Aspartokinase variant and method for producing L-amino acid using the same
10662450 ยท 2020-05-26
Assignee
Inventors
- Hyung Joon KIM (Seoul, KR)
- Hyo Jin Kim (Gyeonggi-do, KR)
- Hyun Won Bae (Gyeonggi-do, KR)
- Hyun Ah Kim (Gyeonggi-do, KR)
- Chang Il Seo (Incheon, KR)
- Ji Sun Lee (Incheon, KR)
- Jin Sook Chang (Gyeonggi-do, KR)
Cpc classification
C12N9/1217
CHEMISTRY; METALLURGY
C12P13/06
CHEMISTRY; METALLURGY
C12P13/08
CHEMISTRY; METALLURGY
C12P13/02
CHEMISTRY; METALLURGY
International classification
C12P13/02
CHEMISTRY; METALLURGY
Abstract
An aspartokinase variant, a microorganism comprising the variant, and a method for producing an aspartate-derived L-amino acid or a homoserine derivative thereof using the microorganism.
Claims
1. An aspartokinase variant having at least 80% sequence identity to SEQ ID NO: 1 having aspartokinase activity, wherein the amino acid at position 377 in the amino acid sequence of SEQ ID NO: 1 is substituted with L-lysine or L-methionine.
2. A polynucleotide encoding the variant of claim 1.
3. A microorganism of the genus Corynebacterium, which produces an aspartate-derived L-amino acid or an amino acid derivative thereof comprising the aspartokinase variant of claim 1, wherein the aspartate-derived L-amino acid or amino acid derivative thereof is selected from the group consisting of lysine, threonine, methionine, homoserine, O-acetylhomoserine, O-succinylhomoserine, isoleucine, and cadaverine.
4. The microorganism according to claim 3, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
5. A method for producing an aspartate-derived L-amino acid or an amino acid derivative thereof, comprising: culturing the microorganism of claim 3 in a medium; and recovering the aspartate-derived L-amino acid or amino acid derivative thereof from the cultured microorganism or cultured medium, wherein the aspartate-derived L-amino acid or amino acid derivative thereof is selected from the group consisting of lysine, threonine, methionine, homoserine, O-acetylhomoserine, O-succinylhomoserine, isoleucine, and cadaverine.
6. The method according to claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
7. A method for producing L-methionine, comprising: culturing the microorganism of claim 3 in a medium; producing O-acetylhomoserine or O-succinylhomoserine from the cultured microorganism or cultured medium; and converting the O-acetylhomoserine or O-succinylhomoserine to L-methionine.
8. The method according to claim 7, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
DETAILED DESCRIPTION OF THE INVENTION
(2) Hereinbelow, the present disclosure will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.
Example 1: Preparation of lysC Variant-Introducing Strain
(3) A variation, the activity of which can be enhanced compared to the wild-type, was selected through the structural modeling of a aspartokinase, and a strain introduced with the variant was prepared as described below.
(4) In the gene lysC (SEQ ID NO: 2) encoding aspartokinase (SEQ ID NO: 1) derived from Corynebacterium glutamicum ATCC13032 (hereinafter referred to as WT), the amino acid at position 377 was selected as the variation site, and L-lysine, which is a basic amino acid, and L-methionine, which is a non-polar amino acid, were selected as representative examples of other amino acids for substitution.
(5) In order to prepare a vector introduced with the variation, centering on the variation site, a pair of primers (SEQ ID NOS: 7 and 8 or SEQ ID NOS: 7 and 10) for amplifying the 5 upstream region and a pair of primers (SEQ ID NOS: 9 and 12 or SEQ ID NOS: 11 and 12) for amplifying the 3 downstream region were devised (Table 1). In the primers of SEQ ID NOS: 7 and 12, an XbaI restriction enzyme site (underlined) was inserted at each end. Further, in a pair of the primers of SEQ ID NOS: 8 and 9 or a pair of the primers of SEQ ID NOS: 10 and 11, a nucleotide substitution variation (underlined) was placed at the site designed to crossover with each other.
(6) TABLE-US-00001 TABLE 1 SEQ ID NO: Primer Sequence (5-3) 7 Primer 1 TCCTCTAGAGCTGCGCAGTGTTGAATACG 8 Primer 2 TGGAAATCTTTTCGATGTTCACGTTGACAT 9 Primer 3 ACATCGAAAAGATTTCCACCTCTGAGATTC 10 Primer 4 TGGAAATCATTTCGATGTTCACGTTGACAT 11 Primer 5 ACATCGAAATGATTTCCACCTCTGAGATTC 12 Primer 6 GACTCTAGAGTTCACCTCAGAGACGATTA
(7) PCR was carried out with the primers of SEQ ID NOS: 7 and 8, SEQ ID NOS: 7 and 10, SEQ ID NOS: 9 and 12, or SEQ ID NOS: 11 and 12 using the chromosome of WT as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 30 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, centering on the variation site of the gene lysC, a DNA fragment (509 bp) of the 5 upstream region and a DNA fragment (520 bp) of the 3 downstream region were obtained, respectively.
(8) PCR was carried out with the primers of SEQ ID NOS: 7 and 12 using the two amplified DNA fragments as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 60 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (1011 bp) including the variat (SEQ ID NO: 4) of the gene lysC encoding the aspartokinase variat (SEQ ID NO: 3), in which the leucine at position 377 is substituted with lysine, was amplified. In addition, in order to confirm the importance of the amino acid at position 377, a DNA fragment (1011 bp) including the variation (SEQ ID NO: 6) of the gene lysC encoding the aspartokinase variant (SEQ ID NO: 5), in which the leucine at position 377 is substituted with methionine, was obtained.
(9) The vector pDZ (Korean Patent No. 0924065), which cannot be replicated in Corynebacterium glutamicum, and the DNA fragment (1011 bp) were treated with a restriction enzyme, XbaI, and these were linked using a DNA ligase and then cloned to obtain plasmids. The plasmids were named as pDZ-lysC(L377K) and pDZ-lysC(L377M).
(10) The vectors, pDZ-lysC(L377K) and pDZ-lysC(L377M), were each transformed into WT using an electric pulse method (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then transformant strains were obtained in an LB medium containing kanamycin (25 mg/L). WT::lysC(L377K) and WT::lysC(L377M), the strains in which the nucleotide variation is introduced into the gene lysC by the DNA fragments inserted on the chromosome via a secondary recombinant process (crossover), were obtained, and these were named as Corynebacterium glutamicum CA01-2307 and CA01-2308, respectively. CA01-2307 and CA01-2308 were deposited to the Korea Culture Center of Microorganisms, which is an international depositary authority under the Budapest Treaty, on Mar. 29, 2017, and assigned Accessions Nos. KCCM12000P and KCCM12001P.
Example 2: Confirmation of Ability of lysC Variat Introducing Strain for Producing Aspartate-Derived Amino Acid
(11) In order to compare the abilities of the strains CA01-2307 and CA01-2308 obtained from Example 1 and the strain WT for producing major aspartate-derived amino acids, the strains were cultured using the following method, and the components in the culture medium were analyzed.
(12) Each strain was inoculated into a corner-baffle flask (250 mL) containing a seed medium (25 mL), and cultured at 37 C. for 20 hours while shaking at 200 rpm. The seed culture solution (1 mL) was inoculated into a corner-baffle flask (250 mL) containing a production medium (24 mL), and then cultured at 37 C. for 24 hours while shaking at 200 rpm. The concentrations of L-lysine and L-threonine, which are representative amino acids derived from L-aspartate and aspartate, were analyzed by HPLC, and the analyzed concentrations are shown in Table 2.
(13) <Seed Medium (pH 7.0)>
(14) Glucose (20 g), peptone (10 g), yeast extract (5 g), urea (1.5 g), KH.sub.2PO.sub.4 (4 g), K.sub.2HPO.sub.4 (8 g), MgSO.sub.4.7H.sub.2O (0.5 g), biotin (100 g), thiamine HCl (1000 g), calcium pantothenate (2000 g), nicotinamide (2000 g) (in 1 L of distilled water)
(15) <Production Medium (pH 7.0)>
(16) Glucose (100 g), (NH.sub.4).sub.2SO.sub.4 (40 g), soy protein (2.5 g), corn steep solids (5 g), urea (3 g), KH.sub.2PO.sub.4 (1 g), MgSO.sub.4.7H.sub.2O (0.5 g), biotin (100 g), thiamine chloride (1000 g), calcium pantothenate (2000 g), nicotinamide (3000 g), CaCO.sub.3 (30 g) (in 1 L of distilled water)
(17) TABLE-US-00002 TABLE 2 Concentrations of aspartate-derived amino acids produced from CA01-2307 and CA01-2308 Concentration L-Aspartate L-Lysine L-Threonine Strain (mg/L) (mg/L) (mg/L) WT 20.3 8.0 340.3 CA01-2307 29.7 3647.7 402.7 CA01-2308 30.2 1572.3 385.4
(18) As a result of analyzing the concentrations of the aspartate-derived amino acids, it was confirmed that when the lysC variation was introduced, the concentration of L-lysine was dramatically increased and those of L-aspartate and L-threonine were also increased compared to WT. Based on the results above, the strains CA01-2307, CA01-2308, and WT were cultured in the same manner as described above in order to compare the abilities thereof for producing lysine in detail. Further, the concentration of L-lysine in the culture medium was analyzed in the same manner as described above (Table 3).
(19) TABLE-US-00003 TABLE 3 Concentrations of L-lysine produced from strains WT, CA01-2307, and CA01-2308 L-Lysine (g/L) Concentration Strain Batch 1 Batch 2 Batch 3 WT 0.008 0.007 0.008 CA01-2307 3.664 3.665 3.598 CA01-2308 1.523 1.475 1.666
(20) As a result of analyzing the concentration of L-lysine, it was confirmed that the productivity of L-lysine produced from CA01-2307 including the lysC(L377K) variation was greatly increased as in the previous evaluation compared to that produced from the strain WT. In addition, it was confirmed that the productivity of L-lysine produced from CA01-2308 including the lysC(L377M) variation also increased compared to that produced from the strain WT. Based on the results above, it was confirmed that the productivity of L-lysine in the aspartate-derived amino acids was greatly increased due to the aspartokinase variant (SEQ ID NO: 3), in which the leucine at position 377, which is selected in the present disclosure, is substituted with lysine, and due to the aspartokinase variant (SEQ ID NO: 5), in which the leucine at position 377 is substituted with methionine.
Example 3: Preparation of L-Threonine-Enhanced Strain and Confirmation of Productivity of L-Threonine
(21) In order to clearly confirm the change in the L-threonine productivity by the introduction of the lysC(L377K) variation, which has the higher lysine productivity confirmed in Example 2, a variation was introduced into the gene encoding homoserine dehydrogenase producing homoserine, which is a common intermediate in the biosynthetic pathway of L-threonine, L-isoleucine, L-methionine, and homoserine derivatives. Specifically, a strain was prepared by introducing the hom(G378E) variation known in the art (Appl. Microbiol. Biotechnol. 45, 612-620 (1996)) into the strain CA01-2307, which was prepared in Example 1. In addition, a strain in which the hom(G378E) variation is introduced into WT was also prepared as a control group. In order to prepare a vector introducing the hom(G378E), PCR was carried out with SEQ ID NOS: 13 and 14 and SEQ ID NOS: 15 and 16 using WT genomic DNA as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 30 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes.
(22) As a result, centering on the variation of the gene horn, a DNA fragment (220 bp) of the 5 upstream region and a DNA fragment (220 bp) of the 3 downstream region were obtained. PCR was carried out with SEQ ID NOS: 13 and 16 using these two PCR products as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 30 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (440 bp) including the variation of the gene horn was amplified.
(23) TABLE-US-00004 TABLE 4 SEQ ID NO: Primer Sequence (5-3) 13 Primer 7 TCCTCTAGACTGGTCGCCTGATGTTCTAC 14 Primer 8 GCCAAAACCTCCACGCGATC 15 Primer 9 ATCGCGTGGAGGTTTTGGCT 16 Primer 10 GACTCTAGATTAGTCCCTTTCGAGGCGGA
(24) The vector pDZ, which was previously used in Example 1, and DNA fragment (440 bp) were treated with a restriction enzyme, XbaI, and these were linked using a DNA ligase and then cloned to obtain a plasmid. The plasmid was named as pDZ-hom(G378E).
(25) The vector, pDZ-hom(G378E), was introduced into the strains WT and CA01-2307 using an electric pulse method (Appl. Microbiol. Biotechnol. (1999, 52:541-545)), and then transformant strains were obtained in a selective medium containing kanamycin (25 mg/L). WT::hom(G378E) and CA01-2307::hom(G378E), the strains in which the nucleotide variation was introduced into the gene horn by the DNA fragment inserted on the chromosome via a secondary recombinant process (crossover), were obtained. In order to compare abilities of WT::hom(G378E) and CA01-2307::hom(G378E) for producing threonine, the strains were cultured in the same manner as in Example 2, and the concentration of threonine in the culture medium was analyzed.
(26) TABLE-US-00005 TABLE 5 Concentrations of threonine produced from strains, WT::hom(G378E) and CA01-2307::hom(G378E) L-Threonine (g/L) Concentration Strain Batch 1 Batch 2 Batch 3 WT::hom(G378E) 0.456 0.475 0.432 CA01-2307::hom(G378E) 1.210 1.132 1.211
(27) As a result of analyzing the concentration of L-threonine, it was confirmed that the productivity of L-threonine was dramatically increased in the strain including the lysC variation (Table 5).
Example 4: Preparation of L-Isoleucine-Enhanced Strain and Comparison of Productivity of L-Isoleucine
(28) In order to confirm the effect of the introduction of the lysC(L377K) variation on the L-isoleucine productivity, a vector for enhancing expression of the ilvA(V323A) variation of the gene (Appl. Enviro. Microbiol., December 1996, p. 4345-4351) encoding L-threonine dehydratase, which is known in the art, was prepared.
(29) In order to prepare a vector introduced with the variation of the gene ilvA, centering on the variation site, a pair of primers (SEQ ID NOS: 17 and 18) for amplifying the 5 upstream region and a pair of primers (SEQ ID NOS: 19 and 20) for amplifying the 3 downstream region were devised. In the primers of SEQ ID NOS: 17 and 20, a BamHI restriction enzyme site (underlined) was inserted at each end. Further, in the primers of SEQ ID NOS: 18 and 19, a nucleotide substitution variation (underlined) was placed at the site designed to crossover with each other.
(30) TABLE-US-00006 TABLE 6 SEQ ID NO: Primer Sequence (5-3) 17 Primer 11 ACGGATCCCAGACTCCAAAGCAAA AGCG 18 Primer 12 ACACCACGGCAGAACCAGGTGCAA AGGACA 19 Primer 13 CTGGTTCTGCCGTGGTGTGCATCAT CTCTG 20 Primer 14 ACGGATCCAACCAAACTTGCTCACA CTC
(31) PCR was carried out with the primers of SEQ ID NOS: 17 and 18 and SEQ ID NOS: 19 and 20 using the chromosome of WT as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 30 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, centering on the variation site of the gene ilvA, a DNA fragment (627 bp) of the 5 upstream region and a DNA fragment (608 bp) of the 3 downstream region were obtained.
(32) PCR was carried out with the primers of SEQ ID NOS: 17 and 20 using the two amplified DNA fragments as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 60 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (1217 bp) including the variation of the gene ilvA encoding the IlvA variant, in which the valine at position 323 is substituted with alanine, was amplified.
(33) The vector pECCG117 (Korean Patent No. 10-0057684) and DNA fragment (1011 bp) were treated with a restriction enzyme, BamHI, and these were linked using a DNA ligase and then cloned to obtain a plasmid. The plasmid was named as pECCG117-ilvA(V323A).
(34) The vector pECCG117-ilvA(V323A) was introduced into the strains WT::hom(G378E) and CA01-2307::hom(G378E), which were prepared in Example 3, using an electric pulse method, and then smeared on a selective medium containing kanamycin (25 mg/L) to obtain the transformant strains.
(35) The strains were cultured in the same manner as in the flask culture method shown in Example 2, and the concentration of L-isoleucine in the culture medium was analyzed (Table 7).
(36) TABLE-US-00007 TABLE 7 L-Isoleucine (g/L) Strain Batch 1 Batch 2 Batch 3 WT::hom(G378E)/pECCG117-ilvA(V323A) 0.102 0.072 0.062 CA01-2307::hom(G378E)/ 0.876 0.900 0.918 pECCG117-ilvA(V323A)
(37) As a result of analyzing the concentration of L-isoleucine, it was confirmed that the productivity of L-isoleucine was greatly increased in the strain including the lysC variation.
Example 5: Preparation of O-Acetylhomoserine-Enhanced Strain and Comparison of Productivity of O-Acetylhomoserine
(38) In order to determine the effect of introduction of the lysC(L377K) variation on the production of O-acetylhomoserine, the gene metB, which encodes the cystathionine gamma-synthase involved in the O-acetylhomoserine degradation pathway, and the gene metY, which encodes O-acetylhomoserine (thiol)-lyase, were deleted, and then the gene metX encoding the homoserine O-acetyltransferase, which is an O-acetylhomoserine biosynthetic enzyme, was overexpressed, and thereby the strain producing O-acetylhomoserine was prepared. First, in order to delete the gene metB, based on the nucleotide sequence information of the gene, metB derived from WT, a pair of primers (SEQ ID NOS: 21 and 22) for amplifying the 5 upstream region of the gene metB and a pair of primers (SEQ ID NOS: 23 and 24) for amplifying the 3 downstream region were devised.
(39) TABLE-US-00008 TABLE 8 SEQ ID NO: Primer Sequence (5-3) 21 Primer 15 TCTAGATGCGCTGATTATCTCACC 22 Primer 16 ACTGGTGGGTCATGGTTGCATATG AGATCAACTCCTGTAA 23 Primer 17 TTACAGGAGTTGATCTCATATGCA ACCATGACCCACCAGT 24 Primer 18 TCTAGACCTTGAAGTTCTTGACTG
(40) PCR was carried out with the primers of SEQ ID NOS: 21 and 22, SEQ ID NO: 23 and 24 using the chromosome of WT as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, polymerization at 72 C. for 90 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (450 bp) of the 5 upstream region of the gene metB and a DNA fragment (467 bp) of the 3 downstream region were obtained.
(41) PCR was carried out with the primers of SEQ ID NOS: 21 and 24 using the two amplified DNA fragments as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 3 minutes. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, the central region of the gene metB was deleted, and thus a DNA fragment (917 bp) including only the upstream and downstream ends was amplified.
(42) The vector pDZ and DNA fragment (917 bp) were treated with a restriction enzyme, XbaI, and these were linked using a DNA ligase and then cloned to obtain a plasmid. The plasmid was named as pDZ-metB.
(43) The vector pDZ-metB was introduced into the strains WT::hom(G378E) and CA01-2307::hom(G378E), which were prepared in Example 3, using an electric pulse method, and then the transformant strains were obtained from a selective medium containing kanamycin (25 mg/L). WT::hom(G378E)metB and CA01-2307::hom(G378E)metB, the strains in which the metB gene is deleted by the DNA fragments inserted on the chromosome via a secondary recombinant process (crossover), were obtained.
(44) In order to delete the gene metY involved in another degradation pathway of O-acetylhomoserine, based on the nucleotide sequence information of the gene, metY derived from WT, a pair of primers (SEQ ID NOS: 25 and 26) for amplifying the 5 upstream region of the gene metY and a pair of primers (SEQ ID NOS: 27 and 28) for amplifying the 3 downstream region were devised.
(45) TABLE-US-00009 TABLE 9 SEQ ID NO: Primer Sequence (5-3) 25 Primer 19 TCTAGAAGTAGCGTTGCTGTACAC 26 Primer 20 ATCAATGGTCTCGATGCCCATATG GCATTTGGAGGTCCTTAAG 27 Primer 21 CTTAAGGACCTCCAAATGCCATAT GGGCATCGAGACCATTGAT 28 Primer 22 TCTAGATGGAACCGTTGCAACCAC
(46) PCR was carried out with SEQ ID NOS: 25 and 26, SEQ ID NO: 27 and 28 using the chromosome of WT as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, polymerization at 72 C. for 90 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (512 bp) of the 5 upstream region of the gene metY and a DNA fragment (520 bp) of the 3 downstream region were obtained.
(47) PCR was carried out with the primers of SEQ ID NOS: 25 and 28 using the two amplified DNA fragments as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 3 minutes. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, the central region of the gene metY was deleted, and thus a DNA fragment (1032 bp) including only the upstream and downstream ends was amplified.
(48) The vector pDZ and DNA fragment (1032 bp) were treated with a restriction enzyme, XbaI, and these were linked using a DNA ligase and then cloned to obtain a plasmid. The plasmid was named as pDZ-metY.
(49) The vector pDZ-metY was introduced into each of the strains WT::hom(G378E)metB and CA01-2307::hom(G378E)metB, which were prepared in the above, using an electric pulse method, and then the transformant strains were obtained in a selective medium containing kanamycin (25 mg/L). WT::hom(G378E)metBmetY and CA01-2307::hom(G378E)metBmetY, the strains in which the gene metY was deleted by the DNA fragments inserted on the chromosome via a secondary recombinant process (crossover), were obtained.
(50) In order to maximize the production of O-acetylhomoserine, a vector for enhancing the expression of the gene metX was prepared. To amplify the gene encoding homoserine O-acetyltransferase (MetX), based on the reported WT-derived sequences, the vector was devised by inserting a BamHI restriction enzyme region at both ends of the primers (SEQ ID NOS: 29 and 30) for amplifying from the promoter region (about 300 bp upstream of the initiation codon) to the terminator region (about 100 bp downstream of the termination codon).
(51) TABLE-US-00010 TABLE 10 SEQ ID NO: Primer Sequence (5-3) 29 Primer 23 GGATCCCCTCGTTGTTCACCCAGC AACC 30 Primer 24 GGATCCCAAAGTCACAACTACTTA TGTTAG
(52) PCR was conducted with the primers of SEQ ID NOS: 25 and 26 using the chromosome of WT as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 90 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (1546 bp) including the gene metX was obtained.
(53) The vector pECCG117 (Korean Patent No. 10-0057684) and DNA fragment of metX were treated with a restriction enzyme, BamHI, and these were linked using a DNA ligase and then cloned to obtain a plasmid. The plasmid was named as pECCG117-metX.
(54) The vector pECCG117-metX was introduced into the strains WT::hom(G378E)metBmetY and CA01-2307::hom(G378E)metBmetY, which were prepared in the above, using an electric pulse method, and then smeared on a selective medium containing kanamycin (25 mg/L) to obtain the transformant strains.
(55) In order to compare the abilities of the strains prepared above for producing O-acetylhomoserine (hereinafter referred to as O-AH), the strains were cultured using the method below and the concentration of O-acetylhomoserine in the culture medium was analyzed.
(56) One platinum loop of the strains was inoculated into a corner-baffle flask (250 mL) containing an O-AH production medium (25 mL), and cultured at 37 C. for 20 hours while shaking at 200 rpm. The concentration of O-acetylhomoserine was analyzed by HPLC, and the analyzed concentration is shown in Table 11.
(57) <O-AH Production Medium (pH 7.0)>
(58) Glucose (100 g), (NH.sub.4).sub.2SO.sub.4 (40 g), soy protein (2.5 g), corn steep solids (5 g), urea (3 g), KH.sub.2PO.sub.4 (1 g), MgSO.sub.4.7H.sub.2O (0.5 g), biotin (100 g), thiamine chloride (1000 g), calcium pantothenate (2000 g), nicotinamide (3000 g), CaCO.sub.3 (30 g), L-methionine (0.3 g) (in 1 L of distilled water).
(59) TABLE-US-00011 TABLE 11 O-Acetylhomoserine (g/L) Strain Batch 1 Batch 2 Batch 3 WT::hom(G378E)metBmetY/ 0.135 0.209 0.175 pECCG117-metX CA01-2307::hom(G378E)metBmetY/ 2.312 2.045 2.532 pECCG117-metX
(60) As a result of analyzing the concentration of O-acetylhomoserine as shown in the table above, it was confirmed that the concentration of O-acetylhomoserine produced by the lysC variation was increased.
Example 6: Preparation of O-Succinylhomoserine-Enhanced Strain and Comparison of Productivity of O-Succinylhomoserine
(61) In order to determine the influence of the introduction of the lysC(L377K) variation on the production of O-succinylhomoserine, the strain producing O-succinylhomoserine was prepared. Since wild-type Corynebacterium glutamicum does not naturally produce O-succinylhomoserine, the strain was modified to have the activity of O-succinyltransferase (MetX) by the substitution of the amino acid at the substrate binding region of the O-acetyltransferase, which was prepared in Example 5, in order to produce O-succinylhomoserine. Accordingly, based on the sequences of the gene, WT-derived metX, a pair of primers (SEQ ID NOS: 31 and 32) was devised to prepare the vector for introducing the metX variation.
(62) TABLE-US-00012 TABLE 12 SEQ ID NO: Primer Sequence (5-3) 31 Primer 25 TCTAGAATGCCCACCCTCGCGCCTTC 32 Primer 26 TCTAGATTAGATGTAGAACTCGATG
(63) PCR was carried out with the primers of SEQ ID NOS: 27 and 28 using the chromosome of WT as a template. After denaturation at 95 C. for 5 minutes, PCR was carried out for a total of 30 cycles under the following conditions: 95 C. denaturation for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 90 seconds. Thereafter, the polymerization reaction was carried out at 72 C. for 7 minutes. As a result, a DNA fragment (1146 bp) of the encoding region of the gene metX was obtained.
(64) The vector pDZ and DNA fragment (1146 bp) were treated with a restriction enzyme, XbaI, and these were linked using a DNA ligase and then cloned to obtain a plasmid. The plasmid was named as pDZ-metX. Based on the vector pDZ-metX, in order to make a variation vector, in which the amino acid at position 176 is substituted with asparagine and the amino acid at position 313 is substituted with arginine, a pair of primers (SEQ ID NOS: 33 and 34), which cause a variation on the amino acid at position 176, and a pair of primers (SEQ ID NOS: 35 and 36), which cause a variation on the amino acid at position 313, were devised.
(65) TABLE-US-00013 TABLE 13 SEQ ID NO: Primer Sequence (5-3) 33 Primer 27 ACGCGCCAGCGCCTGGAACATCGGCA TTCAATCCG 34 Primer 28 CGGATTGAATGCCGATGTTCCAGGCG CTGGCGCGT 35 Primer 29 TAGATACCGATATTCGGTACCCCTAC CACCAG 36 Primer 30 CTGGTGGTAGGGGTACCGAATATCGG TATCTAC
(66) The variant gene metX was prepared using a site-directed mutagenesis kit (Stratagene, USA) together with each of the primers above. The transformant plasmid based on the existing wild-type plasmid pDZ-metX was named as pDZ-metX(Q176N, L313R). The vector pDZ-metX(Q176N, L313R), which was prepared above, was transformed into the strains WT::hom(G378E)metBmetY and CA01-2307::hom(G378E)metBmetY prepared in Example 5 using an electric pulse method, and then the transformant strains were obtained in a selective medium containing kanamycin (25 m g/L). WT::hom(G378E)metX(Q176N, L313R)metBmetY and CA01-2307::hom(G378E)metX(Q176N, L313R)metBmetY, the strains in which the gene metX is replaced with metX(Q176N, L313R) by the DNA fragment inserted on the chromosome via a secondary recombinant process (crossover), were obtained.
(67) In order to maximize the production of O-succinylhomoserine, a vector for enhancing the expression of the variant gene metX(Q176N, L313R) was prepared. Based on pECCG117-metX prepared in Example 5, a vector overexpressing the variant metX was prepared using primers of SEQ ID NOS: 33 to 36, in which the variant amino acid at position at position 176, which has the activity of O-succinyltransferase, is substituted with asparagine and the amino acid at position 313 is substituted with arginine. Specifically, the vector was prepared using a site-directed mutagenesis kit (Stratagene, USA) together with each of the primers, and the prepared vector was named as pECCG117-metX(Q176N, L313R).
(68) pECCG117-metX(Q176N, L313R) and the empty vector pECCG117 were introduced into WT::hom(G378E)metX(Q176N, L313R)metBmetY and CA01-2307::hom(G378E)metX(Q176N, L313R)metBmetY, which are the above-prepared strains producing O-succinylhomoserine, using an electric pulse method, and smeared on a selective medium containing kanamycin (25 mg/L) to obtain the transformant strain.
(69) In order to compare the ability of the strain for producing O-succinylhomoserine, the strain was cultured using the following methods, and the concentration of O-succinylhomoserine in the culture medium was analyzed.
(70) One platinum loop of the strain was inoculated into a corner-baffle flask (250 mL) containing 25 mL of the same O-AH production medium composition used in Example 5, and cultured at 37 C. for 20 hours while shaking at 200 rpm. The concentration of O-succinylhomoserine was analyzed by HPLC, and the analyzed concentration is shown in Table 14.
(71) TABLE-US-00014 TABLE 14 O-Succinylhomoserine (g/L) Strain Batch 1 Batch 2 Batch 3 WT::hom(G378E)metX(Q176N, 0.052 0.120 0.087 L313R)methBmetY/ pECCG117-metX(Q176N, L313R) CA01-2307::hom(G378E)metBmetY/ 1.529 1.632 1.874 pECCG117-metX(Q176N, L313R)
(72) As a result of analyzing the concentration of O-succinylhomoserine as shown in the table above, it was confirmed that the production of O-succinylhomoserine produced by the lysC variation was increased.
(73) These results suggest that the variant of the present disclosure can increase the production of the aspartate-derived amino acid and/or derivative thereof.
(74) From the foregoing, one of ordinary skill in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.