM or MTD, and non-common sequence and non-homologous structure of the peptides, empirically selected peptides were analyzed for their structural features and physicochemical factor indexes.
(78) Hydrophobic CPPs which did not have a bending potential, rigid or too much flexible sequences (too much low or too much high Instability Index), or too low or too high hydrophobic CPPs were unselected, but secondary structure was not considered because helix structure of sequence was not required.
(79) In analysis C, eight selected CPP sequences that could provide a bending potential and higher flexibility were finally analyzed (Table 7 and 8). Common amino acid length is 12 (11.63.0). Proline is presence in the middle of and/or the end of sequence. Rigidity/Flexibility (II) is 45.5-57.3 (Avg: 50.13.6). AI and GRAVY representing structural feature and hydrophobicity of the peptide are 204.737.5 and 2.40.3, respectively. All peptides are consisted with hydrophobic and aliphatic amino acids (A, V, L, I, and P). Therefore, analysis C was chosen as a standard for the new design of new hydrophobic CPPsaMTDs.
(80) Table 7 Shows Characteristics of Published Hydrophobic Cell-Penetrating Peptides (C): Selected CPPs that Provided Bending Potential and Higher Flexibility.
(81) TABLE-US-00007 TABLE7 Rigidity/ Structural SEQ Flexibility Feature ID Molecular Bending (Instability (Aliphatic NOS Peptides Sequence Length Weight pI Potential Index:II) Index:AI) 850 MTM AAVALLPAVLLALLAP 16 1515.9 5.6 Bending 45.5 220.0 851 MTS AAVLLPVLLAAP 12 1147.4 5.6 Bending 57.3 211.7 852 MTD10 LGGAVVAAPVAAAVAP 16 1333.5 5.5 Bending 47.9 140.6 854 MTD47 AAAVPVLVAA 10 881.0 5.6 Bending 47.5 176.0 861 MTD103 LALPVLLLA 9 922.2 5.5 Bending 51.7 271.1 862 MTD132 AVVVPAIVLAAP 12 1119.4 5.6 Bending 50.3 195.0 864 MTD173 AVIPILAVP 9 892.1 5.6 Bending 48.5 216.7 866 MTD181 AVLLLPAAA 9 838.0 5.6 Bending 51.7 206.7 AVE 11.63.0 1081.2244.6 5.60.1 Proline 50.13.6 204.737.5 Presence SEQ A/a ID Hydropathy Residue Composition Secondary # Peptides Sequence (GRAVY) Structure A V L I P G Structure Cargo Ref. 850 MTM AAVALLPAVLLALLAP 2.4 Aliphatic 6 2 6 0 2 0 Helix p50 1 Ring 851 MTS AAVLLPVLLAAP 2.3 Aliphatic 4 2 4 0 2 0 No-Helix CRE 2 Ring 852 MTD10 LGGAVVAAPVAAAVAP 1.8 Aliphatic 7 4 1 0 2 2 Helix Parkin 8 Ring 854 MTD47 AAAVPVLVAA 2.4 Aliphatic 5 3 1 0 1 0 No-Helix CMYC 4 Ring 861 MTD103 LALPVLLLA 2.8 Aliphatic 2 1 5 0 1 0 Helix p18 8 Ring 862 MTD132 AVVVPAIVLAAP 2.4 Aliphatic 4 4 1 1 2 0 No-Helix LIN28 4 Ring 864 MTD173 AVIPILAVP 2.4 Aliphatic 2 2 1 2 2 0 Helix KLF4 4 Ring 866 MTD181 AVLLLPAAA 2.4 Aliphatic 4 1 3 0 1 0 No-Helix SOX2 4 Ring AVE 2.40.3
(82) Table 8 Shows Summarized Critical Factors of Published Hydrophobic Cell-Penetrating Peptides (C).
(83) TABLE-US-00008 TABLE 8 Length: 11.6 3.0 Molecular Weight: 1,081.2 224.6 pI: 5.6 0.1 Bending Potential (BP): Proline presences in the middle and/or the end of peptides. Instability Index (II): 50.1 3.6 Residue Structure & Aliphatic Index (AI): 204.7 37.5 Hydropathy (GRAVY): 2.4 0.3 Aliphatic Ring: Non-polar hydrophobic & aliphatic amino acid (A, V, L, I), Secondary Structure: -Helix is favored but not required.
3. New Design of Improved Hydrophobic CPPsaMTDs Based on the Optimized Critical Factors
(84) 3-1. Determination of Common Sequence and/or Common Homologous Structure
(85) As mentioned above, H-regions of signal sequence (HRSS)-derived CPPs (MTS/MTM and MTD) do not have a common sequence, sequence motif, and/or common-structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence- and structural-motif which satisfy newly determined Critical Factors to have Common Function, namely, to facilitate protein translocation across the membrane with similar mechanism to the analyzed reference CPPs. Based on the analysis A, B and C, the common homologous features have been analyzed to determine the critical factors that influence the cell-permeability. The range value of each critical factor has been determined to include the analyzed index of each critical factor from analysis A, B and C to design novel aMTDs (Table 9). These features have been confirmed experimentally with newly designed aMTDs in their cell-permeability.
(86) Table 9 Shows Comparison The Range/Feature of Each Critical Factor Between
(87) The Value of Analyzed CPPs and The Value Determined for New Design of Novel aMTDs Sequences.
(88) TABLE-US-00009 TABLE 9 Summarized Critical Factors of aMTD Selected CPPs Newly Designed CPPs Critical Factor Range Range Bending Potential Proline presences Proline presences (Proline Position: PP) in the middle in the middle and/or at the (5, 6, 7 end of peptides or 8) and at the end of peptides Rigidity/Flexibility 45.5-57.3 40-60 (Instability Index: II) (50.1 3.6) Structural Feature 140.6-220.0 180-220 (Aliphatic Index: AI) (204.7 37.5) Hydropathy 1.8-2.8 2.1-2.6 (Grand Average of (2.4 0.3) Hydropathy GRAVY) Length 11.6 3.0 9-13 (Number of Amino Acid) Amino acid Composition A, V, I, L, P A, V, I, L, P
(89) In Table 9, universal common features and sequence/structural motif are provided. Length is 9-13 amino acids, and bending potential is provided with the presence of proline in the middle of sequence (at 5, 6, 7 or 8 amino acid) for peptide bending and at the end of peptide for recombinant protein bending and Rigidity/Flexibility of aMTDs is II>40 are described in Table 9.
(90) 3-2. Critical Factors for Development of Advanced MTDs
(91) Recombinant cell-permeable proteins fused to the hydrophobic CPPs to deliver therapeutically active cargo molecules including proteins into live cells had previously been reported, but the fusion proteins expressed in bacteria system were hard to be purified as a soluble form due to their low solubility and yield. To address the crucial weakness for further clinical development of the cell-permeable proteins as protein-based biotherapeutics, greatly improved form of the hydrophobic CPP, named as advanced MTD (aMTD) has newly been developed through critical factors-based peptide analysis. The critical factors used for the current invention of the aMTDs are herein (Table 9).
(92) 1. Amino Acid Length: 9-13
(93) 2. Bending Potential (Proline Position: PP)
(94) : Proline presences in the middle (from 5 to 8 amino acid) and at the end of sequence
(95) 3. Rigidity/Flexibility (Instability Index: II): 40-60
(96) 4. Structural Feature (Aliphatic Index: AI): 180-220
(97) 5. Hydropathy (GRAVY): 2.1-2.6
(98) 6. Amino Acid Composition: Hydrophobic and Aliphatic amino acidsA, V, L, I and P
(99) 3-3. Design of Potentially Best aMTDs that all Critical Factors are Considered and Satisfied
(100) After careful consideration of six critical factors derived from analysis of unique features of hydrophobic CPPs, advanced macromolecule transduction domains (aMTDs) have been designed and developed based on the common 12 amino acid platform which satisfies the critical factors including amino acid length (9-13) determined from the analysis.
(101) ##STR00005##
(102) Unlike previously published hydrophobic CPPs that require numerous experiments to determine their cell-permeability, newly developed aMTD sequences could be designed by performing just few steps as follows using above mentioned platform to follow the determined range value/feature of each critical factor.
(103) First, prepare the 12 amino acid sequence platform for aMTD. Second, place proline (P) in the end (12) of sequence and determine where to place proline in one of four U(s) in 5, 6, 7, and 8. Third, alanine (A), valine (V), leucine (L) or isoleucine (I) is placed in either X(s) and/or U(s), where proline is not placed. Lastly, determine whether the amino acid sequences designed based on the platform, satisfy the value or feature of six critical factors to assure the cell permeable property of aMTD sequences. Through these processes, numerous novel aMTD sequences have been constructed. The expression vectors for preparing non-functional cargo recombinant proteins fused to each aMTD, expression vectors have been constructed and forcedly expressed in bacterial cells. These aMTD-fused recombinant proteins have been purified in soluble form and determined their cell-permeability quantitatively. aMTD sequences have been newly designed, numbered from 1 to 240, as shown in Table 10-15. In Table 10-15, sequence ID Number is a sequence listings for reference, and aMTD numbers refer to amino acid listing numbers that actually have been used at the experiments. For further experiments, aMTD numbers have been used. In addition, polynucleotide sequences shown in the sequence lists have been numbered from SEQ ID NO: 241 to SEQ ID NO: 480.
(104) Tables 10 to 15 show 240 new hydrophobic aMTD sequences that were developed to satisfy all critical factors.
(105) TABLE-US-00010 TABLE10 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue IDNumber aMTD Sequences Length (II) (AI) (GRAVY) Structure 1 1 AAALAPVVLALP 12 57.3 187.5 2.1 Aliphatic 2 2 AAAVPLLAVVVP 12 41.3 195.0 2.4 Aliphatic 3 3 AALLVPAAVLAP 12 57.3 187.5 2.1 Aliphatic 4 4 ALALLPVAALAP 12 57.3 195.8 2.1 Aliphatic 5 5 AAALLPVALVAP 12 57.3 187.5 2.1 Aliphatic 6 11 VVALAPALAALP 12 57.3 187.5 2.1 Aliphatic 7 12 LLAAVPAVLLAP 12 57.3 211.7 2.3 Aliphatic 8 13 AAALVPVVALLP 12 57.3 203.3 2.3 Aliphatic 9 21 AVALLPALLAVP 12 57.3 211.7 2.3 Aliphatic 10 22 AVVLVPVLAAAP 12 57.3 195.0 2.4 Aliphatic 11 23 VVLVLPAAAAVP 12 57.3 195.0 2.4 Aliphatic 12 24 IALAAPALIVAP 12 50.2 195.8 2.2 Aliphatic 13 25 IVAVAPALVALP 12 50.2 203.3 2.4 Aliphatic 14 42 VAALPVVAVVAP 12 57.3 186.7 2.4 Aliphatic 15 43 LLAAPLVVAAVP 12 41.3 187.5 2.1 Aliphatic 16 44 ALAVPVALLVAP 12 57.3 203.3 2.3 Aliphatic 17 61 VAALPVLLAALP 12 57.3 211.7 2.3 Aliphatic 18 62 VALLAPVALAVP 12 57.3 203.3 2.3 Aliphatic 19 63 AALLVPALVAVP 12 57.3 203.3 2.3 Aliphatic
(106) TABLE-US-00011 TABLE11 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue IDNumber aMTD Sequences Length (II) (AI) (GRAVY) Structure 20 64 AIVALPVAVLAP 12 50.2 203.3 2.4 Aliphatic 21 65 IAIVAPVVALAP 12 50.2 203.3 2.4 Aliphatic 22 81 AALLPALAALLP 12 57.3 204.2 2.1 Aliphatic 23 82 AVVLAPVAAVLP 12 57.3 195.0 2.4 Aliphatic 24 83 LAVAAPLALALP 12 41.3 195.8 2.1 Aliphatic 25 84 AAVAAPLLLALP 12 41.3 195.8 2.1 Aliphatic 26 85 LLVLPAAALAAP 12 57.3 195.8 2.1 Aliphatic 27 101 LVALAPVAAVLP 12 57.3 203.3 2.3 Aliphatic 28 102 LALAPAALALLP 12 57.3 204.2 2.1 Aliphatic 29 103 ALIAAPILALAP 12 57.3 204.2 2.2 Aliphatic 30 104 AVVAAPLVLALP 12 41.3 203.3 2.3 Aliphatic 31 105 LLALAPAALLAP 12 57.3 204.1 2.1 Aliphatic 32 121 AIVALPALALAP 12 50.2 195.8 2.2 Aliphatic 33 123 AAIIVPAALLAP 12 50.2 195.8 2.2 Aliphatic 34 124 IAVALPALIAAP 12 50.3 195.8 2.2 Aliphatic 35 141 AVIVLPALAVAP 12 50.2 203.3 2.4 Aliphatic 36 143 AVLAVPAVLVAP 12 57.3 195.0 2.4 Aliphatic 37 144 VLAIVPAVALAP 12 50.2 203.3 2.4 Aliphatic 38 145 LLAVVPAVALAP 12 57.3 203.3 2.3 Aliphatic 39 161 AVIALPALIAAP 12 57.3 195.8 2.2 Aliphatic 40 162 AVVALPAALIVP 12 50.2 203.3 2.4 Aliphatic 41 163 LALVLPAALAAP 12 57.3 195.8 2.1 Aliphatic 42 164 LAAVLPALLAAP 12 57.3 195.8 2.1 Aliphatic 43 165 ALAVPVALAIVP 12 50.2 203.3 2.4 Aliphatic 44 182 ALIAPVVALVAP 12 57.3 203.3 2.4 Aliphatic 45 183 LLAAPVVIALAP 12 57.3 211.6 2.4 Aliphatic 46 184 LAAIVPAIIAVP 12 50.2 211.6 2.4 Aliphatic 47 185 AALVLPLIIAAP 12 41.3 220.0 2.4 Aliphatic 48 201 LALAVPALAALP 12 57.3 195.8 2.1 Aliphatic 49 204 LIAALPAVAALP 12 57.3 195.8 2.2 Aliphatic 50 205 ALALVPAIAALP 12 57.3 195.8 2.2 Aliphatic 51 221 AAILAPIVALAP 12 50.2 195.8 2.2 Aliphatic 52 222 ALLIAPAAVIAP 12 57.3 195.8 2.2 Aliphatic 53 223 AILAVPIAVVAP 12 57.3 203.3 2.4 Aliphatic 54 224 ILAAVPIALAAP 12 57.3 195.8 2.2 Aliphatic 55 225 VAALLPAAAVLP 12 57.3 187.5 2.1 Aliphatic 56 241 AAAVVPVLLVAP 12 57.3 195.0 2.4 Aliphatic 57 242 AALLVPALVAAP 12 57.3 187.5 2.1 Aliphatic 58 243 AAVLLPVALAAP 12 57.3 187.5 2.1 Aliphatic 59 245 AAALAPVLALVP 12 57.3 187.5 2.1 Aliphatic 60 261 LVLVPLLAAAAP 12 41.3 211.6 2.3 Aliphatic 61 262 ALIAVPAIIVAP 12 50.2 211.6 2.4 Aliphatic 62 263 ALAVIPAAAILP 12 54.9 195.8 2.2 Aliphatic 63 264 LAAAPVVIVIAP 12 50.2 203.3 2.4 Aliphatic 64 265 VLAIAPLLAAVP 12 41.3 211.6 2.3 Aliphatic 65 281 ALIVLPAAVAVP 12 50.2 203.3 2.4 Aliphatic 66 282 VLAVAPALIVAP 12 50.2 203.3 2.4 Aliphatic 67 283 AALLAPALIVAP 12 50.2 195.8 2.2 Aliphatic 68 284 ALIAPAVALIVP 12 50.2 211.7 2.4 Aliphatic 69 285 AIVLLPAAVVAP 12 50.2 203.3 2.4 Aliphatic
(107) TABLE-US-00012 TABLE12 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue IDNumber aMTD Sequences Length (II) (AI) (GRAVY) Structure 70 301 VIAAPVLAVLAP 12 57.3 203.3 2.4 Aliphatic 71 302 LALAPALALLAP 12 57.3 204.2 2.1 Aliphatic 72 304 AIILAPIAAIAP 12 57.3 204.2 2.3 Aliphatic 73 305 IALAAPILLAAP 12 57.3 204.2 2.2 Aliphatic 74 321 IVAVALPALAVP 12 50.2 203.3 2.3 Aliphatic 75 322 VVAIVLPALAAP 12 50.2 203.3 2.3 Aliphatic 76 323 IVAVALPVALAP 12 50.2 203.3 2.3 Aliphatic 77 324 IVAVALPAALVP 12 50.2 203.3 2.3 Aliphatic 78 325 IVAVALPAVALP 12 50.2 203.3 2.3 Aliphatic 79 341 IVAVALPAVLAP 12 50.2 203.3 2.3 Aliphatic 80 342 VIVALAPAVLAP 12 50.2 203.3 2.3 Aliphatic 81 343 IVAVALPALVAP 12 50.2 203.3 2.3 Aliphatic 82 345 ALLIVAPVAVAP 12 50.2 203.3 2.3 Aliphatic 83 361 AVVIVAPAVIAP 12 50.2 195.0 2.4 Aliphatic 84 363 AVLAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 85 364 LVAAVAPALIVP 12 50.2 203.3 2.3 Aliphatic 86 365 AVIVVAPALLAP 12 50.2 203.3 2.3 Aliphatic 87 381 VVAIVLPAVAAP 12 50.2 195.0 2.4 Aliphatic 88 382 AAALVIPAILAP 12 54.9 195.8 2.2 Aliphatic 89 383 VIVALAPALLAP 12 50.2 211.6 2.3 Aliphatic 90 384 VIVAIAPALLAP 12 50.2 211.6 2.4 Aliphatic 91 385 IVAIAVPALVAP 12 50.2 203.3 2.4 Aliphatic 92 401 AALAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 93 402 ALAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 94 403 AAALVIPAAILP 12 54.9 195.8 2.2 Aliphatic 95 404 LAAAVIPAAILP 12 54.9 195.8 2.2 Aliphatic 96 405 LAAAVIPVAILP 12 54.9 211.7 2.4 Aliphatic 97 421 AAILAAPLIAVP 12 57.3 195.8 2.2 Aliphatic 98 422 VVAILAPLLAAP 12 57.3 211.7 2.4 Aliphatic 99 424 AVVVAAPVLALP 12 57.3 195.0 2.4 Aliphatic 100 425 AVVAIAPVLALP 12 57.3 203.3 2.4 Aliphatic 101 442 ALAALVPAVLVP 12 57.3 203.3 2.3 Aliphatic 102 443 ALAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 103 444 LAAALVPVALVP 12 57.3 203.3 2.3 Aliphatic 104 445 ALAALVPALVVP 12 57.3 203.3 2.3 Aliphatic 105 461 IAAVIVPAVALP 12 50.2 203.3 2.4 Aliphatic 106 462 IAAVLVPAVALP 12 57.3 203.3 2.4 Aliphatic 107 463 AVAILVPLLAAP 12 57.3 211.7 2.4 Aliphatic 108 464 AVVILVPLAAAP 12 57.3 203.3 2.4 Aliphatic 109 465 IAAVIVPVAALP 12 50.2 203.3 2.4 Aliphatic 110 481 AIAIAIVPVALP 12 50.2 211.6 2.4 Aliphatic 111 482 ILAVAAIPVAVP 12 54.9 203.3 2.4 Aliphatic 112 483 ILAAAIIPAALP 12 54.9 204.1 2.2 Aliphatic 113 484 LAVVLAAPAIVP 12 50.2 203.3 2.4 Aliphatic 114 485 AILAAIVPLAVP 12 50.2 211.6 2.4 Aliphatic 115 501 VIVALAVPALAP 12 50.2 203.3 2.4 Aliphatic 116 502 AIVALAVPVLAP 12 50.2 203.3 2.4 Aliphatic 117 503 AAIIIVLPAALP 12 50.2 220.0 2.4 Aliphatic 118 504 LIVALAVPALAP 12 50.2 211.7 2.4 Aliphatic 119 505 AIIIVIAPAAAP 12 50.2 195.8 2.3 Aliphatic
(108) TABLE-US-00013 TABLE13 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue IDNumber aMTD Sequences Length (II) (AI) (GRAVY) Structure 120 521 LAALIVVPAVAP 12 50.2 203.3 2.4 Aliphatic 121 522 ALLVIAVPAVAP 12 57.3 203.3 2.4 Aliphatic 122 524 AVALIVVPALAP 12 50.2 203.3 2.4 Aliphatic 123 525 ALAIVVAPVAVP 12 50.2 195.0 2.4 Aliphatic 124 541 LLALIIAPAAAP 12 57.3 204.1 2.1 Aliphatic 125 542 ALALIIVPAVAP 12 50.2 211.6 2.4 Aliphatic 126 543 LLAALIA.sup.PAAL.sup.P 12 57.3 204.1 2.1 Aliphatic 127 544 IVALIVAPAAVP 12 43.1 203.3 2.4 Aliphatic 128 545 VVLVLAAPAAVP 12 57.3 195.0 2.3 Aliphatic 129 561 AAVAIVLPAVVP 12 50.2 195.0 2.4 Aliphatic 130 562 ALIAAIVPALVP 12 50.2 211.7 2.4 Aliphatic 131 563 ALAVIVVPALAP 12 50.2 203.3 2.4 Aliphatic 132 564 VAIALIVPALAP 12 50.2 211.7 2.4 Aliphatic 133 565 VAIVLVAPAVAP 12 50.2 195.0 2.4 Aliphatic 134 582 VAVALIVPALAP 12 50.2 203.3 2.4 Aliphatic 135 583 AVILALAPIVAP 12 50.2 211.6 2.4 Aliphatic 136 585 ALIVAIAPALVP 12 50.2 211.6 2.4 Aliphatic 137 601 AAILIAVPIAAP 12 57.3 195.8 2.3 Aliphatic 138 602 VIVALAAPVLAP 12 50.2 203.3 2.4 Aliphatic 139 603 VLVALAAPVIAP 12 57.3 203.3 2.4 Aliphatic 140 604 VALIAVAPAVVP 12 57.3 195.0 2.4 Aliphatic 141 605 VIAAVLAPVAVP 12 57.3 195.0 2.4 Aliphatic 142 622 ALIVLAAPVAVP 12 50.2 203.3 2.4 Aliphatic 143 623 VAAAIALPAIVP 12 50.2 187.5 2.3 Aliphatic 144 625 ILAAAAAPLIVP 12 50.2 195.8 2.2 Aliphatic 145 643 LALVLAAPAIVP 12 50.2 211.6 2.4 Aliphatic 146 645 ALAVVALPAIVP 12 50.2 203.3 2.4 Aliphatic 147 661 AAILAPIVAALP 12 50.2 195.8 2.2 Aliphatic 148 664 ILIAIAIPAAAP 12 54.9 204.1 2.3 Aliphatic 149 665 LAIVLAAPVAVP 12 50.2 203.3 2.3 Aliphatic 150 666 AAIAIIAPAIVP 12 50.2 195.8 2.3 Aliphatic 151 667 LAVAIVAPALVP 12 50.2 203.3 2.3 Aliphatic 152 683 LAIVLAAPAVLP 12 50.2 211.7 2.4 Aliphatic 153 684 AAIVLALPAVLP 12 50.2 211.7 2.4 Aliphatic 154 685 ALLVAVLPAALP 12 57.3 211.7 2.3 Aliphatic 155 686 AALVAVLPVALP 12 57.3 203.3 2.3 Aliphatic 156 687 AILAVALPLLAP 12 57.3 220.0 2.3 Aliphatic 157 703 IVAVALVPALAP 12 50.2 203.3 2.4 Aliphatic 158 705 IVAVALLPALAP 12 50.2 211.7 2.4 Aliphatic 159 706 IVAVALLPAVAP 12 50.2 203.3 2.4 Aliphatic 160 707 IVALAVLPAVAP 12 50.2 203.3 2.4 Aliphatic 161 724 VAVLAVLPALAP 12 57.3 203.3 2.3 Aliphatic 162 725 IAVLAVAPAVLP 12 57.3 203.3 2.3 Aliphatic 163 726 LAVAIIAPAVAP 12 57.3 187.5 2.2 Aliphatic 164 727 VALAIALPAVLP 12 57.3 211.6 2.3 Aliphatic 165 743 AIAIALVPVALP 12 57.3 211.6 2.4 Aliphatic 166 744 AAVVIVAPVALP 12 50.2 195.0 2.4 Aliphatic 167 746 VAIIVVAPALAP 12 50.2 203.3 2.4 Aliphatic 168 747 VALLAIAPALAP 12 57.3 195.8 2.2 Aliphatic 169 763 VAVLIAVPALAP 12 57.3 203.3 2.3 Aliphatic
(109) TABLE-US-00014 TABLE14 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue IDNumber aMTD Sequences Length (II) (AI) (GRAVY) Structure 170 764 AVALAVLPAVVP 12 57.3 195.0 2.3 Aliphatic 171 765 AVALAVVPAVLP 12 57.3 195.0 2.3 Aliphatic 172 766 IVVIAVAPAVAP 12 50.2 195.0 2.4 Aliphatic 173 767 IVVAAVVPALAP 12 50.2 195.0 2.4 Aliphatic 174 783 IVALVPAVAIAP 12 50.2 203.3 2.5 Aliphatic 175 784 VAALPAVALVVP 12 57.3 195.0 2.4 Aliphatic 176 786 LVAIAPLAVLAP 12 41.3 211.7 2.4 Aliphatic 177 787 AVALVPVIVAAP 12 50.2 195.0 2.4 Aliphatic 178 788 AIAVAIAPVALP 12 57.3 187.5 2.3 Aliphatic 179 803 AIALAVPVLALP 12 57.3 211.7 2.4 Aliphatic 180 805 LVLIAAAPIALP 12 41.3 220.0 2.4 Aliphatic 181 806 LVALAVPAAVLP 12 57.3 203.3 2.3 Aliphatic 182 807 AVALAVPALVLP 12 57.3 203.3 2.3 Aliphatic 183 808 LVVLAAAPLAVP 12 41.3 203.3 2.3 Aliphatic 184 809 LIVLAAPALAAP 12 50.2 195.8 2.2 Aliphatic 185 810 VIVLAAPALAAP 12 50.2 187.5 2.2 Aliphatic 186 811 AVVLAVPALAVP 12 57.3 195.0 2.3 Aliphatic 187 824 LIIVAAAPAVAP 12 50.2 187.5 2.3 Aliphatic 188 825 IVAVIVAPAVAP 12 43.2 195.0 2.5 Aliphatic 189 826 LVALAAPIIAVP 12 41.3 211.7 2.4 Aliphatic 190 827 IAAVLAAPALVP 12 57.3 187.5 2.2 Aliphatic 191 828 IALLAAPIIAVP 12 41.3 220.0 2.4 Aliphatic 192 829 AALALVAPVIVP 12 50.2 203.3 2.4 Aliphatic 193 830 IALVAAPVALVP 12 57.3 203.3 2.4 Aliphatic 194 831 IIVAVAPAAIVP 12 43.2 203.3 2.5 Aliphatic 195 832 AVAAIVPVIVAP 12 43.2 195.0 2.5 Aliphatic 196 843 AVLVLVAPAAAP 12 41.3 219.2 2.5 Aliphatic 197 844 VVALLAPLIAAP 12 41.3 211.8 2.4 Aliphatic 198 845 AAVVIAPLLAVP 12 41.3 203.3 2.4 Aliphatic 199 846 IAVAVAAPLLVP 12 41.3 203.3 2.4 Aliphatic 200 847 LVAIVVLPAVAP 12 50.2 219.2 2.6 Aliphatic 201 848 AVAIVVLPAVAP 12 50.2 195.0 2.4 Aliphatic 202 849 AVILLAPLIAAP 12 57.3 220.0 2.4 Aliphatic 203 850 LVIALAAPVALP 12 57.3 211.7 2.4 Aliphatic 204 851 VLAVVLPAVALP 12 57.3 219.2 2.5 Aliphatic 205 852 VLAVAAPAVLLP 12 57.3 203.3 2.3 Aliphatic 206 863 AAVVLLPIIAAP 12 41.3 211.7 2.4 Aliphatic 207 864 ALLVIAPAIAVP 12 57.3 211.7 2.4 Aliphatic 208 865 AVLVIAVPAIAP 12 57.3 203.3 2.5 Aliphatic 209 867 ALLVVIAPLAAP 12 41.3 211.7 2.4 Aliphatic 210 868 VLVAAILPAAIP 12 54.9 211.7 2.4 Aliphatic 211 870 VLVAAVLPIAAP 12 41.3 203.3 2.4 Aliphatic 212 872 VLAAAVLPLVVP 12 41.3 219.2 2.5 Aliphatic 213 875 AIAIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 214 877 VAIIAVPAVVAP 12 57.3 195.0 2.4 Aliphatic 215 878 IVALVAPAAVVP 12 50.2 195.0 2.4 Aliphatic 216 879 AAIVLLPAVVVP 12 50.2 219.1 2.5 Aliphatic 217 881 AALIVVPAVAVP 12 50.2 195.0 2.4 Aliphatic 218 882 AIALVVPAVAVP 12 57.3 195.0 2.4 Aliphatic 219 883 LAIVPAAIAALP 12 50.2 195.8 2.2 Aliphatic
(110) TABLE-US-00015 TABLE15 Rigidity/ Sturctural Sequence Flexibility Feature Hydropathy Residue IDNumber aMTD Sequences Length (II) (AI) (GRAVY) Structure 220 885 LVAIAPAVAVLP 12 57.3 203.3 2.4 Aliphatic 221 887 VLAVAPAVAVLP 12 57.3 195.0 2.4 Aliphatic 222 888 ILAVVAIPAAAP 12 54.9 187.5 2.3 Aliphatic 223 889 ILVAAAPIAALP 12 57.3 195.8 2.2 Aliphatic 224 891 ILAVAAIPAALP 12 54.9 195.8 2.2 Aliphatic 225 893 VIAIPAILAAAP 12 54.9 195.8 2.3 Aliphatic 226 895 AIIIVVPAIAAP 12 50.2 211.7 2.5 Aliphatic 227 896 AILIVVAPIAAP 12 50.2 211.7 2.5 Aliphatic 228 897 AVIVPVAIIAAP 12 50.2 203.3 2.5 Aliphatic 229 899 AVVIALPAVVAP 12 57.3 195.0 2.4 Aliphatic 230 900 ALVAVIAPVVAP 12 57.3 195.0 2.4 Aliphatic 231 901 ALVAVLPAVAVP 12 57.3 195.0 2.4 Aliphatic 232 902 ALVAPLLAVAVP 12 41.3 203.3 2.3 Aliphatic 233 904 AVLAVVAPVVAP 12 57.3 186.7 2.4 Aliphatic 234 905 AVIAVAPLVVAP 12 41.3 195.0 2.4 Aliphatic 235 906 AVIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 236 907 VAIALAPVVVAP 12 57.3 195.0 2.4 Aliphatic 237 908 VALALAPVVVAP 12 57.3 195.0 2.3 Aliphatic 238 910 VAALLPAVVVAP 12 57.3 195.0 2.3 Aliphatic 239 911 VALALPAVVVAP 12 57.3 195.0 2.3 Aliphatic 240 912 VALLAPAVVVAP 12 57.3 195.0 2.3 Aliphatic 52.65.1 201.77.8 2.30.1
(111) 3-4. Design of the Peptides which Did not Satisfy at Least One Critical Factor
(112) To demonstrate that this invention of new hydrophobic CPPsaMTDs, which satisfy all critical factors described above, are correct and rationally designed, the peptides which do not satisfy at least one critical factor have also been designed. Total of 31 rPeptides (rPs) are designed, developed and categorized as follows: no bending peptides, either no proline in the middle as well at the end and/or no central proline; rigid peptides (II<40); too much flexible peptides; aromatic peptides (aromatic ring presences); hydrophobic, with non-aromatic peptides but have amino acids other than A, V, L, I, P or additional proline residues; hydrophilic, but non-aliphatic peptides.
(113) 3-4-1. Peptides that do not Satisfy the Bending Potential
(114) Table 16 shows the peptides that do not have any proline in the middle (at 5, 6, 7 or 8) and at the end of the sequences. In addition, Table 16 describes the peptides that do not have proline in the middle of the sequences. All these peptides are supposed to have no-bending potential.
(115) TABLE-US-00016 TABLE16 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Group rPeptideID Sequences Length (PP) (II) (AI) (GRAVY) No-BendingPeptides 931(867) AVLIAPAILAAA 12 6 57.3 204.2 2.5 (NoProlineat5, 936(868) ALLILAAAVAAP 12 12 41.3 204.2 2.4 6,7or8 152(869) LAAAVAAVAALL 12 None 9.2 204.2 2.7 and/or12) 27(870) LAIVAAAAALVA 12 None 2.1 204.2 2.8 935(871) ALLILPAAAVAA 12 6 57.3 204.2 2.4 670(872) ALLILAAAVAAL 12 None 25.2 236.6 2.8 934(873) LILAPAAVVAAA 12 5 57.3 195.8 2.5 37(874) TTCSQQQYCTNG 12 None 53.1 0.0 1.1 16(875) NNSCTTYTNGSQ 12 None 47.4 0.0 1.4 113(876) PVAVALLIAVPP 12 1,11,12 57.3 195.0 2.1
(116) 3-4-2. Peptides that do not Satisfy the Rigidity/Flexibility
(117) To prove that rigidity/flexibility of the sequence is a crucial critical factor, rigid (Avg. II: 21.86.6) and too high flexible sequences (Avg. II: 82.321.0) were also designed. Rigid peptides that instability index is much lower than that of new aMTDs (II: 41.3-57.3, Avg. II: 53.35.7) are shown in Table 17. Bending, but too high flexible peptides that II is much higher than that of new aMTDs are also provided in Table 18.
(118) TABLE-US-00017 TABLE17 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Group rPeptideID Sequences Length (PP) (II) (AI) (GRAVY) RigidPeptides 226(877) ALVAAIPALAIP 12 6 20.4 195.8 2.2 (II<50) 6(878) VIAMIPAAFWVA 12 6 15.7 146.7 2.2 750(879) LAIAAIAPLAIP 12 8,12 22.8 204.2 2.2 26(880) AAIALAAPLAIV 12 8 18.1 204.2 2.5 527(881) LVLAAVAPIAIP 12 8,12 22.8 211.7 2.4 466(882) IIAAAAPLAIIP 12 7,12 22.8 204.2 2.3 167(883) VAIAIPAALAIP 12 6,12 20.4 195.8 2.3 246(884) VVAVPLLVAFAA 12 5 25.2 195.0 2.7 426(885) AAALAIPLAIIP 12 7,12 4.37 204.2 2.2 606(886) AAAIAAIPIIIP 12 8,12 4.4 204.2 2.4 66(887) AGVLGGPIMGVP 12 7,12 35.5 121.7 1.3 248(888) VAAIVPIAALVP 12 6,12 34.2 203.3 2.5 227(889) LAAIVPIAAAVP 12 6,12 34.2 187.5 2.2 17(890) GGCSAPQTTCSN 12 6 51.6 8.3 0.5 67(891) LDAEVPLADDVP 12 6,12 34.2 130.0 0.3
(119) TABLE-US-00018 TABLE18 Proline Rigidity/ Sturctural rPeptide Position Flexibility Feature Hydropathy Group ID Sequences Length (PP) (II) (AI) (GRAVY) BendingPeptides 692(892) PAPLPPVVILAV 12 1,3,5,6 105.5 186.7 1.8 butTooHigh 69(893) PVAVLPPAALVP 12 1,6,7,12 89.4 162.5 1.6 Flexibility 390(894) VPLLVPVVPVVP 12 2,6,9,12 105.4 210.0 2.2 350(895) VPILVPVVPVVP 12 2,6,9,12 121.5 210.0 2.2 331(896) VPVLVPLVPVVP 12 2,6,9,12 105.4 210.0 2.2 9(897) VALVPAALILPP 12 5,11,12 89.4 203.3 2.1 68(898) VAPVLPAAPLVP 12 3,6,9,12 105.5 162.5 1.6 349(899) VPVLVPVVPVVP 12 2,6,9,12 121.5 201.6 2.2 937(900) VPVLVPLPVPVV 12 2,6,8,10 121.5 210.0 2.2 938(901) VPVLLPVVVPVP 12 2,6,10,12 121.5 210.0 2.2 329(902) LPVLVPVVPVVP 12 2,6,9,12 121.5 210.0 2.2 49(903) VVPAAPAVPVVP 12 3,6,9,12 121.5 145.8 1.7 772(904) LPVAPVIPIIVP 12 2,5,8,12 79.9 210.8 2.1 210(905) ALIALPALPALP 12 6,9,12 89.4 195.8 1.8 28(906) AVPLLPLVPAVP 12 3,6,9,12 89.4 186.8 1.8 693(907) AAPVLPVAVPIV 12 3,6,10 82.3 186.7 2.1 169(908) VALVAPALILAP 12 6,12 73.4 211.7 2.4 29(909) VLPPLPVLPVLP 12 3,4,6,9,12 121.5 202.5 1.7 190(910) AAILAPAVIAPP 12 6,11,12 89.4 163.3 1.8
(120) 3-4-3. Peptides that do not Satisfy the Structural Features
(121) New hydrophobic CPPsaMTDs are consisted with only hydrophobic and aliphatic amino acids (A, V, L, I and P) with average ranges of the indexesAI: 180-220 and GRAVY: 2.1-2.6 (Table 9). Based on the structural indexes, the peptides which contain an aromatic residue (W, F or Y) are shown in Table 19 and the peptides which are hydrophobic with non-aromatic sequences but have amino acids residue other than A, V, L, I, P or additional proline residues are designed (Table 20). Finally, hydrophilic and/or bending peptides which are consisted with non-aliphatic amino acids are shown in Table
(122) TABLE-US-00019 TABLE19 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Group rPeptideID Sequences Length (PP) (II) (AI) (GRAVY) AromaticPeptides 30(911) WFFAGPIMLIWP 12 6,12 9.2 105.8 1.4 (AromaticRing 33(912) AAAILAPAFLAV 12 7 57.3 171.7 2.4 Presences) 131(913) WIIAPVWLAWIA 12 5 51.6 179.2 1.9 922(914) WYVIFVLPLVVP 12 8,12 41.3 194.2 2.2 71(915) FMWMWFPFMWYP 12 7,12 71.3 0.0 0.6 921(916) IWWFVVLPLVVP 12 8,12 41.3 194.2 2.2
(123) TABLE-US-00020 TABLE20 Proline Rigidity/ Sturctural rPeptide Position Flexibility Feature Hydropathy Group ID Sequences Length (PP) (II) (AI) (GRAVY) Hydrophobic 436(917) VVMLVVPAVMLP 12 7,12 57.3 194.2 2.6 butNon 138(918) PPAALLAILAVA 12 1,2 57.3 195.8 2.2 Aromatic 77(919) PVALVLVALVAP 12 1,12 41.3 219.2 2.5 Peptides 577(920) MLMIALVPMIAV 12 8 18.9 195.0 2.7 97(921) ALLAAPPALLAL 12 6,7 57.3 204.2 2.1 214(922) ALIVAPALMALP 12 6,12 60.5 187.5 2.2 59(923) AVLAAPVVAALA 12 6 41.3 187.5 2.5 54(924) LAVAAPPVVALL 12 6,7 57.3 203.3 2.3
(124) TABLE-US-00021 TABLE21 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy Group rPeptideID Sequences Length (PP) (II) (AI) (GRAVY) HydrophilicPeptides 949(925) SGNSCQQCGNSS 12 None 41.7 0.0 1.1 butNonAliphatic 39(926) CYNTSPCTGCCY 12 6 52.5 0.0 0.0 19(927) YVSCCTYTNGSQ 12 None 47.7 0.0 1.0 947(928) CYYNQQSNNNNQ 12 None 59.6 0.0 2.4 139(929) TGSTNSPTCTST 12 7 53.4 0.0 0.7 18(930) NYCCTPTTNGQS 12 6 47.9 0.0 0.9 20(931) NYCNTCPTYGQS 12 7 47.4 0.0 0.9 635(932) GSTGGSQQNNQY 12 None 31.9 0.0 1.9 40(933) TYNTSCTPGTCY 12 8 49.4 0.0 0.6 57(934) QNNCNTSSQGGG 12 None 52.4 0.0 1.6 159(935) CYSGSTSQNQPP 12 11,12 51.0 0.0 1.3 700(936) GTSNTCQSNQNS 12 None 19.1 0.0 1.6 38(937) YYNQSTCGGQCY 12 None 53.8 0.0 1.0
(125) 3-5. Summary of Newly Designed Peptides
(126) Total of 457 sequences have been designed based on the critical factors. Designed potentially best aMTDs (hydrophobic, flexible, bending, aliphatic and 12-A/a length peptides) that do satisfy all range/feature of critical factors are 316. Designed rPeptides that do not satisfy at least one of the critical factors are 141 that no bending peptide sequences are 26; rigid peptide (II<40) sequences are 23; too much flexible peptides are 24; aromatic peptides (aromatic ring presences) are 27; hydrophobic, but non-aromatic peptides are 23; and hydrophilic, but non-aliphatic peptides are 18.
(127) 4. Preparation of Recombinant Report Proteins Fused to aMTDs and rPeptides
(128) Recombinant proteins fused to aMTDs and others [rPeptides, reference hydrophobic CPP sequences (MTM and MTD)] were expressed in a bacterial system, purified with single-step affinity chromatography and prepared as soluble proteins in physiological condition. These recombinant proteins have been tested for the ability of their cell-permeability by utilizing flow cytometry and laser scanning confocal microscopy.
(129) 4-1. Selection of Cargo Protein for Recombinant Proteins Fused to Peptide Sequences
(130) For clinical/non-clinical application, aMTD-fused cargo materials would be biologically active molecules that could be one of the following: enzymes, transcription factors, toxic, antigenic peptides, antibodies and antibody fragments. Furthermore, biologically active molecules could be one of these following macromolecules: enzymes, hormones, carriers, immunoglobulin, membrane-bound proteins, transmembrane proteins, internal proteins, external proteins, secreted proteins, virus proteins, native proteins, glycoproteins, fragmented proteins, disulfide bonded proteins, recombinant proteins, chemically modified proteins and prions. In addition, these biologically active molecules could be one of the following: nucleic acid, coding nucleic acid sequence, mRNAs, antisense RNA molecule, carbohydrate, lipid and glycolipid.
(131) According to these pre-required conditions, a non-functional cargo to evaluate aMTD-mediated protein uptake has been selected and called as Cargo A (CRA) that should be soluble and non-functional. The domain (A/a 289-840; 184 A/a length) is derived from protein S (Genbank ID: CP000113.1).
(132) 4-2. Construction of Expression Vector and Preparation of Recombinant Proteins
(133) Coding sequences for recombinant proteins fused to each aMTD are cloned NdeI (5) and SalI (3) in pET-28a(+) (Novagen, Darmstadt, Germany) from PCR-amplified DNA segments. PCR primers for the recombinant proteins fused to aMTD and rPeptides are represented by SEQ ID NOs: 481-797. Structure of the recombinant proteins is displayed in
(134) The recombinant proteins were forcedly expressed in E. coli BL21 (DE3) cells grown to an OD.sub.600 of 0.6 and induced for 2 hours with 0.7 mM isopropyl--D-thiogalactopyranoside (IPTG). The proteins were purified by Ni.sup.2+ affinity chromatography as directed by the supplier (Qiagen, Hilden, Germany) in natural condition. After the purification, purified proteins were dissolved in a physiological buffer such as DMEM medium.
(135) TABLE-US-00022 TABLE 22 Potentially Best aMTDs (Hydrophobic, Flexible, 240 Bending, Aliphatic & Helical) Random Peptides 31 No Bending Peptides (No Proline at 5 or 6 and/or 12) 02 No Bending Peptides (No Central Proline) 01 Rigid Peptides (II < 50) 09 Too Much Flexible Peptides 09 Aromatic Peptides (Aromatic Ring Presences) 01 Hydrophobic, But Non-Aromatic Peptides 02 Hydrophilic, But Non-Aliphatic Peptides 07
(136) 4-3. Expression of aMTDor Random Peptide (rP)Fused Recombinant Proteins
(137) The present invention also relates to the development method of aMTD sequences having cell-permeability. Using the standardized six critical factors, 316 aMTD sequences have been designed. In addition, 141 rPeptides are also developed that lack one of these critical factors: no bending peptides: i) absence of proline both in the middle and at the end of sequence or ii) absence of proline either in the middle or at the end of sequence, rigid peptides, too much flexible peptides, aromatic peptides (aromatic ring presence), hydrophobic but non-aromatic peptides, and hydrophilic but non-aliphatic peptides (Table 22).
(138) These rPeptides are devised to be compared and contrasted with aMTDs in order to analyze structure/sequence activity relationship (SAR) of each critical factor with regard to the peptides' intracellular delivery potential. All peptide (aMTD or rPeptide)-containing recombinant proteins have been fused to the CRA to enhance the solubility of the recombinant proteins to be expressed, purified, prepared and analyzed.
(139) These designed 316 aMTDs and 141 rPeptides fused to CRA were all cloned (
(140) To prepare the proteins fused to rPeptides, 60 proteins were expressed that were 10 out of 26 rPeptides in the category of no bending peptides (Table 16); 15 out of 23 in the category of rigid peptides [instability index (II)<40] (Table 17); 19 out of 24 in the category of too much flexible peptides (Table 18); 6 out of 27 in the category of aromatic peptides (Table 19); 8 out of 23 in the category of hydrophobic but non-aromatic peptides (Table 20); and 12 out of 18 in the category of hydrophilic but non-aliphatic peptides (Table 21).
(141) 4-4. Quantitative Cell-Permeability of aMTD-Fused Recombinant Proteins
(142) The aMTDs and rPeptides were fluorescently labeled and compared based on the critical factors for cell-permeability by using flow cytometry and confocal laser scanning microscopy (
(143) Table 23 shows Comparison Analysis of Cell-Permeability of aMTDs with a Negative Control (A: rP38).
(144) TABLE-US-00023 TABLE 23 Negative Control rP38 aMTD 19.6 1.6* The Average of 240 aMTDs (Best: 164.2) *Relative Fold (aMTD in Geo Mean in its comparison to rP38)
(145) Relative cell-permeability (relative fold) of aMTDs to the reference CPPs [B: MTM12 (AAVLLPVLLAAP) (SEQ ID NO:938), C: MTD85 (AVALLILAV) (SEQ ID NO: 939)] was also analyzed (Tables 40 and 41)
(146) Table 24 shows Comparison Analysis of Cell-Permeability of aMTDs with a Reference CPP (B: MTM12).
(147) TABLE-US-00024 TABLE 24 MTM12 aMTD 13.1 1.1* The Average of 240 aMTDs (Best: 109.9) *Relative Fold (aMTD in Geo Mean in its comparison to MTM12)
(148) Table 25 shows Comparison Analysis of Cell-Permeability of aMTDs with a Reference CPP (C: MTD85).
(149) TABLE-US-00025 TABLE 25 MTD85 aMTD 6.6 0.5* The Average of 240 aMTDs (Best: 55.5) *Relative Fold (aMTD in Geo Mean in its comparison to MTD85)
(150) Geometric means of negative control (histidine-tagged rP38-fused CRA recombinant protein) subtracted by that of naked protein (histidine-tagged CRA protein) lacking any peptide (rP38 or aMTD) was standardized as relative fold of 1. Relative cell-permeability of 240 aMTDs to the negative control (A type) was significantly increased by up to 164 fold, with average increase of 19.61.6 (Table 26-31).
(151) TABLE-US-00026 TABLE26 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio(Fold) IDNumber aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 1 899 AVVIALPAVVAP 12 7 57.3 195.0 2.4 164.2 109.9 55.5 2 908 VALALAPVVVAP 12 7 57.3 195.0 2.3 150.6 100.8 50.9 3 910 VAALLPAVVVAP 12 6 57.3 195.0 2.3 148.5 99.4 50.2 4 810 VIVLAAPALAAP 12 7 50.2 187.5 2.2 120.0 80.3 40.6 5 904 AVLAVVAPVVAP 12 8 57.3 186.7 2.4 105.7 70.8 35.8 6 321 IVAVALPALAVP 12 7 50.2 203.3 2.3 97.8 65.2 32.9 7 851 VLAVVLPAVALP 12 7 57.3 219.2 2.5 96.6 64.7 32.7 8 911 VALALPAVVVAP 12 6 57.3 195.0 2.3 84.8 56.8 28.7 9 852 VLAVAAPAVLLP 12 7 57.3 203.3 2.3 84.6 56.6 28.6 10 803 AIALAVPVLALP 12 7 57.3 211.7 2.4 74.7 50.0 25.3 11 888 ILAVVAIPAAAP 12 8 54.9 187.5 2.3 71.0 47.5 24.0 12 825 IVAVIVAPAVAP 12 8 43.2 195.0 2.5 69.7 46.6 23.6 13 895 AIIIVVPAIAAP 12 7 50.2 211.7 2.5 60.8 40.7 20.6 14 896 AILIVVAPIAAP 12 8 50.2 211.7 2.5 57.5 38.5 19.4 15 727 VALAIALPAVLP 12 8 57.3 211.6 2.3 54.7 36.7 18.5 16 603 VLVALAAPVIAP 12 8 57.3 203.3 2.4 54.1 36.1 18.2 17 847 LVAIVVLPAVAP 12 8 50.2 219.2 2.6 50.2 33.4 16.9 18 826 LVALAAPIIAVP 12 7 41.3 211.7 2.4 49.2 32.9 16.6 19 724 VAVLAVLPALAP 12 8 57.3 203.3 2.3 47.5 31.8 16.1 20 563 ALAVIVVPALAP 12 8 50.2 203.3 2.4 47.1 31.4 15.9 21 811 AVVLAVPALAVP 12 7 57.3 195.0 2.3 46.5 31.1 15.7 22 831 IIVAVAPAAIVP 12 7 43.2 203.3 2.5 46.3 31.0 15.7 23 829 AALALVAPVIVP 12 8 50.2 203.3 2.4 44.8 30.0 15.2 24 891 ILAVAAIPAALP 12 8 54.9 195.8 2.2 44.7 29.9 15.1 25 905 AVIAVAPLVVAP 12 7 41.3 195.0 2.4 44.0 29.5 14.9 26 564 VAIALIVPALAP 12 8 50.2 211.7 2.4 43.6 29.1 14.7 27 124 IAVALPALIAAP 12 6 50.3 195.8 2.2 43.6 29.0 14.7 28 827 IAAVLAAPALVP 12 8 57.3 187.5 2.2 43.0 28.8 14.6 29 2 AAAVPLLAVVVP 12 5 41.3 195.0 2.4 40.9 27.2 13.8 30 385 IVAIAVPALVAP 12 7 50.2 203.3 2.4 38.8 25.9 13.1 31 828 IALLAAPIIAVP 12 7 41.3 220.0 2.4 36.8 24.6 12.4 32 806 LVALAVPAAVLP 12 7 57.3 203.3 2.3 36.7 24.6 12.4 33 845 AAVVIAPLLAVP 12 7 41.3 203.3 2.4 35.8 24.0 12.1 34 882 AIALVVPAVAVP 12 7 57.3 195.0 2.4 35.0 23.4 11.8 35 545 VVLVLAAPAAVP 12 8 57.3 195.0 2.3 34.6 23.1 11.7 36 161 AVIALPALIAAP 12 6 57.3 195.8 2.2 34.5 23.0 11.6 37 481 AIAIAIVPVALP 12 8 50.2 211.6 2.4 34.3 23.0 11.6 38 900 ALVAVIAPVVAP 12 8 57.3 195.0 2.4 34.3 22.9 11.6 39 223 AILAVPIAVVAP 12 6 57.3 203.3 2.4 33.0 22.1 11.2 40 824 LIIVAAAPAVAP 12 8 50.2 187.5 2.3 32.8 21.9 11.1 41 562 ALIAAIVPALVP 12 8 50.2 211.7 2.4 32.7 21.8 11.0 42 222 ALLIAPAAVIAP 12 6 57.3 195.8 2.2 32.6 21.7 11.0 43 61 VAALPVLLAALP 12 5 57.3 211.7 2.3 31.2 20.8 10.5 44 582 VAVALIVPALAP 12 8 50.2 203.3 2.4 30.6 20.4 10.3 45 889 ILVAAAPIAALP 12 7 57.3 195.8 2.2 30.3 20.3 10.3 46 787 AVALVPVIVAAP 12 6 50.2 195.0 2.4 29.3 19.6 9.9 47 703 IVAVALVPALAP 12 8 50.2 203.3 2.4 29.2 19.5 9.9 48 705 IVAVALLPALAP 12 8 50.2 211.7 2.4 28.6 19.1 9.7 49 885 LVAIAPAVAVLP 12 6 57.3 203.3 2.4 28.3 19.0 9.6 50 3 AALLVPAAVLAP 12 6 57.3 187.5 2.1 27.0 18.0 9.1 51 601 AAILIAVPIAAP 12 8 57.3 195.8 2.3 26.8 17.9 9.0 52 843 AVLVLVAPAAAP 12 8 41.3 219.2 2.5 26.4 17.7 8.9 53 403 AAALVIPAAILP 12 7 54.9 195.8 2.2 25.2 16.8 8.5 54 544 IVALIVAPAAVP 12 8 43.1 203.3 2.4 23.4 15.6 7.9 55 522 ALLVIAVPAVAP 12 8 57.3 203.3 2.4 22.7 15.2 7.7
(152) TABLE-US-00027 TABLE27 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio(Fold) IDNumber aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 56 805 LVLIAAAPIALP 12 8 41.3 220.0 2.4 22.3 14.9 7.6 57 464 AVVILVPLAAAP 12 7 57.3 203.3 2.4 22.3 14.9 7.5 58 405 LAAAVIPVAILP 12 7 54.9 211.7 2.4 22.2 14.8 7.5 59 747 VALLAIAPALAP 12 8 57.3 195.8 2.2 22.0 14.8 7.5 60 501 VIVALAVPALAP 12 8 50.2 203.3 2.4 21.5 14.4 7.3 61 661 AAILAPIVAALP 12 6 50.2 195.8 2.2 21.4 14.3 7.2 62 786 LVAIAPLAVLAP 12 6 41.3 211.7 2.4 21.2 14.2 7.2 63 625 ILAAAAAPLIVP 12 8 50.2 195.8 2.2 20.9 13.9 7.0 64 442 ALAALVPAVLVP 12 7 57.3 203.3 2.3 20.4 13.6 6.9 65 912 VALLAPAVVVAP 12 6 57.3 195.0 2.3 19.9 13.3 6.7 66 165 ALAVPVALAIVP 12 5 50.2 203.3 2.4 19.8 13.2 6.7 67 422 VVAILAPLLAAP 12 7 57.3 211.7 2.4 19.6 13.1 6.6 68 686 AALVAVLPVALP 12 8 57.3 203.3 2.3 19.5 13.1 6.6 69 343 IVAVALPALVAP 12 7 50.2 203.3 2.3 19.4 12.9 6.5 70 323 IVAVALPVALAP 12 7 50.2 203.3 2.3 19.1 12.8 6.4 71 461 IAAVIVPAVALP 12 7 50.2 203.3 2.4 19.0 12.7 6.4 72 21 AVALLPALLAVP 12 6 57.3 211.7 2.3 18.9 12.6 6.4 73 404 LAAAVIPAAILP 12 7 54.9 195.8 2.2 18.9 12.6 6.4 74 261 LVLVPLLAAAAP 12 5 41.3 211.6 2.3 18.5 12.3 6.2 75 524 AVALIVVPALAP 12 8 50.2 203.3 2.4 18.3 12.2 6.2 76 225 VAALLPAAAVLP 12 6 57.3 187.5 2.1 18.3 12.2 6.2 77 264 LAAAPVVIVIAP 12 5 50.2 203.3 2.4 18.2 12.1 6.1 78 1 AAALAPVVLALP 12 6 57.3 187.5 2.1 17.7 11.8 6.0 79 382 AAALVIPAILAP 12 7 54.3 195.8 2.2 17.7 11.8 6.0 80 463 AVAILVPLLAAP 12 7 57.3 211.7 2.4 17.6 11.7 5.9 81 322 VVAIVLPALAAP 12 7 50.2 203.3 2.3 17.6 11.7 5.9 82 503 AAIIIVLPAALP 12 8 50.2 220.0 2.4 17.6 11.8 5.9 83 870 VLVAAVLPIAAP 12 8 41.3 203.3 2.4 16.6 11.1 5.6 84 241 AAAVVPVLLVAP 12 6 57.3 195.0 2.4 16.6 11.0 5.6 85 726 LAVAIIAPAVAP 12 8 57.3 187.5 2.2 16.5 11.0 5.6 86 341 IVAVALPAVLAP 12 7 50.2 203.3 2.3 16.4 10.9 5.5 87 542 ALALIVPAVAP 12 8 50.2 211.6 2.4 16.2 10.8 5.5 88 361 AVVIVAPAVIAP 12 7 50.2 195.0 2.4 16.0 10.7 5.4 89 224 ILAAVPIALAAP 12 6 57.3 195.8 2.2 15.8 10.6 5.3 90 482 ILAVAAIPVAVP 12 8 54.9 203.3 2.4 15.8 10.6 5.3 91 64 AIVALPVAVLAP 12 6 50.2 203.3 2.4 15.8 10.6 5.3 92 484 LAVVLAAPAIVP 12 8 50.2 203.3 2.4 15.6 10.4 5.3 93 868 VLVAAILPAAIP 12 8 54.9 211.7 2.4 14.9 10.0 5.0 94 541 LLALIIAPAAAP 12 8 57.3 204.1 2.1 14.8 9.9 5.0 95 666 AAIAIIAPAIVP 12 8 50.2 195.8 2.3 14.7 9.9 5.0 96 665 LAIVLAAPVAVP 12 8 50.2 203.3 2.3 14.7 9.9 5.0 97 363 AVLAVAPALIVP 12 7 50.2 203.3 2.3 14.7 9.8 4.9 98 242 AALLVPALVAAP 12 6 57.3 187.5 2.1 14.6 9.7 4.9 99 384 VIVAIAPALLAP 12 7 50.2 211.6 2.4 14.0 9.4 4.7 100 877 VAIIAVPAVVAP 12 7 57.3 195.0 2.4 14.0 9.4 4.7 101 863 AAVVLLPIIAAP 12 7 41.3 211.7 2.4 13.8 9.3 4.7 102 525 ALAIVVAPVAVP 12 8 50.2 195.0 2.4 13.8 9.2 4.7 103 875 AIAIVVPAVAVP 12 7 50.2 195.0 2.4 13.8 9.2 4.7 104 285 AIVLLPAAVVAP 12 6 50.2 203.3 2.4 13.3 8.9 4.5 105 281 ALIVLPAAVAVP 12 6 50.2 203.3 2.4 13.3 8.9 4.5 106 867 ALLVVIAPLAAP 12 8 41.3 211.7 2.4 13.2 8.8 4.4 107 766 IVVIAVAPAVAP 12 8 50.2 195.0 2.4 12.9 8.6 4.4 108 342 VIVALAPAVLAP 12 7 50.2 203.3 2.3 12.7 8.5 4.3 109 881 AALIVVPAVAVP 12 7 50.2 195.0 2.4 12.7 8.5 4.3 110 505 AIIIVIAPAAAP 12 8 50.2 195.8 2.3 12.4 8.3 4.2
(153) TABLE-US-00028 TABLE28 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio(Fold) IDNumber aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 111 763 VAVLIAVPALAP 12 8 57.3 203.3 2.3 12.3 7.2 4.2 112 706 IVAVALLPAVAP 12 8 50.2 203.3 2.4 12.0 7.0 4.1 113 687 AILAVALPLLAP 12 8 57.3 220.0 2.3 12.0 7.0 4.1 114 643 LALVLAAPAIVP 12 8 50.2 211.6 2.4 11.8 7.9 4.0 115 282 VLAVAPALIVAP 12 6 50.2 203.3 2.4 11.8 7.9 4.0 116 543 LLAALIAPAALP 12 8 57.3 204.1 2.1 11.7 7.8 4.0 117 325 IVAVALPAVALP 12 7 50.2 203.3 2.3 11.7 7.8 4.0 118 846 IAVAVAAPLLVP 12 8 41.3 203.3 2.4 11.7 6.8 4.0 119 383 VIVALAPALLAP 12 7 50.2 211.6 2.3 11.6 7.7 3.9 120 381 VVAIVLPAVAAP 12 7 50.2 195.0 2.4 11.5 7.7 3.9 121 808 LVVLAAAPLAVP 12 8 41.3 203.3 2.3 11.5 7.6 3.9 122 865 AVLVIAVPAIAP 12 8 57.3 203.3 2.5 11.3 7.5 3.8 123 725 IAVLAVAPAVLP 12 8 57.3 203.3 2.3 11.2 7.5 3.8 124 844 VVALLAPLIAAP 12 7 41.3 211.8 2.4 11.2 7.5 3.8 125 897 AVIVPVAIIAAP 12 5 50.2 203.3 2.5 11.2 7.5 3.8 126 605 VIAAVLAPVAVP 12 8 57.3 195.0 2.4 11.0 7.4 3.7 127 744 AAVVIVAPVALP 12 8 50.2 195.0 2.4 11.0 7.3 3.7 128 221 AAILAPIVALAP 12 6 50.2 195.8 2.2 10.9 7.3 3.7 129 622 ALIVLAAPVAVP 12 8 50.2 203.3 2.4 10.6 7.1 3.6 130 401 AALAVIPAAILP 12 7 54.9 195.8 2.2 10.6 7.1 3.6 131 324 IVAVALPAALVP 12 7 50.2 203.3 2.3 10.3 6.9 3.5 132 878 IVALVAPAAVVP 12 7 50.2 195.0 2.4 10.3 6.9 3.5 133 302 LALAPALALLAP 12 5 57.3 204.2 2.1 10.2 6.8 3.4 134 685 ALLVAVLPAALP 12 8 57.3 211.7 2.3 10.2 5.9 3.4 135 848 AVAIVVLPAVAP 12 8 50.2 195.0 2.4 10.0 6.7 3.4 136 602 VIVALAAPVLAP 12 8 50.2 203.3 2.4 9.9 5.8 3.4 137 788 AIAVAIAPVALP 12 8 57.3 187.5 2.3 9.8 6.6 3.3 138 145 LLAVVPAVALAP 12 6 57.3 203.3 2.3 9.5 6.3 3.2 139 11 VVALAPALAALP 12 6 57.3 187.5 2.1 9.5 6.3 3.2 140 141 AVIVLPALAVAP 12 6 50.2 203.3 2.4 9.4 6.3 3.2 141 521 LAALIVVPAVAP 12 8 50.2 203.3 2.4 9.4 6.3 3.2 142 425 AVVAIAPVLALP 12 7 57.3 203.3 2.4 9.4 6.3 3.2 143 365 AVIVVAPALLAP 12 7 50.2 203.3 2.3 9.3 6.2 3.1 144 263 ALAVIPAAAILP 12 6 54.9 195.8 2.2 9.0 6.0 3.0 145 345 ALLIVAPVAVAP 12 7 50.2 203.3 2.3 8.9 5.9 3.0 146 850 LVIALAAPVALP 12 8 57.3 211.7 2.4 8.8 5.9 3.0 147 144 VLAIVPAVALAP 12 6 50.2 203.3 2.4 8.8 5.9 3.0 148 767 IVVAAVVPALAP 12 8 50.2 195.0 2.4 8.5 5.0 2.9 149 185 AALVLPLIIAAP 12 6 41.3 220.0 2.4 8.5 5.7 2.9 150 849 AVILLAPLIAAP 12 7 57.3 220.0 2.4 8.3 4.8 2.8 151 864 ALLVIAPAIAVP 12 7 57.3 211.7 2.4 8.2 4.8 2.8 152 162 AVVALPAALIVP 12 6 50.2 203.3 2.4 8.2 5.5 2.8 153 164 LAAVLPALLAAP 12 6 57.3 195.8 2.1 8.2 5.5 2.8 154 907 VAIALAPVVVAP 12 7 57.3 195.0 2.4 8.1 5.4 2.8 155 444 LAAALVPVALVP 12 7 57.3 203.3 2.3 8.1 5.4 2.7 156 443 ALAALVPVALVP 12 7 57.3 203.3 2.3 8.0 5.3 2.7 157 901 ALVAVLPAVAVP 12 7 57.3 195.0 2.4 7.7 5.1 2.6 158 887 VLAVAPAVAVLP 12 6 57.3 195.0 2.4 7.7 5.1 2.6 159 746 VAIIVVAPALAP 12 8 50.2 203.3 2.4 7.6 4.4 2.6 160 902 ALVAPLLAVAVP 12 5 41.3 203.3 2.3 7.6 5.1 2.6 161 565 VAIVLVAPAVAP 12 8 50.2 195.0 2.4 7.5 5.0 2.5 162 245 AAALAPVLALVP 12 6 57.3 187.5 2.1 7.5 5.0 2.5 163 743 AIAIALVPVALP 12 8 57.3 211.6 2.4 7.4 4.9 2.5 164 465 AVVILVPLAAAP 12 7 57.3 203.3 2.4 7.4 4.9 2.5 165 104 AVVAAPLVLALP 12 6 41.3 203.3 2.3 7.3 4.9 2.5
(154) TABLE-US-00029 TABLE29 Proline Rigidity/ Sturctural Relative Sequence Position Flexibility Feature Hydropathy Ratio(Fold) IDNumber aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 166 707 IVALAVLPAVAP 12 8 50.2 203.3 2.4 7.3 4.9 2.5 167 872 VLAAAVLPLVVP 12 8 41.3 219.2 2.5 7.3 4.9 2.5 168 583 AVILALAPIVAP 12 8 50.2 211.6 2.4 7.3 4.8 2.4 169 879 AAIVLLPAVVVP 12 7 50.2 219.1 2.5 7.2 4.8 2.4 170 784 VAALPAVALVVP 12 5 57.3 195.0 2.4 7.1 4.7 2.4 171 893 VIAIPAILAAAP 12 5 54.9 195.8 2.3 7.0 4.7 2.4 172 13 AAALVPVVALLP 12 6 57.3 203.3 2.3 7.0 4.7 2.4 173 809 LIVLAAPALAAP 12 7 50.2 195.8 2.2 7.0 4.7 2.4 174 445 ALAALVPALVVP 12 7 57.3 203.3 2.3 6.9 4.6 2.3 175 81 AALLPALAALLP 12 5 57.3 204.2 2.1 6.9 4.6 2.3 176 667 LAVAIVAPALVP 12 8 50.2 203.3 2.3 6.9 4.6 2.3 177 906 AVIALAPVVVAP 12 7 57.3 195.0 2.4 6.8 4.6 2.3 178 483 ILAAAIIPAALP 12 8 54.9 204.1 2.2 6.8 4.5 2.3 179 485 AILAAIVPLAVP 12 8 50.2 211.6 2.4 6.8 4.5 2.3 180 421 AAILAAPLIAVP 12 7 57.3 195.8 2.2 6.7 4.5 2.3 181 585 ALIVAIAPALVP 12 8 50.2 211.6 2.4 6.6 4.4 2.2 182 424 AVVVAAPVLALP 12 7 57.3 195.0 2.4 6.6 4.4 2.2 183 364 LVAAVAPALIVP 12 7 50.2 203.3 2.3 6.5 4.3 2.2 184 402 ALAAVIPAAILP 12 7 54.9 195.8 2.2 6.4 4.3 2.2 185 462 IAAVLVPAVALP 12 7 57.3 203.3 2.4 6.3 4.2 2.1 186 265 VLAIAPLLAAVP 12 6 41.3 211.6 2.3 6.0 4.0 2.0 187 301 VIAAPVLAVLAP 12 6 57.3 203.3 2.4 6.0 4.0 2.0 188 183 LLAAPVVIALAP 12 6 57.3 211.6 2.4 6.0 4.0 2.0 189 243 AAVLLPVALAAP 12 6 57.3 187.5 2.1 5.9 3.9 2.0 190 664 ILIAIAIPAAAP 12 8 54.9 204.1 2.3 5.7 3.8 1.9 191 783 IVALVPAVAIAP 12 6 50.2 203.3 2.5 5.7 3.8 1.9 192 502 AIVALAVPVLAP 12 8 50.2 203.3 2.4 5.6 3.7 1.9 193 262 ALIAVPAIIVAP 12 6 50.2 211.6 2.4 5.5 3.7 1.9 194 683 LAIVLAAPAVLP 12 8 50.2 211.7 2.4 5.5 3.2 1.9 195 830 IALVAAPVALVP 12 7 57.3 203.3 2.4 5.3 3.5 1.8 196 764 AVALAVLPAVVP 12 8 57.3 195.0 2.3 5.0 3.4 1.7 197 807 AVALAVPALVLP 12 7 57.3 203.3 2.3 5.0 3.3 1.7 198 184 LAAIVPAIIAVP 12 6 50.2 211.6 2.4 4.8 3.2 1.6 199 305 IALAAPILLAAP 12 6 57.3 204.2 2.2 4.8 3.2 1.6 200 101 LVALAPVAAVLP 12 6 57.3 203.3 2.3 4.5 3.0 1.5 201 304 AIILAPIAAIAP 12 6 57.3 204.2 2.3 4.4 3.0 1.5 202 604 VALIAVAPAVVP 12 3 57.3 195.0 2.4 4.3 2.5 1.5 203 645 ALAVVALPAIVP 12 8 50.2 203.3 2.4 4.3 2.9 1.5 204 201 LALAVPALAALP 12 6 57.3 195.8 2.1 4.2 2.8 1.4 205 163 LALVLPAALAAP 12 6 57.3 195.8 2.1 4.1 2.4 1.4 206 832 AVAAIVPVIVAP 12 7 43.2 195.0 2.5 4.1 2.7 1.4 207 182 ALIAPVVALVAP 12 6 57.3 203.3 2.4 4.0 2.7 1.4 208 23 VVLVLPAAAAVP 12 6 57.3 195.0 2.4 4.0 2.6 1.3 209 105 LLALAPAALLAP 12 6 57.3 204.1 2.1 4.0 2.6 1.3 210 561 AAVAIVLPAVVP 12 8 50.2 195.0 2.4 3.9 2.6 1.3 211 765 AVALAVVPAVLP 12 8 57.3 195.0 2.3 3.8 2.2 1.3 212 684 AAIVLALPAVLP 12 8 50.2 211.7 2.4 3.5 2.1 1.2 213 143 AVLAVPAVLVAP 12 6 57.3 195.0 2.4 3.3 2.2 1.1 214 504 LIVALAVPALAP 12 8 50.2 211.7 2.4 3.3 2.2 1.1 215 22 AVVLVPVLAAAP 12 6 57.3 195.0 2.4 3.1 2.1 1.1 216 5 AAALLPVALVAP 12 6 57.3 187.5 2.1 3.1 2.1 1.0 217 283 AALLAPALIVAP 12 6 50.2 195.8 2.2 3.1 2.0 1.0 218 65 IAIVAPVVALAP 12 6 50.2 203.3 2.4 3.0 2.0 1.0 219 883 LAIVPAAIAALP 12 6 50.2 195.8 2.2 3.0 2.0 1.0 220 123 AAIIVPAALLAP 12 6 50.2 195.8 2.2 2.9 2.0 1.0
(155) TABLE-US-00030 TABLE30 Sturc- Sequence Proline Rigidity/ tural Hydro- Relative ID Position Flexibility Feature pathy Ratio(Fold) Number aMTD Sequences Length (PP) (II) (AI) (GRAVY) A B C 221 284 ALIAPAVALIVP 12 5 50.2 211.7 2.4 2.8 1.8 0.9 222 205 ALALVPAIAALP 12 6 57.3 195.8 2.2 2.6 1.7 0.9 223 42 VAALPVVAVVAP 12 5 57.3 186.7 2.4 2.5 1.7 0.8 224 121 AIVALPALALAP 12 6 50.2 195.8 2.2 2.5 1.7 0.8 225 25 IVAVAPALVALP 12 6 50.2 203.3 2.4 2.4 1.6 0.8 226 24 IALAAPALIVAP 12 6 50.2 195.8 2.2 2.3 1.6 0.8 227 204 LIAALPAVAALP 12 6 57.3 195.8 2.2 2.2 1.5 0.8 228 12 LLAAVPAVLLAP 12 6 57.3 211.7 2.3 2.2 1.5 0.7 229 43 LLAAPLVVAAVP 12 5 41.3 187.5 2.1 2.1 1.4 0.7 230 103 ALIAAPILALAP 12 6 57.3 204.2 2.2 2.1 1.4 0.7 231 82 AVVLAPVAAVLP 12 6 57.3 195.0 2.4 2.1 1.4 0.7 232 4 ALALLPVAALAP 12 6 57.3 195.8 2.1 2.0 1.3 0.7 233 85 LLVLPAAALAAP 12 5 57.3 195.8 2.1 1.9 1.3 0.7 234 63 AALLVPALVAVP 12 6 57.3 203.3 2.3 1.9 1.3 0.7 235 44 ALAVPVALLVAP 12 5 57.3 203.3 2.3 1.6 1.1 0.5 236 84 AAVAAPLLLALP 12 6 41.3 195.8 2.1 1.5 1.0 0.5 237 62 VALLAPVALAVP 12 6 57.3 203.3 2.3 1.4 0.9 0.5 238 83 LAVAAPLALALP 12 6 41.3 195.8 2.1 1.4 0.9 0.5 239 102 LALAPAALALLP 12 5 57.3 204.2 2.1 1.4 0.9 0.5 240 623 VAAAIALPAIVP 12 8 50.2 187.5 2.3 0.8 0.6 0.3 19.61.6 13.11.1 6.60.5
(156) Moreover, compared to reference CPPs (B type: MTM12 and C type: MTD85), novel 240 aMTDs averaged of 131.1 (maximum 109.9) and 6.60.5 (maximum 55.5) fold higher cell-permeability, respectively (Tables 26-31).
(157) TABLE-US-00031 TABLE 31 Negative control rP38 MTM12 MTD85 aMTD 19.6 1.6* 13.1 1.1* 6.6 0.5* The Average of (Best: 164.2) (Best: 109.9) (Best: 55.5) 240 aMTDs *Relative Fold (aMTD in Geo Mean in its comparison to rP38, MTM12 or MTD85)
(158) In addition, cell-permeability of 31 rPeptides has been compared with that of 240 aMTDs (0.30.04; Tables 32 and 33).
(159) TABLE-US-00032 TABLE32 Proline Rigidity/ Sturctural Position Flexibility Feature Hydropathy RelativeRatio Number ID Sequence Length (PP) (II) (AI) (GRAVY) toaMTDAVE 892 692 PAPLPPVVILAV 12 1,3,5,6 105.5 186.7 1.8 0.74 880 26 AAIALAAPLAIV 12 8 18.1 204.2 2.5 0.65 876 113 PVAVALLIAVPP 12 1,11,12 57.3 195.0 2.1 0.61 882 466 IIAAAAPLAIIP 12 7,12 22.8 204.2 2.3 0.52 883 167 VAIAIPAALAIP 12 6,12 20.4 195.8 2.3 0.50 921 97 ALLAAPPALLAL 12 6,7 57.3 204.2 2.1 0.41 894 390 VPLLVPVVPVVP 12 2,6,9,12 105.4 210.0 2.2 0.41 885 426 AAALAIPLAIIP 12 7,12 4.37 204.2 2.2 0.40 922 241 ALIVAPALMALP 12 6,12 60.5 187.5 2.2 0.33 898 68 VAPVLPAAPLVP 12 3,6,9,12 105.5 162.5 1.6 0.32 926 39 CYNTSPCTGCCY 12 6 52.5 0.0 0.0 0.29 873 934 LILAPAAVVAAA 12 5 57.3 195.8 2.5 0.28 901 938 VPVLLPVVVPVP 12 2,6,10,12 121.5 210.0 2.2 0.28 902 329 LPVLVPVVPVVP 12 2,6,9,12 121.5 210.0 2.2 0.23 886 606 AAAIAAIPIIIP 12 8,12 4.4 204.2 2.4 0.20 903 49 VVPAAPAVPVVP 12 3,6,9,12 121.5 145.8 1.7 0.18 929 139 TGSTNSPTCTST 12 7 53.4 0.0 0.7 0.17 904 772 LPVAPVIPIIVP 12 2,5,8,12 79.9 210.8 21 0.16 916 921 IWWFVVLPLVVP 12 8,12 41.3 194.2 2.2 0.14 887 66 AGVLGGPIMGVP 12 7,12 35.5 121.7 1.3 0.13 907 693 AAPVLPVAVPIV 12 3,6,10 82.3 186.7 2.1 0.13 930 18 NYCCTPTTNGQS 12 6 47.9 0.0 0.9 0.10 875 16 NNSCTTYTNGSQ 12 None 47.4 0.0 1.4 0.08 889 227 LAAIVPIAAAVP 12 6,12 34.2 187.5 2.2 0.08 890 17 GGCSAPQTTCSN 12 6 51.6 8.3 0.5 0.08 891 67 LDAEVPLADDVP 12 6,12 34.2 130.0 0.3 0.08 932 635 GSTGGSQQNNQY 12 None 31.9 0.0 1.9 0.07 909 29 VLPPLPVLPVLP 12 3,4,6,9,12 121.5 202.5 1.7 0.07 934 57 QNNCNTSSQGGG 12 None 52.4 0.0 1.6 0.06 936 700 GTSNTCQSNQNS 12 None 19.1 0.0 1.6 0.05 937 38 YYNQSTCGGQCY 12 ND 53.8 0.0 1.0 0.05 AVE 0.30.04
(160) TABLE-US-00033 TABLE 33 Relative Ratio to aMTD AVE* rPeptide 0.3 0.04 The Average of 31 aMTDs *Out of 240 aMTDs, average relative fold of aMTD had been 19.6 fold compared to type A (rP38).
(161) In summary, relative cell-permeability of aMTDs has shown maximum of 164.0, 109.9 and 55.5 fold higher to rP38, MTM12 and MTD85, respectively. In average of total 240 aMTD sequences, 19.61.6, 13.11.1 and 6.60.5 fold higher cell-permeability are shown to the rP38, MTM12 and MTD85, respectively (Tables 26-31). Relative cell-permeability of negative control (rP38) to the 240 aMTDs is only 0.30.04 fold.
(162) 4-5. Intracellular Delivery and Localization of aMTD-Fused Recombinant Proteins Recombinant proteins fused to the aMTDs were tested to determine their intracellular delivery and localization by laser scanning confocal microscopy with a negative control (rP38) and previous published CPPs (MTM12 and MTD85) as the positive control references. NIH3T3 cells were exposed to 10 M of FITC-labeled protein for 1 hour at 37 C., and nuclei were counterstained with DAPI. Then, cells were examined by confocal laser scanning microscopy (
(163) 4-6. Summary of Quantitative and Visual Cell-Permeability of Newly Developed aMTDs
(164) Histidine-tagged aMTD-fused cargo recombinant proteins have been greatly enhanced in their solubility and yield. Thus, FITC-conjugated recombinant proteins have also been tested to quantitate and visualize intracellular localization of the proteins and demonstrated higher cell-permeability compared to the reference CPPs.
(165) In the previous studies using the hydrophobic signal-sequence-derived CPPsMTS/MTM or MTDs, 17 published sequences have been identified and analyzed in various characteristics such as length, molecular weight, pl value, bending potential, rigidity, flexibility, structural feature, hydropathy, amino acid residue and composition, and secondary structure of the peptides. Based on these analytical data of the sequences, novel artificial and non-natural peptide sequences designated as advanced MTDs (aMTDs) have been invented and determined their functional activity in intracellular delivery potential with aMTD-fused recombinant proteins.
(166) aMTD-fused recombinant proteins have promoted the ability of protein transduction into the cells compared to the recombinant proteins containing rPeptides and/or reference hydrophobic CPPs (MTM12 and MTD85). According to the results, it has been demonstrated that critical factors of cell-penetrating peptide sequences play a major role to determine peptide-mediated intracellular delivery by penetrating plasma membrane. In addition, cell-permeability can considerably be improved by following the rational that all satisfy the critical factors.
(167) 5. Structure/Sequence Activity Relationship (SAR) of aMTDs on Delivery Potential
(168) After determining the cell-permeability of novel aMTDs, structure/sequence activity relationship (SAR) has been analyzed for each critical factor in selected some of and all of novel aMTDs (
(169) TABLE-US-00034 TABLE 34 Rank of Rigidity/ Sturctural Relative Amino Acid Delivery Flexibility Feature Hydropathy Ratio (Fold) Composition Potential (II) (AI) (GRAVY) A B C A V I L 1~10 55.9 199.2 2.3 112.7 75.5 38.1 4.0 3.5 0.4 2.1 11~20 51.2 205.8 2.4 56.2 37.6 19.0 4.0 2.7 1.7 1.6 21~30 49.1 199.2 2.3 43.6 28.9 14.6 4.3 2.7 1.4 1.6 31~40 52.7 201.0 2.4 34.8 23.3 11.8 4.2 2.7 1.5 1.6 41~50 53.8 201.9 2.3 30.0 20.0 10.1 4.3 2.3 1.1 2.3 51~60 51.5 205.2 2.4 23.5 15.7 7.9 4.4 2.1 1.5 2.0 222~231 52.2 197.2 2.3 2.2 1.5 0.8 4.5 2.1 1.0 2.4 232~241 54.1 199.7 2.2 1.7 1.2 0.6 4.6 1.7 0.2 3.5
(170) 5-1. Proline Position:
(171) In regards to the bending potential (proline position: PP), aMTDs with its proline at 7 or 8 amino acid in their sequences have much higher cell-permeability compared to the sequences in which their proline position is at 5 or 6 (
(172) 5-2. Hydropathy:
(173) In addition, when the aMTDs have GRAVY (Grand Average of Hydropathy) ranging in 2.1-2.2, these sequences display relatively lower cell-permeability, while the aMTDs with 2.3-2.6 GRAVY are shown significantly higher one (
(174) 5-3. rPeptide SAR:
(175) To the SAR of aMTDs, rPeptides have shown similar SAR correlations in the cell-permeability, pertaining to their proline position (PP) and hydropathy (GRAVY). These results confirms that rPeptides with high GRAVY (2.4-2.6) have better cell-permeability (
(176) 5-4. Analysis of Amino Acid Composition:
(177) In addition to proline position and hydropathy, the difference of amino acid composition is also analyzed. Since aMTDs are designed based on critical factors, each aMTD-fused recombinant protein has equally two proline sequences in the composition. Other hydrophobic and aliphatic amino acidsalanine, isoleucine, leucine and valineare combined to form the rest of aMTD peptide sequences.
(178) Alanine: In the composition of amino acids, the result does not show a significant difference by the number of alanine in terms of the aMTD's delivery potential because all of the aMTDs have three to five alanines. In the sequences, however, four alanine compositions show the most effective delivery potential (geometric mean) (
(179) Leucine and Isoleucine: Also, the compositions of isoleucine and leucine in the aMTD sequences show inverse relationship between the number of amino acid (I and L) and delivery potential of aMTDs. Lower number of isoleucine and leucine in the sequences tends to have higher delivery potential (geometric mean) (
(180) Valine: Conversely, the composition of valine of aMTD sequences shows positive correlation with their cell-permeability. When the number of valine in the sequence is low, the delivery potential of aMTD is also relatively low (
(181) Ten aMTDs having the highest cell-permeability are selected (average geometric mean: 2584126). Their average number of valine in the sequences is 3.5; 10 aMTDs having relatively low cell-permeability (average geometric mean: 804) had average of 1.9 valine amino acids. The average number of valine in the sequences is lowered as their cell-permeability is also lowered as shown in
(182) 5-5. Conclusion of SAR Analysis:
(183) As seen in
(184) 6. Experimental Confirmation of Index Range/Feature of Critical Factors
(185) The range and feature of five out of six critical factors have been empirically and experimentally determined that are also included in the index range and feature of the critical factors initially proposed before conducting the experiments and SAR analysis. In terms of index range and feature of critical factors of newly developed 240 aMTDs, the bending potential (proline position: PP), rigidity/flexibility (Instability Index: II), structural feature (Aliphatic Index: AI), hydropathy (GRAVY), amino acid length and composition are all within the characteristics of the critical factors derived from analysis of reference hydrophobic CPPs.
(186) Therefore, our hypothesis to design and develop new hydrophobic CPP sequences as advanced MTDs is empirically and experimentally proved and demonstrated that critical factor-based new aMTD rational design is correct.
(187) TABLE-US-00035 TABLE 35 Summarized Critical Factors of aMTD Analysis of Newly Designed Experimental CPPs Results Critical Factor Range Range Bending Potential Proline presences Proline presences (Proline Position: PP) in the middle in the middle (5, 6, 7 (5, 6, 7 or 8) and at the or 8) and at the end of peptides end of peptides Rigidity/Flexibility 40-60 41.3-57.3 (Instability Index: II) Structural Feature 180-220 187.5-220.0 (Aliphatic Index: AI) Hydropathy 2.1-2.6 2.2-2.6 (Grand Average of Hydropathy GRAVY) Length 9-13 12 (Number of Amino Acid) Amino acid Composition A, V, I, L, P A, V, I, L, P
7. Discovery and Development of Protein-Based New Biotherapeutics with MITT Enabled by aMTDs for Protein Therapy
(188) The aMTD sequences have been designed and developed based on the critical factors. Quantitative and visual cell-permeability of 240 aMTDs (hydrophobic, flexible, bending, aliphatic and 12 a/a-length peptides) are all practically determined.
(189) To measure the cell-permeability of aMTDs, rPeptides have also been designed and tested. As seen in
(190) These examined critical factors are within the range that we have set for our critical factors; therefore, we are able to confirm that the aMTDs that satisfy these critical factors have relatively high cell-permeability and much higher intracellular delivery potential compared to reference hydrophobic CPPs reported during the past two decades.
(191) It has been widely evident that many human diseases are caused by proteins with deficiency or over-expression that causes mutations such as gain-of-function or loss-of-function. If biologically active proteins could be delivered for replacing abnormal proteins within a short time frame, possibly within an hour or two, in a quantitative manner, the dosage may be regulated depending on when and how proteins may be needed. By significantly improving the solubility and yield of novel aMTD in this invention (Table 31), one could expect its practical potential as an agent to effectively deliver therapeutic macromolecules such as proteins, peptides, nucleic acids, and other chemical compounds into live cells as well as live mammals including human. Therefore, newly developed MITT utilizing the pool (240) of novel aMTDs can be used as a platform technology for discovery and development of protein-based biotherapeutics to apprehend intracellular protein therapy after determining the optimal cargo-aMTD relationship.
(192) 8. Novel Hydrophobic CPPsaMTDs for Development of iCP-Parkin
(193) 8-1. Selection of aMTD for Cell-Permeability
(194) From 240 aMTDs, 12 aMTDs were selected and used for the construction of iCP Parkin recombinant proteins. 12 aMTDs used are shown in the following Table 36.
(195) Various hydrophobic CPP have been used to enhance the delivery of protein cargoes to mammalian cells and tissues. Similarly, aMTD.sub.321 and aMTD.sub.524 had been discovered to enhance the uptake of a His-tagged coding sequence of solubilization domain A (SDA) in RAW264.7 cells as assessed by flow cytometry. Relative levels of protein uptake was 7 times higher than that of a reference MTM12 protein, which contained 1st generation CPP (membrane translocating motif) and was 2.9 times higher than that of a MTD.sub.85 reference protein, which contained 2nd generation CPP (macromolecule transduction domain). In addition, relative to 8.1-fold higher protein uptake was observed with a random peptide recombinant protein (rP38)-fused with SDA, a peptide sequence, which had an opposite property of that of aMTD (
(196) TABLE-US-00036 TABLE36 SEQIDNO aMTDID AminoAcidSequences 34 124 IAVALPALIAAP 43 165 ALAVPVALAIVP 74 321 IVAVALPALAVP 78 325 IVAVALPAVALP 80 342 VIVALAPAVLAP 83 361 AVVIVAPAVIAP 122 524 AVALIVVPALAP 143 623 VAAAIALPAIVP 152 683 LAIVLAAPAVLP 154 685 ALLVAVLPAALP 155 686 AALVAVLPVALP 156 687 AILAVALPLLAP
(197) Table 37: Characteristics of aMTD.sub.321
(198) TABLE-US-00037 TABLE37 CharacteristicsofaMTD.sub.321 Rigidity/ Structural SEQ aMTD Flexibility Feature Hydropathy ID ID A/aSequence Length (II) (AI) (GRAVY) 74 321 IVAVALPALAVP 12 50.2 203.3 2.4
(199) 8-2. Selection of Solubilization Domain (SD) for Structural Stability
(200) Recombinant cargo (Parkin) proteins fused to hydrophobic CPP could be expressed in a bacterial system, purified with single-step affinity chromatography, but protein dissolved in physiological buffers (e.q. PBS, DMEM or RPMI1640 etc.) was highly insoluble and had extremely low yield as a soluble form. Therefore, an additional non-functional protein domain (solubilization domain: SD) has been applied to fuse with the recombinant protein for improving the solubility, yield and eventually cell and tissue permeability.
(201) According to the specific aim, the selected domains are SDASDF (Table 38). The aMTD/SD-fused recombinant proteins have been determined for their stability. The solubilization domains (SDs) and aMTDs have greatly influenced in increasing solubility/yield and cell-/tissue-permeability of the protein. Therefore, we have developed highly soluble and highly stable Parkin recombinant protein fused with SD (SDA and SDB) and aMTDs for the clinical application.
(202) Table 38: Characteristics of Solubilization Domain
(203) TABLE-US-00038 TABLE 38 Characteristics of Solubilization Domain Protein Instability SD Genbank ID Origin (kDa) pI Index (II) GRAVY A CP000113.1 Bacteria 23 4.6 48.1 0.1 B BC086945.1 Rat 11 4.9 43.2 0.9 C CP012127.1 Human 12 5.8 30.7 0.1 D CP012127.1 Bacteria 23 5.9 26.3 0.1 E CP011550.1 Human 11 5.3 44.4 0.9 F NG_034970 Human 34 7.1 56.1 0.2
(204) 8-3. Construction of Expression Vector
(205) We designed 5 different types of recombinant proteins with or without the aMTD and solubilization domains for Parkin protein. Protein structures were labeled as follows: (1) a cargo protein with His-tag only, (2) a cargo protein fused with His-tag and aMTD, (3) a cargo protein fused with His-tag, aMTD and solubilization domain A (SDA), (4) a cargo protein fused with His-tag, aMTD and solubilization domain B (SDB), (4C) a cargo protein fused with His-tag and solubilization domain B (SDB), (5) a cargo protein fused with aMTD and solubilization domain B (SDB), and (5C) a cargo protein fused with solubilization domain B (SDB), (
(206) 8-4. Preparation of Parkin Recombinant Proteins
(207) Each Parkin recombinant protein was successfully induced by adding IPTG and purified (
(208) 9. Determination of Cell-, Tissue-Permeability of Each Recombinant Protein
(209) The aMTD.sub.321/SD-fused Parkin recombinant proteins have significantly higher cell-, tissue-permeability as compared to the Parkin recombinant proteins lacking aMTD.sub.321 or aMTD.sub.524 sequence (HP, HPSB and other aMTDs). Collectively, even though these aMTD.sub.321/SD-fusion Parkin recombinant proteins (HM.sub.321PSA and HM.sub.321PSB) have similar solubility and yield, cellular and systemic delivery activity of aMTD.sub.321/SDB-fused Parkin recombinant protein was higher than Parkin recombinant protein lacking aMTD.sub.321 sequence. Therefore, aMTD.sub.321/SD-fused Parkin recombinant protein was determined as the most stable structure of the recombinant proteins.
(210) In addition, solubility/yield, permeability, and biological activity of 10 types of aMTDs additionally selected, besides aMTD.sub.321, were measured and shown in
(211) 9-1. Cell-Permeability of Parkin Recombinant Proteins
(212) We investigated in the cell/tissue-permeability and biological activity of developed Parkin recombinant proteins. Cell permeability of Parkin recombinant proteins was evaluated in RAW 264.7 cells after 1 hour of protein treatment. FITC-labeled Parkin recombinant proteins lacking aMTD (HP and HPSB) was not detectable in RAW cells. In contrast, the aMTD-bearing Parkin recombinant proteins, HM.sub.321P, HM.sub.321PSA, HM.sub.321PSB and M.sub.524PSB showed high cell permeability (
(213) 9-2. Tissue-Permeability of Parkin Recombinant Proteins
(214) Next, we determined in vivo tissue-permeability of Parkin recombinant proteins after 15 min and 30 min of intraperitoneal injection of FITC-labeled proteins (
(215) One of the two Parkin recombinant proteins, HM.sub.321PSB, showed a higher intracellular signal in PBMC. The distribution of FITC-labeled proteins in different organs in cryosections analyzed by fluorescence microscopy (
(216) 10. Immunodetection of Parkin Recombinant Proteins in Brain Tissue
(217) To determine the blood-brain-barrier permeability by using immunohistochemical labeling (immunohistochemistry), tissues were immunohistochemically processed using anti-Parkin (1:200, Santa Cruz Biotechnology) monoclonal antibodies. Parkin positive immunoreactivity was observed in brain of the HM.sub.321PSB-treated mice, but it was not observed in brain of the HPSB-treated mice (
(218) The results have demonstrated that the aMTD/SD-fused Parkin recombinant protein could be efficiently delivered to neuronal cells in the brain by penetrating the blood-brain barrier.
(219) 11. Determination of the Biological Activity of iCP-Parkin Recombinant Protein
(220) 11-1. E3 Ligase Activity of iCP-Parkin Recombinant Proteins
(221) To determine the E3 ligase activity of Parkin recombinant protein, Parkin E3 ligase activity was measured by using an auto-ubiquitination assay (Boston Biochem) conducted according to the manufacturers' instructions. As shown in
(222) 11-2. Anti-Apoptotic Effect of iCP-Parkin Recombinant Proteins
(223) To determine the protective effect of Parkin recombinant protein on the neuronal death caused by the neurotoxin, CATH.a and SH-SYSY cells were treated with 6-hydroxydopamine (6-OHDA). After treatment of 6-OHDA, these cells were treated with Parkin recombinant proteins and TUNNEL assays were conducted. A large number of cell death were observed in 6-OHDA only treated group. Similarly to 6-OHDA-treated group, HP lacking aMTD has shown similar percentage of apoptotic cell death with the agonist only group. Contrastingly, aMTD.sub.321/SD-fused Parkin recombinant proteins (HM.sub.321PSA and HM.sub.321PSB) have suppressed apoptosis to 19.7 and 14.2% in CATH.a and SH-SYSY cells, respectively (*p<0.05). Similar results have been obtained in both CATH.a cells and SH-SYSY cells. When aMTD.sub.524 Parkin protein was treated, similar results have been obtained. These results have demonstrated that aMTD/SD-fused Parkin recombinant proteins have neuroprotective effects in cultured neuronal cells. Further, these neuronal cell death inhibitory effects were observed in a dose-dependent manner (
(224) Further, degradation of -Synuclein aggregates was measured by cell counting after Tryphan Blue staining. As shown in
(225) 12. Development of MPTP-PD Animal Models
(226) In order to determine the effect of Parkin recombinant proteins in vivo, we developed various Parkinson's disease-(PD-) animal model that mimics physiological and mental symptoms of Parkinson's disease by using a neural toxin. To induce Parkinson's disease-like symptoms, the neural toxin, MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydrophyridine) was used. This MPTP is converted to a toxic agent MPP+ by monoamine oxidase (MAO-B) in the inner mitochondrial membrane, and this selectively targets dopaminergic neuron to induce Parkinson's disease (
(227) 13. Assessment of Motor Activity Influenced by Parkin Recombinant Proteins
(228) 13-1. Swimming Test
(229) To assess the motor function recovery effect of Parkin recombinant proteins, swimming test was conducted. Swimming activity (4 legged) of each group (Diluent, MPTP only, MPTP+HPSB and MPTP+HM.sub.321PSB) was measured and expressed as a percentage of the unlesioned diluent control. MPTP only group showed significant decrease in the swimming activity as compared to the diluent group. Similarly, HPSB-treated group showed similar result of MPTP only group. Contrastingly, HM.sub.321PSB-treated group showed improved motor activity. Therefore, we have determined that aMTD.sub.321/SD-fused Parkin recombinant protein recovered motor function in acute MPTP-induced Parkinson disease mouse model (
(230) 13-2. Gait Test
(231) To assess the motor function recovery effect of Parkin recombinant proteins, gait test was performed (
(232) 13-3. Sub-Chronic MPTP-PD Model
(233) Rota-Rod test was performed in a sub-chronic MPTP model, and as a result, aMTD.sub.524/SD-fused Parkin protein treated group did walking on a Rota-rod for a long time, similar to the diluent control. That is, motor function recovery by aMTD.sub.524/SD-fused Parkin protein was verified (
(234) 14. Activation of Dopamine Release in MPTP-PD Mouse Model by Parkin Recombinant Proteins
(235) 14-1. Dopamine in Urine
(236) To measure the dopamine level in urine, urine was collected from mice in all groups 10 h after the first treatment of Parkin recombinant proteins. These urine samples have been measured by ELISA. There has been statistically significant difference between MPTP only and HM.sub.321PSB-treated group in the result after 10 h. While MPTP only group has shown decreased urine level, HM.sub.321PSB-treated group have shown similar urine level as compared with the diluent group. The results have demonstrated that the aMTD.sub.321/SD-fused Parkin recombinant protein stimulates dopamine level in urine. (
(237) 14-2. Dopamine in Brain
(238) To measure the dopamine level in the brain, dopamine level of striatal regions in all groups have been measured by ELISA. Striatal dopamine level in HM.sub.321PSB-treated group was more than double compared to the MPTP only and HPSB-treated group. Therefore, we have determined that aMTD.sub.321/SD-fused Parkin recombinant protein causes an increase of striatal dopamine level, decreased by MPTP treatment (
(239) 15. Expression Recovery of Tyrosine Hydroxylase by Parkin Recombinant Proteins in MPTP-PD Model
(240) 15-1. Acute MPTP-PD Model
(241) To determine the protective efficacy of dopaminergic neuron by Parkin recombinant protein, immunohistochemistry was performed using an antibody for tyrosine hydroxylase, which is a marker enzyme in dopamine neurons. The number of dopaminergic neurons in the substantia nigra and the striatum region of the mice treated with aMTD/SD-fused Parkin recombinant protein were observed and compared to the MPTP only and HPSB administrated group. Therefore, we have determined that aMTD/SD-fused Parkin recombinant protein could have a neuroprotective function. Furthermore, the neuronal cell recovery effects of aMTD/SD-fused Parkin recombinant protein were observed in a dose-dependent manner (
(242) 15-2. Sub-Acute MPTP-PD Model
(243) Changes of TH expression in the brain of a sub-acute MPTP model were examined by Western blotting, and as a result, recovery of TH expression by aMTD/SD-fused Parkin protein was observed. In addition, there was no change in the endogenous Parkin protein expression (
(244) 16. Summary of the Present Invention
(245) For the present invention, cell-permeable Parkin recombinant proteins have been designed and developed with the aMTD. All Parkin recombinant proteins fused with aMTD and control recombinant proteins lacking aMTD have been confirmed for their quantitative, visual cell-/tissue-permeability and BBB-permeability. We were able to confirm that the cell-permeable aMTD.sub.321/SD-fused Parkin recombinant proteins and aMTD.sub.524/SD-fused Parkin recombinant proteins had relatively high cell-/tissue-permeability (
(246) The following examples are presented to aid practitioners of the invention, to provide experimental support for the invention, and to provide model protocols. In no way are these examples to be understood to limit the invention.
Example 1. Development of Novel Advanced Macromolecule Transduction Domain (aMTD)
(247) H-regions of signal sequences (HRSP)-derived CPPs (MTS/MTM and MTD) do not have a common sequence, a sequence motif, and/or a common structural homologous feature. In this invention, the aim is to develop improved hydrophobic CPPs formatted in the common sequence and structural motif that satisfy newly determined critical factors to have a common function, to facilitate protein translocation across the plasma membrane with similar mechanism to the analyzed CPPs.
(248) The structural motif as follows:
(249) ##STR00006##
(250) In Table 9, universal common sequence/structural motif is provided as follows. The amino acid length of the peptides in this invention ranges from 9 to 13 amino acids, mostly 12 amino acids, and their bending potentials are dependent with the presence and location of proline in the middle of sequence (at 5, 6, 7 or 8 amino acid) and at the end of peptide (at 12) for recombinant protein bending. Instability index (II) for rigidity/flexibility of aMTDs is II<40, grand average of hydropathy (GRAVY) for hydropathy is around 2.2, and aliphatic index (AI) for structural features is around 200 (Table 9). Based on these standardized critical factors, new hydrophobic peptide sequences, namely advanced macromolecule transduction domain peptides (aMTDs), in this invention have been developed and summarized in Tables 10 to 15.
Example 2. Construction of Expression Vectors for Recombinant Proteins Fused to aMTDs
(251) Our newly developed technology has enabled us to expand the method for making cell-permeable recombinant proteins. The expression vectors were designed for histidine-tagged CRA proteins fused with aMTDs or rPeptides. To construct expression vectors for recombinant proteins, polymerase chain reaction (PCR) had been devised to amplify each designed aMTD or rPeptide fused to CRA.
(252) The PCR reactions (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1 reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea) was digested on the restriction enzyme site between Nde I (5) and Sal I (3) involving 35 cycles of denaturation (95 C.), annealing (62 C.), and extension (72 C.) for 30 seconds each. For the last extension cycle, the PCR reactions remained for 5 minutes at 72 C. Then, they were cloned into the site of pET-28a(+) vectors (Novagen, Madison, Wis., USA). DNA ligation was performed using T4 DNA ligase at 4 C. overnight. These plasmids were mixed with competent cells of E. coli DH5-alpha strain on the ice for 10 minutes. This mixture was placed on the ice for 2 minutes after it was heat shocked in the water bath at 42 C. for 90 seconds. Then, the mixture added with LB broth media was recovered in 37 C. shaking incubator for 1 hour. Transformant was plated on LB broth agar plate with kanamycin (50 g/mL) (Biopure, Johnson city, TN, USA) before incubating at 37 C. overnight. From a single colony, plasmid DNA was extracted, and after the digestion of Nde I and Sal I restriction enzymes, digested DNA was confirmed at 645 bp by using 1.2% agarose gels electrophoresis (
Example 3. Inducible Expression, Purification and Preparation of Recombinant Proteins Fused to aMTDs and rPeptides
(253) To express recombinant proteins, pET-28a(+) vectors for the expression of CRA proteins fused to a negative control [rPeptide 38 (rP38)], reference hydrophobic CPPs (MTM12 and MTD85) and aMTDs were transformed in E. coli BL21 (DE3) strains. Cells were grown at 37 C. in LB medium containing kanamycin (50 g/ml) with a vigorous shaking and induced at OD.sub.600=0.6 by adding 0.7 mM IPTG (Biopure) for 2 hours at 37 C. Induced recombinant proteins were loaded on 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue (InstantBlue, Expedeon, Novexin, UK) (
(254) The E. coli cultures were harvested by centrifugation at 5,000 rpm for 10 minutes, and the supernatant was discarded. The pellet was re-suspended in the lysis buffer (50 mM NaH.sub.2PO.sub.4, 10 mM Imidazol, 300 mM NaCl, pH 8.0). The cell lysates were sonicated on ice using a sonicator (Sonics and Materials, Inc., Newtowen, Conn., USA) equipped with a probe. After centrifuging the cell lysates at 5,000 rpm for 10 minutes to pellet the cellular debris, the supernatant was incubated with lysis buffer-equilibrated Ni-NTA resin (Qiagen, Hilden, Germany) gently by open-column system (Bio-rad, Hercules, Calif., USA). After washing protein-bound resin with 200 ml wash buffer (50 mM NaH.sub.2PO.sub.4, 20 mM Imidazol, 300 mM NaCl, pH 8.0), the bounded proteins were eluted with elution buffer (50 mM NaH.sub.2PO.sub.4, 250 mM Imidazol, 300 mM NaCl, pH 8.0).
(255) Recombinant proteins purified under natural condition were analyzed on 15% SDS-PAGE gel and stained with Coomassie Brilliant Blue (
Example 4. Determination of Quantitative Cell-Permeability of Recombinant Proteins
(256) For quantitative cell-permeability, the aMTD- or rPeptide-fused recombinant proteins were conjugated to fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo., USA). RAW 264.7 cells were treated with 10 M FITC-labeled recombinant proteins for 1 hour at 37 C., washed three times with cold PBS, treated with 0.25% tripsin/EDTA (Sigma-Aldrich, St. Louis, Mo.) for 20 minutes at 37 C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins were analyzed by flow cytometry (Guava, Millipore, Darmstadt, Germany) using the FlowJo cytometric analysis software (
Example 5. Determination of Cell-Permeability and Intracellular Localization of Recombinant Proteins
(257) For a visual reference of cell-permeability, NIH3T3 cells were cultured for 24 hours on coverslip in 24-wells chamber slides, treated with 10 M FITC-conjugated recombinant proteins for 1 hour at 37 C., and washed three times with cold PBS. Treated cells were fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 10 minutes at room temperature, washed three times with PBS, and mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif., USA), and counter stained with DAPI (4,6-diamidino-2-phenylindole). The intracellular localization of the fluorescent signal was determined by confocal laser scanning microscopy (LSM700, Zeiss, Germany;
Example 6. Construction of Expression Vectors for Recombinant Proteins
(258) Our newly developed technology, aMTD-based MITT, has enabled us to improve the method for developing cell-permeable recombinant proteins. The expression vectors were designed for Parkin proteins fused with or without aMTD and solubilization domain A (SDA) or solubilization domain B (SDB). To acquire expression vectors for recombinant proteins, polymerase chain reaction (PCR) had been devised to amplify these recombinant proteins.
(259) The PCR (100 ng genomic DNA, 10 pmol each primer, each 0.2 mM dNTP mixture, 1 reaction buffer and 2.5 U Pfu(+) DNA polymerase (Doctor protein, Korea) was conducted and the product was digested on the restriction enzyme site between BamHI (5) and HindIII (3) involving 35 cycles of denaturation (95 C.) for 30 seconds, annealing (60 C.) for 30 seconds, and extension (72 C.) for 2 min each. For the last extension cycle, the PCR product remained for 5 minutes at 72 C. Then, they were cloned into the site of pET-28a (+) vectors (Novagen, Madison, Wis., USA). DNA ligation was performed using T4 DNA ligase (NEB, USA) at 4 C. overnight. These plasmids were mixed with competent cells of E. coli DH5a and E. coli (BL21(DE3) codon plus RIL) strain (ATCC, USA) on the ice for 10 minutes. This mixture was placed on the ice for 2 minutes after it was heat-shocked in the water bath at 42 C. for 90 seconds. Then, the mixture added with LB broth media (ELPIS, Korea) was recovered in 37 C. shaking incubator for 1 hour. Transformant was plated on LB broth agar plate with kanamycin (50 g/mL) with a vigorous shaking and induced with 0.7 mM IPTG (Biopure, Johnson city, TN, USA) at OD.sub.600=0.6 before incubating at 37 C. overnight. From a single colony, plasmid DNA was extracted, and after the digestion of BamHI and HindIII restriction enzymes (NEB, USA), digested DNA was confirmed by using 1.2% agarose gels electrophoresis (
(260) Tables 39 and 40: PCR Primers for His-tagged Parkin Proteins
(261) TABLE-US-00039 TABLE39 SEQIDNO RecombinantProtein 5Primer(5-3) 833 HP ATAGGATCCATGATAGTTTTG 834 HM321P GGGTTTGGATCCATTGTGGCGGTGGCGCTGCCGGCGCT HM321PSA GGCGGTGCCGATGATAGTGTTTG HM321PSB 835 M524 GGAATTCCATATGGCGGTGGCGCTGATTGTGGTGCCGGCGCTG GCGCCGATGATAGTGTTTGTCAGGTTCAACTCCAGCCA 836 HPSB/PSB ATAGGATCCATGATAGTGTTTG 837 HM124PSB GGGTTTCATATGATTGCGGTGGCGCTGCCGGCGCTGATTGCGG CGCCGGCAAATATTACCGTTTTCTAT 838 HM165PSB GGGTTTCATATGGCGCTGGCGGTGCCGGTGGCGCTGGCGATTG TGCCGGCAAATATTACCGTTTTCTAT 839 HM325PSB GGGTTTCATATGATTGTGGCGGTGGCGCTGCCGGCGGTGGCGC TGCCGGCAAATATTACCGTTTTCTAT 840 HM342PSB GGGTTTCATATGGTGATTGTGGCGCTGGCGCCGGCGGTGCTGG CGCCGGCAAATATTACCGTTTTCTAT 841 HM361PSB GGGTTTCATATGGCGGTGGTGATTGTGGCGCCGGCGGTGATTG CGCCGGCAAATATTACCGTTTTCTAT 842 HM524PSB GGGTTTCATATGGCGGTGGCGCTGATTGTGGTGCCGGCGCTGG CGCCGGCAAATATTACCGTTTTCTAT 843 HM623PSB GGGTTTCATATGGTGGCGGGGGCGATTGCGCTGCCGGCGATTG TGCCGGCAAATATTACCGTTTTCTAT 844 HM683PSB GGGTTTCATATGCTGGCGATTGTGCTGGCGGGGCCGGCGGTGC TGCCGGCAAATATTACCGTTTTCTAT 845 HM685PSB GGGTTTCATATGGCGCTGCTGGTGGCGGTGCTGCCGGCGGCGC TGCCGGCAAATATTACCGTTTTCTAT 846 HM686PSB GGGTTTCATATGGCGGCGCTGGTGGCGGTGCTGCCGGTGGCGC TGCCGGCAAATATTACCGTTTTCTAT 847 HM687PSB GGGTTTCATATGGCGATTCTGGCGGTGGCGCTGCCGCTGCTGG CGCCGGCAAATATTACCGTTTTCTAT
(262) TABLE-US-00040 TABLE40 SEQIDNO RecombinantProtein 3Primer(5-3) 848 HP,HM321P TATAAGCTTCCTACACGTCGA 849 HM321PSA,HM321PSB, TATAAGCTTGCACGTCGAACC HM524PSB/M524,HPSB/PSB, HM124PSB,HM165PSB,HM325PSB, HM342PSB,HM361PSB,HM524PSB, HM623PSB,HM683PSB,HM685PSB, HM686PSB,HM687PSB
Example 7-1. Expression and Purification of Histidine-Tagged Parkin Recombinant Proteins
(263) Denatured recombinant proteins were lysed using denature lysis buffer (8 M Urea, 10 mM Tris, 100 mM NaH.sub.2PO.sub.4) and purified by adding Ni-NTA resin. Resin bound to proteins were washed 3 times with 30 mL of denature washing buffer (8 M Urea, 10 mM Tris, 20 m imidazole, 100 mM NaH.sub.2PO.sub.4). Proteins were eluted 3 times with 30 mL of denature elution buffer (8 M Urea, 10 mM Tris, 250 mM imidazole). After purification, they were dialyzed twice against a refolding buffer (550 mM Guanidine-HCl, 440 mM L-Arginine, 50 mM Tris, 100 mM NDSB, 150 mM NaCl, 2 mM reduced glutathione and 0.2 mM oxidized glutathione). Finally, they were dialyzed against a physiological buffer such as DMEM at 4 C. until the dialysis was over 30010.sup.5 times. Concentration of purified proteins was quantified using Bradford assay according to the manufacturer's instructions. After purification, they were dialyzed against DMEM as indicated above. Finally, SDS-PAGE analysis of cell lysates before () and after (+) IPTG induction; aliquots of Ni.sup.2+ affinity purified proteins (P); and molecular weight standards (M) were conducted to confirm the presence of target protein (
Example 7-2. Determination of Solubility/Yield of Parkin Recombinant Proteins
(264) The aMTD-fused Parkin proteins containing SDA or SDB are cloned, expressed, purified, and prepared in a soluble form under the denatural condition. Each recombinant protein fused to aMTD and/or SD was determined for their size (number of amino acids), yield (mg/L) and solubility on 10% SDS-PAGE gel and stained with Coomassie Brilliant Blue. Solubility was scored on a 5-point scale ranging from highly soluble proteins with little tendency to precipitate (+++++) to largely insoluble proteins (+) by measuring their turbidity (A450). Yield (mg/L) in physiological buffer condition of each recombinant protein was also determined. The cell-permeable Parkin recombinant proteins were observed as a single band, where the amount of the final purified protein was up to 46 mg/L in this protein purification procedure (
(265) Further, solubility/yield, permeability, and biological activity of 10 types of aMTDs additionally selected, besides aMTD.sub.321, were measured and shown in
(266) Relative yield of aMTD-SD-fused Parkin Recombinant Proteins compared to negative control (HP) and relative yield of SDB-fused Parkin Recombinant Proteins (HPSB) compared to negative Control (HP) are shown in
Example 8. Expression and Purification of Histidine-Tag Free Parkin Fusion Proteins
(267) Sequences of E. coli codon-optimized and histidine-tag free recombinant parkin proteins fused to aMTDs were also synthesized with specific primer (Table 39), and then finally cloned into pET 28a and pET 22b. The proteins were expressed in E. coli BL21-CodonPlus (DE3) cells grown to an A600 of 0.5-0.7 and induced for 3 hrs with 0.7 mM IPTG. Cells were harvested and disrupted by sonication (20 sec-on/40 sec-off) for 30 min in buffer A (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 0.1% Triton X-100). Inclusion body was isolated by centrifugation (5,000 rpm for 30 min at 4 C) and dissolved in buffer B (50 mM Tris-HCl, pH 10.0, 8 M urea) for overnight for denaturation. Denatured inclusion body was dialyzed against buffer C (30 mM sodium phosphate, pH 8.0, 0.02% Tween-20) for 48 hrs at 4 C. for refolding. Insoluble particles were removed by centrifugation (9,000 rpm for 30 min at 4p C). Purification was conducted by ion-exchange column chromatography with AKTA Purifier FPLC system (GE HealthCare, Pittsburgh, Pa., USA). In brief, Q-Sepharose anion column was flowed with protein solution in buffer C for protein binding and washed with buffer D (30 mM sodium phosphate, pH 8.0, 30 mM NaCl) for removing the unbound proteins. Proteins were eluted with salt gradient (30 mM to 1 M NaCl) of elution buffer E (30 mM sodium phosphate, pH 8.0). All recombinant proteins were eluted at a major single peak. After purification, proteins were dialyzed against a physiological buffer.
Example 9. Intracellular Delivery of Parkin Recombinant Proteins
(268) For quantitative cell-permeability, the aMTD/SD-fused Parkin recombinant proteins were conjugated to fluorescein isothiocyanate (FITC) according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, Mo., USA). RAW 264.7 cells (ATCC, USA) were treated with 10 M FITC-labeled recombinant proteins for 1 hour at 37 C., washed three times with cold PBS, treated with proteinase K (5 g/ml) for 10 min at 37 C. to remove cell-surface bound proteins. Cell-permeability of these recombinant proteins were analyzed by flow cytometry (FACS Calibur; BD, Franklin Lakes, N.J., USA) using the FlowJo analysis software (
Example 10. Determination of Intracellular Localization of iCP-Parkin Recombinant Proteins
(269) For a visual reference of cell-permeability, NIH3T3 cells (ATCC, USA) were cultured for 24 hours on a coverslip in 24-wells chamber slides, treated with 10 M of vehicle (culture medium, DMEM), FITC only, FITC-conjugated Negative Control (rP38), FITC-conjugated Previously Developed CPP (MTM.sub.12 and MTD.sub.85), FITC-conjugated recombinant proteins (FITC-HP, FITC-HPSB, FITC-HM.sub.321P, FITC-HM.sub.321PSA, FITC-HM.sub.321PSB and FITC-M.sub.524PSB) for 1 hour at 37 C., and washed three times with cold PBS. Treated cells were fixed in 4% paraformaldehyde (PFA, Junsei, Tokyo, Japan) for 10 minutes at room temperature, washed three times with PBS, and mounted with VECTASHIELD Mounting Medium (Vector laboratories, Burlingame, Calif., USA) with DAPI (4,6-diamidino-2-phenylindole) for nuclear staining. The intracellular localization of the fluorescent signal was determined by confocal laser scanning microscopy (top) and by Nomarski interference microscope image of the same cells (LSM700, Zeiss, Germany) (bottom)(
Example 11-1. Determination of In Vivo Delivery of Parkin Recombinant Proteins in PBMC
(270) For determination in vivo delivery, ICR mouse (5 weeks old, female) were injected intraperitoneally (IP, 600 ug/head) with FITC only or FITC-conjugated proteins (FITC-HPSB and FITC-HM.sub.321PSB). After 15 min and 30 min, A peripheral blood mononuclear cell (PBMC) were isolated from whole blood in mice, and were analyzed by flow cytometry (BD, GUABA) (
Example 11-2. Determination of In Vitro Delivery of Parkin Recombinant Proteins in RAW264.7 Cells and NIH3T3 Cells
(271) For determination in vitro delivery, RAW264.7 cells were incubated for 1 hour at 37 C. with 10 M FITC-conjugated Parkin recombinant proteins (FITC-HP, FITC-HM.sub.321P, FITC-HM.sub.321PSA, FITC-HM.sub.321PSB and FITC-M.sub.524PSB) (
(272) An equimolar concentration of unconjugated FITC (FITC only) or vehicle (culture medium, DMEM), treated to remove cell-associated but non-internalized protein, and analyzed by flow cytometry (
(273) As shown in
Example 12. Determination of Tissue-Permeability of Parkin Recombinant Proteins in Vivo
(274) For a visual reference of tissue-permeability, diluent, FITC only and 30 mg/kg of FITC-labeled Parkin recombinant proteins (FITC-HP, FITC-HPSB, FITC-HM.sub.321P, FITC-HM.sub.321PSA, FITC-HM.sub.321PSB, and FITC-M.sub.524PSB) was injected intraperitoneally to ICR mice (5 weeks old, female). Two hours later, the mice are sacrificed, and liver, kidney, spleen, lung, heart and brain were isolated and embedded with an OCT compound (Sakura, Alphen anden Rijn, Neetherlands), frozen, and then sectioned to a thickness of 20 m. The tissue specimens are mounted on a glass and observed by fluorescence microscopy (Nikon, Tokyo, Japen)(
Example 13. Detection of Parkin Recombinant Proteins in Brain
(275) For immunohistochemistry, 6-week-old ICR female mice were injected intraperitoneally with diluent (PBS) or with 600 g His-tagged Parkin recombinant proteins. After 2 h, mice was perfused with 0.9% NaCl and fixed with cold 4% paraformaldehyde. After the brains were removed, they were post-fixed with 4% paraformaldehyde and transferred to 30% sucrose. The brains were cut into 30 m coronal sections using a freezing microtome. Brain cryosections (30 m) are immunostained with anti-Parkin (1:100, Santa Cruz Biotechnology) monoclonal antibodies, followed by biotin-conjugated goat anti-mouse secondary antibody (Vector Laboratories), and developed with Avidin-Biotin Complex kit (Vectastain kit, Vector Laboratories). For western blot analysis, mice treated with proteins were perfused with 0.9% NaCl. Brains were isolated, and striatal region was dissected and homogenized in lysis buffer (Intron, Seongnam, Korea). Supernatant from the centrifugation (13,000 rpm for 10 min at 4 C.) is analyzed by western blot that is probed with antibodies against Parkin (1:200) and -actin (1:2,000). The secondary antibody is goat anti-mouse IgG-HRP (all antibodies were from Santa Cruz Biotechnology) (
(276) In detail, in order to examine how much iCP-Parkin recombinant proteins were present in the neuronal cells of brain, mice were sacrificed 10 minutes, 1, 2, 4, 8, 12, 16 and 24 hours after injection intravenously of FITC-labeled HPSB and HM.sub.524PSB. And then neuronal cells of brain were separated, fluorescence intensity thereof was measured by Flow cytometry, and shown in
(277) Further, the brain tissues obtained by the experiment was cryosectioned (20 m) to obtain tissue sections, where fluorescence distribution was examined under a fluorescent microscope, and shown in
(278) Further, delivery of aMTD-mediated Parkin recombinant protein to the brain was examined by immunoblotting, and shown in
(279) As shown in
Example 14-1. Assessment of E3 Ligase Activity
(280) Parkin E3 ligase activity was measured by using an auto-ubiquitination assay (Boston Biochem) conducted according to the manufacturers' instructions. Briefly, 1 g of purified Parkin proteins were reacted with 0.1 M E1, 1 M E2, 50 M Ubiquitin and 10 M Mg-ATP for 1 hr at 37 C., followed by western blot with anti-Ubiquitin antibody (1:1,000, Enzo Life Science). As shown in
Example 14-2. Anti-Apoptotic Effect of Parkin Recombinant Proteins in Neuronal Cells
(281) Terminal dUTP nick-end labeling (TUNEL) assays are conducted according to the manufacturers' instructions (Roche). Mouse dopaminergic neuronal (CATH.a) cells (ATCC: American Type Culture Collection) are plated (310.sup.4/well) and CATH.a cells at 70% confluence were pre-treated with 50 M 6-hydroxydopamine (6-OHDA, Agonist) for 1 h at 37 C. followed by the treatment with 2.5 M HP, Parkin recombinant proteins (HM.sub.321P, HM.sub.321PSA or HM.sub.321PSB) for 2.5 h at 37 C., and assessed for apoptosis by TUNEL staining. Human brain tumor (SH-SYSY) cells (Korea Cell Line Bank) are also cultured, plated (310.sup.4/well) and SH-SYSY cells at 70% confluence were pre-treated with 100 M 6-hydroxydopamine (6-OHDA, Agonist) for 6 h followed by the treatment with 2.5 M HP, Parkin recombinant proteins (HM.sub.321P, HM.sub.321PSA or HM.sub.321PSB) for 2.5 h at 37 C., and assessed for apoptosis by TUNEL staining. Many aMTDs were subjected to the biological activity test in the same manner, and cell death was examined by TUNEL staining and Annexin V staining.
(282) For test dose dependency of M.sub.524PSB, SH-SY5Y cells at 70% confluence were co-treated with 1 mM MPP+(1-methyl-4-phenylpyridinium) and different concentrations of M.sub.524PSB for 24 h. and cell death was analyzed by TUNEL assay and Western blot assay with anti-Bcl2 (Santa cruz, sc-7382) and anti-Caspase3 (Cell signaling, 9665) antibodies.
(283) As shown in
Example 14-3. Assessment of Degradation of -Synuclein Aggregates
(284) -Synuclein oligomer was generated by aggregating 1 mg/ml of -Synuclein (ATGEN # SNA2001) in stationary incubator for 5 weeks at 37 C. Human brain tumor (SH-SY5Y) cells (Korea Cell Line Bank) were cultured, plated (310.sup.5/well) and pre-treated with 1 M of the aggregated -Synuclein oligomer for 2 h to induce apoptosis followed by the co-treatment with 10 M Parkin recombinant proteins for 24 h at 37 C., and analyzed the alteration by cell counting after Tryphan blue staining.
(285) Proteins were quantified by Bradford assay, and then chemiluminescence detection (Ez-Western Lumi Femto, DOGEN # DG-WF200) on Western blot was performed using primary anti--synuclein antibody (1:200, Santa Cruz # sc-7011-R), secondary anti-rabbit IgG HRP-linked antibody (1:5000, Cell signaling #7074S) (
Example 15. MPTP-Induced Parkinson's Disease Mouse Models and Therapeutic Protocol
(286) 8-week-old C57BL/6 male and female mice housed in plastic cages in a temperature- and humidity-controlled room with a 12-h light/12 h-dark cycle. Mice were randomly assigned to one of four experimental groups (Diluent, MPTP only, MPTP+HPSB and MPTP+HM.sub.321PSB or M.sub.524PSB). For acute MPTP-induced PD Mode, three groups of mice except for diluent were received intraperitoneal injections of MPTP (15 mg/kg3 times/day, 2 h interval) for three consecutive days. The neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (Sigma-Aldrich, St. Louis, Mo.) was dissolved in 0.9% NaCl. Controls are treated with 0.9% NaCl for the same time period. After 3 days, mice in MPTP+HPSB and MPTP+HM.sub.321PSB groups were received intraperitoneal injection of HPSB, HM.sub.321PSB recombinant protein (600 g/head, a time/day) for five consecutive days, respectively. For sub-acute MPTP-induced PD Mode, MPTP (30 mg/kg/day) was injected intraperitoneally for 5 days and Protein (HPSB, HM.sub.321PSB) injection were started at day 9 for 5 consecutive days. For sub-chronic MPTP-induced PD Mode, MPTP (20 mg/kg4 times/day, 2 h interval) was injected intraperitoneally for 1 day and Protein (HPSB, M.sub.524PSB) injection were started at day 36 for 5 consecutive days. Urine and brain dopamine levels, gross motor function and brain lesions (TH immunostaining) were analyzed on subsequent days as indicated in
Example 16. Measurement of Dopamine in Urine of MPTP-PD Animal Models Treated with Parkin Recombinant Proteins
(287) For measurement of dopamine synthesized in the urine, we collected the urine of mice in all groups after 10 h on the first day of treatment of Parkin recombinant protein. Dopamine synthesized in the urine is measured by using a commercial ELISA kit according to instructions provided by the manufacturer (GenWay, San Diego, Calif., USA). In brief, rabbit anti-dopamine antibody is added to urine or tissue extract, and the immune complexes are recovered in wells coated with goat anti rabbit antibody. A second enzyme conjugated anti-dopamine antibody directed against a different epitope produces the reaction products proportional to the amount of antigen as compared against a standard curve.
(288) Urine dopamine levels in MPTP-lesioned mice were measured by ELISA 10 hrs after HPSB and HM.sub.321PSB protein treatment. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05) (
(289) As shown in
Example 17. Measurement of Dopamine in Brain of MPTP-PD Animal Models Treated with Parkin Recombinant Proteins
(290) For measurement of dopamine synthesized in the brain, we collected the brain of mice in all groups after 10 h on the 8th day of treatment of Parkin recombinant protein.
(291) Dopamine synthesized in the brain extracts is measured by using a commercial ELISA kit according to instructions provided by the manufacturer (GenWay, San Diego, Calif.). In brief, rabbit anti-dopamine antibody is added to urine or tissue extract, and the immune complexes are recovered in wells coated with goat anti-rabbit antibody. A second enzyme conjugated anti-dopamine antibody directed against a different epitope produces the reaction products proportional to the amount of antigen as compared against a standard curve.
(292) Dopamine levels in striatal biopsies were determined by ELISA in lesioned mice without protein treatment or after daily treatments with HM.sub.321PSB as shown in
(293) As shown in
Example 18. Assessment of Motor Activity with Swim Test of MPTP-PD Animal Models Treated with Parkin Recombinant Proteins
(294) Gross motor functions of MPTP-lesioned mice are assessed by using a swim test. 9 hrs after the last MPTP treatment mice were treated for 3 hrs with 600 ug proteins (IP, HPSB or HM.sub.321PSB), and 24 hrs after treating the proteins motor ability was assessed by placing the mice in a 37 C. water bath and video recording subsequent movements. The percentage of time of the mice in each treatment group were engaged in 4 legged motion is presented as meanS.D. The number of mice in each group was as follows: Diluent, 12; MPTP only, 7; MPTP+HPSB, 14; MPTP+HM.sub.321PSB, 12.
(295) Unlesioned mice have swum using all 4 legs 98% of the time. The percent of time of each group (MPTP only, MPTP+HPSB or MPTP+HM.sub.321PSB) spent swimming (4 legged) is measured and expressed as a percentage of the unlesioned diluent control. Experimental differences between groups were assessed by a Student's two-paired t-test (*p<0.05) (
(296) As shown in
Example 19 Assessment of Motor Activity with Gait Test and Rota-Rod Test of MPTP-PD Animal Models Treated with Parkin Recombinant Proteins
(297) 19-1. Gait Test
(298) The mice were allowed to walk along a 50 cm long, 10 cm wide runway with 10 cm high walls into an enclosed box. Parameters measured in footprint analysis with dotted lines representing the direction of progression (DoP) of walking are shown. Footprints of MPTP-lesioned mice were evaluated for stride length (cm) and sway length (cm) (
(299) As shown in
(300) 19-2. Rota-Rod Test
(301) For this experiment, a mouse was trained at a speed of 15 rpm for 10 minutes three times, prior to MPTP injection. In this experiment, after injection MPTP, the mouse was placed on a Rota-Rod for 10 minutes while the speed was accelerated to 4-30 rpm, and the time that the mouse remained on the Rota-Rod before falling was measured. This procedure was repeated three times. All tests were recorded with a video camera.
(302) As shown in
Example 20. Expression Recovery of Tyrosine Hydroxylase
(303) MPTM-lesioned mice were treated with Parkin recombinant proteins for 5 days as shown in
(304) TH expression was measured by western blotting in the sub-acute MPTP PD model prepared according to the procedure in
(305) Parkin (1:200, Santa cruz, Cat #32282), tyrosine hydroxylase (TH, 1:2000, Millipore, cat # AB152), -actin (1:5000, Cell signaling, cat #4967S) were used as primary antibodies, and anti-mouse IgG-HRP-liked antibody (Cell signaling, cat #7074s) and anti-rabbit IgG-HRP-liked antibody (Cell signaling, cat #7076s) were used as secondary antibodies. Blocking was performed with 5% BSA at room temperature for 1 hour, and the primary antibodies were added and allowed to react at 4 C. for 16 hours or longer or at room temperature for 3 hours. After washing with TBS-T (10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 0.05% tween-20), the secondary antibodies were treated at room temperature for 1 hour, followed by washing with TBS-T. Observation and analysis were conducted using ECL (Enhanced Chemiluminescence) for chemiluminescent detection. No great changes in endogenous Parkin expression were observed in all experimental groups.
(306) As shown in
Example 21. Statistical Analysis
(307) All experimental data using cultured cells are expressed as meanS.D. for at least three independent experiments. Statistical significance is evaluated using a two-tailed Student's t-test or ANOVA method. Experimental differences between groups are assessed using paired Student's t-tests. For animal experiments, ANOVA is used for comparing between and within groups to determine the significance. Differences with p<0.05 are considered to be statistically significant.
(308) Those skilled in the art to which the present invention pertains will appreciate that the present invention may be implemented in different forms without departing from the essential characteristics thereof. Therefore, it should be understood that the disclosed embodiments are not limitative, but illustrative in all aspects. The scope of the present invention is made to the appended claims rather than to the foregoing description, and all variations which come within the range of equivalency of the claims are therefore intended to be embraced therein.